Molecular Endocrinology 11 (11): 1581-1592
Copyright © 1997 by The Endocrine Society
Interactions of Estrogen- and Thyroid Hormone Receptors on a Progesterone Receptor Estrogen Response Element (ERE) Sequence: a Comparison with the Vitellogenin A2 Consensus ERE
Roderick E. M. Scott,
X. Sharon Wu-Peng,
Paul M. Yen,
William W. Chin and
Donald W. Pfaff
Neurobiology and Behavior (R.E.M.S., X.S.W-P., D.W.P.),
Rockefeller University, New York, New York 10021,
Division
of Genetics, Brigham and Womens Hospital and Harvard Medical
School (P.M.Y., W.W.C.), Boston, Massachusetts 02115
 |
ABSTRACT
|
|---|
The identification of hormone response elements in
the promoter regions of hormonally regulated genes has revealed a
striking similarity between the half-site of the estrogen-response
element (ERE) and a consensus sequence constituting the thyroid
hormone-response element. Because of the potential for thyroid hormone
(T3) to affect estrogen (E)- and
progesterone-dependent female reproductive behavior via EREs, we have
begun to investigate the activity of an ERE identified in the
progesterone receptor (PR) proximal promoter and its interactions with
the estrogen receptor (ER) and thyroid hormone receptors (TR). In
addition, we have compared ER and TR interactions on the PR ERE
construct with that of the vitellogenin A2 (vit A2) consensus ERE.
Electrophoretic mobility shift assays demonstrated that TR binds to the
PR ERE as well as to the consensus ERE sequence in vitro.
Further, these two EREs were differentially regulated by
T3 in the presence of TR.
T3 in the presence of TR
increased
transcription from a PR ERE construct
5-fold and had no inhibitory
effect on E induction. Similarly, T3 also
activated a ß-galactosidase reporter construct containing PR promoter
sequences spanning -1400 to +700. In addition, the TR isoforms ß1
and ß2 also stimulated transcription from the PR ERE construct by 5-
to 6-fold. A TR
mutant lacking the ability to bind AGGTCA sequences
in vitro failed to activate transcription from the PR ERE
construct, demonstrating dependence on DNA binding. In contrast to its
actions on the PR ERE construct, TR
did not activate transcription
from the vit A2 consensus ERE but rather attenuated E-mediated
transcriptional activation. Attenuation from the vit A2 consensus ERE
is not necessarily dependent on DNA binding as the TR
DNA binding
mutant was still able to inhibit E-dependent transactivation. In
contrast to TR
, the isoforms TRß1 and TRß2 failed to inhibit
E-induced activation from the vit A2 consensus ERE. These results
demonstrate that the PR ERE construct differs from the vit A2 consensus
ERE in its ability to respond to TRs and that divergent pathways exist
for activation and inhibition by TR. Since ERs, PRs, and TRs are all
present in hypothalamic neurons, these findings may be significant for
endocrine integration, which is important for reproductive behavior.
 |
INTRODUCTION
|
|---|
Progesterone receptors (PRs) mediate the actions of the progestin
hormones and act in a sex- and tissue-specific fashion to mediate a
number of reproductive functions (1). These receptors are intranuclear
receptor proteins, which function as ligand-modulated transcription
factors and are members of a large family of related hormone-dependent
nuclear proteins, including the steroid, thyroid, and retinoid
receptors that share common functional domains (2, 3). These are
responsible for properties such as ligand binding, dimerization, DNA
binding, and transactivation (2, 4). Ligand binding is typically
followed by dimerization with subsequent binding of the ligand-receptor
complex to specific DNA sequences possessing a high level of dyad
symmetry. Such binding sites are termed "hormone-response elements"
(HRE) (5, 6) and contain perfect or imperfect palindromic or directly
repeating half-sites that are normally five to six nucleotides in
length. It is through these sequences that the steroid receptors exert
their regulatory influence on discrete genes (7, 8).
