help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gong, W.
Right arrow Articles by Beato, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gong, W.
Right arrow Articles by Beato, M.
Molecular Endocrinology 11 (10): 1476-1485
Copyright © 1997 by The Endocrine Society

Point Mutation in the Ligand-Binding Domain of the Progesterone Receptor Generates a Transdominant Negative Phenotype

Wenrong Gong, Sebastián Chávez1 and Miguel Beato

Institut für Molekularbiologie und Tumorforschung, Philipps Universität, D-35037 Marburg, Germany


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A short conserved {alpha}-helix in the carboxyl-terminal activation function of the ligand-binding domain of steroid hormone receptors, called AF2, is important for ligand-dependent transactivation of inducible genes. We have generated two AF2 mutants of the B isoform of human progesterone receptor (PRB): a point mutant, PRBE911A, and a short deletion, PRB{Delta}907–913R. The two mutants are expressed at levels comparable to the wild type receptor in transfected cells. The PRBE911A mutant showed similar hormone- and DNA- binding affinities as the wild type receptor, whereas the PRB{Delta}907–913R mutant was defective in hormone and DNA binding. Both mutants were inactive when transiently transfected in CV-1 cells, which do not express endogenous PR. However, the point mutant, but not the deletion mutant, inhibited transactivation by cotransfected wild type PRB in a hormone-dependent fashion. The activity of endogenous PR in T47D cells or of endogenous glucocorticoid receptor in HeLa cells was also inhibited by the PRBE911A, but not by the deletion mutant. The point mutant was less active when introduced into an N-terminal truncated form of PR, where it gave rise to proteins that formed homodimers with poor affinity for DNA, but were able to form heterodimers with PRB. The negative dominant phenotype of the PRBE911A mutant likely originates from competition with wild type receptors for binding to DNA and will be useful for mechanistic studies of receptor function.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The progesterone receptor (PR) is a ligand-activated member of the superfamily of nuclear receptors and shares their characteristic modular structure with an N-terminal transactivation domain, a highly conserved DNA-binding domain, and a C-terminal ligand-binding domain (1). Two different isoforms of PR, namely PRA and PRB (Fig. 1AGo), were originally identified in chick oviduct (2) and have since been found in most progesterone-responsive cells (3, 4). Both isoforms differ only in their N-termini, PRB extending 164 amino acids further than PRA, and are synthesized from the same gene using two different promoters (5). Within the N-terminal domain, in addition to the constitutive activation function 1 (AF1) common to both isoforms (6), another transactivation function has been postulated in the region unique to the B isoform (7). It has been reported that, in most cells examined, the B isoform is a stronger activator of transcription than the A isoform and that in some cells PRA functions as a transcriptional inhibitor of PRB and other steroid hormone receptors (8). However, in some contexts PRA is a stronger activator than PRB (9, 10), and the physiological function of both isoforms is not known.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 1. Structure of PR Isoforms and Mutants

A, The domain structure of PR is indicated, in particular the DNA binding domain, DBD, and the ligand binding domain, LBD. The position of the activation functions AF1 and AF2 is also indicated. The numbers refer to amino acid positions in the wild type PRB isoform. B, Comparison of the amino acid sequence of the AF2 in various nuclear receptors. The seven amino acids replaced by alanine in PR{Delta}907–913R are indicated at the top. The glutamate residue at 911 is marked by an asterisk. Two pairs of conserved hydrophobic residues are boxed.

 
The C-terminal domain of PR is involved not only in ligand binding but also in interactions with heat shock proteins, in nuclear translocation, in dimerization, and in ligand-dependent transactivation (3). This latter function is mediated by a short core sequence, AF2, highly conserved among nuclear receptors (Fig. 1BGo) (11). The crystal structure of the unliganded retinoic acid X receptor (RXR{alpha}) (12) and of the liganded retinoic acid A receptor (RAR{gamma}) (13) suggests that the amphipathic helix within AF2 participates in structural changes induced by ligand binding, leading to the exposure of amino acid residues for interaction with transcriptional coactivators (14, 15, 16). Mutations in the AF2 region of various steroid hormone receptors can destroy its transactivation function, with or without influencing ligand binding (10, 17, 18). More interestingly, several mutations in the estrogen receptors’ AF2 act as dominant negative mutants, e.g. the mutated receptors interfere dominantly with the activity of the wild type estrogen receptors (19, 20). A carboxyl-terminal deleted form of glucocorticoid receptor, called GRß, has also been claimed to exhibit a transdominant negative phenotype (21, 22, 23).

We wanted to know whether mutations in the AF-2 region of PR also lead to a dominant negative phenotype that could be useful in defining functions of the unliganded receptor. For this reason, we decided to substitute the negatively charged glutamic acid at position 911 of the human PRB, which is conserved in virtually all the nuclear receptors (11), by the neutral residue alanine to generate PRBE911A (Fig. 1Go). This position had already been mutated in a previous study, but in combination with a similar mutation of glutamic acid 907 and not as single point mutant (10). Moreover, the dominant behavior of this PRB double mutant has not been reported. In addition to the point mutant, we also constructed a mutant PRB{Delta}907–913R (Fig. 1Go). In contrast to the deletion mutant, the point mutant PRBE911A binds ligand and DNA with apparently normal affinities, but both mutants had lost their ligand-dependent activation function in CV-1 cells. However, upon binding, ligand PRBE911A, but not PRB{Delta}907–913R, inhibited the activity not only of wild type PR and glucocorticoid receptor (GR) in cotransfected CV-1 cells, but also of the endogenous PR in T47D cells, and of the endogenous GR in HeLa cells. The mechanism of this inhibition is discussed based on in vitro DNA binding experiments.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PRBE911A and PRB{Delta}907–913R Are Activation Defective in CV-1 Cells
The transactivation function of the point mutant PRBE911A and the short deletion mutant PRB{Delta}907–913R, in which seven amino acids within the amphipathic helix in AF2 were substituted by an arginine, were tested in transient transfection assays in CV-1 cells, which lack steroid hormone receptors. While the wild type human PRB activated a reporter plasmid containing two progesterone responsive elements (PREs) in a ligand-dependent manner, no significant activation was observed with the short deletion mutant PRB{Delta}907–913R, and a very weak activation was found with the point mutant PRBE911A (Fig. 2Go). In the same assay the PRA isoform showed a significant activation, twice that found with PRBE911A but much lower than the activation by the PRB isoform (Fig. 2Go). The truncated form PR3, which lacks amino acids 1 to 550 (Fig. 1Go A), exhibited higher transactivation, about two third of the value observed with PRB, but the point mutation in the background of this shorter receptor, PR3E911A, was virtually inactive. We found no agonistic activity of the antiprogestin RU486 with any of the constructs tested (Fig. 2Go). Moreover, we observed no transactivation in the absence of ligand with any of the receptor expression vectors, suggesting that in our assay we are measuring exclusively activity dependent on ligand binding and likely requiring the activation function AF2.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 2. Transactivation Properties of PR Isoforms and Mutants

