Molecular Endocrinology, Vol 9, 1405-1412, Copyright © 1995 by Endocrine Society

ARTICLES

Activation of human insulin-like growth factor binding protein-1 gene promoter by a distal regulatory sequence in a human endometrial adenocarcinoma cell line

J Gao, J Mazella and L Tseng
Department of Obstetrics and Gynecology, State University of New York at Stony Brook 11794, USA.

Insulin-like growth factor-binding protein-1 (IG-FBP-1) is the major secretory protein of decidualized human endometrium. To understand IGFBP-1 gene regulation in human endometrium, we studied the IGFBP-1 gene promoter activity in human endometrial adenocarcinoma cell line HEC-1B. Previously, we have reported that a 105-base pair (bp) ClaI/RsaI fragment, from -2732 to -2628, of IGFBP-1 promoter enhances promoter activity by 10-fold in HEC-1B cells. In this study we have characterized the activation of IGFBP-1 promoter by this distal regulatory sequence. Transient transfection assays with deletion constructs demonstrated that the activating cis-elements were located in a 59-bp fragment, from -2686 to -2628, which enhanced promoter activity 50-fold. Transient transfections and gel mobility shift assays with oligo-directed mutants revealed three cis-elements within this 59- bp region: I) ATGGGTGGGA (-2675 to -2666), II) GCTGAGCAAGTGCACAACTATCC (-2660 to -2638), and III) AGGGCGGAGT (-2637 to -2628). In nuclear extracts of HEC-1B cells, at least two proteins bound to cis-element III, one of which was transcription factor Sp1 since antibody against Sp1 caused a supershift in a gel mobility shift assay. A protein with a molecular mass of approximately 100 kilodaltons bound to cis-element I as revealed by Southwestern blotting. An unidentified protein bound to cis-element II. Mutations in cis-element I, II, and III reduced promoter activity by 37%, 86%, and 88%, respectively, indicating that there was a synergistic function among these three cis- elements.(ABSTRACT TRUNCATED AT 250 WORDS)

This article has been cited by other articles:

				W. Zhang, J. Mazella, H. J. Kloosterboer, and L. Tseng Progestagenic Effects of Tibolone are Target Gene--Specific In Human Endometrial Cells Reproductive Sciences, September 1, 2006; 13(6): 459 - 465. [Abstract] [PDF]

				J.J. Kim, O.L. Buzzio, S. Li, and Z. Lu Role of FOXO1A in the Regulation of Insulin-Like Growth Factor-Binding Protein-1 in Human Endometrial Cells: Interaction with Progesterone Receptor Biol Reprod, October 1, 2005; 73(4): 833 - 839. [Abstract] [Full Text] [PDF]

				M. Tang, J. Mazella, H. Hui Zhu, and L. Tseng Ligand activated relaxin receptor increases the transcription of IGFBP-1 and prolactin in human decidual and endometrial stromal cells Mol. Hum. Reprod., April 1, 2005; 11(4): 237 - 243. [Abstract] [Full Text] [PDF]

				J. Gao, J. Mazella, M. Tang, and L. Tseng Ligand-Activated Progesterone Receptor Isoform hPR-A Is a Stronger Transactivator Than hPR-B for the Expression of IGFBP-1 (Insulin-Like Growth Factor Binding Protein-1) in Human Endometrial Stromal Cells Mol. Endocrinol., December 1, 2000; 14(12): 1954 - 1961. [Abstract] [Full Text]

				J. Gao and L. Tseng Progesterone Receptor (PR) Inhibits Expression of Insulin-Like Growth Factor-Binding Protein-1 (IGFBP-1) in Human Endometrial Cell Line HEC-1B: Characterization of the Inhibitory Effect of PR on the Distal Promoter Region of the IGFBP-1 Gene Mol. Endocrinol., June 1, 1997; 11(7): 973 - 979. [Abstract] [Full Text]