help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, S.
Right arrow Articles by Roy, A. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, S.
Right arrow Articles by Roy, A. K.
Molecular Endocrinology 11 (1): 3-15
Copyright © 1997 by The Endocrine Society

Functional Role of a Conformationally Flexible Homopurine/Homopyrimidine Domain of the Androgen Receptor Gene Promoter Interacting with SP1 and a Pyrimidine Single Strand DNA-Binding Protein

Shuo Chen, Prakash C. Supakar, Robert L. Vellanoweth, Chung S. Song, Bandana Chatterjee and Arun K. Roy

Department of Cellular and Structural Biology The University of Texas Health Science Center at San Antonio San Antonio, Texas 78284-7762


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The androgen receptor (AR) gene promoter does not contain the TATA or CAAT box, but it contains a long (~90-bp) homopurine/homopyrimidine (pur/pyr) stretch immediately upstream of the Sp1-binding GC box site. This pur/pyr stretch is conserved at the same proximal position in the rat, mouse, and human AR gene promoters. Mutation of this region results in a 3-fold decline in promoter activity, indicating an important regulatory function. Examination of the conformational state of the AR pur/pyr region with the single-strand-specific S1 nuclease showed that it is capable of forming a non-B DNA structure involving unpaired single strands. Fine mapping of the S1-sensitive site revealed an unsymmetric cleavage pattern indicative of an intramolecular triple helical H-form DNA conformation. Electrophoretic mobility shift analyses showed that the pur/pyr region of the AR promoter can bind a novel pyrimidine single-strand-specific protein (ssPyrBF) and also a double-strand DNA-binding protein. Both oligonucleotide cross-competition and antibody supershift experiments established that the double-strand binding protein is equivalent to Sp1. Deoxyribonuclease I (DNase I) footprinting analysis showed multiple Sp1-binding to the pur/pyr site and a weaker Sp1 interaction to this region compared with the adjacently located GC box, where Sp1 functions to recruit the TFIID complex. These results suggest that the pur/pyr domain of the AR gene can serve to attract additional Sp1 molecules when it exists in the double-stranded B-DNA conformation. However, binding of ssPyrBF and the resultant stabilization of the non-B DNA structure is expected to prevent its interaction with Sp1. We speculate that in the TATA-less AR gene promoter, multiple weak Sp1 sites at the pur/pyr region adjacent to the GC box can provide a readily available source of this transcription factor to the functional GC box, thereby facilitating the assembly of the initiation complex.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The androgen receptor (AR) is a ligand-activated transcription factor belonging to the steroid/thyroid hormone receptor superfamily (1, 2). AR plays a central role in the coordination of the male-specific sexual phenotype and in the development of the male reproductive organs (3). It has also been implicated in prostatic hyperplasia and carcinogenesis (4, 5, 6, 7). Although qualitatively AR is expressed in almost all tissues examined so far, the extent of its expression in various tissues differs within 2 to 3 orders of magnitude (8, 9, 10). Furthermore, within the same cell type, there can be vast differences in AR expression at different phases of development and aging (7, 9). Such spatio-temporal regulation of AR gene expression in target cells is thought to be mediated through differential expression of transcription factors that are involved in the regulation of this gene (9, 10, 11). Thus, a thorough understanding of AR promoter function appears essential to the elucidation of the mechanism of tissue-specific expression of this receptor protein. Because of this reasoning, we and others have been examining the specific protein-binding sites at the AR gene promoter and characterizing the biological function of these protein-DNA interactions in transfected cells (9, 10, 11, 12, 13, 14, 15, 16, 17). These studies have revealed that a number of promoter elements come into play in the overall regulation of AR gene transcription. Furthermore, through a comparative analysis of the AR promoter sequences by phylogenetic footprinting (18), we have shown the presence of at least 22 potential binding sites for known transcription factors on the AR promoters of several species within closely conserved locations (10). In essence, these different approaches have resulted in the identification of positive transcriptional activity mediated by several trans-acting factors such as the constitutive activator Sp1 (14), the cAMP-responsive cAMP-response element binding protein factor (15), and the age-dependent factor (9). Negative regulation is also operative via NF{kappa}B at a perfectly palindromic site (11), by another factor binding to the mouse AR 5'-flanking region (16), as well as by single-stranded DNA-specific binding proteins presumably affecting transcriptional elongation (17).

The proximal 5'-flanking region of the AR gene promoter lacks an obvious TATA box or CAAT box but contains a long homopurine/homopyrimidine (pur/pyr) stretch around -150 to -60 bp. This pur/pyr stretch is conserved at approximately the same position in the rat, mouse, and human AR genes. Deletion of DNA sequences containing this region from the human AR promoter causes a 3-fold decline in promoter activity (15). Given the evolutionarily conserved nature of the pur/pyr element and its potential importance as a target for triplex-mediated gene therapy (19), we undertook to elucidate the mechanism by which this site exerts its regulatory role. In this report we present results to show that the pur/pyr site of the AR promoter is sensitive to S1 nuclease within a six-copy mirror repeat of the sequence GGGGA on supercoiled DNA. The S1 sensitivity pattern is suggestive of various isoforms of H-DNA, and the possibility of an intramolecular triplex structure was further supported by the formation of a site-specific triple helix in vitro at the physiological pH. Analyses of protein-DNA interactions revealed that the pur/pyr site is capable of binding both a sequence-specific single-strand binding protein and the transcription factor Sp1. Multiple Sp1-binding sites at the pur/pyr region adjacent to one functional GC box can potentially assure a constant supply of Sp1 for recruitment of the transcription factor IID (TFIID) complex, and the process may be hindered by conformational perturbation associated with the interaction of the single-strand binding protein at the pur/pyr site.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Phylogenetic Footprinting of the Androgen Receptor Promoter Reveals a Potentially Important 5'-Proximal Homopurine-Homopyrimidine Element
An optimal alignment of the rat, mouse, and human AR promoter sequences (18) revealed a large number of phylogenetic footprints with >= 8 bp identity. Many of these are potential binding sites of known transcription factors (10) while others are bound by novel transcription factors (9). By far, the greatest stretch of homology was found between -138 and -60 (rat coordinates), previously shown by Mizokami et al. (15) to have functional promoter activity in the human AR gene. This homologous region encompasses a homopurine/homopyrimidine (pur/pyr) element containing six direct repeats of the sequence GGGGA in the rat, five repeats in the mouse, and three in the human (Fig. 1Go). Given the high degree of homology in this region across species lines and its unusual sequence characteristics, its functional importance to transcription of the rat AR (rAR) gene was further investigated.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. Homologous Polypurine Regions in the Rat, Mouse and Human AR Promoters

The top strand depicts the rAR sequence from -152 to +43 bp relative to the transcriptional start site (arrow). The next two strands depict the mouse and human sequences, respectively. Bases identical to the rat are indicated by dashes, mismatches by letters, and gaps by dots.