The transactivation function was tested in CV-1 cells transfected with the reporter gene pTGT2.2cat and the indicated expression vectors using the calcium phosphate precipitation method (50). The figure shows the CAT activity in arbitrary units (see Materials and Methods) as mean value and SD calculated from six determinations.

 
PRBE911A Binds Hormone and PRE with Similar Affinity as Wild Type PR
The lack of significant hormone-dependent activation by the two receptor mutants could reflect either a lack of affinity for the hormone ligand or a defective interaction of the liganded receptor mutants with the PREs. We have used nuclear extracts from Cos-7 cells transiently transfected with expression vectors for PRB, PRA, PRBE911A, PRAE911A, PR3E911A, or PRB{Delta}907–913R, to determine the hormone- and DNA-binding ability of the different receptor variants and mutants. The levels of expression of the various proteins were similar, as judged by Western blotting (Fig. 3AGo). [3H]ORG2058 was used as synthetic progestin in hormone-binding tests with dextran-coated charcoal, and the results were analyzed using Scatchard plots (24). As the ligand-binding behavior of AF2 mutants is similar in the PRB and in the PRA background (10), we have tested only the steroid-binding affinity of the mutations in the PRB background. The point mutant PRBE911A exhibited the same ligand affinity as the wild type PRB (Fig. 3BGo). The apparent disassociation constants were 1.02 nM for wild type PRB and 0.98 nM for PRBE911A. The deletion mutant PRB{Delta}907–913R did not show specific ligand binding (data not shown). Thus, the lack of activation by PRBE911A is not due to a reduced affinity for the agonistic ligand, while this could be the reason for the inactivity of the deletion mutant PRB{Delta}907–913R.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 3. Properties of the PR Variants and Mutants

A, Expression of various PR isoforms and mutants in Cos-7 cells. The figure shows a Western blot performed with the PR (C-19) antibody, which recognizes the C-terminal end of PR present in all the expressed proteins. Cells transfected with the empty pSG5 vector did not exhibit specific immunoreactive bands. Recombinant PRB purified from baculovirus and a T47D nuclear extract were used as positive controls. The molecular weights of PRB, PRA, and PR3 are indicated on the right margin. B, Scatchard analysis of [3H]ORG2058 binding to PRB and PRBE911A (see Materials and Methods for details). C, DNA- binding activity of the PR isoforms and mutants. Nuclear extracts from Cos-7 cells transfected with expression vectors for the indicated receptor variants and mutants were incubated with a 32P-labeled PRE oligonucleotide. The figure shows an autoradiogram of the retarded protein-DNA complexes separated from free DNA by electrophoresis on an 8% polyacrylamide gel. Recombinant PRB purified from baculovirus was used as positive control. The band at the top represents aggregated material present in the preparation of purified PRB.

 
To measure the affinity of wild type and mutant receptors for DNA we used a 32P-labeled double-stranded oligonucleotide encompassing a complete palindromic PRE in electrophoretic mobility shift assays (25). The wild type PRB and PRA isoforms exhibited similar affinities for the PRE oligonucleotide (Fig. 3CGo). The truncated PR3 form showed reduced DNA binding (Fig. 3CGo, lane 5), probably reflecting formation of less stable dimers (see below). The PRB{Delta}907–913R mutant did not bind to the PRE oligonucleotide in band shift experiments (Fig. 3CGo). We tested the E911A mutation in the background of PRB, PRA and in the truncated form PR3. In all these backgrounds, the DNA- binding activity of the point mutant was comparable to the cognate wild type receptor isoform (Fig. 3CGo, compare lanes 2, 4, and 6 with lanes 1, 3, and 5, respectively), suggesting that the lack of transactivation by this mutant is not due to a defect in DNA recognition. It is, therefore, likely that the point mutation affects steps in the transactivation process distal to the ligand- and DNA-binding events.

PRBE911A Is a Strong Repressor of Wild Type PR Activity
To test the influence of the receptor mutants on the activity of wild type PR, we have used transient cotransfection assays in CV-1 cells. Different amounts of PRBE911A or PRB{Delta}907–913R were cotransfected with 1 µg of a human (h)PRB expression vector along with the reporter gene containing two PREs. As shown in Fig. 4Go, suppression of hPRB function increases with the amount of transfected PRBE911A. When equal amounts of wild type and PRBE911A were transfected, the activity of the wild type PRB was reduced to 60% of the values found in the absence of cotransfected mutant PR. With a 5-fold excess of the PRBE911A, the activity of hPRB was diminished to 25% of the controls. A similar excess of PRB{Delta}907–913R had no significant effect on the activity of the wild type PRB (Fig. 4Go). Thus the point mutant is able to repress the transactivation function of transiently expressed PRB.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Transdominant Negative Effect on Cotransfected PRB

Inhibition of wild type PRB by receptor variants and mutants cotransfected in CV-1 cells along with a reporter gene containing two PREs. CV-1 cells were transfected with 1 µg of the expression plasmid for wild type PRB, 3 µg of the reporter pTGT2.2cat, and 1 µg of the internal reference plasmid pRSV-ßGal. In addition, the indicated amounts of expression vectors for receptor variants and mutants were cotransfected. The relative CAT activity measured in the corresponding cell extracts is expressed as percentage of the activation found when only PRB and no other receptor construct was transfected. The figure shows the mean value and the SD of six determinations after normalization for protein content and ß-galactosidase activity.

