Molecular Endocrinology 11 (10): 1476-1485
Copyright © 1997 by The Endocrine Society
Point Mutation in the Ligand-Binding Domain of the Progesterone Receptor Generates a Transdominant Negative Phenotype
Wenrong Gong,
Sebastián Chávez1 and
Miguel Beato
Institut für Molekularbiologie und Tumorforschung,
Philipps Universität, D-35037 Marburg, Germany
 |
ABSTRACT
|
|---|
A short conserved
-helix in the
carboxyl-terminal activation function of the ligand-binding domain of
steroid hormone receptors, called AF2, is important for
ligand-dependent transactivation of inducible genes. We have generated
two AF2 mutants of the B isoform of human progesterone receptor (PRB):
a point mutant, PRBE911A, and a short deletion, PRB
907913R. The
two mutants are expressed at levels comparable to the wild type
receptor in transfected cells. The PRBE911A mutant showed similar
hormone- and DNA- binding affinities as the wild type receptor, whereas
the PRB
907913R mutant was defective in hormone and DNA binding.
Both mutants were inactive when transiently transfected in CV-1 cells,
which do not express endogenous PR. However, the point mutant, but not
the deletion mutant, inhibited transactivation by cotransfected wild
type PRB in a hormone-dependent fashion. The activity of endogenous PR
in T47D cells or of endogenous glucocorticoid receptor in HeLa cells
was also inhibited by the PRBE911A, but not by the deletion mutant. The
point mutant was less active when introduced into an N-terminal
truncated form of PR, where it gave rise to proteins that formed
homodimers with poor affinity for DNA, but were able to form
heterodimers with PRB. The negative dominant phenotype of the PRBE911A
mutant likely originates from competition with wild type receptors for
binding to DNA and will be useful for mechanistic studies of receptor
function.
 |
INTRODUCTION
|
|---|
The progesterone receptor (PR) is a ligand-activated member of the
superfamily of nuclear receptors and shares their characteristic
modular structure with an N-terminal transactivation domain, a highly
conserved DNA-binding domain, and a C-terminal ligand-binding domain
(1). Two different isoforms of PR, namely PRA and PRB (Fig. 1A
), were originally identified in chick
oviduct (2) and have since been found in most progesterone-responsive
cells (3, 4). Both isoforms differ only in their N-termini, PRB
extending 164 amino acids further than PRA, and are synthesized from
the same gene using two different promoters (5). Within the N-terminal
domain, in addition to the constitutive activation function 1 (AF1)
common to both isoforms (6), another transactivation function has been
postulated in the region unique to the B isoform (7). It has been
reported that, in most cells examined, the B isoform is a stronger
activator of transcription than the A isoform and that in some cells
PRA functions as a transcriptional inhibitor of PRB and other steroid
hormone receptors (8). However, in some contexts PRA is a stronger
activator than PRB (9, 10), and the physiological function of both
isoforms is not known.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 1. Structure of PR Isoforms and Mutants
A, The domain structure of PR is indicated, in particular the DNA
binding domain, DBD, and the ligand binding domain, LBD. The position
of the activation functions AF1 and AF2 is also indicated. The
numbers refer to amino acid positions in the wild type
PRB isoform. B, Comparison of the amino acid sequence of the AF2 in
various nuclear receptors. The seven amino acids replaced by alanine in
PR 907913R are indicated at the top. The glutamate
residue at 911 is marked by an asterisk. Two pairs of
conserved hydrophobic residues are boxed.
|
|
The C-terminal domain of PR is involved not only in ligand binding but
also in interactions with heat shock proteins, in nuclear
translocation, in dimerization, and in ligand-dependent transactivation
(3). This latter function is mediated by a short core sequence, AF2,
highly conserved among nuclear receptors (Fig. 1B
) (11). The crystal
structure of the unliganded retinoic acid X receptor (RXR
) (12) and
of the liganded retinoic acid A receptor (RAR
) (13) suggests that
the amphipathic helix within AF2 participates in structural changes
induced by ligand binding, leading to the exposure of amino acid
residues for interaction with transcriptional coactivators (14, 15, 16).
Mutations in the AF2 region of various steroid hormone receptors can
destroy its transactivation function, with or without influencing
ligand binding (10, 17, 18). More interestingly, several mutations in
the estrogen receptors AF2 act as dominant negative mutants,
e.g. the mutated receptors interfere dominantly with the
activity of the wild type estrogen receptors (19, 20). A
carboxyl-terminal deleted form of glucocorticoid receptor, called
GRß, has also been claimed to exhibit a transdominant negative
phenotype (21, 22, 23).
We wanted to know whether mutations in the AF-2 region of PR also lead
to a dominant negative phenotype that could be useful in defining
functions of the unliganded receptor. For this reason, we decided to
substitute the negatively charged glutamic acid at position 911 of the
human PRB, which is conserved in virtually all the nuclear receptors
(11), by the neutral residue alanine to generate PRBE911A (Fig. 1
).
This position had already been mutated in a previous study, but in
combination with a similar mutation of glutamic acid 907 and not as
single point mutant (10). Moreover, the dominant behavior of this PRB
double mutant has not been reported. In addition to the point mutant,
we also constructed a mutant PRB
907913R (Fig. 1
). In contrast to
the deletion mutant, the point mutant PRBE911A binds ligand and DNA
with apparently normal affinities, but both mutants had lost their
ligand-dependent activation function in CV-1 cells. However, upon
binding, ligand PRBE911A, but not PRB
907913R, inhibited the
activity not only of wild type PR and glucocorticoid receptor (GR) in
cotransfected CV-1 cells, but also of the endogenous PR in T47D cells,
and of the endogenous GR in HeLa cells. The mechanism of this
inhibition is discussed based on in vitro DNA binding
experiments.