 
Mutation of the Homopurine/Homopyrimidine-Rich Region of the rAR Gene Results in Decreased Reporter Activity
It has been demonstrated previously in several genes that promoter-proximal pur/pyr elements provide important regulatory activity (20, 21, 22, 23, 24, 25). To further characterize the biological role of the pur/pyr region in the transcription of the rAR gene, we used a transfection assay of the wild type and mutant promoters in human hepatoma (HepG2) and in human uterine carcinoma (HeLa) cells. A set of constructs was created in which a segment of the AR promoter from -1040 to +555 bp, either wild type or containing mutations at the pur/pyr site, was fused to the firefly luciferase reporter gene. The two mutant constructs were Del AR-Luc lacking 50 bp of the pur/pyr region (-140 to -91) and Mut AR-Luc containing a 50-bp GT insert (sequence shown in the Fig. 2Go legend) replacing the wild type sequences. The GT insert was selected to fill in the deleted area because of the fact that this sequence neither forms triple helix nor binds to any one of the two sequence-specific binding proteins that interacts to the pur/pyr domain described later (data not shown). Results in Fig. 2Go show that activities of the two mutant promoters decreased by about 3- to 4-fold compared with the wild type promoter in the hepatoma cell line. Furthermore, in HeLa cells, the two mutant constructs showed a similar extent of reduction in the luciferase activities (data not shown). These results are consistent with those reported by Mizokami et al. (15) and indicate that the pur/pyr element serves as an activator of rAR gene transcription.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Functional Activities of the Wild Type and Mutant Homopurine/Homopyrimidine Element of the rAR Promoter in Hepatoma Cells

Panel A, Schematic representation of the constructs used in the luciferase assays. WT is the 1595-bp fragment of the rAR gene promoter (-1040 to +555 bp) inserted into the luciferase reporter vector, pGL-2; Del indicates a mutant plasmid with a deletion of 50 bp from -140 to -91 bp; Mut contains a replacement of the normal sequences from -140 to -91 with a GT-insert (5'CTCGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGCTCG3'). Panel B, Results of the transfection experiment in HepG2 cells. Luciferase activities are expressed as activity per unit amount of the cell protein. The three points represent data from the average of duplicates of three different experiments and the bar represents the mean.

 
Sequence-Specific Nuclear Proteins Interact with the pur/pyr Element
In analogy to the mechanism by which most other cis-acting elements function, we used the pur/pyr element to search for potential trans-acting factors. In the double-stranded form, synthetic oligonucleotides corresponding to the rAR sequence from -123 to -91 produced a low mobility complex in a gel shift DNA-binding assay (Fig. 3Go, lane 1). An excess of the unlabeled pur/pyr oligonucleotide effectively competed for formation of the complex while the mutant duplex containing the mutated sequence where the last two purines of the GGGGA mirror repeat were changed to pyrimidines (pur/pyr(ds)mut, Table 1Go) failed to do so (lane 3). Neither of the single strands nor a heterologous double-stranded oligonucleotide (lanes 4–6) affected the complex to any appreciable degree. The vertebrate transcription factor Sp1 is known to bind GC-rich elements with consensus recognition sequence of 5'-GGGGCGGG-3' (26). Furthermore, recent studies on the transcriptional regulation of the collagen type IV gene have revealed a dimeric protein, CTC box binding factor (CTCBF), that interacts with a C5TC7 element close to the transcriptional start point of the collagen type IV TATA-less promoter (27). The (GGGGA)6 repeat of the pur/pyr element contains five overlapping copies that are structurally related to both the C4TC4 element and the Sp1-binding GC box. To test whether Sp1 or CTCBF binds to the rAR pur/pyr sequence, two oligonucleotide duplexes, one corresponding to the SV40 GC-box and the other to the collagen IV gene from -91 to -66 (Table 1Go), were used to compete for the retarded complex. An excess of either the unlabeled CTC box or the Sp1 consensus element efficiently competed for the shifted complex while the TATA box element was unable to do so (Fig. 3Go, lanes 7–9). Genersch et al. (27) have shown that the Sp1 consensus element does not compete with the authentic CTCBF element, and the TATA oligo can serve as an efficient competitor for CTCBF complex. In addition, these authors reported that the CTCBF-DNA complex contains TATA-binding protein (TBP), and antibodies directed against recombinant TBP interfere with the formation of the specific CTCBF-DNA complex. In the case of the AR pur/pyr element, the lack of competition by the TATA oligo, its efficient competition by the Sp1 oligo, and our inability to observe any interference of the anti-TBP antibody on the formation of the specific pur/pyr-protein complex (data not shown) lead us to conclude that despite the cross-competition of the CTCBF oligo at 100-fold molar excess, the pur/pyr binding protein is not CTCBF.



View larger version (93K):
[in this window]
[in a new window]
 
Figure 3. Electrophoretic Mobility Shift Assays (EMSA) with Double-Stranded Homopurine/Homopyrimidine Element

The 33-bp double-stranded pur/pyr oligonucleotide corresponding to -123 to -91 bp of rAR was end-labeled and incubated with HeLa cell nuclear extracts in the presence or absence of 100-fold molar excess of the unlabeled specific or nonspecific competitor DNA oligonucleotide duplexes described in Table 1Go. Lane 1, Without competitor DNA; lane 2, pur/pyr(ds) homologous competitor; lane 3, mutant pur/pyr(ds); lane 4, single-stranded pyr(ss); lane 5, single-stranded pur(ss); lane 6, unrelated ds oligonucleotide duplex at -940 rAR [-940(ds)]; lane 7, CTC box element of CTCBF; lane 8, TATA box element from thymidine kinase promoter; lane 9, Sp1-binding GC box site from SV40 enhancer.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Oligonucleotides Used in This Study

 
Results presented in Fig. 4Go show that the Sp1 consensus element and the AR pur/pyr duplex form retarded complexes of the same electrophoretic mobility and can effectively cross-compete with each other for the formation of the protein-DNA complex. Either the HeLa cell nuclear extract or recombinantly produced Sp1 was able to generate the same cross-reacting complex. However, unlike the recombinant Sp1 (Fig. 4BGo), the HeLa nuclear extract (Fig. 4AGo) produced two faster migrating additional bands. Studies with pur/pyr element of the platelet-derived growth factor-A chain have shown that in addition to Sp1, it can also bind EGR-1, another Zn-finger transcription factor with cross-reactivity to the Sp1 cis-element (28). They may also be due to complexes formed with other members of the Sp1 family, i.e. Sp2 and Sp3 (29). These two faster migrating bands are more prominent with the labeled Sp1 oligo (Fig. 4AGo, lanes 5 and 8), possibly due to its relatively higher affinity for the Sp family of DNA-binding proteins. Finally, supershift experiments with antibodies specifically directed to the recombinant Sp1 protein confirmed the presence of Sp1 in the retarded complex formed with both the labeled pur/pyr element (Fig. 4CGo, lanes 2 and 3) and the Sp1 consensus sequence (Fig. 4CGo, lanes 5 and 6). It is noteworthy that the specific Sp1 antibody selectively supershifted the slowest migrating band without affecting two faster migrating bands. From these results we conclude that the pur/pyr element of the androgen receptor gene can specifically interact with Sp1. This finding is also consistent with observations of Sp1 binding to pur/pyr regions of the epidermal growth factor receptor promoter (20).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 4. Sp1 as the Binding Protein to Double-Stranded pur/pyr Oligonucleotide