It has been demonstrated that estrogen (E) facilitates the induction of
female reproductive behavior (1). In addition, it has been demonstrated
that E is also responsible for PR induction at the level of protein as
well as mRNA in most target tissues (9, 10, 11) and that there is a strong
correlation between this induction of PR by E and the occurrence of
female reproductive behavior in rats (10, 12, 13). Further, experiments
using antisense DNA against PR mRNA (14) as well as PR blockers have
shown that synthesis and occupation of PR are required for normal
reproductive behavior (15, 16). The E-induced increase in the number of
PR mRNA-containing neurons in the ventromedial hypothalamus (VMH) and
arcuate nucleus suggests an explanation for the permissive effect of E
on progesterone (P)-facilitated reproductive behavior. By increasing
the number of PR-containing neurons present in these hypothalamic
nuclei, E increases the responsiveness of these cell groups to P.
Whereas PRs are also expressed in uterus and oviduct, PRs in the brain
are produced in a highly specific pattern, with expression limited to
discrete brain regions (17). Brain regions that contain large numbers
of PR expressing cells include the VMH, arcuate nucleus, and the
preoptic area. In addition to demonstrating tissue specificity, PR is
also regulated in a sex-specific fashion. In adult females levels of PR
mRNA are significantly increased in the VMH and arcuate nucleus after E
treatment. In contrast, E shows little or no effect on levels of PR
binding sites or mRNA in the VMH of male rats (18, 19, 20). Further, adult
females show greater sensitivity to P than males, as reflected by
dissimilarities in P-mediated neuroendocrine regulation (21) and
differences in the capacity to display the P-facilitated behavior,
lordosis (13).
The molecular mechanisms responsible for the regulation of PR gene
transcription are of primary interest for two reasons. First, insight
into its regulation yields information on the actions of an important
steroid hormone-dependent transcription factor, and second, it would
facilitate the understanding of the factors that are involved in
neuronal circuits responsible for reproductive behavior at the
molecular level. It has already been observed that the half-site of the
estrogen-response element (ERE) is identical to the half-site of the
thyroid hormone-response element (TRE) (22). Indeed, manipulations of
thyroid hormone (TH) and E in vitro potentiate or mutually
inhibit effects of gene expression (22, 23, 24). In addition, environmental
conditions that alter levels of circulating TH, such as cold
temperature, alter E-dependent female reproductive behavior (25, 26, 27, 28).
Further, recent experiments demonstrated that both exogenous and
endogenous TH interfered with E-induced sexual behavior (29).
Our laboratory, along with others, has recently cloned a large part of
the rat PR-regulatory region (30, 31) and has demonstrated that the
sequence from -1400 to +700 is responsive to E (32). A number of
potential EREs have been identified within this sequence, and one ERE
that appears to be biologically active and is found across species is
located at +617/+629 (33). Although not very frequent, intragenic
regulatory elements have been described for other genes (34, 35). An
homologous sequence that has been shown to bind estrogen receptor (ER)
as well as being transcriptionally active is found in the rabbit,
located at +698/+723 (36). The rabbit and rat PR ERE sequence is
conserved in eight of the ten positions relative to the consensus ERE.
Because of recent evidence demonstrating interactions between TRs and
EREs (22, 37), and their implication in modulating female reproductive
behavior (29), we have begun to investigate the effects of thyroid
hormone receptor (TR) on the regulation of PR. Here, the properties of
an ERE and its flanking sequence, identified in the PR promoter, were
compared with those of the well characterized consensus ERE from the
vitellogenin A2 gene. Unexpectedly, TR had distinctly different
transcriptional effects on two different EREs tested, and results
demonstrate different activity in response to T3-mediated
effects via TR. Our results show that in the presence of
T3, the TR isoforms
, ß1, and ß2 activated
transcription from a PR ERE construct and that DNA binding was
necessary for transcriptional activation. In contrast, TRs were unable
to activate transcription from the vitellogenin A2 (vit A2) ERE.
Further, TR
attenuated E-induced activation from this ERE, with DNA
binding appearing not necessary for this attenuation. In addition,
attenuation was isoform-specific in that TRß1 and ß2 had no effect
on E-induced activation.
