Molecular Endocrinology 11 (1): 3-15
Copyright © 1997 by The Endocrine Society
Functional Role of a Conformationally Flexible Homopurine/Homopyrimidine Domain of the Androgen Receptor Gene Promoter Interacting with SP1 and a Pyrimidine Single Strand DNA-Binding Protein
Shuo Chen,
Prakash C. Supakar,
Robert L. Vellanoweth,
Chung S. Song,
Bandana Chatterjee and
Arun K. Roy
Department of Cellular and Structural Biology The University of
Texas Health Science Center at San Antonio San Antonio, Texas
78284-7762
 |
ABSTRACT
|
|---|
The androgen receptor (AR) gene promoter does not
contain the TATA or CAAT box, but it contains a long (
90-bp)
homopurine/homopyrimidine (pur/pyr) stretch immediately upstream of the
Sp1-binding GC box site. This pur/pyr stretch is conserved at the same
proximal position in the rat, mouse, and human AR gene promoters.
Mutation of this region results in a 3-fold decline in promoter
activity, indicating an important regulatory function. Examination of
the conformational state of the AR pur/pyr region with the
single-strand-specific S1 nuclease showed that it is capable of forming
a non-B DNA structure involving unpaired single strands. Fine mapping
of the S1-sensitive site revealed an unsymmetric cleavage pattern
indicative of an intramolecular triple helical H-form DNA conformation.
Electrophoretic mobility shift analyses showed that the pur/pyr region
of the AR promoter can bind a novel pyrimidine single-strand-specific
protein (ssPyrBF) and also a double-strand DNA-binding protein. Both
oligonucleotide cross-competition and antibody supershift experiments
established that the double-strand binding protein is equivalent to
Sp1. Deoxyribonuclease I (DNase I) footprinting analysis showed
multiple Sp1-binding to the pur/pyr site and a weaker Sp1 interaction
to this region compared with the adjacently located GC box, where Sp1
functions to recruit the TFIID complex. These results suggest that the
pur/pyr domain of the AR gene can serve to attract additional Sp1
molecules when it exists in the double-stranded B-DNA conformation.
However, binding of ssPyrBF and the resultant stabilization of the
non-B DNA structure is expected to prevent its interaction with Sp1. We
speculate that in the TATA-less AR gene promoter, multiple weak Sp1
sites at the pur/pyr region adjacent to the GC box can provide a
readily available source of this transcription factor to the functional
GC box, thereby facilitating the assembly of the initiation complex.
 |
INTRODUCTION
|
|---|
The androgen receptor (AR) is a ligand-activated transcription
factor belonging to the steroid/thyroid hormone receptor superfamily
(1, 2). AR plays a central role in the coordination of the
male-specific sexual phenotype and in the development of the male
reproductive organs (3). It has also been implicated in prostatic
hyperplasia and carcinogenesis (4, 5, 6, 7). Although qualitatively AR is
expressed in almost all tissues examined so far, the extent of its
expression in various tissues differs within 2 to 3 orders of magnitude
(8, 9, 10). Furthermore, within the same cell type, there can be vast
differences in AR expression at different phases of development and
aging (7, 9). Such spatio-temporal regulation of AR gene expression in
target cells is thought to be mediated through differential expression
of transcription factors that are involved in the regulation of this
gene (9, 10, 11). Thus, a thorough understanding of AR promoter function
appears essential to the elucidation of the mechanism of
tissue-specific expression of this receptor protein. Because of this
reasoning, we and others have been examining the specific
protein-binding sites at the AR gene promoter and characterizing the
biological function of these protein-DNA interactions in transfected
cells (9, 10, 11, 12, 13, 14, 15, 16, 17). These studies have revealed that a number of promoter
elements come into play in the overall regulation of AR gene
transcription. Furthermore, through a comparative analysis of the AR
promoter sequences by phylogenetic footprinting (18), we have shown the
presence of at least 22 potential binding sites for known transcription
factors on the AR promoters of several species within closely conserved
locations (10). In essence, these different approaches have resulted in
the identification of positive transcriptional activity mediated by
several trans-acting factors such as the constitutive
activator Sp1 (14), the cAMP-responsive cAMP-response element binding
protein factor (15), and the age-dependent factor (9). Negative
regulation is also operative via NF
B at a perfectly palindromic site
(11), by another factor binding to the mouse AR 5'-flanking region
(16), as well as by single-stranded DNA-specific binding proteins
presumably affecting transcriptional elongation (17).
The proximal 5'-flanking region of the AR gene promoter lacks an
obvious TATA box or CAAT box but contains a long
homopurine/homopyrimidine (pur/pyr) stretch around -150 to -60 bp.
This pur/pyr stretch is conserved at approximately the same position in
the rat, mouse, and human AR genes. Deletion of DNA sequences
containing this region from the human AR promoter causes a 3-fold
decline in promoter activity (15). Given the evolutionarily conserved
nature of the pur/pyr element and its potential importance as a target
for triplex-mediated gene therapy (19), we undertook to elucidate the
mechanism by which this site exerts its regulatory role. In this report
we present results to show that the pur/pyr site of the AR promoter is
sensitive to S1 nuclease within a six-copy mirror repeat of the
sequence GGGGA on supercoiled DNA. The S1 sensitivity pattern is
suggestive of various isoforms of H-DNA, and the possibility of an
intramolecular triplex structure was further supported by the formation
of a site-specific triple helix in vitro at the
physiological pH. Analyses of protein-DNA interactions revealed that
the pur/pyr site is capable of binding both a sequence-specific
single-strand binding protein and the transcription factor Sp1.
Multiple Sp1-binding sites at the pur/pyr region adjacent to one
functional GC box can potentially assure a constant supply of Sp1 for
recruitment of the transcription factor IID (TFIID) complex, and the
process may be hindered by conformational perturbation associated with
the interaction of the single-strand binding protein at the pur/pyr
site.
 |
RESULTS
|
|---|
Phylogenetic Footprinting of the Androgen Receptor Promoter Reveals
a Potentially Important 5'-Proximal Homopurine-Homopyrimidine
Element
An optimal alignment of the rat, mouse, and human AR promoter
sequences (18) revealed a large number of phylogenetic footprints
with
8 bp identity. Many of these are potential binding sites
of known transcription factors (10) while others are bound by novel
transcription factors (9). By far, the greatest stretch of homology was
found between -138 and -60 (rat coordinates), previously shown by
Mizokami et al. (15) to have functional promoter activity in
the human AR gene. This homologous region encompasses a
homopurine/homopyrimidine (pur/pyr) element containing six direct
repeats of the sequence GGGGA in the rat, five repeats in the mouse,
and three in the human (Fig. 1
). Given the high degree
of homology in this region across species lines and its unusual
sequence characteristics, its functional importance to transcription of
the rat AR (rAR) gene was further investigated.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 1. Homologous Polypurine Regions in the Rat, Mouse and
Human AR Promoters
The top strand depicts the rAR sequence from -152 to
+43 bp relative to the transcriptional start site
(arrow). The next two strands depict the mouse and human
sequences, respectively. Bases identical to the rat are indicated by
dashes, mismatches by letters, and gaps
by dots.
|
|
Mutation of the Homopurine/Homopyrimidine-Rich Region of the rAR
Gene Results in Decreased Reporter Activity
It has been demonstrated previously in several genes that
promoter-proximal pur/pyr elements provide important regulatory
activity (20, 21, 22, 23, 24, 25). To further characterize the biological role of the
pur/pyr region in the transcription of the rAR gene, we used a
transfection assay of the wild type and mutant promoters in human
hepatoma (HepG2) and in human uterine carcinoma (HeLa) cells. A set of
constructs was created in which a segment of the AR promoter from
-1040 to +555 bp, either wild type or containing mutations at the
pur/pyr site, was fused to the firefly luciferase reporter gene. The
two mutant constructs were Del AR-Luc lacking 50 bp of the pur/pyr
region (-140 to -91) and Mut AR-Luc containing a 50-bp GT insert
(sequence shown in the Fig. 2
legend) replacing the wild type
sequences. The GT insert was selected to fill in the deleted area
because of the fact that this sequence neither forms triple helix nor
binds to any one of the two sequence-specific binding proteins that
interacts to the pur/pyr domain described later (data not shown).