 |
RESULTS
|
|---|
PRBE911A and PRB
907913R Are Activation Defective in CV-1
Cells
The transactivation function of the point mutant PRBE911A and the
short deletion mutant PRB
907913R, in which seven amino acids
within the amphipathic helix in AF2 were substituted by an arginine,
were tested in transient transfection assays in CV-1 cells, which lack
steroid hormone receptors. While the wild type human PRB activated a
reporter plasmid containing two progesterone responsive elements (PREs)
in a ligand-dependent manner, no significant activation was observed
with the short deletion mutant PRB
907913R, and a very weak
activation was found with the point mutant PRBE911A (Fig. 2
). In the same assay the PRA isoform
showed a significant activation, twice that found with PRBE911A but
much lower than the activation by the PRB isoform (Fig. 2
). The
truncated form PR3, which lacks amino acids 1 to 550 (Fig. 1
A),
exhibited higher transactivation, about two third of the value observed
with PRB, but the point mutation in the background of this shorter
receptor, PR3E911A, was virtually inactive. We found no agonistic
activity of the antiprogestin RU486 with any of the constructs tested
(Fig. 2
). Moreover, we observed no transactivation in the absence of
ligand with any of the receptor expression vectors, suggesting that in
our assay we are measuring exclusively activity dependent on ligand
binding and likely requiring the activation function AF2.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 2. Transactivation Properties of PR Isoforms and
Mutants
The transactivation function was tested in CV-1 cells transfected with
the reporter gene pTGT2.2cat and the indicated expression vectors using
the calcium phosphate precipitation method (50). The figure shows the
CAT activity in arbitrary units (see Materials and
Methods) as mean value and SD calculated from six
determinations.
|
|
PRBE911A Binds Hormone and PRE with Similar Affinity as Wild Type
PR
The lack of significant hormone-dependent activation by the
two receptor mutants could reflect either a lack of affinity for the
hormone ligand or a defective interaction of the liganded receptor
mutants with the PREs. We have used nuclear extracts from Cos-7 cells
transiently transfected with expression vectors for PRB, PRA, PRBE911A,
PRAE911A, PR3E911A, or PRB
907913R, to determine the hormone- and
DNA-binding ability of the different receptor variants and mutants. The
levels of expression of the various proteins were similar, as judged by
Western blotting (Fig. 3A
).
[3H]ORG2058 was used as synthetic progestin in
hormone-binding tests with dextran-coated charcoal, and the results
were analyzed using Scatchard plots (24). As the ligand-binding
behavior of AF2 mutants is similar in the PRB and in the PRA background
(10), we have tested only the steroid-binding affinity of the mutations
in the PRB background. The point mutant PRBE911A exhibited the same
ligand affinity as the wild type PRB (Fig. 3B
). The apparent
disassociation constants were 1.02 nM for wild type PRB and
0.98 nM for PRBE911A. The deletion mutant PRB
907913R
did not show specific ligand binding (data not shown). Thus, the lack
of activation by PRBE911A is not due to a reduced affinity for the
agonistic ligand, while this could be the reason for the inactivity of
the deletion mutant PRB
907913R.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 3. Properties of the PR Variants and Mutants
A, Expression of various PR isoforms and mutants in Cos-7 cells. The
figure shows a Western blot performed with the PR (C-19) antibody,
which recognizes the C-terminal end of PR present in all the expressed
proteins. Cells transfected with the empty pSG5 vector did not exhibit
specific immunoreactive bands. Recombinant PRB purified from
baculovirus and a T47D nuclear extract were used as positive controls.
The molecular weights of PRB, PRA, and PR3 are indicated on the
right margin. B, Scatchard analysis of
[3H]ORG2058 binding to PRB and PRBE911A (see
Materials and Methods for details). C, DNA- binding
activity of the PR isoforms and mutants. Nuclear extracts from Cos-7
cells transfected with expression vectors for the indicated receptor
variants and mutants were incubated with a 32P-labeled PRE
oligonucleotide. The figure shows an autoradiogram of the retarded
protein-DNA complexes separated from free DNA by electrophoresis on an
8% polyacrylamide gel. Recombinant PRB purified from baculovirus was
used as positive control. The band at the top represents
aggregated material present in the preparation of purified PRB.
|
|
To measure the affinity of wild type and mutant receptors for DNA we
used a 32P-labeled double-stranded oligonucleotide
encompassing a complete palindromic PRE in electrophoretic mobility
shift assays (25). The wild type PRB and PRA isoforms exhibited similar
affinities for the PRE oligonucleotide (Fig. 3C
). The truncated PR3
form showed reduced DNA binding (Fig. 3C
, lane 5), probably reflecting
formation of less stable dimers (see below). The PRB
907913R mutant
did not bind to the PRE oligonucleotide in band shift experiments (Fig. 3C
). We tested the E911A mutation in the background of PRB, PRA and in
the truncated form PR3. In all these backgrounds, the DNA- binding
activity of the point mutant was comparable to the cognate wild type
receptor isoform (Fig. 3C
, compare lanes 2, 4, and 6 with lanes 1, 3,
and 5, respectively), suggesting that the lack of transactivation by
this mutant is not due to a defect in DNA recognition. It is,
therefore, likely that the point mutation affects steps in the
transactivation process distal to the ligand- and DNA-binding
events.
PRBE911A Is a Strong Repressor of Wild Type PR Activity
To test the influence of the receptor mutants on the activity of
wild type PR, we have used transient cotransfection assays in CV-1
cells. Different amounts of PRBE911A or PRB
907913R were
cotransfected with 1 µg of a human (h)PRB expression vector along
with the reporter gene containing two PREs. As shown in Fig. 4
, suppression of hPRB function increases
with the amount of transfected PRBE911A. When equal amounts of wild
type and PRBE911A were transfected, the activity of the wild type PRB
was reduced to 60% of the values found in the absence of cotransfected
mutant PR. With a 5-fold excess of the PRBE911A, the activity of hPRB
was diminished to 25% of the controls. A similar excess of
PRB
907913R had no significant effect on the activity of the wild
type PRB (Fig. 4
). Thus the point mutant is able to repress the
transactivation function of transiently expressed PRB.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 4. Transdominant Negative Effect on Cotransfected PRB
Inhibition of wild type PRB by receptor variants and mutants
cotransfected in CV-1 cells along with a reporter gene containing two
PREs. CV-1 cells were transfected with 1 µg of the expression plasmid
for wild type PRB, 3 µg of the reporter pTGT2.2cat, and 1 µg of the
internal reference plasmid pRSV-ßGal. In addition, the indicated
amounts of expression vectors for receptor variants and mutants were
cotransfected. The relative CAT activity measured in the corresponding
cell extracts is expressed as percentage of the activation found when
only PRB and no other receptor construct was transfected. The figure
shows the mean value and the SD of six determinations after
normalization for protein content and ß-galactosidase activity.