 |
RESULTS
|
|---|
TR as Well as ER Bind to a PR- and Consensus ERE
To evaluate direct DNA-protein interactions on the putative PR ERE
as well as to the consensus ERE, electrophoretic mobility shift assay
(EMSA) was used. Initially, rat hypothalamic nuclear protein extracts
were incubated with labeled vit A2 consensus ERE (Fig. 1A
) or with labeled PR ERE probe (Fig. 1B
). To demonstrate specificity, protein binding to either probe could
be competed out with excess amount of cold probe in a
concentration-dependent manner. The lower, denser band observed with
the PR ERE probe was caused by nonspecific binding; no oligomer, even
in large molar excess, could reduce the signal of this band. Binding of
ER from hypothalamic extracts to these probes was indirectly
demonstrated by using excess cold consensus ERE to decrease levels of
bound probe. Similarly, indirect evidence of TR binding to these probes
was demonstrated by decreasing the levels of bound probe after addition
of the TREs, F2H and DR4, in excess. No such decrease was observed when
excess amounts of cold glucocorticoid response elements were added in
the assay.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 1. Hypothalamic Nuclear Factors Bind to the PR ERE and
vit A2 Consensus ERE
Hypothalamic nuclear extract (10 µg) from ovariectomized (OVX) female
rats was incubated with either the consensus ERE probe (A) or with the
PR ERE probe (B) and analyzed by EMSA as described in Materials
and Methods. The arrow in A and B indicates
position of specific binding. Cold probe was added in excess (10x or
50x), demonstrating specificity of the interaction. Specific binding
could be competed away by addition of TR binding elements F2H and DR4.
No effect on specific binding was observed with either probe when cold
glucocorticoid response elements were added in excess. The first lanes
in panel A and B show migration of the free probes. The control lane
represents labeled probe incubated with hypothalamic extract alone. The
numbers above the lanes indicate the molar excess of
unlabeled oligos added.
|
|
Initial results demonstrated a possible interaction between the PR ERE
sequence and ER and TR; thus we used purified TR
and ER to examine
their binding directly (Fig. 2
). EMSA
demonstrated that both purified ER and TR bound the vit A2 ERE (Fig. 2A
) and PR ERE sequence (Fig. 2B
) quite efficiently. Using antibodies
to ER and TR
we demonstrated that hypothalamic nuclear protein
extracts bound to these probes included ER and TR (Fig. 3
). A supershift is observed when the
ER-specific antibody H222 is added to the hypothalamic extract, whereas
a decrease in specific binding is seen when a TR
-specific antibody
is added to the hypothalamic nuclear extract. A decrease in signal is
likely caused by antibody binding to the TR and interfering with
protein-DNA interactions. These results demonstrate that ER and TR have
the ability to bind to a putative ERE on the PR promoter region as well
as to a consensus ERE.

View larger version (77K):
[in this window]
[in a new window]
|
Figure 2. Purified TR and ER Bind to the PR ERE as Well as to
the Consensus ERE
Both TR and ER bind to the vit A2 consensus ERE (A), and a supershift
is observed when the purified ER is preincubated with the ER-specific
antibody H222. No such shift is observed with control antibody.
Purified TR (0.5 pmol) or ER (0.25 pmol) incubated with the PR ERE (B)
results in a shift in mobility of the PR ERE probe. A supershift is
observed when the ER protein is preincubated with the ER-specific
antibody H222. No such shift is seen when ER is preincubated with the
control antibody.
|
|
E Responsiveness of the PR ERE
We have previously demonstrated that the region -1400/+700 of the
rat PR gene is responsive to E (32). To assess the ability of the
putative PR ERE fragment to regulate expression, we isolated the rat
sequence homologous to the rabbit sequence used in the binding studies.
This fragment (+618/630) was inserted upstream of the thymidine kinase
(tk) promoter and chloramphenicol acetyl transferase (CAT) coding
sequence. This construct was then transfected into CV-1 cells along
with 2 µg of the expression vector coding for the ER (Fig. 4A
). Only a very small increase in
transcription could be observed after addition of
10-7 M E. However, when this ERE was
placed in tandem with itself, synergistic activation of transcription
by E was observed. On the double PR ERE, ER showed moderate levels of
activation. On the triple PR ERE construct we found a relatively high
level of transcriptional activity by ER. This is similar to what has
been observed by others with this element (33). That this stimulation
of transcription was hormone dependent was demonstrated by adding
increasing concentrations of E to the transfected CV-1 cells (Fig. 4B
).
CAT activity was assayed as a function of E concentration. At the
lowest concentration (10-7 M), no effect was
observed in CV-1 cells but CAT activity increased in parallel with the
increase in E concentration.