A, EMSA was performed with HeLa cell nuclear extracts (2 µg) and either end-labeled double-stranded pur/pyr (lanes 1–4), or with end-labeled Sp1 GC box oligonucleotide duplex (lanes 5–8) in the presence or absence of 100-fold molar excess of unlabeled competitor DNA. Lanes 1 and 5, No competitor DNA; lanes 2 and 6, pur/pyr(ds); lanes 3 and 7, Sp1 oligo; lanes 4 and 8, -940(ds) oligo. B, EMSA with 0.1 U of the purified recombinant Sp1 protein with either end-labeled pur/pyr(ds) (lanes 1–4), or with end-labeled Sp1 oligo (lanes 5–8). Lanes 1 and 5, no competitor DNA; lanes 2 and 6, Sp1 oligo; lanes 3 and 7, pur/pyr(ds); lanes 4 and 8, -940(ds) oligo. C, Antibody supershift assays with either end-labeled pur/pyr(ds) (lanes 1–3) or end-labeled Sp1 oligo duplex (lanes 4–6). Lanes 1 and 4, No antibody added; lanes 2 and 5, HeLa nuclear extract (10 µg) preincubated with 1 µl anti-Sp1; lanes 3 and 6, HeLa nuclear extract (10 µg) preincubated with 2 µl anti-Sp1.

 
The rat androgen receptor gene contains a bonafide Sp1 element at the -60 position (30). Such a proximal Sp1 site close to the initiation site of TATA-less promoters is thought to function in recruiting and stabilizing the TFIID complex, which is critical for transcriptional initiation (26). Results presented in Fig. 5Go show that the recombinant Sp1 protein produced two protected regions in the DNase I footprinting assay, one covering the GC box (-44- to -63-bp positions) and the other around the pur/pyr site (-66- to -145-bp positions). The protection on the pur/pyr site appears considerably weaker than the GC box area, possibly due to the combined effects of an inherent weakness of the pur/pyr binding to Sp1 and the strong competition for the Sp1 protein by the adjacent GC box site. In addition to pur/pyr and GC box sites, footprinting with the nuclear extract produced a downstream protection spanning -20- to -40-bp positions, which is the expected location for the formation of the TFIID complex (Fig. 5Go, lane 4).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 5. DNase I Footprinting Analysis of the Proximal Promoter Region of the rAR Gene

A 297-bp 32P-labeled DNA fragment of the rAR promoter region spanning -283 to +14-bp positions (lower strand radiolabeled at position +14) was used in DNase I protection assays with either purified recombinant Sp1 protein or rat liver nuclear extract. Lanes 1 and 5, 25 µg BSA; lane 2, 2 U of recombinant Sp1 protein; lane 3, 8 U of recombinant Sp1 protein; lane 4, 50 µg of rat liver nuclear extract; 0.02 µg/ml (lanes 1, 2, 3, and 5) and 0.2 µg/ml (lane 4) of DNase I were used for the digestion reaction. Protected areas are identified on the right of the panel. Two uncharacterized protected footprints observed with nuclear extract are shown with brackets on the top of the figure.

 
Band shift assays were also carried out with labeled single-strand components of the pur/pyr element to determine whether additional interactions could occur at this site. When either the purine (pur) strand or the pyrimidine (pyr) strand of the pur/pyr element (-91 to -123 bp) was labeled and incubated with the HeLa cell nuclear extract, a complex of an intermediate mobility was detected only with the labeled pyr probe (Fig. 6Go, lane 4) which can be competed out with the homologous single-stranded oligonucleotide (lane 5). Competition of this labeled pyr complex with the complementary purine strand, double stranded pur/pyr oligo, a mutant version of the pyrimidine strand [pyr(ss)mut, Table 1Go] and the single-stranded -940 oligonucleotide, all were ineffective, indicating a sequence-specific interaction between the single-stranded pyrimidine probe and the binding protein. These results suggest that, in addition to Sp1 interacting with the double-stranded form of pur/pyr, a sequence-specific, pyrimidine-rich single-strand binding protein, hereby termed ssPyrBF, interacts with a single-stranded form of the pur/pyr element.



View larger version (78K):
[in this window]
[in a new window]
 
Figure 6. Electrophoretic Mobility Shift Assays with Single-Stranded Purine and Pyrimidine Oligonucleotides

Experiments were performed with either single-stranded purine (lanes 1 and 2) or with single-stranded pyrimidine (lanes 3–9) probes. Nuclear extract derived from HeLa cells was added in samples run in all lanes except 1 and 3. Lane 1, Free pur(ss) probe, no competitor; lane 2, pur(ss) probe with nuclear extract; lane 3, free pyr(ss) probe, no nuclear extract; lane 4, pyr(ss) probe plus nuclear extract; lanes 6 to 9, competition with 100-fold molar excess of oligonucleotides as indicated on the top. Nucleotide sequences of the competitor oligonucleotides are shown in Table 1Go.

 
Because the AR gene is expressed in nearly all tissues and the pur/pyr element is present in the AR gene across species lines, we checked the tissue and species distribution of the ssPyrBF. Nuclear extracts from rat prostate and spleen and extracts of a number of cell lines including Jurkat (from human T lymphocytes), HeLa (from human uterus), PC-3 (from human prostate), PA III (from rat prostate), CHO (from hamster ovary), and COS1 (from monkey kidney), and HepG2 (from human liver) all showed the same specific band shift complex with the radiolabeled single-stranded pyr element (data not shown). Thus, it appears that the ssPyrBF is expressed in diverse cell types derived from various mammalian species.

S1 Nuclease Sensitivity at the pur/pyr Site
Previous studies have demonstrated that supercoiled plasmid DNAs containing pur/pyr regions of other genes can be cleaved by S1 nuclease at these sites (20, 21, 22, 24, 25, 31, 32, 33, 34, 35, 36). Such sensitivity to S1 nuclease is associated with functionally important regions of several eukaryotic promoters (20, 22, 24, 25, 32, 35). To determine whether the pur/pyr element of the rAR gene is also sensitive to S1 nuclease, the plasmid DNA containing the rAR sequence from -1040 to +22 was treated with S1 nuclease, and the products were resolved on an agarose gel. When the supercoiled plasmid DNA was digested initially with S1 nuclease and subsequently with restriction enzymes, two additional DNA fragments of 135 and 401 bp were detected (Fig. 7Go, lane 7). These two bands were not detected, however, when S1 nuclease was added to the linear plasmid DNA (Fig. 7Go, lane 6). From the fragment sizes, the S1 nuclease sensitive site was located to the region containing the pur/pyr element.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 7. Mapping of an S1 Nuclease-Sensitive Site in the rAR Promoter Region

Upper panel, Schematic representation of the S1-sensitive site. The thin line represents the rAR promoter region, and the rectangle is the pur/pyr element (-150 to -49 bp) of the rAR gene promoter. The S1-sensitive region within the pur/pyr element is indicated by arrows. Lower panel, Ethidium bromide-stained agarose gel. Lanes 1, 2 and 8 denote DNA size markers; lane 3, untreated supercoiled DNA; lane 4, supercoiled DNA linearized with PstI; lane 5, supercoiled DNA treated with PstI and XbaI; lane 6, supercoiled DNA digested with PstI before treatment with S1 and XbaI; lane 7, supercoiled DNA treated with S1 and then digested with PstI and XbaI, yielding two additional fragments of 401 bp and 135 bp indicated by arrows.