 
To test the effect of receptor mutants on endogenous PR, transfection experiments were performed with the human breast cancer cell line T47D, which contains a high amount of PR (26). Transfection of PRBE911A, PRB{Delta}907–913R, or any other of the variants tested had little effect on the activity of the reporter in the absence of hormone. After treatment with the agonist R5020, a strong induction was found in the absence of transfected PR mutants due to the activity of the endogenous PR (Fig. 5Go). A progressive inhibition of the endogenous PR was observed with increasing amounts of transfected PRBE911A, whereas PRB{Delta}907–913R had no effect at the highest concentration tested (Fig. 5Go). As little as 0.5 µg of the PRBE911A expression vector led to a reduction of the R5020 induction to less than 60% of control values, and 2.5 µg of mutant DNA repressed activation by the endogenous PR to 27% of the controls. In parallel we tested the dominant negative activity of hPRA, which is known to inhibit the function of PRB in certain contexts (8). We found that hPRA showed similar repressive effects as PRBE911A when 0.5 µg DNA was transfected, whereas the inhibitory effect of PRA was weaker than that of PRBE911A with 2.5 µg transfected DNA (Fig. 5Go). When the point mutant was introduced into the PRA background, the inhibitory effect was similar to that found in the PRB background and stronger than the effect of PRA with high concentration of transfected DNA. Thus, the point mutant was at least as active as the PRA in repressing the function of endogenous PR. On the other hand, the inhibitory effect of the point mutation in E911A was markedly reduced in the background of the truncated PR3 receptor variant. The maximal effect observed with PR3E911A was a reduction of the transactivation response to 44% of the controls (Fig. 5Go). This suggests that a region between amino acids 165 and 550 is required for the efficient repression of the wild type PR. A similar observation has been reported for dominant negative mutants of the estrogen receptor (27).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 5. Transdominant Negative Activity of Receptor Variants and Mutants on Endogenous PRB

T47D cells were transfected by the diethylaminoethyl (DEAE)-Dextran method (51) with the indicated amounts of the various isoforms and mutants of PR expression vectors along with the reporter plasmid pTGT2.2cat and the internal reference plasmid pRSV-ßGal. The relative CAT activity was measured as described in the legend to Fig. 4Go. The figure shows the mean and SD of six determinations.

 
PRBE911A Inhibits the Activity of Endogenous and Transfected Glucocorticoid Receptor
To test whether the inhibitory effect of PRBE911A is limited to wild type PR, we performed transfection experiments in HeLa cells, which contain significant levels of endogenous glucocorticoid receptor (GR). In these cells, PRBE911A, when activated by R5020, induced chloramphenicol acetyltransferase (CAT) activity from pTGT2.2.cat 2 to 3-fold in the absence of dexamethasone (Fig. 6Go), reflecting a residual activation that could be attributed to the AF1 in the N-terminal domain. Transfection of 0.5 µg and 2 µg of PRBE911A DNA decreased the dexamethasone-induced GR activity to 74.5% and 60%, respectively (Fig. 6Go). This effect was completely dependent on the addition of the PR-specific agonistic ligand R5020. In the absence of R5020, transfection of PRBE911A into HeLa cells does not influence the activity of GR. We also tested the effect of PRBE911A on the activity of GR transfected into CV1 cells (Fig. 7Go). The results show that, in the presence of the agonist ligand R5020, the point mutant of PR represses transfected GR with comparable efficiency as transfected PR (see Fig. 4Go). That means that the PR mutant is activated by its cognate ligand to accomplish its transdominant negative effect on GR induction.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 6. Inhibition of the Function of Endogenous GR in HeLa Cells by PRBE911A

HeLa cells were transfected by the calcium phosphate precipitation method with the pTGT2.2cat reporter gene and the indicated expression vectors for PR variants and treated with the indicated synthetic hormones. The figure shows the mean values and the SD of six determinations, after normalization for protein content and ß-galactosidase activity.

 


View larger version (31K):
[in this window]
[in a new window]
 
Figure 7. Transdominant Negative Effect on Cotransfected GR

Inhibition of wild type GR by receptor variants and mutants cotransfected in CV-1 cells along with a reporter gene containing two PREs. CV-1 cells were transfected with 0.5 µg of the expression plasmid for wild type GR (21), 3 µg of the reporter pTGT2.2cat, and 1 µg of the internal reference plasmid pRSV-ßGal. In addition, the indicated amounts of expression vectors for receptor variants and mutants were cotransfected. The relative CAT activity measured in the corresponding cell extracts is expressed as percentage of the activation found when only dexamethasone was added. The figure shows the mean value and the SD of two experiments performed in duplicate after normalization for protein content and ß-galactosidase activity.

 
PRBE911A also Inhibits Activation by Wild Type PR of Reporters Containing a Single PRE
Steroid hormone receptors are known to synergize on adjacent HREs (28, 29). Therefore, the transdominant negative phenotype of PRBE911A could be due to the inability of the mutant receptor to synergize with itself or with the wild type PR on a reporter containing two PREs. To test this possibility, we have examined the inhibitory effects of PRBE911A using the pTGT1.2cat reporter gene, which contains only one PRE in front of the tk-promoter. As shown in Fig. 7Go, PRBE911A inhibited activation of this reporter by the endogenous wild type PR of T47D cells in a concentration-dependent manner. However, the inhibitory effect was only 70% of that observed with the pTGT2.2cat, containing two adjacent PREs (Fig. 8Go). Thus, at least part of the transdominant negative effect of PRBE911A is due to mechanisms other than an inhibition of the synergism between adjacent PREs.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 8. Inhibition by PRBE911A of Transactivation on Reporters Containing a Single PRE or Two PREs

Comparison of the dominant negative activity of PRBE911A in T47D cells cotransfected with either pTGT2.2cat or pTGT1.2cat. For details see legend to Fig. 5Go.