Results in Fig. 2
show that activities of the two mutant
promoters decreased by about 3- to 4-fold compared with the wild type
promoter in the hepatoma cell line. Furthermore, in HeLa cells, the two
mutant constructs showed a similar extent of reduction in the
luciferase activities (data not shown). These results are consistent
with those reported by Mizokami et al. (15) and indicate
that the pur/pyr element serves as an activator of rAR gene
transcription.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 2. Functional Activities of the Wild Type and Mutant
Homopurine/Homopyrimidine Element of the rAR Promoter in Hepatoma Cells
Panel A, Schematic representation of the constructs used in the
luciferase assays. WT is the 1595-bp fragment of the rAR gene promoter
(-1040 to +555 bp) inserted into the luciferase reporter vector,
pGL-2; Del indicates a mutant plasmid with a deletion of 50 bp from
-140 to -91 bp; Mut contains a replacement of the normal sequences
from -140 to -91 with a GT-insert
(5'CTCGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGCTCG3'). Panel B,
Results of the transfection experiment in HepG2 cells. Luciferase
activities are expressed as activity per unit amount of the cell
protein. The three points represent data from the
average of duplicates of three different experiments and the
bar represents the mean.
|
|
Sequence-Specific Nuclear Proteins Interact with the pur/pyr
Element
In analogy to the mechanism by which most other
cis-acting elements function, we used the pur/pyr element to
search for potential trans-acting factors. In the
double-stranded form, synthetic oligonucleotides corresponding to the
rAR sequence from -123 to -91 produced a low mobility complex in a
gel shift DNA-binding assay (Fig. 3
, lane 1). An excess
of the unlabeled pur/pyr oligonucleotide effectively competed for
formation of the complex while the mutant duplex containing the mutated
sequence where the last two purines of the GGGGA mirror repeat were
changed to pyrimidines (pur/pyr(ds)mut, Table 1
) failed
to do so (lane 3). Neither of the single strands nor a heterologous
double-stranded oligonucleotide (lanes 46) affected the complex to
any appreciable degree. The vertebrate transcription factor Sp1 is
known to bind GC-rich elements with consensus recognition sequence of
5'-GGGGCGGG-3' (26). Furthermore, recent studies on the transcriptional
regulation of the collagen type IV gene have revealed a dimeric
protein, CTC box binding factor (CTCBF), that interacts with a
C5TC7 element close to the transcriptional
start point of the collagen type IV TATA-less promoter (27). The
(GGGGA)6 repeat of the pur/pyr element contains five
overlapping copies that are structurally related to both the
C4TC4 element and the Sp1-binding GC box. To
test whether Sp1 or CTCBF binds to the rAR pur/pyr sequence, two
oligonucleotide duplexes, one corresponding to the SV40 GC-box and the
other to the collagen IV gene from -91 to -66 (Table 1
), were used to
compete for the retarded complex. An excess of either the unlabeled CTC
box or the Sp1 consensus element efficiently competed for the shifted
complex while the TATA box element was unable to do so (Fig. 3
, lanes
79). Genersch et al. (27) have shown that the Sp1
consensus element does not compete with the authentic CTCBF element,
and the TATA oligo can serve as an efficient competitor for CTCBF
complex. In addition, these authors reported that the CTCBF-DNA complex
contains TATA-binding protein (TBP), and antibodies directed against
recombinant TBP interfere with the formation of the specific CTCBF-DNA
complex. In the case of the AR pur/pyr element, the lack of competition
by the TATA oligo, its efficient competition by the Sp1 oligo, and our
inability to observe any interference of the anti-TBP antibody on the
formation of the specific pur/pyr-protein complex (data not
shown) lead us to conclude that despite the cross-competition of the
CTCBF oligo at 100-fold molar excess, the pur/pyr binding protein is
not CTCBF.

View larger version (93K):
[in this window]
[in a new window]
|
Figure 3. Electrophoretic Mobility Shift Assays (EMSA) with
Double-Stranded Homopurine/Homopyrimidine Element
The 33-bp double-stranded pur/pyr oligonucleotide corresponding to
-123 to -91 bp of rAR was end-labeled and incubated with HeLa cell
nuclear extracts in the presence or absence of 100-fold molar excess of
the unlabeled specific or nonspecific competitor DNA oligonucleotide
duplexes described in Table 1 . Lane 1, Without competitor DNA; lane 2,
pur/pyr(ds) homologous competitor; lane 3, mutant pur/pyr(ds); lane 4,
single-stranded pyr(ss); lane 5, single-stranded pur(ss); lane 6,
unrelated ds oligonucleotide duplex at -940 rAR [-940(ds)]; lane 7,
CTC box element of CTCBF; lane 8, TATA box element from thymidine
kinase promoter; lane 9, Sp1-binding GC box site from SV40 enhancer.
|
|
Results presented in Fig. 4
show that the Sp1 consensus
element and the AR pur/pyr duplex form retarded complexes of the same
electrophoretic mobility and can effectively cross-compete with each
other for the formation of the protein-DNA complex. Either the HeLa
cell nuclear extract or recombinantly produced Sp1 was able to generate
the same cross-reacting complex. However, unlike the recombinant Sp1
(Fig. 4B
), the HeLa nuclear extract (Fig. 4A
) produced two faster
migrating additional bands. Studies with pur/pyr element of the
platelet-derived growth factor-A chain have shown that in addition to
Sp1, it can also bind EGR-1, another Zn-finger transcription factor
with cross-reactivity to the Sp1 cis-element (28). They may
also be due to complexes formed with other members of the Sp1 family,
i.e. Sp2 and Sp3 (29). These two faster migrating bands are
more prominent with the labeled Sp1 oligo (Fig. 4A
, lanes 5 and 8),
possibly due to its relatively higher affinity for the Sp family of
DNA-binding proteins. Finally, supershift experiments with antibodies
specifically directed to the recombinant Sp1 protein confirmed the
presence of Sp1 in the retarded complex formed with both the labeled
pur/pyr element (Fig. 4C
, lanes 2 and 3) and the Sp1 consensus sequence
(Fig. 4C
, lanes 5 and 6). It is noteworthy that the specific Sp1
antibody selectively supershifted the slowest migrating band without
affecting two faster migrating bands. From these results we conclude
that the pur/pyr element of the androgen receptor gene can specifically
interact with Sp1. This finding is also consistent with observations of
Sp1 binding to pur/pyr regions of the epidermal growth factor receptor
promoter (20).

View larger version (42K):
[in this window]
[in a new window]
|
Figure 4. Sp1 as the Binding Protein to Double-Stranded
pur/pyr Oligonucleotide
A, EMSA was performed with HeLa cell nuclear extracts (2 µg) and
either end-labeled double-stranded pur/pyr (lanes 14), or with
end-labeled Sp1 GC box oligonucleotide duplex (lanes 58) in the
presence or absence of 100-fold molar excess of unlabeled competitor
DNA. Lanes 1 and 5, No competitor DNA; lanes 2 and 6, pur/pyr(ds);
lanes 3 and 7, Sp1 oligo; lanes 4 and 8, -940(ds) oligo. B, EMSA with
0.1 U of the purified recombinant Sp1 protein with either end-labeled
pur/pyr(ds) (lanes 14), or with end-labeled Sp1 oligo (lanes 58).