View larger version (11K):
[in this window]
[in a new window]
|
Figure 4. Effects of E on a PR ERE-tk Promoter Construct
A, Ten micrograms of a reporter construct containing zero, one, two, or
three copies of the PR ERE sequence (+618/630+) of the rat PR gene
inserted upstream of the tk promoter sequence were co-transfected along
with 2 µg of an ER expression vector into CV-1 cells and analyzed for
E responsiveness as described in Materials and Methods.
B, The PR (ERE)3 construct activity was examined as a function of E
concentration after cotransfection with an ER expression vector into
CV-1 cells. CAT activity was determined 24 h following hormone
treatment. The results represent the mean of duplicate determinations
for a representative experiment.
|
|
Effects Of E and T3 on CAT Activity from
the Consensus ERE Compared with the PR(ERE)3
EMSA results implied that a possible role for TR as well as
ER exists in the regulation of PR expression in vivo, via
the PR ERE sequence. To investigate the transcriptional response of the
PR and consensus ERE to T3 as well as E, 2 µg ER and/or
TR
expression vectors were cotransfected into CV-1 cells with 10
µg of a CAT construct containing the tk promoter under the control of
the consensus ERE or three copies of the PR ERE. Figure 5
shows the effects of E and/or
T3 on the vit A2 consensus ERE in the presence/absence of
ER and TR
. Figure 6
shows the results
obtained with the PR ERE. Treatment with E alone stimulated CAT
activity from the vit A2 consensus (Fig. 5
) both in the presence and
absence of TR
(5- to 6-fold). Treatment with T3 alone
had no effect on the CAT activity of the vit A2 consensus ERE even in
the presence of TR
. However, addition of T3 to E-treated
cells cotransfected with the vit A2 ERE construct and TR
and ER
attenuated the E-dependent stimulation of CAT activity (see Fig. 5
). As
with the vit A2 consensus ERE, E alone stimulated CAT activity from the
PR ERE sequence (Fig. 6
). However, in contrast to the vit A2 consensus
ERE, addition of T3 in the presence of TR
alone
stimulated transcriptional activity of the PR ERE-CAT construct 5- to
6-fold (Fig. 6
). Further, unlike the consensus ERE, T3 in
the presence of TR
had no inhibitory effect on E induced stimulation
via ER of the PR ERE CAT construct.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 5. Activity of the vit A2 Consensus ERE after
Treatment with E2 and/or T3 in the Presence of
ER and/or TR
The 19-bp sequence containing the vit A2 ERE was attached to the tk
promoter, and 10 µg were cotransfected into CV-1 cells with 2 µg ER
and/or a TR expression vector as described in Materials and
Methods. Cells were treated with E (10-7
M) and/or T3 (10-7 M),
and CAT activity was measured. Values are expressed as the mean ±
SEM, where n = 34 for each duplicate experiment. *,
P < 0.01 as compared with vehicle control. #,
P < 0.01 as compared with the E-treated ER + TR
group (Newman-Keuls test). E2 and T3 had no
effect on a tk construct lacking the ERE (data not shown).
|
|

View larger version (14K):
[in this window]
[in a new window]
|
Figure 6. Activity of PR(ERE)3 after Treatment with
E2 and/or T3 in the Presence of ER and/or TR
PR(ERE)3 construct (10 µg) was transfected into CV-1 cells with 2
µg ER and/or TR and treated with E (10-7
M) and/or T3 (10-7 M)
as described The values are expressed as the mean ±
SEM, where n = 34 for each duplicate experiment. *,
P < 0.01 as compared with vehicle control.
|
|
Effects of the TR Isoforms ß1 and ß2 on Expression from the
Consensus ERE and PR(ERE)3
At least three functional isoforms of the TR, termed TR
,
TRß1, and TRß2, have been identified. Each isoform has the
potential for acting in a dissimilar manner on exposure to
T3. We thus tested the effects of the two ß-isoforms on
expression from the vit A2 consensus and PR ERE and compared them to
the results obtained previously with the TR
form (see Figs. 5
and 6
). Our previous results demonstrated an inhibitory effect by
T3 on E-induced activation from the vit A2 consensus ERE in
the presence of 2 µg TR
(Fig. 5
). In contrast, transfection with 2
µg TRß1 or TRß2 had no attenuating effect on E-induced activation
from the consensus ERE after addition of T3 (Fig. 7
, A and B). To ensure that sufficient
levels of TR ß-isoforms were present, increasing amounts of DNA were
added to the transfection. Despite the addition of up to 15 µg TR
ß1 or ß2 expression vector in the transfection, no attenuation of
E-induced activation could be detected. However, treatment of the PR
ERE-CAT construct with T3 in the presence of 2 µg TRß1
or TRß2 expression vector had a similar result as when treated in the
presence of TR
. All three isoforms activated the PR ERE in the
presence of T3 alone (5- to 7-fold), and T3 had
no attenuating effect in the presence of E (Fig. 8
).