 
The E911A Receptor Mutant Forms Heterodimers with Wild Type PR
Steroid hormone receptors, and in particular PR, bind to their target palindromic sequences as homodimers (30). One possible mechanism for the inhibitory effect of PRBE911A would be the formation of inactive heterodimers with wild type PR on target PREs. To test this possibility, we performed gel retardation experiments with nuclear extracts from Cos-7 cells transfected with wild type isoforms or mutant PR. To distinguish the heterodimers, we used the E911A mutation in the background of PRA or of the truncated form PR3 (31). When Cos-7 cells were transfected with expression vectors for PRB and PRA, the expected three retarded complexes were found (32) corresponding to PRB/PRB and PRA/PRA homodimers and to PRB/PRA heterodimers (Fig. 9Go, lane 1). A similar pattern was seen with nuclear extracts from T47D cells, which contain both isoforms of PR (Fig. 8Go, lane 4). In Cos-7 cells transfected with the mutant PRAE911A and the wild type PRB, we found PRB/PRB homodimers and a faster migrating complex that we interpret as an heterodimer of PRB with the mutant PRAE911A or PR3E911A, respectively (Fig. 9Go, lanes 2 and 3). With truncated mutants, very little or no retarded complexes were observed corresponding to the mutant homodimer, likely because these shorter homodimers bind DNA with lower affinity (Fig. 3CGo, lane 5). These data show conclusively that the mutant receptor can form heterodimers with the wild type PRB.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 9. Detection of Homo- and Heterodimers between PRB, PRA, and/or PR-Mutants

Cos-7 cells were transfected with expression vectors for the indicated receptor variants and mutants (see legend to Fig. 3AGo). Nuclear extracts were prepared and incubated with 32 P-labeled PRE oligonucleotide (see Fig. 3CGo). Specific competition was accomplished by added 50 ng of unlabeled PRE. The nature of the complexes is indicated on the left margin. B:B, Homodimer of PRB; A:A, homodimer of PRA or PRAE911A; B:A, heterodimer between PRB and PRA or PRAE911A; B:PR3, heterodimer between PRB and PR3E911A.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Our experiments were aimed at generating a transdominant negative mutant of the PR able to inhibit the wild type PR. Therefore, we constructed mutations within the carboxyl-terminal transactivation function AF2, which is conserved among all nuclear receptors (11). One of the two mutants we have analyzed exhibits the desired properties. Before the possible mechanism of the negative dominant phenotype is discussed, we want to comment on the behavior of the mutants in the absence of wild type PR.

Phenotype of the PR Mutants in the Absence of Steroid Hormone Receptors
Substitution of seven amino acids by an alanine in PRB{Delta}907–913R leads to a complete loss of the transactivation function and yields a protein in Cos-7 cells that does not bind ligand or specific DNA in vitro. A similar behavior has been reported for a mutant of the chicken PR lacking 29 amino acids at the carboxyl-terminal end, which is also inactive and does not bind steroid (33). Deletion of an additional 290 amino acids restores transactivation, though in a ligand-independent fashion (33). Interestingly, deletion of only 42 amino acids of the carboxyl-terminal end of the hPR yields a receptor that cannot bind agonist, but binds the antiprogestin RU486 and is activated by it (34). PRB{Delta}907–913R, however, does not respond to RU486 in gene transfer experiments. Thus, mutations in the carboxyl-terminal region of PR exhibit complex phenotypes depending on the precise nature of the mutation, suggesting that this region of PR fulfils different and possibly overlapping functions in vivo.

The properties of the deletion mutant could result from a perturbation of the interaction with the hsp90 chaperone complex, leading to incorrect folding of the mutant receptor and poor ligand binding. The fact that we did not observe DNA binding with PRB{Delta}907–913R is probably explained by the instability of the corresponding homodimers, as ligand binding favors dimerization of the receptor and homodimers are required for efficient binding to palindromic PREs (35).

The point mutant PRBE911A behaves as the wild type PR in that it binds the agonistic ligand R5020 with normal affinity and does not respond to the antagonist RU486. These results suggest that the nature of the ligand recognition has not been altered by the point mutation. The binding to a palindromic PRE was also specific, although we have not attempted to compare its affinity for DNA to that of wild type PR. These results suggest that PRBE911A is able to bind to PREs in vivo. The mutant is completely inactive in the absence of ligand in all cell lines tested. In the presence of the agonistic ligand R5020, PRBE911A behaves differently in various cell lines. It shows virtually no activity in transfection studies with CV-1 cells and exhibits a very weak effect in HeLa cells (2- to 3-fold induction). In MCF10, a human mammary epithelial cell line without endogenous PR, a double mutant hPRB(E907A,E911A) exhibits a reduced but significant transactivation activity (10). However, concentrations of progesterone in the micromolar range are required to detect significant activation. At nanomolar concentrations of hormone, very little activation is observed (10), comparable to the levels we found with PRBE911A. This weak effect suggests that not only the carboxyl-terminal activation function AF2, but also the amino terminal function AF1, is repressed in the mutant, and that both activation functions are required for significant transactivation of a reporter gene (32). The inactivation of the amino-terminal AF1 could be due to an intramolecular repressing function of the mutated carboxyl-terminal end or could be mediated by interaction with a corepressor (36, 37, 38, 39).

The ability of PRBE911A to bind ligand with normal affinity and the absolute requirement for ligand in activation and inhibition assays (see below) suggest that the point mutant is still able to interact normally with the chaperone complex containing hsp90, which is required for proper folding of PR (40). Only after the ligand has induced dissociation from the hsp90 complex, can PRBE911A exert its transcriptional regulatory effects.