Lanes 1 and 5, no competitor DNA; lanes 2 and 6, Sp1 oligo; lanes 3 and
7, pur/pyr(ds); lanes 4 and 8, -940(ds) oligo. C, Antibody supershift
assays with either end-labeled pur/pyr(ds) (lanes 13) or end-labeled
Sp1 oligo duplex (lanes 46). Lanes 1 and 4, No antibody added; lanes
2 and 5, HeLa nuclear extract (10 µg) preincubated with 1 µl
anti-Sp1; lanes 3 and 6, HeLa nuclear extract (10 µg) preincubated
with 2 µl anti-Sp1.
|
|
The rat androgen receptor gene contains a bonafide Sp1 element at the
-60 position (30). Such a proximal Sp1 site close to the initiation
site of TATA-less promoters is thought to function in recruiting and
stabilizing the TFIID complex, which is critical for transcriptional
initiation (26). Results presented in Fig. 5
show
that the recombinant Sp1 protein produced two protected regions
in the DNase I footprinting assay, one covering the GC box (-44- to
-63-bp positions) and the other around the pur/pyr site (-66- to
-145-bp positions). The protection on the pur/pyr site appears
considerably weaker than the GC box area, possibly due to the combined
effects of an inherent weakness of the pur/pyr binding to Sp1 and the
strong competition for the Sp1 protein by the adjacent GC box site. In
addition to pur/pyr and GC box sites, footprinting with the nuclear
extract produced a downstream protection spanning -20- to -40-bp
positions, which is the expected location for the formation of the
TFIID complex (Fig. 5
, lane 4).

View larger version (32K):
[in this window]
[in a new window]
|
Figure 5. DNase I Footprinting Analysis of the Proximal
Promoter Region of the rAR Gene
A 297-bp 32P-labeled DNA fragment of the rAR promoter
region spanning -283 to +14-bp positions (lower strand radiolabeled at
position +14) was used in DNase I protection assays with either
purified recombinant Sp1 protein or rat liver nuclear extract. Lanes 1
and 5, 25 µg BSA; lane 2, 2 U of recombinant Sp1 protein; lane 3, 8 U
of recombinant Sp1 protein; lane 4, 50 µg of rat liver nuclear
extract; 0.02 µg/ml (lanes 1, 2, 3, and 5) and 0.2 µg/ml (lane 4)
of DNase I were used for the digestion reaction. Protected areas are
identified on the right of the panel. Two
uncharacterized protected footprints observed with nuclear extract are
shown with brackets on the top of the figure.
|
|
Band shift assays were also carried out with labeled single-strand
components of the pur/pyr element to determine whether additional
interactions could occur at this site. When either the purine (pur)
strand or the pyrimidine (pyr) strand of the pur/pyr element (-91 to
-123 bp) was labeled and incubated with the HeLa cell nuclear extract,
a complex of an intermediate mobility was detected only with the
labeled pyr probe (Fig. 6
, lane 4) which can be competed
out with the homologous single-stranded oligonucleotide (lane 5).
Competition of this labeled pyr complex with the complementary purine
strand, double stranded pur/pyr oligo, a mutant version of the
pyrimidine strand [pyr(ss)mut, Table 1
] and the single-stranded -940
oligonucleotide, all were ineffective, indicating a sequence-specific
interaction between the single-stranded pyrimidine probe and the
binding protein. These results suggest that, in addition to Sp1
interacting with the double-stranded form of pur/pyr, a
sequence-specific, pyrimidine-rich single-strand binding protein,
hereby termed ssPyrBF, interacts with a single-stranded form of the
pur/pyr element.

View larger version (78K):
[in this window]
[in a new window]
|
Figure 6. Electrophoretic Mobility Shift Assays with
Single-Stranded Purine and Pyrimidine Oligonucleotides
Experiments were performed with either single-stranded purine (lanes 1
and 2) or with single-stranded pyrimidine (lanes 39) probes. Nuclear
extract derived from HeLa cells was added in samples run in all lanes
except 1 and 3. Lane 1, Free pur(ss) probe, no competitor; lane 2,
pur(ss) probe with nuclear extract; lane 3, free pyr(ss) probe, no
nuclear extract; lane 4, pyr(ss) probe plus nuclear extract; lanes 6 to
9, competition with 100-fold molar excess of oligonucleotides as
indicated on the top. Nucleotide sequences of the
competitor oligonucleotides are shown in Table 1 .
|
|
Because the AR gene is expressed in nearly all tissues and the pur/pyr
element is present in the AR gene across species lines, we checked the
tissue and species distribution of the ssPyrBF. Nuclear extracts from
rat prostate and spleen and extracts of a number of cell lines
including Jurkat (from human T lymphocytes), HeLa (from human uterus),
PC-3 (from human prostate), PA III (from rat prostate), CHO (from
hamster ovary), and COS1 (from monkey kidney), and HepG2 (from human
liver) all showed the same specific band shift complex with the
radiolabeled single-stranded pyr element (data not shown). Thus, it
appears that the ssPyrBF is expressed in diverse cell types derived
from various mammalian species.
S1 Nuclease Sensitivity at the pur/pyr Site
Previous studies have demonstrated that supercoiled plasmid DNAs
containing pur/pyr regions of other genes can be cleaved by S1 nuclease
at these sites (20, 21, 22, 24, 25, 31, 32, 33, 34, 35, 36). Such sensitivity to S1
nuclease is associated with functionally important regions of several
eukaryotic promoters (20, 22, 24, 25, 32, 35). To determine whether the
pur/pyr element of the rAR gene is also sensitive to S1 nuclease, the
plasmid DNA containing the rAR sequence from -1040 to +22 was treated
with S1 nuclease, and the products were resolved on an agarose gel.
When the supercoiled plasmid DNA was digested initially with S1
nuclease and subsequently with restriction enzymes, two additional DNA
fragments of 135 and 401 bp were detected (Fig. 7
, lane
7). These two bands were not detected, however, when S1 nuclease was
added to the linear plasmid DNA (Fig. 7
, lane 6). From the fragment
sizes, the S1 nuclease sensitive site was located to the region
containing the pur/pyr element.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 7. Mapping of an S1 Nuclease-Sensitive Site in the rAR
Promoter Region
Upper panel, Schematic representation of the
S1-sensitive site. The thin line represents the rAR
promoter region, and the rectangle is the pur/pyr
element (-150 to -49 bp) of the rAR gene promoter. The S1-sensitive
region within the pur/pyr element is indicated by
arrows. Lower panel, Ethidium
bromide-stained agarose gel. Lanes 1, 2 and 8 denote DNA size markers;
lane 3, untreated supercoiled DNA; lane 4, supercoiled DNA linearized
with PstI; lane 5, supercoiled DNA treated with
PstI and XbaI; lane 6, supercoiled DNA
digested with PstI before treatment with S1 and
XbaI; lane 7, supercoiled DNA treated with S1 and then
digested with PstI and XbaI, yielding two
additional fragments of 401 bp and 135 bp indicated by
arrows.