|
|
To test the effect of receptor mutants on endogenous PR, transfection
experiments were performed with the human breast cancer cell line T47D,
which contains a high amount of PR (26). Transfection of PRBE911A,
PRB
907913R, or any other of the variants tested had little effect
on the activity of the reporter in the absence of hormone. After
treatment with the agonist R5020, a strong induction was found in the
absence of transfected PR mutants due to the activity of the endogenous
PR (Fig. 5
). A progressive inhibition of
the endogenous PR was observed with increasing amounts of transfected
PRBE911A, whereas PRB
907913R had no effect at the highest
concentration tested (Fig. 5
). As little as 0.5 µg of the PRBE911A
expression vector led to a reduction of the R5020 induction to less
than 60% of control values, and 2.5 µg of mutant DNA repressed
activation by the endogenous PR to 27% of the controls. In parallel we
tested the dominant negative activity of hPRA, which is known to
inhibit the function of PRB in certain contexts (8). We found that hPRA
showed similar repressive effects as PRBE911A when 0.5 µg DNA was
transfected, whereas the inhibitory effect of PRA was weaker than that
of PRBE911A with 2.5 µg transfected DNA (Fig. 5
). When the point
mutant was introduced into the PRA background, the inhibitory effect
was similar to that found in the PRB background and stronger than the
effect of PRA with high concentration of transfected DNA. Thus, the
point mutant was at least as active as the PRA in repressing the
function of endogenous PR. On the other hand, the inhibitory effect of
the point mutation in E911A was markedly reduced in the background of
the truncated PR3 receptor variant. The maximal effect observed with
PR3E911A was a reduction of the transactivation response to 44% of the
controls (Fig. 5
). This suggests that a region between amino acids 165
and 550 is required for the efficient repression of the wild type PR. A
similar observation has been reported for dominant negative mutants of
the estrogen receptor (27).

View larger version (34K):
[in this window]
[in a new window]
|
Figure 5. Transdominant Negative Activity of Receptor
Variants and Mutants on Endogenous PRB
T47D cells were transfected by the diethylaminoethyl (DEAE)-Dextran
method (51) with the indicated amounts of the various isoforms and
mutants of PR expression vectors along with the reporter plasmid
pTGT2.2cat and the internal reference plasmid pRSV-ßGal. The relative
CAT activity was measured as described in the legend to Fig. 4 . The
figure shows the mean and SD of six determinations.
|
|
PRBE911A Inhibits the Activity of Endogenous and Transfected
Glucocorticoid Receptor
To test whether the inhibitory effect of PRBE911A is limited to
wild type PR, we performed transfection experiments in HeLa cells,
which contain significant levels of endogenous glucocorticoid receptor
(GR). In these cells, PRBE911A, when activated by R5020, induced
chloramphenicol acetyltransferase (CAT) activity from pTGT2.2.cat 2 to
3-fold in the absence of dexamethasone (Fig. 6
), reflecting a residual activation that
could be attributed to the AF1 in the N-terminal domain. Transfection
of 0.5 µg and 2 µg of PRBE911A DNA decreased the
dexamethasone-induced GR activity to 74.5% and 60%, respectively
(Fig. 6
). This effect was completely dependent on the addition of the
PR-specific agonistic ligand R5020. In the absence of R5020,
transfection of PRBE911A into HeLa cells does not influence the
activity of GR. We also tested the effect of PRBE911A on the activity
of GR transfected into CV1 cells (Fig. 7
). The results show that, in the
presence of the agonist ligand R5020, the point mutant of PR represses
transfected GR with comparable efficiency as transfected PR (see Fig. 4
). That means that the PR mutant is activated by its cognate ligand to
accomplish its transdominant negative effect on GR induction.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 6. Inhibition of the Function of Endogenous GR in HeLa
Cells by PRBE911A
HeLa cells were transfected by the calcium phosphate precipitation
method with the pTGT2.2cat reporter gene and the indicated expression
vectors for PR variants and treated with the indicated synthetic
hormones. The figure shows the mean values and the SD of
six determinations, after normalization for protein content and
ß-galactosidase activity.
|
|

View larger version (31K):
[in this window]
[in a new window]
|
Figure 7. Transdominant Negative Effect on Cotransfected GR
Inhibition of wild type GR by receptor variants and mutants
cotransfected in CV-1 cells along with a reporter gene containing two
PREs. CV-1 cells were transfected with 0.5 µg of the expression
plasmid for wild type GR (21), 3 µg of the reporter pTGT2.2cat, and 1
µg of the internal reference plasmid pRSV-ßGal. In addition, the
indicated amounts of expression vectors for receptor variants and
mutants were cotransfected. The relative CAT activity measured in the
corresponding cell extracts is expressed as percentage of the
activation found when only dexamethasone was added. The figure shows
the mean value and the SD of two experiments performed in
duplicate after normalization for protein content and ß-galactosidase
activity.
|
|
PRBE911A also Inhibits Activation by Wild Type PR of Reporters
Containing a Single PRE
Steroid hormone receptors are known to synergize on adjacent HREs
(28, 29). Therefore, the transdominant negative phenotype of PRBE911A
could be due to the inability of the mutant receptor to synergize with
itself or with the wild type PR on a reporter containing two PREs. To
test this possibility, we have examined the inhibitory effects of
PRBE911A using the pTGT1.2cat reporter gene, which contains only one
PRE in front of the tk-promoter. As shown in Fig. 7
, PRBE911A inhibited
activation of this reporter by the endogenous wild type PR of T47D
cells in a concentration-dependent manner. However, the inhibitory
effect was only 70% of that observed with the pTGT2.2cat, containing
two adjacent PREs (Fig. 8
). Thus, at
least part of the transdominant negative effect of PRBE911A is due to
mechanisms other than an inhibition of the synergism between adjacent
PREs.