Mechanism of the Transdominant Negative Effect of PRBE911A
PRBE911A inhibits the transcriptional activation function of the wild type PR cotransfected in CV-1 cells as well as the endogenous wild type receptor of the breast cancer cell line T47D. The mutant also inhibits the endogenous GR of HeLa cells and transfected GR in CV1 cells. A similar inhibitory effect is observed when the point mutant is introduced in the background of hPRA, whereas with a shorter form of the mutant, the inhibitory effect is less pronounced than in the hPRB background. That the inhibitory effect of PRA appears to be equally strong at low concentrations of transfected DNA, but weaker than that of PRBE911A at high concentrations, may reflect the fact that T47D cells already contain high levels of PRA, at least as high as the levels of PRB (41). Therefore, it is possible that the actual levels required to obtain a maximal inhibitory effect of PRA are reached with low amounts of transfected DNA. This may be the reason why no clear dependence on the amount of transfected PRA DNA is observed. If this is the case, the actual levels of PRBE911A will be lower than those of PRA and, therefore, its transdominant effect will be more pronounced.

What could be the mechanism of the dominant negative effect working in trans? Since the functional assays were carried out with reporters with two adjacent PREs, one possibility is that the point mutant forms homodimers unable to synergize with each other or with an adjacent wild type receptor homodimer. This cannot be the only mechanism, as the point mutant also inhibits transactivation by the wild type receptor of a reporter containing a single PRE. In this context the negative dominant effect could be due to the formation of inactive heterodimers between the mutant and the wild type receptor. In DNA band shift experiments, we observe the formation of such heterodimers, although we do not have evidence as to their functional activity.

A simple explanation for the negative dominant effect would be competition with the wild type receptor for binding to the hormone-responsive elements. This mechanism would explain not only the weaker dominant effect observed when the point mutation is introduced into shorter forms of the receptor, which show lower affinity for DNA, but would also account for the dominant negative effect on GR. From previous experiments we know that neither hPRB nor hPRA is able to form heterodimers with GR (35, 42, 43). We, therefore, do not expect PRBE911A to form heterodimers with GR. The inhibition of transactivation by GR is thus likely due to DNA-binding competition by the mutant homodimers or by heterodimers containing the mutant and the wild type PR. As the effect of the mutant on transactivation by transfected PR and GR are of comparable magnitude, we suspect that DNA-binding competition is the main mechanism of the negative dominant effect.

The use of the point mutant to study the function of the unliganded wild type PR could be improved by introducing additional mutations, which change the ligand-binding specificity (44). Eventually it could be possible to design a receptor variant that acts constitutively as a transdominant negative mutant. This receptor variant could be expressed under the control of an inducible promoter, for instance a tetracycline-regulated promoter (45), to control its expression. In this way one could study a possible participation of the unliganded PR in cell growth and differentiation processes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Chemicals and Materials
Cell culture media and sera were purchased from GIBCO/Life Technologies (Eggenstein, Germany). [14C]Chloramphenicol, [3H]Org2058, nitrocellulose membranes, and the enhanced chemiluminescence (ECL) kit for Western blotting were from Amersham Life Science (Little Chalfont, U.K.). Anti-PR antibody PR(C-19) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Oligonucleotides were synthesized on an Applied Biosystems (Foster City, CA) DNA synthesizer. Plasmids pTGT1.2cat and pTGT2.2cat have been described (25). pSG5, pRSV-ßGal, hPR0, hPR2, and hPR3 plasmids were as described previously (31). pBK-RSV was purchased from Stratagene (La Jolla, CA).

PR Mutagenesis and Construction of the Expression Plasmids for PR Mutants
Eight hundred base pairs of the 3'-untranslated end of hPR0 were removed by cloning the 3.2-kb EcoRI-ScaI fragment from hPR0 into pBK-RSV opened with the same enzymes to yield pBK-PRB. PCR mutagenesis was performed by using as upstream primers PR-1 mu (5'-CCAGAAATGATGTCTGCAGTTATTGCT-3') or PR-dl (5'CCCGGGCACTGAGTGTTGAATTTCCTCGAGCTGCACAATTACCCAAGATA-3') and as down-stream primer a sequence from the SV40 polyadenylation region (5'-GATGCTATTGCTTTATTTGTAACCA-3'). PR-1 mu contains a single-base exchange (A to C, underlined) leading to replacement of Glu911 of PRB by Ala (PRBE911A). PR-dl contains a 21-base deletion [nucleotides 2895–2915, numbering of Misrahi et al.(46)] and a 3-base insertion (underlined) behind nucleotide 2892, which creates an XhoI site (bold) and results in the substituion of amino acids 907–913 of PRB by an Arg residue (PRB{Delta}907–913R). The amplified fragments were isolated from an agarose gel and cleaved with NotI to remove the SV40 sequences. The smaller NotI fragments containing the mutations were used as 3'-primers in a second PCR together with the 5'-primer PR-HindIII (5'-GGAGTTTGTCAAGCTTCAAGTTAGCCAA-3') located further upstream in the ligand-binding domain of PR. The amplified 700-bp fragments were trimmed with HindIII and XbaI and cloned into pBK-PR opened with the same enzymes to yield pBK-PRBE911A and pBK-PRB{Delta}907–913R. The mutations were introduced into eukaryotic PR expression vectors by replacing the wild type BstXI fragment of hPR0, covering the region of mutagenesis, by the corresponding BstXI fragments of pBK-PRBE911A and pBK-PRB{Delta}907–913R, resulting in the expression plasmids hPRBE911A and hPRB{Delta}907–913R, respectively. Similarly, the point mutation was cloned into hPRA (hPR2) and into another N-terminal-deleted hPR lacking 550 amino acids (hPR3), leading to hPRAE911A and hPR3E911A, respectively.