|
|
Fine Mapping of the S1 Nicking Site Suggests an H-DNA
Conformation
To determine the detail of the cleavage sites on the two strands,
the digestion products were labeled, and individual strands were
resolved on a denaturing polyacrylamide gel. The results presented in
Fig. 8
show a collection of labeled fragments generated
from both strands. Densitometric scanning of the autoradiogram allowed
a quantification of the relative cleavage rate at each position from
the intensity of the individual bands. Results of the quantification
are shown in the lower panel of this figure. The
unsymmetrical nature of the cleavage intensity is suggestive of an
intramolecular triple helical H-form DNA conformation (37, 38, 39). We also
note that S1 sensitivity within this region of the rAR promoter occurs
strictly at the pur/pyr element, and the pyrimidine strand is
relatively more sensitive to S1 cleavage than the purine strand of the
DNA.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 8. Fine Mapping of the S1 Nuclease-Sensitive Sites
within the rAR Homopurine/Homopyrimidine Element
Upper panel, The supercoiled plasmid DNA containing rAR
promoter sequences from -1040 to +22 bp was treated with S1 nuclease,
and the S1-freed ends were labeled either on the top
strand (lane 1, pur*) or on the bottom strand
(lane 2, pyr*); the DNA was digested with PstI and the
fragment was resolved through a denaturing acrylamide gel. GATC refers
to sequencing reactions used as DNA markers. Lower
panel, Summary of S1 mapping experiment. Arrows
above and below the DNA sequences represent S1
cleavage sites on the upper and lower
strands, respectively. The degree of S1 sensitivity as determined by
densitometric scanning is indicated by arrow length.
|
|
The pur/pyr Element Is Capable of Forming Triple Helical DNA
in Vitro
The S1 sensitivity pattern shown in Fig. 8
suggested that the
pur/pyr element may form an intramolecular triplex. At the
physiological pH, although pur-pur-pyr (G*GC) triplet can form the
stable Hoogsteen hydrogen bond (*), the pyr-pur-pyr (C*GC) triplet is
unstable (19, 37, 39). We therefore further tested the possibility of
triplex formation at the pur-pyr site by band shift and footprinting
experiments in vitro. For physiological relevance, triplex
formation was allowed to occur at pH 7.4 in the presence of 5
mM MgCl2 (21). Triplex DNA complexes, because
of their decreased charge density, migrate more slowly than the duplex
DNA in gel mobility shift assays. Figure 9
shows that
the addition of increasing concentrations of the homologous parallel
purine [pur(ss), Table 1
] to the labeled double-stranded pur/pyr DNA
resulted in a gradual shift from a duplex form (D) to a distinct,
slower migrating band (T), indicating the formation of a DNA triplex.
The gel shift profile obtained is very similar in appearance to that
produced by other known G-rich triplex-forming oligonucleotides (TFOs)
(21). An appreciable shift of the pur/pyr target duplex to triplex is
seen at an approximately 10-fold molar excess of the single-stranded
oligo, and a complete shift of the duplex to triplex occurred at a
50-fold molar excess. In addition to the parallel purine, the
antiparallel purine (pur-ap) was also capable of forming DNA triplexes
by this assay (data not shown). Furthermore, pur-ap was also found to
form triplex DNA when either a 536-bp rAR fragment from -513 to +22 or
a supercoiled plasmid containing sequences from -1040 to +22 was used
as the target (data not presented), indicating that triple helix
formation was not dependent on the use of small oligonucleotides and
further suggesting that this site is capable of forming a triplex in
the larger context of the AR promoter.

View larger version (97K):
[in this window]
[in a new window]
|
Figure 9. Band Shift Analysis of Triplex Formation
Labeled double-stranded pur/pyr DNA [pur/pyr(ds), Table 1 ] was
incubated with increasing concentrations of single-stranded purine
oligonucleotide [pur(ss), Table 1 ] and run on a native polyacrylamide
gel. S, D, and T point to the positions of migration of labeled
single-stranded, double-stranded, and triple-stranded DNA. Lanes 1 and
2, Labeled single-stranded pyr and double-stranded pur/pyr probes,
respectively. Lanes 36, Labeled double-stranded probe with 10-, 20-,
50- and 100-fold molar excesses of the unlabeled pur(ss).
|
|
To establish the specificity of triplex formation and to exactly map
the contact sites on the rAR promoter, DNase I footprinting was
performed with a radiolabeled 536-bp rAR fragment (-513 to +22).
Results presented in Fig. 10
show that, unlike the
single-stranded pyrimidine, the single-stranded purine oligonucleotide
(both in the parallel and in the antiparallel orientation) and its TFO
variant were able to provide specific protection of sequences spanning
-148 to -80 positions. Such an overprotection of the target sequences
by TFOs in DNase I footprinting experiments has been noted previously
(40, 41). Additional footprinting experiments using other GT-rich
oligonucleotides (GT insert, Table 1
) did not protect any region of the
AR fragment from DNase I digestion (data not shown). Thus, the
possibility of the intramolecular triple helix (H-DNA) structure, as
indicated by the uneven S1 sensitivity (Fig. 8
), is also supported by
the sequence-specific triplex formation by TFOs at the physiological
pH.

View larger version (52K):
[in this window]
[in a new window]
|
Figure 10. DNase I Protection by TFOs
An end-labeled 536-bp double-stranded DNA fragment containing the
pur/pyr target was mixed with 50-fold molar excesses of single-stranded
oligonucleotides as indicated on the top of the figure.
Lane 1 contains the G ladder as a sequence marker, and lane 6 contains
DNase I digestion product in the absence of any single-stranded
oligonucleotide. The sequence of the protected region is shown at the
right of the panel. Nucleotide sequences of the
single-stranded oligonucleotides used for the triplex formation are
provided in Table 1 . The nucleotide sequence of the parallel purine
(pur-p) is the same as pur(ss) shown in Table 1 .
|
|
 |
DISCUSSION
|
|---|
The existence of homopurine/homopyrimidine stretches in
promoter-proximal locations in a number of TATA-less mammalian genes
has been reported. In addition to AR, these include C-Ki-ras,
transforming growth factor-ß3, epidermal growth factor receptor, and
human Ha-ras (20, 22, 34, 42). However, the precise role of the pur-pyr
elements in the regulation of these TATA-less promoters has so far been
unclear. Results presented in this paper show that, in the case of the
AR gene, the pur/pyr element in its double-stranded form specifically
binds to Sp1. Similar binding of Sp1 to the pur/pyr region of the
epidermal growth factor receptor promoter has also been reported (20).
In addition to its binding to the pur/pyr element, DNase I footprinting
data show a stronger Sp1-binding site (GC box) is located immediately
downstream (-63- to -44-bp positions). Pugh and Tjian (26) have shown
that binding of Sp1 at the promoter-proximal site of the TATA-less
promoter functions to recruit and stabilize the TFIID complex, which is
essential for transcriptional activation. Additionally, in a number of
TATA-less genes such as dihydrofolate reductase, fibroblast grwoth
factor, and transforming growth factor-
, multiple Sp1-binding sites
that are located farther apart have been identified (43). Electron
microscopic examination of the Sp1-DNA complexes has shown that these
distant Sp1 sites interact with Sp1 at the GC box through DNA looping
and provide a synergistic stimulatory role through protein-protein
interaction (44). However, in the case of the AR gene, it is possible
that the weak Sp1 sites (pur/pyr domain) located immediately upstream
from the GC box can function through a nonlooping mechanism. We
speculate that such an alternative function may involve a localized
increase in the Sp1 concentration at the pur/pyr site followed by the
downstream slide of this protein to the higher affinity GC box
site.