View larger version (17K):
[in this window]
[in a new window]
|
Figure 7. Activity of the TR Isoforms ß1 and ß2 on the
vit A2 Consensus ERE-tk CAT Construct
The vit A2 consensus ERE was transfected into CV-1 cells (10 µg)
along with 2 µg ER expression vector and increasing amounts of TRß1
(A) or a TRß2 expression vector as shown. Cells were treated with E
(10-7 M) and/or T3
(10-7 M) for 24 h, and CAT activity was
subsequently assayed. Values are expressed as the mean ±
SEM, where n = 3 for a duplicate experiment. *,
P < 0.01 compared with vehicle.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Figure 8. Activity of the TR Isoforms ß1 and ß2 on the
PR(ERE)3-CAT Construct
PR(ERE)3 construct (10 µg) was transfected into CV-1 cells along with
2 µg ER expression vector and 2 µg TRß1 (A) or a TRß2 (B)
expression vector. Cells were treated with E (10-7
M) and/or T3 (10-7 M).
CAT activity was measured 24 h following addition of hormones.
Values are expressed as the mean ± SEM where n =
3 for a duplicate experiment. *, P < 0.01 as
compared with vehicle.
|
|
Inhibition by T3 on the Consensus ERE Not
Affected by a DNA-Binding Mutant of TR
, but Loss of Activation by
T3 is observed on the PR ERE
Two possible mechanisms of repression by TRs have been suggested.
In one mechanism, direct binding of the TR to the ERE is necessary to
prevent DNA access of related proteins or to act as a silencer protein.
A second possibility is that TR interacts through protein-protein
interactions to inhibit expression and is not dependent on direct
contact with DNA. To explore possible mechanisms of inhibition on the
consensus ERE, as well as to determine whether direct interaction of
the TR
with the PR ERE is necessary for the activation by
T3, cotransfection experiments with 2 µg of a mutated
TR
were performed. The TR
construct used here contains the
ligand-binding and dimerization domain as well as a portion of the
hinge region but contains a mutation in the p-box, affecting its
ability to bind DNA (38). After cotransfection of the TR
p' mutation
construct and ER expression construct with the vit A2 consensus ERE,
inhibition of E-dependent CAT activity was still observed after
addition of T3 (Fig. 9A
). In
contrast, no stimulation of the PR ERE construct was detected by
T3 after cotransfection with the TR
p' (Fig. 9B
).
Further, no effects of T3 were observed on the PR ERE on
addition of E after cotransfection of the ER expression construct along
with the TR
p' construct.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 9. Activity of a TR DNA-Binding Mutant on E
Responsiveness of the PR (ERE)3 and Consensus ERE-tk Promoter Construct
The PR (ERE)3 and consensus ERE reporter vectors were transfected into
CV-1 cells as described in Materials and Methods along
with 2 µg ER expression vector and 2 µg TR DNA-binding mutant
expression vector. After transfection, cells were treated for 24 h
with 10-7 M E, 10-7 M
T3, or vehicle. The activity of the constructs was assessed
by CAT assays as described in Materials and Methods.