 
Fine Mapping of the S1 Nicking Site Suggests an H-DNA Conformation
To determine the detail of the cleavage sites on the two strands, the digestion products were labeled, and individual strands were resolved on a denaturing polyacrylamide gel. The results presented in Fig. 8Go show a collection of labeled fragments generated from both strands. Densitometric scanning of the autoradiogram allowed a quantification of the relative cleavage rate at each position from the intensity of the individual bands. Results of the quantification are shown in the lower panel of this figure. The unsymmetrical nature of the cleavage intensity is suggestive of an intramolecular triple helical H-form DNA conformation (37, 38, 39). We also note that S1 sensitivity within this region of the rAR promoter occurs strictly at the pur/pyr element, and the pyrimidine strand is relatively more sensitive to S1 cleavage than the purine strand of the DNA.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 8. Fine Mapping of the S1 Nuclease-Sensitive Sites within the rAR Homopurine/Homopyrimidine Element

Upper panel, The supercoiled plasmid DNA containing rAR promoter sequences from -1040 to +22 bp was treated with S1 nuclease, and the S1-freed ends were labeled either on the top strand (lane 1, pur*) or on the bottom strand (lane 2, pyr*); the DNA was digested with PstI and the fragment was resolved through a denaturing acrylamide gel. GATC refers to sequencing reactions used as DNA markers. Lower panel, Summary of S1 mapping experiment. Arrows above and below the DNA sequences represent S1 cleavage sites on the upper and lower strands, respectively. The degree of S1 sensitivity as determined by densitometric scanning is indicated by arrow length.

 
The pur/pyr Element Is Capable of Forming Triple Helical DNA in Vitro
The S1 sensitivity pattern shown in Fig. 8Go suggested that the pur/pyr element may form an intramolecular triplex. At the physiological pH, although pur-pur-pyr (G*GC) triplet can form the stable Hoogsteen hydrogen bond (*), the pyr-pur-pyr (C*GC) triplet is unstable (19, 37, 39). We therefore further tested the possibility of triplex formation at the pur-pyr site by band shift and footprinting experiments in vitro. For physiological relevance, triplex formation was allowed to occur at pH 7.4 in the presence of 5 mM MgCl2 (21). Triplex DNA complexes, because of their decreased charge density, migrate more slowly than the duplex DNA in gel mobility shift assays. Figure 9Go shows that the addition of increasing concentrations of the homologous parallel purine [pur(ss), Table 1Go] to the labeled double-stranded pur/pyr DNA resulted in a gradual shift from a duplex form (D) to a distinct, slower migrating band (T), indicating the formation of a DNA triplex. The gel shift profile obtained is very similar in appearance to that produced by other known G-rich triplex-forming oligonucleotides (TFOs) (21). An appreciable shift of the pur/pyr target duplex to triplex is seen at an approximately 10-fold molar excess of the single-stranded oligo, and a complete shift of the duplex to triplex occurred at a 50-fold molar excess. In addition to the parallel purine, the antiparallel purine (pur-ap) was also capable of forming DNA triplexes by this assay (data not shown). Furthermore, pur-ap was also found to form triplex DNA when either a 536-bp rAR fragment from -513 to +22 or a supercoiled plasmid containing sequences from -1040 to +22 was used as the target (data not presented), indicating that triple helix formation was not dependent on the use of small oligonucleotides and further suggesting that this site is capable of forming a triplex in the larger context of the AR promoter.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 9. Band Shift Analysis of Triplex Formation

Labeled double-stranded pur/pyr DNA [pur/pyr(ds), Table 1Go] was incubated with increasing concentrations of single-stranded purine oligonucleotide [pur(ss), Table 1Go] and run on a native polyacrylamide gel. S, D, and T point to the positions of migration of labeled single-stranded, double-stranded, and triple-stranded DNA. Lanes 1 and 2, Labeled single-stranded pyr and double-stranded pur/pyr probes, respectively. Lanes 3–6, Labeled double-stranded probe with 10-, 20-, 50- and 100-fold molar excesses of the unlabeled pur(ss).

 
To establish the specificity of triplex formation and to exactly map the contact sites on the rAR promoter, DNase I footprinting was performed with a radiolabeled 536-bp rAR fragment (-513 to +22). Results presented in Fig. 10Go show that, unlike the single-stranded pyrimidine, the single-stranded purine oligonucleotide (both in the parallel and in the antiparallel orientation) and its TFO variant were able to provide specific protection of sequences spanning -148 to -80 positions. Such an overprotection of the target sequences by TFOs in DNase I footprinting experiments has been noted previously (40, 41). Additional footprinting experiments using other GT-rich oligonucleotides (GT insert, Table 1Go) did not protect any region of the AR fragment from DNase I digestion (data not shown). Thus, the possibility of the intramolecular triple helix (H-DNA) structure, as indicated by the uneven S1 sensitivity (Fig. 8Go), is also supported by the sequence-specific triplex formation by TFOs at the physiological pH.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 10. DNase I Protection by TFOs

An end-labeled 536-bp double-stranded DNA fragment containing the pur/pyr target was mixed with 50-fold molar excesses of single-stranded oligonucleotides as indicated on the top of the figure. Lane 1 contains the G ladder as a sequence marker, and lane 6 contains DNase I digestion product in the absence of any single-stranded oligonucleotide. The sequence of the protected region is shown at the right of the panel. Nucleotide sequences of the single-stranded oligonucleotides used for the triplex formation are provided in Table 1Go. The nucleotide sequence of the parallel purine (pur-p) is the same as pur(ss) shown in Table 1Go.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The existence of homopurine/homopyrimidine stretches in promoter-proximal locations in a number of TATA-less mammalian genes has been reported. In addition to AR, these include C-Ki-ras, transforming growth factor-ß3, epidermal growth factor receptor, and human Ha-ras (20, 22, 34, 42). However, the precise role of the pur-pyr elements in the regulation of these TATA-less promoters has so far been unclear. Results presented in this paper show that, in the case of the AR gene, the pur/pyr element in its double-stranded form specifically binds to Sp1. Similar binding of Sp1 to the pur/pyr region of the epidermal growth factor receptor promoter has also been reported (20). In addition to its binding to the pur/pyr element, DNase I footprinting data show a stronger Sp1-binding site (GC box) is located immediately downstream (-63- to -44-bp positions). Pugh and Tjian (26) have shown that binding of Sp1 at the promoter-proximal site of the TATA-less promoter functions to recruit and stabilize the TFIID complex, which is essential for transcriptional activation. Additionally, in a number of TATA-less genes such as dihydrofolate reductase, fibroblast grwoth factor, and transforming growth factor-{alpha}, multiple Sp1-binding sites that are located farther apart have been identified (43). Electron microscopic examination of the Sp1-DNA complexes has shown that these distant Sp1 sites interact with Sp1 at the GC box through DNA looping and provide a synergistic stimulatory role through protein-protein interaction (44). However, in the case of the AR gene, it is possible that the weak Sp1 sites (pur/pyr domain) located immediately upstream from the GC box can function through a nonlooping mechanism. We speculate that such an alternative function may involve a localized increase in the Sp1 concentration at the pur/pyr site followed by the downstream slide of this protein to the higher affinity GC box site.