View larger version (12K):
[in this window]
[in a new window]
|
Figure 8. Inhibition by PRBE911A of Transactivation on
Reporters Containing a Single PRE or Two PREs
Comparison of the dominant negative activity of PRBE911A in T47D cells
cotransfected with either pTGT2.2cat or pTGT1.2cat. For details see
legend to Fig. 5 .
|
|
The E911A Receptor Mutant Forms Heterodimers with Wild Type PR
Steroid hormone receptors, and in particular PR, bind to their
target palindromic sequences as homodimers (30). One possible mechanism
for the inhibitory effect of PRBE911A would be the formation of
inactive heterodimers with wild type PR on target PREs. To test this
possibility, we performed gel retardation experiments with nuclear
extracts from Cos-7 cells transfected with wild type isoforms or mutant
PR. To distinguish the heterodimers, we used the E911A mutation in the
background of PRA or of the truncated form PR3 (31). When Cos-7 cells
were transfected with expression vectors for PRB and PRA, the expected
three retarded complexes were found (32) corresponding to PRB/PRB and
PRA/PRA homodimers and to PRB/PRA heterodimers (Fig. 9
, lane 1). A similar pattern was seen
with nuclear extracts from T47D cells, which contain both isoforms of
PR (Fig. 8
, lane 4). In Cos-7 cells transfected with the mutant
PRAE911A and the wild type PRB, we found PRB/PRB homodimers and a
faster migrating complex that we interpret as an heterodimer of PRB
with the mutant PRAE911A or PR3E911A, respectively (Fig. 9
, lanes 2 and
3). With truncated mutants, very little or no retarded complexes were
observed corresponding to the mutant homodimer, likely because these
shorter homodimers bind DNA with lower affinity (Fig. 3C
, lane 5).
These data show conclusively that the mutant receptor can form
heterodimers with the wild type PRB.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 9. Detection of Homo- and Heterodimers between PRB,
PRA, and/or PR-Mutants
Cos-7 cells were transfected with expression vectors for the indicated
receptor variants and mutants (see legend to Fig. 3A ). Nuclear extracts
were prepared and incubated with 32 P-labeled PRE oligonucleotide (see
Fig. 3C ). Specific competition was accomplished by added 50 ng of
unlabeled PRE. The nature of the complexes is indicated on the left
margin. B:B, Homodimer of PRB; A:A, homodimer of PRA or PRAE911A; B:A,
heterodimer between PRB and PRA or PRAE911A; B:PR3, heterodimer between
PRB and PR3E911A.
|
|
 |
DISCUSSION
|
|---|
Our experiments were aimed at generating a transdominant negative
mutant of the PR able to inhibit the wild type PR. Therefore, we
constructed mutations within the carboxyl-terminal transactivation
function AF2, which is conserved among all nuclear receptors (11). One
of the two mutants we have analyzed exhibits the desired properties.
Before the possible mechanism of the negative dominant phenotype is
discussed, we want to comment on the behavior of the mutants in the
absence of wild type PR.
Phenotype of the PR Mutants in the Absence of Steroid Hormone
Receptors
Substitution of seven amino acids by an alanine in PRB
907913R
leads to a complete loss of the transactivation function and yields a
protein in Cos-7 cells that does not bind ligand or specific DNA
in vitro. A similar behavior has been reported for a mutant
of the chicken PR lacking 29 amino acids at the carboxyl-terminal end,
which is also inactive and does not bind steroid (33). Deletion of an
additional 290 amino acids restores transactivation, though in a
ligand-independent fashion (33). Interestingly, deletion of only 42
amino acids of the carboxyl-terminal end of the hPR yields a receptor
that cannot bind agonist, but binds the antiprogestin RU486 and is
activated by it (34). PRB
907913R, however, does not respond to
RU486 in gene transfer experiments. Thus, mutations in the
carboxyl-terminal region of PR exhibit complex phenotypes depending on
the precise nature of the mutation, suggesting that this region of PR
fulfils different and possibly overlapping functions in
vivo.
The properties of the deletion mutant could result from a perturbation
of the interaction with the hsp90 chaperone complex, leading to
incorrect folding of the mutant receptor and poor ligand binding. The
fact that we did not observe DNA binding with PRB
907913R is
probably explained by the instability of the corresponding homodimers,
as ligand binding favors dimerization of the receptor and homodimers
are required for efficient binding to palindromic PREs (35).
The point mutant PRBE911A behaves as the wild type PR in that it binds
the agonistic ligand R5020 with normal affinity and does not respond to
the antagonist RU486. These results suggest that the nature of the
ligand recognition has not been altered by the point mutation. The
binding to a palindromic PRE was also specific, although we have not
attempted to compare its affinity for DNA to that of wild type PR.
These results suggest that PRBE911A is able to bind to PREs in
vivo. The mutant is completely inactive in the absence of ligand
in all cell lines tested. In the presence of the agonistic ligand
R5020, PRBE911A behaves differently in various cell lines. It shows
virtually no activity in transfection studies with CV-1 cells and
exhibits a very weak effect in HeLa cells (2- to 3-fold induction). In
MCF10, a human mammary epithelial cell line without endogenous
PR, a double mutant hPRB(E907A,E911A) exhibits a reduced but
significant transactivation activity (10). However, concentrations of
progesterone in the micromolar range are required to detect significant
activation. At nanomolar concentrations of hormone, very little
activation is observed (10), comparable to the levels we found with
PRBE911A. This weak effect suggests that not only the carboxyl-terminal
activation function AF2, but also the amino terminal function AF1, is
repressed in the mutant, and that both activation functions are
required for significant transactivation of a reporter gene (32). The
inactivation of the amino-terminal AF1 could be due to an
intramolecular repressing function of the mutated carboxyl-terminal end
or could be mediated by interaction with a corepressor (36, 37, 38, 39).
The ability of PRBE911A to bind ligand with normal affinity and the
absolute requirement for ligand in activation and inhibition assays
(see below) suggest that the point mutant is still able to interact
normally with the chaperone complex containing hsp90, which is required
for proper folding of PR (40). Only after the ligand has induced
dissociation from the hsp90 complex, can PRBE911A exert its
transcriptional regulatory effects.