Values are expressed as the mean ± SEM where n =
34. *, P < 0.01 as compared with vehicle. #,
P < 0.01 compared with E2 treatment
group.
|
|
Activation by T3 of PR Promoter
Sequences
The endogenous PR promoter does not contain three identical copies
of an ERE arranged in tandem, and therefore the PR (ERE)3 construct
used in these studies is somewhat artificial. We therefore tested the
responsiveness of a single PR ERE copy to T3 (Fig. 10A
). After cotransfection of 10 µg
of a CAT construct containing a single copy of the PR ERE attached to a
tk promoter and 2 µg of a TR
expression vector, CAT activity was
increased
2-fold after treatment with T3. In addition,
we tested the responsiveness of the PR promoter sequence from -1400 to
+700 attached to a ß-galactosidase reporter gene, which we have
previously demonstrated to be responsive to E (32). Upon transfection
and after addition of 10-7 M T3,
the PR promoter sequence was able to initiate transcription of the
ß-galactosidase gene, and ß-galactosidase activity was observed
(Fig. 10B
). This activity was hormone dependent, and little activity
was observed when treated with vehicle. No activity was observed in the
absence of the PR promoter sequence.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 10. Effects of T3 on PR Promoter Sequences
A, Ten micrograms of a CAT reporter construct containing a single copy
of the PR ERE sequence (+618/+630) were cotransfected along with 2 µg
of a TR expression vector into CV-1 cells and examined for
T3 responsiveness. Values are expressed as the mean ±
SEM where n = 3. B, CV-1 cells were cotransfected with
10 µg of a PR reporter construct containing the ß-galactosidase
gene under the regulation of a PR promoter fragment spanning
-1400/+700, along with 2 µg of a TR expression vector. After
treatment with either T3 (10-7 M)
or vehicle for 24 h, cells were fixed and stained for
ß-galactosidase activity.
|
|
 |
DISCUSSION
|
|---|
Accumulated evidence has demonstrated that control of E-responsive
gene regulation can be quite complex (39). Several lines of evidence
indicate that gene regulation by E and EREs involve not only ER but
also other transcription factors and DNA-binding proteins. For example,
other members of the nuclear hormone receptor family such as TR,
retinoid X receptor and retinoic acid receptor have been shown to
interact with EREs in addition to their cognate response elements (22, 37, 40). Recently, it has been proposed that T3 and its
receptor play a role in the inhibition of E-dependent reproductive
behavior (29). PR, along with ER, plays a central role in this specific
behavior; this suggests that TR could be playing a direct role on PR by
down-regulating its promoter activity. Thus, we began to examine the
effects of TR and its ligand T3 on binding and
transcriptional activities of E-induced activation from a PR ERE and
its flanking sequence. Our experiments compare and contrast the results
obtained with the consensus vit A2 ERE with those obtained with an ERE
and adjacent flanking sequences found on the PR gene.
ER and TR interact on the PR ERE
Initially, to identify some of the hypothalamic factors that could
associate with these EREs, interactions of a PR-ERE and a consensus ERE
from the vit A2 gene with nuclear protein extracts from rat
hypothalamus were examined. The results from both the competition
assays and supershift assays suggest that ER was present in these
extracts and could bind to the PR ERE. The presence of ER in rat
hypothalamic extract is consistent with ligand binding,
immunocytochemical, and in situ hybridization assays
(41, 42, 43). However, what is perhaps of greater interest is that TREs
were able to compete for specific binding with the PR ERE and vit A2
ERE probes and that preincubation of the hypothalamic nuclear extract
with a TR antibody was able to diminish binding to the PR ERE probe.
Further, purified TR
protein was able to bind to the PR ERE as well
as the vit A2 ERE. In addition, it has recently been shown that TRß1
and TRß2 can also interact with the consensus ERE (44). These results
demonstrate that hypothalamic TR as well as ER can potentially interact
on the PR ERE and its adjacent flanking sequence. The rat medial
hypothalamus has both ER- and TR-containing neurons in overlapping
regions, including the VMN (45, 46, 47). These results therefore suggest
that TRs can interact with E-responsive genes in the hypothalamus, such
as PR, with the potential to affect behavioral systems.
Transcriptional Regulation of the PR and vit A2 EREs by ER and
TR
Our results demonstrate that the imperfect ERE located at
+617/+629 of the rat PR first exon has endogenous responsiveness to E
as well as an ability to bind ER. In addition, the homologous sequence
found in the rabbit gene has shown a similar responsiveness to E (36).
However, it is clear from a number of studies that natural HREs rarely
conform to the idealized consensus sequence. Such deviations from the
consensus sequence can affect binding and transcriptional activity of
the cognate receptor. It appears that the change of two bases within
the core PR ERE and the different flanking sequences are sufficient to
result in a weaker responsiveness to E when compared with the strong
activational activity observed with the vit A2 ERE. It is likely that
together, the different imperfect EREs identified within the endogenous
PR promoter can synergize to result in a strong response to E.