Both deletion of the pur/pyr element and mutation of the nucleotide sequence to prevent specific protein binding cause about a 3-fold decline in AR promoter activity, indicating an overall positive regulatory function of this region. However, it is important to note that this element binds both Sp1 and ssPyrBF. Such a binding of both a double-strand DNA-binding protein (Sp1) and a single-strand binding protein (ssPyrBF) to the same sequence is expected to occur in a mutually exclusive manner; i.e. when Sp1 binds to the double-stranded state of the DNA, the ssPyrBF will be unable to interact and vice-versa. Although Sp1 is a known stimulatory protein, the regulatory direction of the ssPyrBF is undetermined. Preliminary results in our laboratory show that during the age-dependent decline in the hepatic expression of the AR gene, the ssPyrBF increases about 2-fold. Moreover, the liver nuclear extracts from aging rats are known to contain a markedly reduced level of Sp1 (45). These observations are consistent with a possible negative regulatory role of ssPyrBF in the AR promoter function.

Although the exact recognition and cleavage site of the S1 nuclease is unknown, it appears to recognize a number of conformations that distort the phosphodiester backbone. Long pur/pyr stretches generally produce such structural distortions (39). The S1 nuclease sensitivity data presented in this article suggest that the rAR pur/pyr element is sufficiently long to generate non-B DNA conformations. Structural models based on S1 digestion patterns and changes in superhelical density predict that long (>40 bp) pur/pyr elements can form H-DNA structures (38). Results of in vitro studies with the TFOs show that the pur/pyr element of rAR promoter is capable of forming (dG)2-dC triplex, which can potentially generate *H-form (37) configurations. If this is the only configuration, it would theoretically release a pyrimidine-rich, S1-sensitive strand. However, the in vitro results show that both of the DNA strands are susceptible to S1 attack. This observation may indicate that the distorted structures exist in conformational equilibrium, and attack on both strands can occur during the state of transition (37, 39). In addition, because of localized distortions of the phosphodiester backbone, a small portion of the triple-stranded structure may also be accessible to S1 recognition (39). Despite these considerations, it needs to be emphasized that at present, the in vivo existence of H form DNA is only inferential and the mechanism by which S1-sensitive DNA structures regulate gene transcription is unclear. In this context, a recent report on the characterization of the pur/pyr domain of the chicken malic enzyme gene promoter (46) is highly relevant to the situation described in this paper for the AR gene promoter. These authors have also concluded that the pur/pyr domain of the malic enzyme gene promoter can form an intramolecular triplex structure, and that specific protein binding to the single-stranded pyrimidine stretches can play a negative regulatory role in gene transcription.

On the basis of the results presented in this paper and all of the above considerations, we propose a model to further explain the role of specific protein-DNA interaction at the pur/pyr element in the overall regulation of the AR gene. Schematically depicted in Fig. 11Go, the model is centered on the possibility that within the cell the rAR pur/pyr element is capable of existing in alternative structure forms, i.e. normal double-stranded B-DNA and an intramolecular triplex (H form). Among the two H forms, the pur-pur-pyr form is expected to be thermodynamically more stable at the physiological pH. Binding of Sp1 to this site will only be possible when the pur/pyr element is in the B-DNA form. In both of the H forms, but to a much greater extent in the pur-pur-pyr form, the single-stranded pyr will be exposed, thus providing a target for the binding of ssPyrBF. This specific ssPyrBF-DNA interaction, therefore, would tend to stabilize the intramolecular triplex H form structure preventing the Sp1 binding and its accumulation to the nearest supply source for the GC box, thereby indirectly interfering with the transcriptional initiation. Thus, the ratio of Sp1 to ssPyrBF could provide an additional control in the regulated expression of the AR gene. Such a regulatory step may also be operative in other TATA-less genes with a long pur/pyr element near the GC box site.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 11. A Model for Transcriptional Control at the AR Homopurine/Homopyrimidine Element

The essence of the model is that the conformational structure of the pur/pyr element can alternate between a B-DNA double-stranded form and two H forms involving intramolecular triple helices. In contrast to (C*GC) pyr-pur-pyr, the pur-pur-pyr (G*GC) structure can form stable Hoogsteen hydrogen bond (*) at the physiological pH and, therefore, is the preferred conformation (37, 39). The two DNA-binding proteins (Sp1 and ssPyrBF) specific for this element can only bind to particular structures. When the pur/pyr element is in double-stranded conformation, Sp1 can interact and accumulate at the pur/pyr site providing a readily available source for the GC box located immediately downstream. This situation will enhance transcription. When the element is in a pur-pur-pyr H form structure, the binding of the single strand pyrimidine-specific factor (ssPyrBF) can stabilize the triple-helical conformation, thereby preventing the binding of Sp1 and removing the nearby supply source of this transcription factor for the functional GC box. Varying ratios of ssPyrBF to Sp1 could potentially play a role in the differential regulation of the AR gene.

 

    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid DNAs and Oligonucleotides
For all plasmid constructions, standard recombinant DNA technologies were used. For the S1 sensitivity analyses, plasmid pAR was constructed by subcloning the rAR gene fragment from -1040 to +22 bp into the pGL-2 vector (Promega, Madison, WI). Three promoter-reporter plasmids were constructed for transfection experiments. For the wild type control, a fragment spanning -1040 to +555 bp of the rAR gene was inserted into the luciferase-containing vector pGL2 to create the plasmid pWtAR-Luc. Two mutant plasmids were generated from this construct by 1) deleting a 50-bp region spanning the pur/pyr element from -140 to -91 to give pDelAR-Luc; and 2) replacing the same 50-bp region with the GT-rich oligonucleotide 5'CTCGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTCG3' (GT insert) to give pMutAR-Luc. All constructs were confirmed by DNA sequencing. All oligonucleotides used in this study were synthesized by Midland Company (Midland, TX). After synthesis and deprotection, the oligonucleotides were purified through 16% denaturing polyacrylamide gels. Base-substituted TFOs were designed to form G:GC triplets (19). Double-stranded oligonucleotides were synthesized as two complementary oligonucleotides containing HindIII and SmaI sites at their 5'-ends. The oligonucleotides were subcloned into the HindIII and SmaI sites of the Bluescript vector (Stratagene, La Jolla, CA), and the resulting plasmid was confirmed by DNA sequencing.