Transient Transfection and CAT Assay
CV-1, HeLa, and Cos-7 cells were maintained in DMEM supplemented with 10% FCS. T47D cells were cultured as previously described (47). For transfection of CV-1 or HeLa cells, 4 x 105 cells were plated on 60-mm plates 24 h before transfection. The day of the transfection, the medium was replaced and 1 h later the following were added: 500 µl of a HEPES-DNA mixture, containing 3 µg of pTGT2.2cat or pTGT1.2cat, 1 µg pRSV-ßGal, and variable amounts of the PR expression vector (wild type or its mutants), complemented with the amount of empty pSG5 vector to reach a final amount of 6 µg. Sixteen hours after transfection the medium was replaced by medium with 10% charcoal-stripped FCS containing either hormone agonists (R5020, 20 nM, or Dexamethasone, 100 nM), antihormone (RU486, 10 nM), or ethanol as control. The cells were incubated for another 48 h. Transfection of T47D and Cos-7 cells by the diethylaminoethyl-Dextran method was done as previously described (47). Cell extracts were prepared by three cycles of freezing and thawing. CAT and ß-galactosidase assays were performed as described (47), and CAT activity was quantitated with an Imaging Scanner (United Technologies Packard, Downers Grove, IL).

Western Blotting
Cell extracts (48) were mixed with an equal amount of 2 x SDS gel loading buffer, containing 100 mM Tris-HCl (pH 6.8), 200 mM dithiothreitol, 4% SDS, 0.2% bromophenol blue, and 20% glycerol, heated in boiling water for 5 min, electrophoresed on 8% SDS acrylamide gels, and electrophoretically transferred to a nitrocellulose membrane. The membrane was blocked with Tris-buffer-saline (TBS) containing 0.1% Tween (TBST) and 3% skim milk for at least 2 h at room temperature or overnight at 4 C and washed 4 times, 10 min each, with TBST. The washed membrane was incubated with 1:2000 diluted PR(C-19) anti-PR antibody in TBST solutions for 90 min and washed again and incubated for 90 min with a peroxidase-labeled anti-rabbit antibody (1:2000 dilution, included in ECL-Kit). The membrane was washed again, and positive bands were visualized with the enhanced chemiluminescence reagents following the instructions of the manufacturer.

Hormone-Binding Assay
Cell extracts from Cos-7 cells transiently transfected with PRB, PRBE911A, or PRB{Delta}907–913R were prepared according to a published protocol (48). Aliquots of the cell extracts (30 ml) were incubated on ice for 2 h with different concentrations of [3H]-Org2058 and with or without a 1000-fold excess of cold ligand, in a total volume of 120 µl. An equal volume of Dextran-coated charcoal was then added, the samples were vortexed, and incubation was continued on ice for 10 min (49). After centrifugation at 10,000 x g for 20 min, the radioactivities of 160 µl of supernatant and of the remaining activated-charcoal were measured by liquid scintillation counting. The amount of total and specifically bound ligand was calculated as described (48).

Electrophoretic Mobility Shift Assay
Nuclear extracts containing receptors were prepared from T47D cells or transfected Cos-7 cells pretreated with 50 nM R5020 for 1 h. Extract (5 µl) was preincubated for 10 min on ice with 10 µl binding buffer (7 mM HEPES, pH 7.9, 4% glycerol, 4% ficoll, 1 mM MgCl2, 0.1 mM EDTA, and 2 mM dithiothreitol) and 5 µl Poly(deoxyinosinic-deoxycytidylic)acid, followed by incubation for 10 min at room temperature with 20,000 cpm of the 32P-labeled double-stranded oligonucleotide 5'-AGCTTCAAGAACACAGTGTTCTAGGATC-3', which contains a complete palindromic PRE sequence (shown in bold). Specific competition assays were done by adding 50 ng cold PRE oligonucleotide. The reaction mixture was analyzed by electrophoresis using an 5% native polyacrylamide gel (acrylamide-bisacrylamide ratio, 40:1), and the results were visualized by autoradiography of the dried gel (25).


    ACKNOWLEDGMENTS
 
We thank Pierre Chambon’s group in Strasbourg for PR expression vectors and Jörg Klug for carefully reading the manuscript.


    FOOTNOTES
 
Address requests for reprints to: Miguel Beato, Institut fur Molekularbiologie und Tumorforschung, Philipps Universitat, E.-Mannkopff-Strasse 2, D-35037 Marburg, Germany.

This work was supported by the Deutsche Forschungsgemeinschaft, the Fond der Chemischen Insdutrie, and the Schering Foundation.

1 Present address: Departamento de Genética, Facultad de Biología, Universidad de Sevilla, Reina Mercedes, Apartado 1095, E-41080 Sevilla, Spain. Back