Both deletion of the pur/pyr element and mutation of the nucleotide
sequence to prevent specific protein binding cause about a 3-fold
decline in AR promoter activity, indicating an overall positive
regulatory function of this region. However, it is important to note
that this element binds both Sp1 and ssPyrBF. Such a binding of
both a double-strand DNA-binding protein (Sp1) and a single-strand
binding protein (ssPyrBF) to the same sequence is expected to occur in
a mutually exclusive manner; i.e. when Sp1 binds to the
double-stranded state of the DNA, the ssPyrBF will be unable to
interact and vice-versa. Although Sp1 is a known stimulatory protein,
the regulatory direction of the ssPyrBF is undetermined. Preliminary
results in our laboratory show that during the age-dependent decline in
the hepatic expression of the AR gene, the ssPyrBF increases about
2-fold. Moreover, the liver nuclear extracts from aging rats are known
to contain a markedly reduced level of Sp1 (45). These observations are
consistent with a possible negative regulatory role of ssPyrBF in the
AR promoter function.
Although the exact recognition and cleavage site of the S1 nuclease is
unknown, it appears to recognize a number of conformations that distort
the phosphodiester backbone. Long pur/pyr stretches generally produce
such structural distortions (39). The S1 nuclease sensitivity data
presented in this article suggest that the rAR pur/pyr element is
sufficiently long to generate non-B DNA conformations. Structural
models based on S1 digestion patterns and changes in superhelical
density predict that long (>40 bp) pur/pyr elements can form H-DNA
structures (38). Results of in vitro studies with the TFOs
show that the pur/pyr element of rAR promoter is capable of forming
(dG)2-dC triplex, which can potentially generate *H-form
(37) configurations. If this is the only configuration, it would
theoretically release a pyrimidine-rich, S1-sensitive strand. However,
the in vitro results show that both of the DNA strands are
susceptible to S1 attack. This observation may indicate that the
distorted structures exist in conformational equilibrium, and attack on
both strands can occur during the state of transition (37, 39). In
addition, because of localized distortions of the phosphodiester
backbone, a small portion of the triple-stranded structure may also be
accessible to S1 recognition (39). Despite these considerations, it
needs to be emphasized that at present, the in vivo
existence of H form DNA is only inferential and the mechanism by which
S1-sensitive DNA structures regulate gene transcription is unclear. In
this context, a recent report on the characterization of the pur/pyr
domain of the chicken malic enzyme gene promoter (46) is highly
relevant to the situation described in this paper for the AR gene
promoter. These authors have also concluded that the pur/pyr domain of
the malic enzyme gene promoter can form an intramolecular triplex
structure, and that specific protein binding to the single-stranded
pyrimidine stretches can play a negative regulatory role in gene
transcription.
On the basis of the results presented in this paper and all of
the above considerations, we propose a model to further explain the
role of specific protein-DNA interaction at the pur/pyr element in the
overall regulation of the AR gene. Schematically depicted in Fig. 11
, the model is centered on the possibility that
within the cell the rAR pur/pyr element is capable of existing in
alternative structure forms, i.e. normal double-stranded
B-DNA and an intramolecular triplex (H form). Among the two H forms,
the pur-pur-pyr form is expected to be thermodynamically more stable at
the physiological pH. Binding of Sp1 to this site will only be possible
when the pur/pyr element is in the B-DNA form. In both of the H forms,
but to a much greater extent in the pur-pur-pyr form, the
single-stranded pyr will be exposed, thus providing a target for the
binding of ssPyrBF. This specific ssPyrBF-DNA interaction, therefore,
would tend to stabilize the intramolecular triplex H form structure
preventing the Sp1 binding and its accumulation to the nearest supply
source for the GC box, thereby indirectly interfering with the
transcriptional initiation. Thus, the ratio of Sp1 to ssPyrBF could
provide an additional control in the regulated expression of the AR
gene. Such a regulatory step may also be operative in other TATA-less
genes with a long pur/pyr element near the GC box site.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 11. A Model for Transcriptional Control at the AR
Homopurine/Homopyrimidine Element
The essence of the model is that the conformational structure of the
pur/pyr element can alternate between a B-DNA double-stranded form and
two H forms involving intramolecular triple helices. In contrast to
(C*GC) pyr-pur-pyr, the pur-pur-pyr (G*GC) structure can form stable
Hoogsteen hydrogen bond (*) at the physiological pH and, therefore, is
the preferred conformation (37, 39). The two DNA-binding proteins (Sp1
and ssPyrBF) specific for this element can only bind to particular
structures. When the pur/pyr element is in double-stranded
conformation, Sp1 can interact and accumulate at the pur/pyr site
providing a readily available source for the GC box located immediately
downstream. This situation will enhance transcription. When the element
is in a pur-pur-pyr H form structure, the binding of the single
strand pyrimidine-specific factor (ssPyrBF) can stabilize the
triple-helical conformation, thereby preventing the binding of Sp1 and
removing the nearby supply source of this transcription factor for the
functional GC box. Varying ratios of ssPyrBF to Sp1 could potentially
play a role in the differential regulation of the AR gene.
|
|
 |
MATERIALS AND METHODS
|
|---|
Plasmid DNAs and Oligonucleotides
For all plasmid constructions, standard recombinant DNA
technologies were used. For the S1 sensitivity analyses, plasmid pAR
was constructed by subcloning the rAR gene fragment from -1040 to +22
bp into the pGL-2 vector (Promega, Madison, WI). Three
promoter-reporter plasmids were constructed for transfection
experiments. For the wild type control, a fragment spanning -1040 to
+555 bp of the rAR gene was inserted into the luciferase-containing
vector pGL2 to create the plasmid pWtAR-Luc. Two mutant plasmids were
generated from this construct by 1) deleting a 50-bp region spanning
the pur/pyr element from -140 to -91 to give pDelAR-Luc; and 2)
replacing the same 50-bp region with the GT-rich oligonucleotide
5'CTCGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTCG3' (GT
insert) to give pMutAR-Luc. All constructs were confirmed by DNA
sequencing. All oligonucleotides used in this study were synthesized by
Midland Company (Midland, TX). After synthesis and deprotection, the
oligonucleotides were purified through 16% denaturing polyacrylamide
gels. Base-substituted TFOs were designed to form G:GC triplets (19).
Double-stranded oligonucleotides were synthesized as two complementary
oligonucleotides containing HindIII and SmaI
sites at their 5'-ends. The oligonucleotides were subcloned into the
HindIII and SmaI sites of the Bluescript vector
(Stratagene, La Jolla, CA), and the resulting plasmid was confirmed by
DNA sequencing.
S1 Nuclease Sensitivity Assay
S1 digestion of the supercoiled plasmid DNA was performed as
described elsewhere (20). Briefly, DNA at a concentration of 0.1
µg/ml was digested in 30 mM sodium acetate (pH 4.5), 300
mM NaCl, 0.2 mM EDTA, 3 mM
ZnCl2 with 5 U of S1 nuclease per µg of DNA at 42 C for
20 min. S1-nicked plasmid DNA was then digested with PstI
and XbaI and electrophoresed on 1.5% agarose gels. For fine
mapping, the nicked plasmid DNA was digested with XbaI,
end-labeled with [
-32P] ATP and T4 polynucleotide
kinase or [
-32P] dCTP and the Klenow fragment of DNA
polymerase I at the 5'- or 3'-ends, respectively. The labeled DNA was
then digested with PstI and purified through a 1% agarose
gel. Samples were analyzed on 6% polyacrylamide-8 M urea
sequencing gels along with DNA-sequencing ladder markers.