S1 Nuclease Sensitivity Assay
S1 digestion of the supercoiled plasmid DNA was performed as described elsewhere (20). Briefly, DNA at a concentration of 0.1 µg/ml was digested in 30 mM sodium acetate (pH 4.5), 300 mM NaCl, 0.2 mM EDTA, 3 mM ZnCl2 with 5 U of S1 nuclease per µg of DNA at 42 C for 20 min. S1-nicked plasmid DNA was then digested with PstI and XbaI and electrophoresed on 1.5% agarose gels. For fine mapping, the nicked plasmid DNA was digested with XbaI, end-labeled with [{gamma}-32P] ATP and T4 polynucleotide kinase or [{alpha}-32P] dCTP and the Klenow fragment of DNA polymerase I at the 5'- or 3'-ends, respectively. The labeled DNA was then digested with PstI and purified through a 1% agarose gel. Samples were analyzed on 6% polyacrylamide-8 M urea sequencing gels along with DNA-sequencing ladder markers.

Preparation of Nuclear Extracts
Nuclear extracts from the rat tissues were prepared using the procedure of Hattori et al. (47). Briefly, the tissue homogenate was centrifuged through a 2.2 M sucrose cushion to obtain the purified nuclear pellet. Resuspended nuclei were lysed in a buffer containing 10% glycerol, 10 mM HEPES, pH 7.6, 100 mM KCl, 3 mM MgCl2, 0.1 mM EDTA, and 1 mM dithiothreitol (DTT), and the nuclear proteins were extracted in the presence of 0.4 M ammonium sulfate. Extracts were fractionated by ammonium sulfate precipitation (0.33 g/ml), and precipitated nuclear proteins were extensively dialyzed in 20 mM HEPES, pH 7.6, 100 mM KCl, 0.2 mM EDTA, 2 mM DTT, and 1 mM NaMoO4. The dialysate was clarified by centrifugation and flash-frozen in liquid nitrogen. Nuclear extracts from HeLa, Jurkat, PC3, COS1, PA III, and CHO cells were prepared using the methods of Dignam et al. (48). All buffers contained 2 µg/ml each of aprotinin, leupeptin, bestatin, 0.1 mM phenylmethylsulfonylfluoride, and 1 mM DTT, which were added just before use. All manipulations were performed at 4 C. Protein concentrations were determined using the Bradford assay (49).

DNA Protein-Binding Assay (Electrophoretic Mobility Shift Assay and DNase I Footprinting)
For the single-stranded probe, oligonucleotides containing the single-stranded purine- or pyrimidine-rich region of the rAR gene from -123 to -91 bp (Table 1Go) were radiolabeled at the 5'-end. Unincorporated radiolabel was removed by ethanol precipitation of the oligonucleotides. The double-stranded pur/pyr probe (-123 to -91) was released from the Bluescript vector by digestion with HindIII and radiolabeled at the 3'-end. After Smal digestion, the 33-bp fragment was gel purified and used in both DNA protein and triplex band shift analyses. Nuclear extracts (2–10 µg) were preincubated in 20-µl reactions containing 10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM EDTA, 5% glycerol, 2 µg of poly(deoxyinosinic-deoxycytidylic acid), and 1–2 µg of low mol wt salmon sperm DNA. After 5 min at room temperature, radiolabeled probes (30,000 cpm) were added, and the incubation was continued for another 20 min (9). No significant difference in protein binding to either single- or double-stranded pur/pyr probes by nuclear extracts derived from either the rodent (young-adult rat liver) or the human (HeLa cells) source was observed. These two nuclear extracts have, therefore, been used interchangeably in various experiments as described. For competition binding reactions, the unlabeled competitor in 100-fold molar excess of the labeled probe was included in the reaction. After incubation, the reaction mixtures were loaded onto a 5% native polyacrylamide gel in 0.5x Tris-boric acid-EDTA (TBE), electrophoresed, dried, and exposed to x-ray film (X-OMAT, Eastman-Kodak, Rochester, NY) (9). Electrophoretic mobility shift assays for Sp1 were performed with 0.1 U of recombinant purified human Sp1 (Promega) without any nonspecific competitor DNA. Antibody supershift experiments were performed with specific Sp1 antibody, which does not cross-react with Sp2/Sp3/Sp4 (Santa Cruz Biotech, CA). This antibody was added to the nuclear extract 10 min before the addition of the radiolabeled probe. For DNase I footprinting, a radiolabeled 297-bp DNA fragment was generated by PCR using a plasmid template and two primers (unlabeled primer at -283 and 5'-radiolabeled primer at +14). The end-labeled PCR fragment was gel purified and incubated with either the rat liver nuclear extract (50 µg) or recombinant Sp1 protein (2 U and 8 U) in the reaction mixture as described above. After mild DNase I digestion, DNA fragments were analyzed on a 6% polyacrylamide-sequencing gel containing 8 M urea.

Gel Mobility Shift Analysis of Triplex Formation
The labeled target double-stranded DNA probe (100–200 fmol) containing the pur/pyr region of the rAR gene (-123 to -91) was incubated with increasing concentrations of the single-stranded oligonucleotides in a buffer consisting of 10 mM Tris-HCl, pH 7.4, 10% sucrose, 5 mM MgCl2, and 1 mM spermine. The incubation was at 37 C for 60 min. The samples were electrophoresed through a 10% polyacrylamide gel in 89 mM Tris, 89 mM boric acid, 5 mM MgCl2. The gels were then dried and autoradiographed.

Triplex-Mediated DNase I Footprinting
Probes were generated by digesting plasmid pAR with XbaI. The purine-rich upper strand was labeled at the 3'-end by end-filling with the Klenow fragment of DNA polymerase I. After a second digestion with PstI, the 536-bp double-stranded probes (-513 to +22) were purified on a 5% nondenaturing polyacrylamide gel. The labeled 536-bp duplex DNA fragment was incubated with a 50-fold molar excess of single-stranded oligonucleotides in a buffer containing 10 mM MgCl2, 10% sucrose, and 10 mM Tris-HCl at pH 7.4 for 60 min at 37 C. DNase I was added at 0.125 U/ml, and the incubation was continued for 10 min. Reactions were stopped by the addition of 15 mM EDTA and calf thymus DNA to 0.2 mg/ml (21). The products were then resolved on a 6% denaturing polyacrylamide gel.

DNA Transfection and Enzyme Assay
Different cell lines used in this study were obtained from ATCC and grown in DMEM-Hank’s F-12 medium (1:1 vol/vol) containing 10% FBS. T25 flasks were seeded with 0.5 to 1 x 106 cells and cultured overnight before transfection. Three AR promoter-containing reporter plasmids (10 µg) were transfected into cells by the calcium-phosphate-DNA coprecipitation method, and cells were harvested 24 h post transfection. The cell extracts were assayed for luciferase activity (50), and light emission was quantified in a Bio-Oribit 1250 luminometer (Pharmacia-LKB, Gaithersburg, MD). Protein concentrations of cell extracts were measured using the Bradford assay, and transfection results were computed as luciferase activities per mg of total protein.