Received for publication March 26, 1997. Revision received May 28, 1997. Accepted for publication June 9, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Beato M, Herrlich P, Schütz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83:851–857[CrossRef][Medline]
  2. Schrader WT, O’Malley BW 1972 Progesterone-binding components of chick oviduct. J Biol Chem 247:51–59[Abstract/Free Full Text]
  3. Gronemeyer H 1992 Control of transcription activation by steroid hormone receptors. FASEB J 6:2524–2529[Abstract]
  4. Horwitz KB, Tung L, Takimoto GS 1997 The molecular biology of progesterone receptors: why are there two isoforms? In: Beier HMH, Chwalisz K (eds). The Endometrium as a Target for Contraception. Springer, Berlin, pp 1–20
  5. Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P 1990 Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 9:1603–1624[Medline]
  6. Meyer ME, Quirin-Stricker C, Lerouge T, Bocquel MT, Gronemeyer H 1992 A limiting factor mediates the differential activation of promoters by the human progesterone receptor isoforms. J Biol Chem 267:10882–10887[Abstract/Free Full Text]
  7. Sartorius CA, Melville MY, Hovland AR, Tung L, Takimoto GS, Horwitz KB 1994 A third transactivation function (AF3) of human progesterone receptors located in the unique N-terminal segment of the B-isoform. Mol Endocrinol 8:1347–1360[Abstract/Free Full Text]
  8. Vegeto E, Shahbaz MM, Wen DX, Goldman ME, O’Malley BW, McDonnell DP 1993 Human progesterone receptor-A form is a cell-specific and promoter-specific repressor of human progesterone receptor-B function. Mol Endocrinol 7:1244–1255[Abstract/Free Full Text]
  9. Tora L, Gronemeyer H, Turcotte B, Gaub MP, Chambon P 1988 The N-terminal region of the chicken progesterone receptor specifies target gene activation. Nature 333:185–188[CrossRef][Medline]
  10. Wen DX, Xu YF, Mais DE, Goldman ME, McDonnell DP 1994 The A and B isoforms of the human progesterone receptor operate through distinct signaling pathways within target cells. Mol Cell Biol 14:8356–8364[Abstract/Free Full Text]
  11. Danielian PS, White R, Lees JA, Parker MG 1992 Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J 11:1025–1033[Medline]
  12. Bourguet W, Ruff M, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the ligand-binding domain of the human nuclear receptor RXR-alpha. Nature 375:377–382[CrossRef][Medline]
  13. Renaud JP, Rochel N, Ruff M, Vivat V, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the RAR-{gamma} ligand-binding domain bound to all-trans retinoic acid. Nature 378:681–689[CrossRef][Medline]
  14. vom Baur E, Zechel C, Heery D, Heine M, Garnier JM, Vivat V, LeDouarin B, Gronemeyer H, Chambon P, Losson R 1995 Differential ligand-dependent interactions between the AF-2 activation domain of nuclear receptors and the putative transcriptional intermediary factors mSUG1 and TIF1. EMBO J 15:110–124[Medline]
  15. Voegel JJ, Heine MJS, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  16. Wurtz JM, Bourguet W, Renaud JP, Vivat V, Chambon P, Moras D, Gronemeyer H 1996 A canonical structure for the ligand-binding domain of nuclear receptors. Nature Struct Biol 3:87–94[CrossRef][Medline]
  17. Cavaillès V, Dauvois S, Danielian PS, Parker MG 1994 Interaction of proteins with transcriptionally active estrogen receptors. Proc Natl Acad Sci USA 91:10009–10013[Abstract/Free Full Text]
  18. Lanz RB, Rusconi S 1994 A conserved carboxy-terminal subdomain is important for ligand interpretation and transactivation by nuclear receptors. Endocrinology 135:2183–2195[Abstract]
  19. Ince BA, Zhuang Y, Wrenn CK, Shapiro DJ, Katzenellenbogen BS 1993 Powerful dominant negative mutants of the human estrogen receptor. J Biol Chem 268: 14026–14032
  20. Ince BA, Schodin DJ, Shapiro DJ, Katzenellenbogen BS 1995 Repression of endogenous estrogen receptor activity in MCF-7 human breast cancer cells by dominant negative estrogen receptors. Endocrinology 136:3194–3199[Abstract]
  21. Hollenberg SM, Weinberger C, Ong ES, Cerelli G, Oro A, Lebo R, Thompson EB, Rosenfeld MG, Evans RM 1985 Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature 318:635–641[CrossRef][Medline]
  22. Bamberger CM, Bamberger AM, DeCastro M, Chrousos GP 1995 Glucocorticoid receptor ß, a potential endogenous inhibitor of glucocorticoid action in humans. J Clin Invest 95:2435–2441
  23. Oakley RH, Sar M, Cidlowski JA 1996 The human glucocorticoid receptor ß isoform. Expression, biochemical properties, and putative function. J Biol Chem 271:9550–9559[Abstract/Free Full Text]
  24. Fleischmann G, Beato M 1978 Characterization of the progesterone receptor of rabbit uterus with the synthetic progestin 16a-ethyl-21-hydroxy-19-norpregn-4-ene-3, 20-dione. Biochim Biophys Acta 540:500–517
  25. Truss M, Chalepakis G, Slater EP, Mader S, Beato M 1991 Functional interaction of hybrid response elements with wild type and mutant steroid hormone receptors. Mol Cell Biol 11:3247–3258[Abstract/Free Full Text]
  26. Horwitz KB, Zava DT, Thilagia AK, Jensen EM, McGuire WL 1978 Steroid receptor analysis of nine human breast cancer cell lines. Cancer Res 38:2434–2437[Abstract/Free Full Text]
  27. Schodin DJ, Zhuang Y, Shapiro DJ, Katzenellenbogen BS 1995 Analysis of mechanisms that determine dominant negative estrogen receptor effectiveness. J Biol Chem 270:31163–31171[Abstract/Free Full Text]
  28. Strähle U, Schmid W, Schütz G 1988 Synergistic action of the glucocorticoid receptor with transcription factors. EMBO J 7:3389–3395[Medline]
  29. Tsai SY, Tsai MJ, O’Malley BW 1989 Cooperative binding of steroid hormone receptors contributes to transcriptional synergism at target enhancer elements. Cell 57:443–448[CrossRef][Medline]
  30. Beato M 1989 Gene regulation by steroid hormones. Cell 56:335–344[CrossRef][Medline]
  31. Kastner P, Bocquel M, Turcotte B, Garnier J, Horwitz K, Chambon P, Gronemeyer H 1990 Transient expression of human and chicken progesterone receptors does not support alternative translational initiation from a single mRNA as the mechanism generating two receptor isoforms. J Biol Chem 265:12163–12167[Abstract/Free Full Text]
  32. Meyer ME, Pornon A, Ji J, Bocquel MT, Chambon P, Gronemeyer H 1990 Agonistic and antagonistic activities of RU486 on the functions of the human progesterone receptor. EMBO J 9:3923–3932[Medline]