Mechanism of the Transdominant Negative Effect of PRBE911A
PRBE911A inhibits the transcriptional activation function of the
wild type PR cotransfected in CV-1 cells as well as the endogenous wild
type receptor of the breast cancer cell line T47D. The mutant also
inhibits the endogenous GR of HeLa cells and transfected GR in CV1
cells. A similar inhibitory effect is observed when the point mutant is
introduced in the background of hPRA, whereas with a shorter form of
the mutant, the inhibitory effect is less pronounced than in the
hPRB background. That the inhibitory effect of PRA appears to be
equally strong at low concentrations of transfected DNA, but weaker
than that of PRBE911A at high concentrations, may reflect the fact that
T47D cells already contain high levels of PRA, at least as high as the
levels of PRB (41). Therefore, it is possible that the actual levels
required to obtain a maximal inhibitory effect of PRA are reached with
low amounts of transfected DNA. This may be the reason why no clear
dependence on the amount of transfected PRA DNA is observed. If this is
the case, the actual levels of PRBE911A will be lower than those of PRA
and, therefore, its transdominant effect will be more
pronounced.
What could be the mechanism of the dominant negative effect working in
trans? Since the functional assays were carried out with reporters with
two adjacent PREs, one possibility is that the point mutant forms
homodimers unable to synergize with each other or with an adjacent wild
type receptor homodimer. This cannot be the only mechanism, as the
point mutant also inhibits transactivation by the wild type receptor of
a reporter containing a single PRE. In this context the negative
dominant effect could be due to the formation of inactive heterodimers
between the mutant and the wild type receptor. In DNA band shift
experiments, we observe the formation of such heterodimers, although we
do not have evidence as to their functional activity.
A simple explanation for the negative dominant effect would be
competition with the wild type receptor for binding to the
hormone-responsive elements. This mechanism would explain not only the
weaker dominant effect observed when the point mutation is introduced
into shorter forms of the receptor, which show lower affinity for DNA,
but would also account for the dominant negative effect on GR. From
previous experiments we know that neither hPRB nor hPRA is able to form
heterodimers with GR (35, 42, 43). We, therefore, do not expect
PRBE911A to form heterodimers with GR. The inhibition of
transactivation by GR is thus likely due to DNA-binding competition by
the mutant homodimers or by heterodimers containing the mutant and the
wild type PR. As the effect of the mutant on transactivation by
transfected PR and GR are of comparable magnitude, we suspect that
DNA-binding competition is the main mechanism of the negative dominant
effect.
The use of the point mutant to study the function of the unliganded
wild type PR could be improved by introducing additional mutations,
which change the ligand-binding specificity (44). Eventually it could
be possible to design a receptor variant that acts constitutively as a
transdominant negative mutant. This receptor variant could be expressed
under the control of an inducible promoter, for instance a
tetracycline-regulated promoter (45), to control its expression. In
this way one could study a possible participation of the unliganded PR
in cell growth and differentiation processes.
 |
MATERIALS AND METHODS
|
|---|
Chemicals and Materials
Cell culture media and sera were purchased from GIBCO/Life
Technologies (Eggenstein, Germany). [14C]Chloramphenicol,
[3H]Org2058, nitrocellulose membranes, and the enhanced
chemiluminescence (ECL) kit for Western blotting were from Amersham
Life Science (Little Chalfont, U.K.). Anti-PR antibody PR(C-19) was
purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).
Oligonucleotides were synthesized on an Applied Biosystems (Foster
City, CA) DNA synthesizer. Plasmids pTGT1.2cat and pTGT2.2cat have been
described (25). pSG5, pRSV-ßGal, hPR0, hPR2, and hPR3 plasmids were
as described previously (31). pBK-RSV was purchased from Stratagene (La
Jolla, CA).
PR Mutagenesis and Construction of the Expression Plasmids for PR
Mutants
Eight hundred base pairs of the 3'-untranslated end of
hPR0 were removed by cloning the 3.2-kb
EcoRI-ScaI fragment from hPR0 into pBK-RSV opened
with the same enzymes to yield pBK-PRB. PCR mutagenesis was performed
by using as upstream primers PR-1 mu
(5'-CCAGAAATGATGTCTGCAGTTATTGCT-3') or PR-dl
(5'CCCGGGCACTGAGTGTTGAATTTCCTCGAGCTGCACAATTACCCAAGATA-3')
and as down-stream primer a sequence from the SV40 polyadenylation
region (5'-GATGCTATTGCTTTATTTGTAACCA-3'). PR-1 mu contains a
single-base exchange (A to C, underlined) leading to
replacement of Glu911 of PRB by Ala (PRBE911A). PR-dl contains a
21-base deletion [nucleotides 28952915, numbering of Misrahi
et al.(46)] and a 3-base insertion (underlined)
behind nucleotide 2892, which creates an XhoI site
(bold) and results in the substituion of amino acids
907913 of PRB by an Arg residue (PRB
907913R). The amplified
fragments were isolated from an agarose gel and cleaved with
NotI to remove the SV40 sequences. The smaller
NotI fragments containing the mutations were used as
3'-primers in a second PCR together with the 5'-primer
PR-HindIII (5'-GGAGTTTGTCAAGCTTCAAGTTAGCCAA-3') located
further upstream in the ligand-binding domain of PR. The amplified
700-bp fragments were trimmed with HindIII and
XbaI and cloned into pBK-PR opened with the same enzymes to
yield pBK-PRBE911A and pBK-PRB
907913R. The mutations were
introduced into eukaryotic PR expression vectors by replacing the wild
type BstXI fragment of hPR0, covering the region of
mutagenesis, by the corresponding BstXI fragments of
pBK-PRBE911A and pBK-PRB
907913R, resulting in the expression
plasmids hPRBE911A and hPRB
907913R, respectively. Similarly, the
point mutation was cloned into hPRA (hPR2) and into another
N-terminal-deleted hPR lacking 550 amino acids (hPR3), leading to
hPRAE911A and hPR3E911A, respectively.
Transient Transfection and CAT Assay
CV-1, HeLa, and Cos-7 cells were maintained in DMEM supplemented
with 10% FCS. T47D cells were cultured as previously described (47).
For transfection of CV-1 or HeLa cells, 4 x 105 cells
were plated on 60-mm plates 24 h before transfection. The day of
the transfection, the medium was replaced and 1 h later the
following were added: 500 µl of a HEPES-DNA mixture, containing 3
µg of pTGT2.2cat or pTGT1.2cat, 1 µg pRSV-ßGal, and variable
amounts of the PR expression vector (wild type or its mutants),
complemented with the amount of empty pSG5 vector to reach a final
amount of 6 µg. Sixteen hours after transfection the medium was
replaced by medium with 10% charcoal-stripped FCS containing either
hormone agonists (R5020, 20 nM, or Dexamethasone, 100
nM), antihormone (RU486, 10 nM), or ethanol as
control. The cells were incubated for another 48 h. Transfection
of T47D and Cos-7 cells by the diethylaminoethyl-Dextran method was
done as previously described (47). Cell extracts were prepared by three
cycles of freezing and thawing. CAT and ß-galactosidase assays were
performed as described (47), and CAT activity was quantitated with an
Imaging Scanner (United Technologies Packard, Downers Grove, IL).
Western Blotting
Cell extracts (48) were mixed with an equal amount of
2 x SDS gel loading buffer, containing 100 mM
Tris-HCl (pH 6.8), 200 mM dithiothreitol, 4% SDS, 0.2%
bromophenol blue, and 20% glycerol, heated in boiling water for 5 min,
electrophoresed on 8% SDS acrylamide gels, and electrophoretically
transferred to a nitrocellulose membrane. The membrane was blocked with
Tris-buffer-saline (TBS) containing 0.1% Tween (TBST) and 3% skim
milk for at least 2 h at room temperature or overnight at 4 C and
washed 4 times, 10 min each, with TBST. The washed membrane was
incubated with 1:2000 diluted PR(C-19) anti-PR antibody in TBST
solutions for 90 min and washed again and incubated for 90 min with a
peroxidase-labeled anti-rabbit antibody (1:2000 dilution, included in
ECL-Kit). The membrane was washed again, and positive bands were
visualized with the enhanced chemiluminescence reagents following the
instructions of the manufacturer.
Hormone-Binding Assay
Cell extracts from Cos-7 cells transiently transfected with PRB,
PRBE911A, or PRB
907913R were prepared according to a published
protocol (48). Aliquots of the cell extracts (30 ml) were incubated on
ice for 2 h with different concentrations of
[3H]-Org2058 and with or without a 1000-fold excess of
cold ligand, in a total volume of 120 µl. An equal volume of
Dextran-coated charcoal was then added, the samples were vortexed, and
incubation was continued on ice for 10 min (49). After centrifugation
at 10,000 x g for 20 min, the radioactivities of 160
µl of supernatant and of the remaining activated-charcoal were
measured by liquid scintillation counting. The amount of total and
specifically bound ligand was calculated as described (48).
Electrophoretic Mobility Shift Assay
Nuclear extracts containing receptors were prepared from
T47D cells or transfected Cos-7 cells pretreated with 50 nM
R5020 for 1 h. Extract (5 µl) was preincubated for 10 min on ice
with 10 µl binding buffer (7 mM HEPES, pH 7.9, 4%
glycerol, 4% ficoll, 1 mM MgCl2, 0.1
mM EDTA, and 2 mM dithiothreitol) and 5 µl
Poly(deoxyinosinic-deoxycytidylic)acid, followed by incubation for 10
min at room temperature with 20,000 cpm of the 32P-labeled
double-stranded oligonucleotide
5'-AGCTTCAAGAACACAGTGTTCTAGGATC-3', which
contains a complete palindromic PRE sequence (shown in
bold). Specific competition assays were done by adding 50 ng
cold PRE oligonucleotide. The reaction mixture was analyzed by
electrophoresis using an 5% native polyacrylamide gel
(acrylamide-bisacrylamide ratio, 40:1), and the results were visualized
by autoradiography of the dried gel (25).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Pierre Chambons group in Strasbourg for PR
expression vectors and Jörg Klug for carefully reading the
manuscript.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Miguel Beato, Institut fur Molekularbiologie und Tumorforschung, Philipps Universitat, E.-Mannkopff-Strasse 2, D-35037 Marburg, Germany.
This work was supported by the Deutsche Forschungsgemeinschaft, the
Fond der Chemischen Insdutrie, and the Schering Foundation.
1 Present address: Departamento de Genética, Facultad de
Biología, Universidad de Sevilla, Reina Mercedes, Apartado
1095, E-41080 Sevilla, Spain. 
Received for publication March 26, 1997.
Revision received May 28, 1997.
Accepted for publication June 9, 1997.
 |
REFERENCES
|
|---|
-
Beato M, Herrlich P, Schütz G 1995 Steroid
hormone receptors: many actors in search of a plot. Cell 83:851857[CrossRef][Medline]
-
Schrader WT, OMalley BW 1972 Progesterone-binding
components of chick oviduct. J Biol Chem 247:5159[Abstract/Free Full Text]
-
Gronemeyer H 1992 Control of transcription activation by
steroid hormone receptors. FASEB J 6:25242529[Abstract]
-
Horwitz KB, Tung L, Takimoto GS 1997 The molecular
biology of progesterone receptors: why are there two isoforms? In:
Beier HMH, Chwalisz K (eds). The Endometrium as a Target for
Contraception. Springer, Berlin, pp 120
-
Kastner P, Krust A, Turcotte B, Stropp U, Tora L,
Gronemeyer H, Chambon P 1990 Two distinct estrogen-regulated
promoters generate transcripts encoding the two functionally different
human progesterone receptor forms A and B. EMBO J 9:16031624[Medline]
-
Meyer ME, Quirin-Stricker C, Lerouge T, Bocquel MT,
Gronemeyer H 1992 A limiting factor mediates the differential
activation of promoters by the human progesterone receptor isoforms.