    ACKNOWLEDGMENTS
 
We thank Dr. Gary Felsenfeld for valuable comments on the first draft of this article. Dedicated technical assistance from Miss Tina Hassan and secretarial help from Mrs. Katrine Krueger and Nyra White are greatly appreciated.


    FOOTNOTES
 
Address requests for reprints to: Arun K. Roy, Ph.D., Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, Texas.

This investigation was supported by NIH Grants R37 DK-14744 and R01 AG-10486. S.C. is an NIH Predoctoral Trainee (T32 AG00165), and A.K.R. is recipient of an NIH MERIT award.

Received for publication September 9, 1996. Accepted for publication October 10, 1996.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  2. Mangelsdorf D, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  3. Quigley CA, De Bellis A, Marschke KB, El-Awady MK, Wilson EM, French FS 1995 Androgen receptor defects: historical, clinical, and molecular perspectives. Endocr Rev 16:271–289[CrossRef][Medline]
  4. Visakorpi T, Hyytinen E, Koivisto P, Tanner M, Keinanan R, Palmberg C, Polotie A, Tammela T, Isola J, Kallioniemi OP 1995 In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat Genet 9:401–406[CrossRef][Medline]
  5. Taplin ME, Bubley GJ, Shuster TD, Frantz ME, Spooner AE, Ogata GK, Keer HN, Balk SP 1995 Mutation of the androgen receptor gene in metastatic androgen-independent prostate cancer. N Engl J Med 332:1393–1398[Abstract/Free Full Text]
  6. Wilson JD 1995 The promiscuous receptor. Prostate cancer comes of age. N Engl J Med 332:1440–1441[Free Full Text]
  7. Prins GS, Jung MH, Vellanoweth RL, Chatterjee B, Roy AK 1996 Age-dependent expression of the androgen receptor gene in the prostate and its implication in glandular differentiation and hyperplasia. Dev Genet 18:99–106[CrossRef][Medline]
  8. Sar M, Lubahn DB, French FS, Wilson EM 1990 Immunohistochemical localization of the androgen receptor in rat and human tissues. Endocrinology 127:3180–3186[Abstract]
  9. Supakar PC, Song CS, Jung MH, Slomczynska MA, Kim JM, Vellanoweth RL, Chatterjee B, Roy AK 1993 A novel regulatory element associated with age-dependent expression of the rat androgen receptor gene. J Biol Chem 268:26400–26408[Abstract/Free Full Text]
  10. Roy AK, Chatterjee B 1995 Androgen action. Crit Rev Euk Gene Expr 5:157–176[Medline]
  11. Supakar PC, Jung MH, Song CS, Chatterjee B, Roy AK 1995 Nuclear factor kB functions as a negative regulator for the rat androgen receptor gene and NF-kB activity increases during the age-dependent desensitization of the liver. J Biol Chem 270:837–842[Abstract/Free Full Text]
  12. Tilley WD, Marcelli M, McPhaul MJ 1990 Expression of the human androgen receptor gene utilizes a common promoter in diverse human tissues and cell lines. J Biol Chem 265:13776–13781[Abstract/Free Full Text]
  13. Song CS, Her S, Slomczynska M, Choi SJ, Jung MH, Roy AK, Chatterjee B 1993 A distal activation domain is critical in the regulation of the rat androgen receptor gene promoter. Biochem J 294:779–784
  14. Faber PW, van Rooij HJ, Schipper HJ, Brinkmann AO, Trapman J 1993 Two different, overlapping pathways of transcription initiation are active on the TATA-less human androgen receptor promoter. J Biol Chem 268:9296–9301[Abstract/Free Full Text]
  15. Mizokami A, Yeh SY, Chang CS 1994 Identification of 3',5'-cyclic adenosine monophosphate response element and other cis-acting elements in the human androgen receptor gene promoter. Mol Endocrinol 8:77–88[Abstract]
  16. Kumar MV, Jones EA, Grossmann ME, Blexrud MD, Tindall DJ 1994 Identification and characterization of a suppressor element in the 5'-flanking region of the mouse androgen receptor gene. Nucleic Acids Res 22:3693–3698[Abstract/Free Full Text]
  17. Grossmann ME, Tindall DJ 1995 The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA. J Biol Chem 270:10968–10975[Abstract/Free Full Text]
  18. Gumucio DL, Shelton DA, Bailey WJ, Slightom JL, Goodman M 1993 Phylogenetic footprinting reveals unexpected complexity in trans factor binding upstream from the epsilon-globin gene. Proc Natl Acad Sci USA 90:6018–6022[Abstract/Free Full Text]
  19. Durland RH, Kesseler DJ, Gunnell S, Duvic M, Pettitt BM, Hogan ME 1991 Binding of triple helix forming oligonucleotides to sites in gene promoters. Biochemistry 30:9246–9255[CrossRef][Medline]
  20. Johnson A, Jinno Y, Merlino GT 1988 Modulation of epidermal growth factor receptor proto-oncogene transcription by a promoter site sensitive to S1 nuclease. Mol Cell Biol 8:4174–4184[Abstract/Free Full Text]
  21. Cooney M, Czernuszewicz G, Postel EH, Flint SJ, Hogan ME 1988 Site-specific oligonucleotide binding represses transcription of the human c-myc gene in vitro. Science 241:456–459[Abstract/Free Full Text]
  22. Hoffman EK, Trusko SP, Murphy M, George DL 1990 An S1 nuclease-sensitive homopurine/homopyrimidine domain in the c-Ki-ras promoter interacts with a nuclear factor. Proc Natl Acad Sci USA 87:2705–2709[Abstract/Free Full Text]
  23. Grigoriev M, Parseuth D, Guieysse AL, Robin P, Thuong NT, Helene D, Harel-Bellan A 1993 Inhibition of triple helix-directed DNA cross-linking at specific sites. Proc Natl Acad Sci USA 90:3501–3505[Abstract/Free Full Text]
  24. Wang ZY, Lin XH, Nobuyoshi M, Deuel TF 1993 Identification of a single-stranded DNA-binding protein that interacts with an S1 nuclease-sensitive region in the platelet-derived growth factor A-chain gene promoter. J Biol Chem 268:10681–10685[Abstract/Free Full Text]
  25. Hollingsworth M, Closken C, Harris A, McDonald CD, Pahwa GS, Maher, III LJ 1994 A nuclear factor that binds purine-rich, single-stranded oligonucleotides derived from S1-sensitive elements upstream of the CFTR gene and the MUC1 gene. Nucleic Acids Res 22:1138–1146[Abstract/Free Full Text]
  26. Pugh BF, Tjian R 1991 Transcription from TATA-less promoter requires a multisubunit TFIID complex. Genes Dev 5:1935–1945[Abstract/Free Full Text]
  27. Genersch E, Eckerskorn C, Lottespeich F, Herzog C, Kuhn K, Poschl E 1995 Purification of the sequence-specific transcription factor CTCBF involved in the control of human collagen IV genes: subunits with homology to Ku antigen. EMBO J 14:791–800[Medline]