  33. Carson MA, Tsai MJ, Conneely OM, Maxwell BL, Clark JH, Dobson ADW, Elbrecht A, Toft DO, Schrader WT, O’Malley BW 1987 Structure-function properties of the chicken progesterone receptor A synthesized from complementary DNA. Mol Endocrinol 1:791–801[Abstract/Free Full Text]
  34. Vegeto E, Allan GF, Schrader WT, Tsai M-J, McDonnell D, O’Malley BW 1992 The mechanism of RU486 antagonism is dependent on the conformation of the carboxy-terminal tail of the human progesterone receptor. Cell 69:703–713[CrossRef][Medline]
  35. Chalepakis G, Arnemann J, Slater EP, Brüller H, Gross B, Beato M 1988 Differential gene activation by glucocorticoids and progestins through the hormone regulatory element of mouse mammary tumor virus. Cell 53:371–382[CrossRef][Medline]
  36. Hörlein A, Näär AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Söderström M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–404[CrossRef][Medline]
  37. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]
  38. Burris TP, Nawaz Z, Tsai MJ, O’Malley BW 1995 A nuclear hormone receptor-associated protein that inhibits transactivation by the thyroid hormone and retinoic acid receptors. Proc Natl Acad Sci USA 92:9525–9529[Abstract/Free Full Text]
  39. Lee HS, Aumais J, White JH 1996 Hormone-dependent transactivation by estrogen receptor chimeras that do not interact with hsp90. Evidence for transcriptional repressors. J Biol Chem 271:25727–25730[Abstract/Free Full Text]
  40. Johnson J, Corbisier R, Stensgard B, Toft D 1996 The involvement of p23, hsp90, and immunophilins in the assembly of progesterone receptor complexes. J Steroid Biochem Mol Biol 56:31–37[CrossRef][Medline]
  41. Sartorius CA, Groshong SD, Miller LA, Powell RL, Tung L, Takimoto GS, Horwitz KB 1994 New T47D breast cancer cell lines for the independent study of progesterone B- and A-receptors: only antiprogestin-occupied B-receptors are switched to transcriptional agonists by cAMP. Cancer Res 54:3868–3877[Abstract/Free Full Text]
  42. Truss M, Chalepakis G, Beato M 1992 Interplay of steroid hormone receptors and transcription factors on the mouse mammary tumor virus promoter. J Steroid Biochem Mol Biol 43:365–378[CrossRef][Medline]
  43. Slater EP, Redeuilh G, Beato M 1991 Hormonal regulation of vitellogenin genes: an estrogen-reponsive element in the Xenopus A2 gene and a multihormonal regulatory region in the chicken II gene. Mol Endocrinol 5:386–396[Abstract/Free Full Text]
  44. Benhamou B, Garcia T, Lerouge T, Vergezac A, Gofflo D, Bigogne C, Chambon P, Gronemeyer H 1992 A single amino acid that determines the sensitivity of progesterone receptors to RU486. Science 255:206–209[Abstract/Free Full Text]
  45. Gossen M, Bujard H 1992 Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA 89:5547–5551[Abstract/Free Full Text]
  46. Misrahi M, Atger M, d’Aurio L, Loosfelt H, Meriel C, Fridlansky F, Guichon-Mantel A, Galibert F, Milgrom E 1987 Complete amino acid sequence of the human progesterone receptor deduced from cloned cDNA. Biochem Biophys Res Commun 143:740–748[CrossRef][Medline]
  47. Truss M, Bartsch J, Schelbert A, Haché RJG, Beato M 1995 Hormone induces binding of receptors and transcription factors to a rearranged nucleosome on the MMTV promoter in vivo. EMBO J 14:1737–1751[Medline]
  48. Andrews NC, Faller DV 1991 A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19:2499[Free Full Text]
  49. Beato M, Feigelson P 1972 Glucocorticoid binding proteins of rat liver cytosol. I. Separation and identification of the binding proteins. J Biol Chem 247:7890–7896[Abstract/Free Full Text]
  50. Gorman CM, Moffat LF, Howard BH 1982 Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044–1051[Abstract/Free Full Text]
  51. Lopata MA, Cleveland DW, Sollner-Webb B 1984 High level transient expression of a chloramphenicol acetyl transferase gene by DEAE-dextran mediated DNA transfection coupled with a dimethyl sulfoxide or glycerol shock treatment. Nucleic Acids Res 12:5707–5717[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
I. Quiles, L. Millan-Arino, A. Subtil-Rodriguez, B. Minana, N. Spinedi, C. Ballare, M. Beato, and A. Jordan
Mutational Analysis of Progesterone Receptor Functional Domains in Stable Cell Lines Delineates Sets of Genes Regulated by Different Mechanisms
Mol. Endocrinol., June 1, 2009; 23(6): 809 - 826.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Subtil-Rodriguez, L. Millan-Arino, I. Quiles, C. Ballare, M. Beato, and A. Jordan
Progesterone Induction of the 11{beta}-Hydroxysteroid Dehydrogenase Type 2 Promoter in Breast Cancer Cells Involves Coordinated Recruitment of STAT5A and Progesterone Receptor to a Distal Enhancer and Polymerase Tracking
Mol. Cell. Biol., June 1, 2008; 28(11): 3830 - 3849.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Ballare, M. Uhrig, T. Bechtold, E. Sancho, M. Di Domenico, A. Migliaccio, F. Auricchio, and M. Beato
Two Domains of the Progesterone Receptor Interact with the Estrogen Receptor and Are Required for Progesterone Activation of the c-Src/Erk Pathway in Mammalian Cells
Mol. Cell. Biol., March 15, 2003; 23(6): 1994 - 2008.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kucera, M. Waltner-Law, D. K. Scott, R. Prasad, and D. K. Granner
A Point Mutation of the AF2 Transactivation Domain of the Glucocorticoid Receptor Disrupts Its Interaction with Steroid Receptor Coactivator 1
J. Biol. Chem., July 12, 2002; 277(29): 26098 - 26102.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. S. Castro, M. Arvidsson, M. B. Bolin, and T. Perlmann
Activity of the Nurr1 Carboxyl-terminal Domain Depends on Cell Type and Integrity of the Activation Function 2
J. Biol. Chem., December 24, 1999; 274(52): 37483 - 37490.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Vaxillaire, A. Abderrahmani, P. Boutin, B. Bailleul, P. Froguel, M. Yaniv, and M. Pontoglio
Anatomy of a Homeoprotein Revealed by the Analysis of Human MODY3 Mutations
J. Biol. Chem., December 10, 1999; 274(50): 35639 - 35646.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gong, W.
Right arrow Articles by Beato, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gong, W.
Right arrow Articles by Beato, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals