This Article Full Text Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ma, T. Articles by Thompson, E. A. Search for Related Content PubMed PubMed Citation Articles by Ma, T. Articles by Thompson, E. A.

A Novel Glucocorticoid Receptor Binding Element within the Murine c-myc Promoter

Department of Human Biological Chemistry and Genetics (E.A.T.) and Department of Internal Medicine (J.A.C., A.R.B.) The University of Texas Medical Branch Galveston, Texas 77555-0645
Department of Biochemistry (T.M.) Baylor College of Medicine Houston, Texas 77330

In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.

This article has been cited by other articles:

				H. Igarashi, K. L. Medina, T. Yokota, M. I. D. Rossi, N. Sakaguchi, P. C. Comp, and P. W. Kincade Early lymphoid progenitors in mouse and man are highly sensitive to glucocorticoids Int. Immunol., May 1, 2005; 17(5): 501 - 511. [Abstract] [Full Text] [PDF]