J Biol Chem 267:1088210887[Abstract/Free Full Text]
-
Sartorius CA, Melville MY, Hovland AR, Tung L, Takimoto GS,
Horwitz KB 1994 A third transactivation function (AF3) of human
progesterone receptors located in the unique N-terminal segment of the
B-isoform. Mol Endocrinol 8:13471360[Abstract/Free Full Text]
-
Vegeto E, Shahbaz MM, Wen DX, Goldman ME, OMalley BW,
McDonnell DP 1993 Human progesterone receptor-A form is a cell-specific
and promoter-specific repressor of human progesterone receptor-B
function. Mol Endocrinol 7:12441255[Abstract/Free Full Text]
-
Tora L, Gronemeyer H, Turcotte B, Gaub MP, Chambon P 1988 The
N-terminal region of the chicken progesterone receptor specifies target
gene activation. Nature 333:185188[CrossRef][Medline]
-
Wen DX, Xu YF, Mais DE, Goldman ME, McDonnell DP 1994 The A
and B isoforms of the human progesterone receptor operate through
distinct signaling pathways within target cells. Mol Cell Biol 14:83568364[Abstract/Free Full Text]
-
Danielian PS, White R, Lees JA, Parker MG 1992 Identification
of a conserved region required for hormone dependent transcriptional
activation by steroid hormone receptors. EMBO J 11:10251033[Medline]
-
Bourguet W, Ruff M, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the ligand-binding domain of the human nuclear
receptor RXR-alpha. Nature 375:377382[CrossRef][Medline]
-
Renaud JP, Rochel N, Ruff M, Vivat V, Chambon P, Gronemeyer H,
Moras D 1995 Crystal structure of the RAR-
ligand-binding domain
bound to all-trans retinoic acid. Nature 378:681689[CrossRef][Medline]
-
vom Baur E, Zechel C, Heery D, Heine M, Garnier JM, Vivat V,
LeDouarin B, Gronemeyer H, Chambon P, Losson R 1995 Differential
ligand-dependent interactions between the AF-2 activation domain of
nuclear receptors and the putative transcriptional intermediary factors
mSUG1 and TIF1. EMBO J 15:110124[Medline]
-
Voegel JJ, Heine MJS, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent
activation function AF-2 of nuclear receptors. EMBO J 15:36673675[Medline]
-
Wurtz JM, Bourguet W, Renaud JP, Vivat V, Chambon P, Moras D,
Gronemeyer H 1996 A canonical structure for the ligand-binding domain
of nuclear receptors. Nature Struct Biol 3:8794[CrossRef][Medline]
-
Cavaillès V, Dauvois S, Danielian PS, Parker MG 1994 Interaction of proteins with transcriptionally active estrogen
receptors. Proc Natl Acad Sci USA 91:1000910013[Abstract/Free Full Text]
-
Lanz RB, Rusconi S 1994 A conserved carboxy-terminal subdomain
is important for ligand interpretation and transactivation by nuclear
receptors. Endocrinology 135:21832195[Abstract]
-
Ince BA, Zhuang Y, Wrenn CK, Shapiro DJ,
Katzenellenbogen BS 1993 Powerful dominant negative mutants of the
human estrogen receptor. J Biol Chem 268: 1402614032
-
Ince BA, Schodin DJ, Shapiro DJ, Katzenellenbogen BS 1995 Repression of endogenous estrogen receptor activity in MCF-7 human
breast cancer cells by dominant negative estrogen receptors.
Endocrinology 136:31943199[Abstract]
-
Hollenberg SM, Weinberger C, Ong ES, Cerelli G, Oro A, Lebo R,
Thompson EB, Rosenfeld MG, Evans RM 1985 Primary structure and
expression of a functional human glucocorticoid receptor cDNA. Nature 318:635641[CrossRef][Medline]
-
Bamberger CM, Bamberger AM, DeCastro M, Chrousos GP 1995 Glucocorticoid receptor ß, a potential endogenous inhibitor of
glucocorticoid action in humans. J Clin Invest 95:24352441
-
Oakley RH, Sar M, Cidlowski JA 1996 The human glucocorticoid
receptor ß isoform. Expression, biochemical properties, and putative
function. J Biol Chem 271:95509559[Abstract/Free Full Text]
-
Fleischmann G, Beato M 1978 Characterization of the
progesterone receptor of rabbit uterus with the synthetic progestin
16a-ethyl-21-hydroxy-19-norpregn-4-ene-3, 20-dione. Biochim Biophys
Acta 540:500517
-
Truss M, Chalepakis G, Slater EP, Mader S, Beato M 1991 Functional interaction of hybrid response elements with wild type and
mutant steroid hormone receptors. Mol Cell Biol 11:32473258[Abstract/Free Full Text]
-
Horwitz KB, Zava DT, Thilagia AK, Jensen EM, McGuire WL 1978 Steroid receptor analysis of nine human breast cancer cell lines.
Cancer Res 38:24342437[Abstract/Free Full Text]
-
Schodin DJ, Zhuang Y, Shapiro DJ, Katzenellenbogen BS 1995 Analysis of mechanisms that determine dominant negative estrogen
receptor effectiveness. J Biol Chem 270:3116331171[Abstract/Free Full Text]
-
Strähle U, Schmid W, Schütz G 1988 Synergistic
action of the glucocorticoid receptor with transcription factors. EMBO
J 7:33893395[Medline]
-
Tsai SY, Tsai MJ, OMalley BW 1989 Cooperative binding of
steroid hormone receptors contributes to transcriptional synergism at
target enhancer elements. Cell 57:443448[CrossRef][Medline]
-
Beato M 1989 Gene regulation by steroid hormones. Cell 56:335344[CrossRef][Medline]
-
Kastner P, Bocquel M, Turcotte B, Garnier J, Horwitz K,
Chambon P, Gronemeyer H 1990 Transient expression of human and chicken
progesterone receptors does not support alternative translational
initiation from a single mRNA as the mechanism generating two receptor
isoforms. J Biol Chem 265:1216312167[Abstract/Free Full Text]
-
Meyer ME, Pornon A, Ji J, Bocquel MT, Chambon P, Gronemeyer H 1990 Agonistic and antagonistic activities of RU486 on the functions of
the human progesterone receptor. EMBO J 9:39233932[Medline]
-
Carson MA, Tsai MJ, Conneely OM, Maxwell BL, Clark JH, Dobson
ADW, Elbrecht A, Toft DO, Schrader WT, OMalley BW 1987 Structure-function properties of the chicken progesterone receptor A
synthesized from complementary DNA. Mol Endocrinol 1:791801[Abstract/Free Full Text]
-
Vegeto E, Allan GF, Schrader WT, Tsai M-J, McDonnell D,
OMalley BW 1992 The mechanism of RU486 antagonism is dependent on the
conformation of the carboxy-terminal tail of the human progesterone
receptor. Cell 69:703713[CrossRef][Medline]
-
Chalepakis G, Arnemann J, Slater EP, Brüller H, Gross B,
Beato M 1988 Differential gene activation by glucocorticoids and
progestins through the hormone regulatory element of mouse mammary
tumor virus. Cell 53:371382[CrossRef][Medline]
-
Hörlein A, Näär AM, Heinzel T, Torchia J,
Gloss B, Kurokawa R, Ryan A, Kamei Y, Söderström M,
Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the
thyroid hormone receptor mediated by a nuclear receptor co-repressor.