Preparation of Nuclear Extracts
Nuclear extracts from the rat tissues were prepared using the
procedure of Hattori et al. (47). Briefly, the tissue
homogenate was centrifuged through a 2.2 M sucrose cushion
to obtain the purified nuclear pellet. Resuspended nuclei were lysed in
a buffer containing 10% glycerol, 10 mM HEPES, pH 7.6, 100
mM KCl, 3 mM MgCl2, 0.1
mM EDTA, and 1 mM dithiothreitol (DTT), and the
nuclear proteins were extracted in the presence of 0.4 M
ammonium sulfate. Extracts were fractionated by ammonium sulfate
precipitation (0.33 g/ml), and precipitated nuclear proteins were
extensively dialyzed in 20 mM HEPES, pH 7.6, 100
mM KCl, 0.2 mM EDTA, 2 mM DTT, and
1 mM NaMoO4. The dialysate was clarified by
centrifugation and flash-frozen in liquid nitrogen. Nuclear extracts
from HeLa, Jurkat, PC3, COS1, PA III, and CHO cells were prepared using
the methods of Dignam et al. (48). All buffers contained 2
µg/ml each of aprotinin, leupeptin, bestatin, 0.1 mM
phenylmethylsulfonylfluoride, and 1 mM DTT, which were
added just before use. All manipulations were performed at 4 C. Protein
concentrations were determined using the Bradford assay (49).
DNA Protein-Binding Assay (Electrophoretic Mobility Shift Assay
and DNase I Footprinting)
For the single-stranded probe, oligonucleotides containing the
single-stranded purine- or pyrimidine-rich region of the rAR gene from
-123 to -91 bp (Table 1
) were radiolabeled at the 5'-end.
Unincorporated radiolabel was removed by ethanol precipitation of the
oligonucleotides. The double-stranded pur/pyr probe (-123 to -91) was
released from the Bluescript vector by digestion with
HindIII and radiolabeled at the 3'-end. After
Smal digestion, the 33-bp fragment was gel purified and used
in both DNA protein and triplex band shift analyses. Nuclear extracts
(210 µg) were preincubated in 20-µl reactions containing 10
mM Tris-HCl, pH 7.5, 50 mM NaCl, 1
mM EDTA, 5% glycerol, 2 µg of
poly(deoxyinosinic-deoxycytidylic acid), and 12 µg of low mol wt
salmon sperm DNA. After 5 min at room temperature, radiolabeled probes
(30,000 cpm) were added, and the incubation was continued for another
20 min (9). No significant difference in protein binding to either
single- or double-stranded pur/pyr probes by nuclear extracts derived
from either the rodent (young-adult rat liver) or the human (HeLa
cells) source was observed. These two nuclear extracts have, therefore,
been used interchangeably in various experiments as described. For
competition binding reactions, the unlabeled competitor in 100-fold
molar excess of the labeled probe was included in the reaction. After
incubation, the reaction mixtures were loaded onto a 5% native
polyacrylamide gel in 0.5x Tris-boric acid-EDTA (TBE),
electrophoresed, dried, and exposed to x-ray film (X-OMAT,
Eastman-Kodak, Rochester, NY) (9). Electrophoretic mobility shift
assays for Sp1 were performed with 0.1 U of recombinant purified human
Sp1 (Promega) without any nonspecific competitor DNA. Antibody
supershift experiments were performed with specific Sp1 antibody, which
does not cross-react with Sp2/Sp3/Sp4 (Santa Cruz Biotech, CA). This
antibody was added to the nuclear extract 10 min before the addition of
the radiolabeled probe. For DNase I footprinting, a radiolabeled 297-bp
DNA fragment was generated by PCR using a plasmid template and two
primers (unlabeled primer at -283 and 5'-radiolabeled primer at +14).
The end-labeled PCR fragment was gel purified and incubated with either
the rat liver nuclear extract (50 µg) or recombinant Sp1 protein (2 U
and 8 U) in the reaction mixture as described above. After mild DNase I
digestion, DNA fragments were analyzed on a 6%
polyacrylamide-sequencing gel containing 8 M urea.
Gel Mobility Shift Analysis of Triplex Formation
The labeled target double-stranded DNA probe (100200 fmol)
containing the pur/pyr region of the rAR gene (-123 to -91) was
incubated with increasing concentrations of the single-stranded
oligonucleotides in a buffer consisting of 10 mM Tris-HCl,
pH 7.4, 10% sucrose, 5 mM MgCl2, and 1
mM spermine. The incubation was at 37 C for 60 min. The
samples were electrophoresed through a 10% polyacrylamide gel in 89
mM Tris, 89 mM boric acid, 5 mM
MgCl2. The gels were then dried and autoradiographed.
Triplex-Mediated DNase I Footprinting
Probes were generated by digesting plasmid pAR with
XbaI. The purine-rich upper strand was labeled at the 3'-end
by end-filling with the Klenow fragment of DNA polymerase I. After a
second digestion with PstI, the 536-bp double-stranded
probes (-513 to +22) were purified on a 5% nondenaturing
polyacrylamide gel. The labeled 536-bp duplex DNA fragment was
incubated with a 50-fold molar excess of single-stranded
oligonucleotides in a buffer containing 10 mM
MgCl2, 10% sucrose, and 10 mM Tris-HCl at pH
7.4 for 60 min at 37 C. DNase I was added at 0.125 U/ml, and the
incubation was continued for 10 min. Reactions were stopped by the
addition of 15 mM EDTA and calf thymus DNA to 0.2 mg/ml
(21). The products were then resolved on a 6% denaturing
polyacrylamide gel.
DNA Transfection and Enzyme Assay
Different cell lines used in this study were obtained from ATCC
and grown in DMEM-Hanks F-12 medium (1:1 vol/vol) containing 10%
FBS. T25 flasks were seeded with 0.5 to 1 x
106 cells and cultured overnight before transfection. Three
AR promoter-containing reporter plasmids (10 µg) were transfected
into cells by the calcium-phosphate-DNA coprecipitation method, and
cells were harvested 24 h post transfection. The cell extracts
were assayed for luciferase activity (50), and light emission was
quantified in a Bio-Oribit 1250 luminometer (Pharmacia-LKB,
Gaithersburg, MD). Protein concentrations of cell extracts were
measured using the Bradford assay, and transfection results were
computed as luciferase activities per mg of total protein.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Gary Felsenfeld for valuable comments on the first
draft of this article. Dedicated technical assistance from Miss Tina
Hassan and secretarial help from Mrs. Katrine Krueger and Nyra White
are greatly appreciated.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Arun K. Roy, Ph.D., Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, Texas.
This investigation was supported by NIH Grants R37 DK-14744 and R01
AG-10486. S.C. is an NIH Predoctoral Trainee (T32 AG00165), and A.K.R.
is recipient of an NIH MERIT award.
Received for publication September 9, 1996.
Accepted for publication October 10, 1996.