  28. Wang ZY, Deuel TF 1992 An S1 sensitive homopurine/homopyrimidine domain in the PDGF A-chain promoter contains a novel binding site for the growth factor-inducible protein EGR-1. Biochem Biophys Res Commun 188:433–439[CrossRef][Medline]
  29. Hagen G, Dennig J, Preib A, Beato M, Suske G 1995 Functional analyses of the transcription factor Sp4 reveal properties distinct from Sp1 and Sp3. J Biol Chem 270:24989–24994[Abstract/Free Full Text]
  30. Baarends WM, Themmen APN, Blok LJ, Mackenbach P, Brinkmann AO, Meijer D, Faber PW, Trapman J, Grootegoed JA 1990 The rat androgen receptor gene promoter. Mol Cell Endocrinol 74:75–84[CrossRef][Medline]
  31. Yu YT, Manley JL 1986 Structure and function of the S1 nuclease-sensitive site in the adenovirus late promoter. Cell 45:743–751[CrossRef][Medline]
  32. Boles TC, Hogan ME 1987 DNA structure equilibria in the human c-myc gene. Biochemistry 26:367–376[CrossRef][Medline]
  33. Ing NH, Beekman JM, Kessler DJ, Murphy M, Jayaraman K, Zendergui JG, Hogan ME, O’Malley BW, Tsai MJ 1993 In vivo transcription of a progesterone-responsive gene is specifically inhibited by a triplex-forming oligonucleotide. Nucleic Acids Res 21:2789–2796[Abstract/Free Full Text]
  34. Mayfield C, Miller D 1994 Effect of a basic linker substitution on triplex formation, Sp1 binding, and specificity in an oligonucleotide targeted to the human Ha-ras promoter. Nucleic Acids Res 22:1909–1916[Abstract/Free Full Text]
  35. Wang ZY, Lin XH, Nobuyoshi M, Qiu QQ, Deuel TF 1992 Binding of single-stranded oligonucleotides to a non-B-form DNA structure results in loss of promoter activity of the platelet-derived growth factor A-chain gene. J Biol Chem 267:13669–13674[Abstract/Free Full Text]
  36. Grigoriev M, Parseuth D, Robin P, Hemar A, Saison-Behmoaras T, Dautry-Varsat A, Thuong NT, Helene C, Harel-Bellan A 1992 A triple helix-forming oligonucleotide-intercalator conjugate acts as a transcriptional repressor via inhibition of NF kappa B binding to interleukin-2 receptor alpha-regulatory sequence. J Biol Chem 267:3389–3395[Abstract/Free Full Text]
  37. Frank-Kamenetskii MD, Mirkin SM 1995 Triplex DNA structures. Annu Rev Biochem 64:65–95[Medline]
  38. Lyamichev VI, Mirkin SM, Frank-Kamenetskii MD 1986 Structures of homopurine-homopyrimidine tract in superhelical DNA. J Biomol Struct Dyn 3:667–669[Medline]
  39. Wells RD, Collier DA, Hanvey JC, Shimizu M, Wohlrab F 1988 The chemistry and biology of unusual DNA structures adopted by oligopurine, oligopyrimidine sequences. FASEB J 2:2939–2949[Abstract]
  40. Fox KR 1994 Formation of DNA triple helices incorporating blocks of G.GC and T.AT triplets using short acridine-linked oligonucleotides. Nucleic Acids Res 22:2016–2021[Abstract/Free Full Text]
  41. Mayfield C, Ebbinghaus S, Gee J, Jones D, Rodu B, Squibb M, Miller D 1994 Triplex formation by the human Ha-ras promoter inhibits Sp1 binding and in vitro transcription. J Biol Chem 269:18232–18238[Abstract/Free Full Text]
  42. Lafyatis R, Denhez F, Williams T, Sporn M, Roberts A 1991 Sequence specific protein binding to and activation of the TGFß3 promoter through a repeated TCCC motif. Nucleic Acids Res 23:6419–6425
  43. Azizkhan JC, Jensen DE, Pierce AJ, Wade M 1993 Transcription from TATA-less promoters: dihydrofolate reductase as a model. Crit Rev Euk Gene Exp 3:229–254[Medline]
  44. Su W, Jackson S, Tjian R, Echols H 1991 DNA looping between sites for transcriptional activation: self-association of DNA-bound Sp1. Genes Dev 5:820–826[Abstract/Free Full Text]
  45. Ammendola R, Mesuraca M, Russo T, Cimino F 1992 Sp1 DNA binding efficiency is highly reduced in nuclear extracts from aged rat tissue. J Biol Chem 267:17944–17948[Abstract/Free Full Text]
  46. Xu G, Goodridge AG 1996 Characterization of a polypyrimidine/polypurine tract in the promoter of the gene for chicken malic enzyme. J Biol Chem 271:16008–16019[Abstract/Free Full Text]
  47. Hattori M, Tugores A, Veloz L, Karin M, Brenner DA 1990 A simplified method for the preparation of transcriptionally active liver nuclear extracts. DNA Cell Biol 9:777–781[Medline]
  48. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  49. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  50. De Wet JR, Wood KV, DeLuca M, Helinski DR, Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells. Mol Cell Biol 7:725–737[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
D. Sun, K. Guo, J. J. Rusche, and L. H. Hurley
Facilitation of a structural transition in the polypurine/polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G-quadruplex-interactive agents
Nucleic Acids Res., October 20, 2005; 33(18): 6070 - 6080.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Chen, A. Unterbrink, S. Kadapakkam, J. Dong, T. T. Gu, J. Dickson, H.-H. Chuang, and M. MacDougall
Regulation of the Cell Type-specific Dentin Sialophosphoprotein Gene Expression in Mouse Odontoblasts by a Novel Transcription Repressor and an Activator CCAAT-binding Factor
J. Biol. Chem., October 1, 2004; 279(40): 42182 - 42191.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. K. Lee and C. Chang
Expression and Degradation of Androgen Receptor: Mechanism and Clinical Implication
J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4043 - 4054.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
O. C. Farokhzad, J. M. Teodoridis, H. Park, M. A. Arnaout, and C. S. Shelley
CD43 gene expression is mediated by a nuclear factor which binds pyrimidine-rich single-stranded DNA
Nucleic Acids Res., June 1, 2000; 28(11): 2256 - 2267.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. D. Nelson, M. Musso, and M. W. Van Dyke
The Yeast STM1 Gene Encodes a Purine Motif Triple Helical DNA-binding Protein
J. Biol. Chem., February 25, 2000; 275(8): 5573 - 5581.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. S. Song, M. H. Jung, P. C. Supakar, B. Chatterjee, and A. K. Roy
Negative Regulation of the Androgen Receptor Gene Promoter by NFI and an Adjacently Located Multiprotein-Binding Site
Mol. Endocrinol., September 1, 1999; 13(9): 1487 - 1496.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
K. Zahedi, J. J. Bissler, A. E. Prada, J. A. Prada, and A. E. Davis III
The Promoter of the C1 Inhibitor Gene Contains a Polypurine{middle dot}Polypyrimidine Segment that Enhances Transcriptional Activity
J. Immunol., June 15, 1999; 162(12): 7249 - 7255.
[Abstract]