Nature 377:397404[CrossRef][Medline]
-
Chen JD, Evans RM 1995 A transcriptional co-repressor that
interacts with nuclear hormone receptors. Nature 377:454457[CrossRef][Medline]
-
Burris TP, Nawaz Z, Tsai MJ, OMalley BW 1995 A nuclear
hormone receptor-associated protein that inhibits transactivation by
the thyroid hormone and retinoic acid receptors. Proc Natl Acad Sci USA 92:95259529[Abstract/Free Full Text]
-
Lee HS, Aumais J, White JH 1996 Hormone-dependent
transactivation by estrogen receptor chimeras that do not interact with
hsp90. Evidence for transcriptional repressors. J Biol Chem 271:2572725730[Abstract/Free Full Text]
-
Johnson J, Corbisier R, Stensgard B, Toft D 1996 The
involvement of p23, hsp90, and immunophilins in the assembly of
progesterone receptor complexes. J Steroid Biochem Mol Biol 56:3137[CrossRef][Medline]
-
Sartorius CA, Groshong SD, Miller LA, Powell RL, Tung L,
Takimoto GS, Horwitz KB 1994 New T47D breast cancer cell lines for the
independent study of progesterone B- and A-receptors: only
antiprogestin-occupied B-receptors are switched to transcriptional
agonists by cAMP. Cancer Res 54:38683877[Abstract/Free Full Text]
-
Truss M, Chalepakis G, Beato M 1992 Interplay of steroid
hormone receptors and transcription factors on the mouse mammary tumor
virus promoter. J Steroid Biochem Mol Biol 43:365378[CrossRef][Medline]
-
Slater EP, Redeuilh G, Beato M 1991 Hormonal regulation
of vitellogenin genes: an estrogen-reponsive element in the
Xenopus A2 gene and a multihormonal regulatory region in the
chicken II gene. Mol Endocrinol 5:386396[Abstract/Free Full Text]
-
Benhamou B, Garcia T, Lerouge T, Vergezac A, Gofflo D, Bigogne
C, Chambon P, Gronemeyer H 1992 A single amino acid that determines the
sensitivity of progesterone receptors to RU486. Science 255:206209[Abstract/Free Full Text]
-
Gossen M, Bujard H 1992 Tight control of gene expression in
mammalian cells by tetracycline-responsive promoters. Proc Natl Acad
Sci USA 89:55475551[Abstract/Free Full Text]
-
Misrahi M, Atger M, dAurio L, Loosfelt H, Meriel C,
Fridlansky F, Guichon-Mantel A, Galibert F, Milgrom E 1987 Complete
amino acid sequence of the human progesterone receptor deduced from
cloned cDNA. Biochem Biophys Res Commun 143:740748[CrossRef][Medline]
-
Truss M, Bartsch J, Schelbert A, Haché RJG, Beato M 1995 Hormone induces binding of receptors and transcription factors to a
rearranged nucleosome on the MMTV promoter in vivo. EMBO J 14:17371751[Medline]
-
Andrews NC, Faller DV 1991 A rapid micropreparation
technique for extraction of DNA-binding proteins from limiting numbers
of mammalian cells. Nucleic Acids Res 19:2499[Free Full Text]
-
Beato M, Feigelson P 1972 Glucocorticoid binding proteins of
rat liver cytosol. I. Separation and identification of the binding
proteins. J Biol Chem 247:78907896[Abstract/Free Full Text]
-
Gorman CM, Moffat LF, Howard BH 1982 Recombinant genomes which
express chloramphenicol acetyltransferase in mammalian cells. Mol Cell
Biol 2:10441051[Abstract/Free Full Text]
-
Lopata MA, Cleveland DW, Sollner-Webb B 1984 High level
transient expression of a chloramphenicol acetyl transferase gene by
DEAE-dextran mediated DNA transfection coupled with a dimethyl
sulfoxide or glycerol shock treatment. Nucleic Acids Res 12:57075717[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
I. Quiles, L. Millan-Arino, A. Subtil-Rodriguez, B. Minana, N. Spinedi, C. Ballare, M. Beato, and A. Jordan
Mutational Analysis of Progesterone Receptor Functional Domains in Stable Cell Lines Delineates Sets of Genes Regulated by Different Mechanisms
Mol. Endocrinol.,
June 1, 2009;
23(6):
809 - 826.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Subtil-Rodriguez, L. Millan-Arino, I. Quiles, C. Ballare, M. Beato, and A. Jordan
Progesterone Induction of the 11{beta}-Hydroxysteroid Dehydrogenase Type 2 Promoter in Breast Cancer Cells Involves Coordinated Recruitment of STAT5A and Progesterone Receptor to a Distal Enhancer and Polymerase Tracking
Mol. Cell. Biol.,
June 1, 2008;
28(11):
3830 - 3849.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Ballare, M. Uhrig, T. Bechtold, E. Sancho, M. Di Domenico, A. Migliaccio, F. Auricchio, and M. Beato
Two Domains of the Progesterone Receptor Interact with the Estrogen Receptor and Are Required for Progesterone Activation of the c-Src/Erk Pathway in Mammalian Cells
Mol. Cell. Biol.,
March 15, 2003;
23(6):
1994 - 2008.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kucera, M. Waltner-Law, D. K. Scott, R. Prasad, and D. K. Granner
A Point Mutation of the AF2 Transactivation Domain of the Glucocorticoid Receptor Disrupts Its Interaction with Steroid Receptor Coactivator 1
J. Biol. Chem.,
July 12, 2002;
277(29):
26098 - 26102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Castro, M. Arvidsson, M. B. Bolin, and T. Perlmann
Activity of the Nurr1 Carboxyl-terminal Domain Depends on Cell Type and Integrity of the Activation Function 2
J. Biol. Chem.,
December 24, 1999;
274(52):
37483 - 37490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Vaxillaire, A. Abderrahmani, P. Boutin, B. Bailleul, P. Froguel, M. Yaniv, and M. Pontoglio
Anatomy of a Homeoprotein Revealed by the Analysis of Human MODY3 Mutations
J. Biol. Chem.,
December 10, 1999;
274(50):
35639 - 35646.
[Abstract]
[Full Text]
[PDF]
|
 |
|