 |
REFERENCES
|
|---|
-
Evans RM 1988 The steroid and thyroid hormone receptor
superfamily. Science 240:889895[Abstract/Free Full Text]
-
Mangelsdorf D, Thummel C, Beato M, Herrlich P, Schutz G,
Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The
nuclear receptor superfamily: the second decade. Cell 83:835839[CrossRef][Medline]
-
Quigley CA, De Bellis A, Marschke KB, El-Awady MK, Wilson EM,
French FS 1995 Androgen receptor defects: historical, clinical, and
molecular perspectives. Endocr Rev 16:271289[Abstract/Free Full Text]
-
Visakorpi T, Hyytinen E, Koivisto P, Tanner M, Keinanan R,
Palmberg C, Polotie A, Tammela T, Isola J, Kallioniemi OP 1995 In
vivo amplification of the androgen receptor gene and progression
of human prostate cancer. Nat Genet 9:401406[CrossRef][Medline]
-
Taplin ME, Bubley GJ, Shuster TD, Frantz ME, Spooner AE,
Ogata GK, Keer HN, Balk SP 1995 Mutation of the androgen receptor gene
in metastatic androgen-independent prostate cancer. N Engl J
Med 332:13931398[Abstract/Free Full Text]
-
Wilson JD 1995 The promiscuous receptor. Prostate cancer
comes of age. N Engl J Med 332:14401441[Free Full Text]
-
Prins GS, Jung MH, Vellanoweth RL, Chatterjee B, Roy AK 1996 Age-dependent expression of the androgen receptor gene in the prostate
and its implication in glandular differentiation and hyperplasia. Dev
Genet 18:99106[CrossRef][Medline]
-
Sar M, Lubahn DB, French FS, Wilson EM 1990 Immunohistochemical localization of the androgen receptor in rat and
human tissues. Endocrinology 127:31803186[Abstract/Free Full Text]
-
Supakar PC, Song CS, Jung MH, Slomczynska MA, Kim JM,
Vellanoweth RL, Chatterjee B, Roy AK 1993 A novel regulatory element
associated with age-dependent expression of the rat androgen receptor
gene. J Biol Chem 268:2640026408[Abstract/Free Full Text]
-
Roy AK, Chatterjee B 1995 Androgen action. Crit Rev Euk Gene
Expr 5:157176[Medline]
-
Supakar PC, Jung MH, Song CS, Chatterjee B, Roy AK 1995 Nuclear factor kB functions as a negative regulator for the rat
androgen receptor gene and NF-kB activity increases during the
age-dependent desensitization of the liver. J Biol Chem 270:837842[Abstract/Free Full Text]
-
Tilley WD, Marcelli M, McPhaul MJ 1990 Expression of the human
androgen receptor gene utilizes a common promoter in diverse human
tissues and cell lines. J Biol Chem 265:1377613781[Abstract/Free Full Text]
-
Song CS, Her S, Slomczynska M, Choi SJ, Jung MH, Roy AK,
Chatterjee B 1993 A distal activation domain is critical in the
regulation of the rat androgen receptor gene promoter. Biochem J 294:779784
-
Faber PW, van Rooij HJ, Schipper HJ, Brinkmann AO, Trapman J 1993 Two different, overlapping pathways of transcription initiation
are active on the TATA-less human androgen receptor promoter. J
Biol Chem 268:92969301[Abstract/Free Full Text]
-
Mizokami A, Yeh SY, Chang CS 1994 Identification of
3',5'-cyclic adenosine monophosphate response element and other
cis-acting elements in the human androgen receptor gene promoter. Mol
Endocrinol 8:7788[Abstract/Free Full Text]
-
Kumar MV, Jones EA, Grossmann ME, Blexrud MD, Tindall DJ 1994 Identification and characterization of a suppressor element in the
5'-flanking region of the mouse androgen receptor gene. Nucleic Acids
Res 22:36933698[Abstract/Free Full Text]
-
Grossmann ME, Tindall DJ 1995 The androgen receptor is
transcriptionally suppressed by proteins that bind single-stranded DNA.
J Biol Chem 270:1096810975[Abstract/Free Full Text]
-
Gumucio DL, Shelton DA, Bailey WJ, Slightom JL, Goodman M 1993 Phylogenetic footprinting reveals unexpected complexity in trans
factor binding upstream from the epsilon-globin gene. Proc Natl Acad
Sci USA 90:60186022[Abstract/Free Full Text]
-
Durland RH, Kesseler DJ, Gunnell S, Duvic M, Pettitt BM, Hogan
ME 1991 Binding of triple helix forming oligonucleotides to sites in
gene promoters. Biochemistry 30:92469255[CrossRef][Medline]
-
Johnson A, Jinno Y, Merlino GT 1988 Modulation of epidermal
growth factor receptor proto-oncogene transcription by a promoter site
sensitive to S1 nuclease. Mol Cell Biol 8:41744184[Abstract/Free Full Text]
-
Cooney M, Czernuszewicz G, Postel EH, Flint SJ, Hogan ME 1988 Site-specific oligonucleotide binding represses transcription of the
human c-myc gene in vitro. Science 241:456459[Abstract/Free Full Text]
-
Hoffman EK, Trusko SP, Murphy M, George DL 1990 An S1
nuclease-sensitive homopurine/homopyrimidine domain in the c-Ki-ras
promoter interacts with a nuclear factor. Proc Natl Acad Sci USA 87:27052709[Abstract/Free Full Text]
-
Grigoriev M, Parseuth D, Guieysse AL, Robin P, Thuong NT,
Helene D, Harel-Bellan A 1993 Inhibition of triple helix-directed DNA
cross-linking at specific sites. Proc Natl Acad Sci USA 90:35013505[Abstract/Free Full Text]
-
Wang ZY, Lin XH, Nobuyoshi M, Deuel TF 1993 Identification of
a single-stranded DNA-binding protein that interacts with an S1
nuclease-sensitive region in the platelet-derived growth factor A-chain
gene promoter. J Biol Chem 268:1068110685[Abstract/Free Full Text]
-
Hollingsworth M, Closken C, Harris A, McDonald CD, Pahwa GS,
Maher, III LJ 1994 A nuclear factor that binds purine-rich,
single-stranded oligonucleotides derived from S1-sensitive elements
upstream of the CFTR gene and the MUC1 gene. Nucleic Acids Res 22:11381146[Abstract/Free Full Text]
-
Pugh BF, Tjian R 1991 Transcription from TATA-less promoter
requires a multisubunit TFIID complex. Genes Dev 5:19351945[Abstract/Free Full Text]
-
Genersch E, Eckerskorn C, Lottespeich F, Herzog C, Kuhn K,
Poschl E 1995 Purification of the sequence-specific transcription
factor CTCBF involved in the control of human collagen IV genes:
subunits with homology to Ku antigen. EMBO J 14:791800[Medline]
-
Wang ZY, Deuel TF 1992 An S1 sensitive
homopurine/homopyrimidine domain in the PDGF A-chain promoter contains
a novel binding site for the growth factor-inducible protein EGR-1.
Biochem Biophys Res Commun 188:433439[CrossRef][Medline]
-
Hagen G, Dennig J, Preib A, Beato M, Suske G 1995 Functional
analyses of the transcription factor Sp4 reveal properties distinct
from Sp1 and Sp3. J Biol Chem 270:2498924994[Abstract/Free Full Text]
-
Baarends WM, Themmen APN, Blok LJ, Mackenbach P, Brinkmann AO,
Meijer D, Faber PW, Trapman J, Grootegoed JA 1990 The rat androgen
receptor gene promoter. Mol Cell Endocrinol 74:7584[CrossRef][Medline]
-
Yu YT, Manley JL 1986 Structure and function of the S1
nuclease-sensitive site in the adenovirus late promoter. Cell 45:743751[CrossRef][Medline]
-
Boles TC, Hogan ME 1987 DNA structure equilibria in the human
c-myc gene. Biochemistry 26:367376[CrossRef][Medline]
-
Ing NH, Beekman JM, Kessler DJ, Murphy M, Jayaraman K,
Zendergui JG, Hogan ME, OMalley BW, Tsai MJ 1993 In vivo
transcription of a progesterone-responsive gene is specifically
inhibited by a triplex-forming oligonucleotide. Nucleic Acids Res 21:27892796[Abstract/Free Full Text]
-
Mayfield C, Miller D 1994 Effect of a basic linker
substitution on triplex formation, Sp1 binding, and specificity in an
oligonucleotide targeted to the human Ha-ras promoter. Nucleic Acids
Res 22:19091916[Abstract/Free Full Text]
-
Wang ZY, Lin XH, Nobuyoshi M, Qiu QQ, Deuel TF 1992 Binding of
single-stranded oligonucleotides to a non-B-form DNA structure results
in loss of promoter activity of the platelet-derived growth factor
A-chain gene. J Biol Chem 267:1366913674[Abstract/Free Full Text]
-
Grigoriev M, Parseuth D, Robin P, Hemar A, Saison-Behmoaras T,
Dautry-Varsat A, Thuong NT, Helene C, Harel-Bellan A 1992 A triple
helix-forming oligonucleotide-intercalator conjugate acts as a
transcriptional repressor via inhibition of NF kappa B binding to
interleukin-2 receptor alpha-regulatory sequence. J Biol Chem 267:33893395[Abstract/Free Full Text]
-
Frank-Kamenetskii MD, Mirkin SM 1995 Triplex DNA structures.
Annu Rev Biochem 64:6595[Medline]
-
Lyamichev VI, Mirkin SM, Frank-Kamenetskii MD 1986 Structures
of homopurine-homopyrimidine tract in superhelical DNA. J Biomol
Struct Dyn 3:667669[Medline]
-
Wells RD, Collier DA, Hanvey JC, Shimizu M, Wohlrab F 1988 The
chemistry and biology of unusual DNA structures adopted by oligopurine,
oligopyrimidine sequences. FASEB J 2:29392949[Abstract]
-
Fox KR 1994 Formation of DNA triple helices incorporating
blocks of G.GC and T.AT triplets using short acridine-linked
oligonucleotides. Nucleic Acids Res 22:20162021[Abstract/Free Full Text]
-
Mayfield C, Ebbinghaus S, Gee J, Jones D, Rodu B, Squibb M,
Miller D 1994 Triplex formation by the human Ha-ras promoter inhibits
Sp1 binding and in vitro transcription. J Biol Chem 269:1823218238[Abstract/Free Full Text]
-
Lafyatis R, Denhez F, Williams T, Sporn M, Roberts A 1991 Sequence specific protein binding to and activation of the TGFß3
promoter through a repeated TCCC motif. Nucleic Acids Res 23:64196425
-
Azizkhan JC, Jensen DE, Pierce AJ, Wade M 1993 Transcription
from TATA-less promoters: dihydrofolate reductase as a model. Crit Rev
Euk Gene Exp 3:229254[Medline]
-
Su W, Jackson S, Tjian R, Echols H 1991 DNA looping between
sites for transcriptional activation: self-association of DNA-bound
Sp1. Genes Dev 5:820826[Abstract/Free Full Text]
-
Ammendola R, Mesuraca M, Russo T, Cimino F 1992 Sp1 DNA
binding efficiency is highly reduced in nuclear extracts from aged rat
tissue. J Biol Chem 267:1794417948[Abstract/Free Full Text]
-
Xu G, Goodridge AG 1996 Characterization of a
polypyrimidine/polypurine tract in the promoter of the gene for chicken
malic enzyme. J Biol Chem 271:1600816019[Abstract/Free Full Text]
-
Hattori M, Tugores A, Veloz L, Karin M, Brenner DA 1990 A
simplified method for the preparation of transcriptionally active liver
nuclear extracts. DNA Cell Biol 9:777781[Medline]
-
Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription
initiation by RNA polymerase II in a soluble extract from isolated
mammalian nuclei. Nucleic Acids Res 11:14751489[Abstract/Free Full Text]
-
Bradford MM 1976 A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the principle
of protein-dye binding. Anal Biochem 72:248254[CrossRef][Medline]
-
De Wet JR, Wood KV, DeLuca M, Helinski DR, Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells.
Mol Cell Biol 7:725737[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
Y. Yan, G. Dalmasso, H. T. T. Nguyen, T. S. Obertone, L. Charrier-Hisamuddin, S. V. Sitaraman, and D. Merlin
Nuclear Factor-{kappa}B Is a Critical Mediator of Ste20-Like Proline-/Alanine-Rich Kinase Regulation in Intestinal Inflammation
Am. J. Pathol.,
October 1, 2008;
173(4):
1013 - 1028.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Sun, K. Guo, J. J. Rusche, and L. H. Hurley
Facilitation of a structural transition in the polypurine/polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G-quadruplex-interactive agents
Nucleic Acids Res.,
October 20, 2005;
33(18):
6070 - 6080.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Chen, A. Unterbrink, S. Kadapakkam, J. Dong, T. T. Gu, J. Dickson, H.-H. Chuang, and M. MacDougall
Regulation of the Cell Type-specific Dentin Sialophosphoprotein Gene Expression in Mouse Odontoblasts by a Novel Transcription Repressor and an Activator CCAAT-binding Factor
J. Biol. Chem.,
October 1, 2004;
279(40):
42182 - 42191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. K. Lee and C. Chang
Expression and Degradation of Androgen Receptor: Mechanism and Clinical Implication
J. Clin. Endocrinol. Metab.,
September 1, 2003;
88(9):
4043 - 4054.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. C. Farokhzad, J. M. Teodoridis, H. Park, M. A. Arnaout, and C. S. Shelley
CD43 gene expression is mediated by a nuclear factor which binds pyrimidine-rich single-stranded DNA
Nucleic Acids Res.,
June 1, 2000;
28(11):
2256 - 2267.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. D. Nelson, M. Musso, and M. W. Van Dyke
The Yeast STM1 Gene Encodes a Purine Motif Triple Helical DNA-binding Protein
J. Biol. Chem.,
February 25, 2000;
275(8):
5573 - 5581.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Song, M. H. Jung, P. C. Supakar, B. Chatterjee, and A. K. Roy
Negative Regulation of the Androgen Receptor Gene Promoter by NFI and an Adjacently Located Multiprotein-Binding Site
Mol. Endocrinol.,
September 1, 1999;
13(9):
1487 - 1496.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. Zahedi, J. J. Bissler, A. E. Prada, J. A. Prada, and A. E. Davis III
The Promoter of the C1 Inhibitor Gene Contains a Polypurine{middle dot}Polypyrimidine Segment that Enhances Transcriptional Activity
J. Immunol.,
June 15, 1999;
162(12):
7249 - 7255.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F.J. Ghadessy, S.L. Liow, and E.L. Yong
Mutations in the promoter region of the androgen receptor gene are not common in males with idiopathic infertility
Mol. Hum. Reprod.,
March 1, 1999;
5(3):
287 - 290.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Nambiar, S. K. Swamynathan, J. C. Kandala, and R. V. Guntaka
Characterization of the DNA-Binding Domain of the Avian Y-Box Protein, chkYB-2, and Mutational Analysis of Its Single-Strand Binding Motif in the Rous Sarcoma Virus Enhancer
J. Virol.,
February 1, 1998;
72(2):
900 - 909.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Di Matteo, M. Salerno, G. Guarguaglini, B. Di Fiore, F. Palitti, and P. Lavia
Interactions with Single-stranded and Double-stranded DNA-binding Factors and Alternative Promoter Conformation upon Transcriptional Activation of the Htf9-a/RanBP1 and Htf9-c Genes
J. Biol. Chem.,
January 2, 1998;
273(1):
495 - 505.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.B. ROTHMAN-DENES, X. DAI, E. DAVYDOVA, R. CARTER, and K. KAZMIERCZAK
Transcriptional Regulation by DNA Structural Transitions and Single-stranded DNA-binding Proteins
Cold Spring Harb Symp Quant Biol,
January 1, 1998;
63(0):
63 - 74.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Sakamoto, K. Ohshima, L. Montermini, M. Pandolfo, and R. D. Wells
Sticky DNA, a Self-associated Complex Formed at Long GAA{middle dot}TTC Repeats in Intron 1 of the Frataxin Gene, Inhibits Transcription
J. Biol. Chem.,
July 13, 2001;
276(29):
27171 - 27177.
[Abstract]
[Full Text]
[PDF]
|
 |
|