In addition to E, liganded TR also resulted in activation from the PR
ERE construct, and this activation was observed with all isoforms of TR
examined. Liganded TR
also activated a ß-galactosidase reporter
gene attached to a -1400/+700 bp PR promoter sequence in CV-1 cells.
The TR
DNA-binding mutant failed to activate transcription from the
PR ERE construct, demonstrating that transcriptional activation by TR
was DNA dependent, supporting our EMSA analysis. Activation by liganded
TR was observed from a single PR ERE element, thereby discounting the
possibility that an artificial TRE had been created during subcloning
of the multiple construct. However, it remains possible that
transcriptional activation by TRs from the PR ERE construct is via an
imperfect TRE that might exist adjacent to, or even overlapping, the
ERE identified in the PR promoter and that is contained within the
flanking region of the ERE itself.
In light of recent findings showing an inhibitory effect of
T3 on E- and P-stimulated reproductive behavior (29), these
results demonstrating activation of the PR ERE construct by liganded TR
were somewhat unexpected. However, we cannot rule out the possibility
that T3 inhibits PR expression within the context of the
cellular environment of the hypothalamus or that other neuronal
circuits interact with T3 to alter levels of the PR gene in
an inhibitory fashion. We are examining this question in
vivo by in situ hybridization for PR mRNA after
treatment with E and T3 in brain sections, as well as by
solution hybridization with pituitary and hypothalamic RNA
extracts.
In contrast to the effects of liganded TR on the PR ERE, however, we
have demonstrated that addition of T3 in the presence of
TR
leads to attenuation of E-induced activation of the vit A2
consensus ERE-reporter gene. This is consistent with previous reports
examining the effects of TR on E-induced activation from the vit A2 ERE
(22). Many nuclear receptors, including TR, have been shown to exert
transcriptional control by both inductive and inhibitory mechanisms,
depending on the cell context, hormone status, and DNA-binding site,
including flanking sequences of the HRE (48). Our findings have
demonstrated that liganded TR
both activates transcription from one
ERE (PR ERE) and also inhibits E-induced activation from another ERE
(vit A2 consensus ERE), both within the context of the same cell type.
In addition, attenuation of E-induced activation from the vit A2
consensus ERE by liganded TR appears to be isoform-specific as under
these conditions, in contrast to the
-form, the ß-forms of TR have
no effect on E-induced activation. Higher amounts of TR plasmids were
tested to ensure that sufficient TR ß-isoform were present. Despite
this, addition of up to 15 µg TR ß1 or ß2 expression plasmid was
still insufficient to detect attenuation of E-induced activation from
the vit A2 consensus ERE. However, under identical conditions, 2 µg
of the ß-forms were sufficient to activate transcription from the PR
ERE construct, and further that a F2H-reporter fusion gene
is induced by both the
- and ß1-form in CV-1 cells (our
unpublished observation). A similar result was observed when
T3 regulation of TR responsive genes was examined (49). In
addition, TR isoform-specific action has been reported for the
repression of glucocorticoid receptor-mediated transcriptional
activation (50).
Inhibitory regulation of gene transcription has been reported in a
number of systems (for review see 51 . For example, the formation
of inactive dimers may block transcriptional activity (52, 53), while
in some cases it appears that the mechanism of inhibition involves
competition of the inhibitory and activating factors for binding to the
appropriate DNA-regulatory sequence (37, 54). Negative regulation may
also result as a consequence of protein-protein interactions and does
not require DNA binding (55, 56). Our results demonstrate that a TR
DNA-binding mutant retains the ability to attenuate the E-induced
activation from the vit A2 consensus ERE. This indicates that the
inhbitory function of TR
can be mediated through protein-protein
interactions, and that TR binding to the ERE alone is not necessary for
this inhibition. For example, a "squelching" mechanism may be
occurring whereby ER and TR share common transcription factors or
coactivators. Such a model has been reported to be in operation in
other systems (57). In contrast, transcriptional activation from the PR
ERE construct by TR was strictly DNA-dependent, suggesting that
divergent pathways exist for transcriptional activation and inhibition
by TR. A similar study demonstrated that ER and glucocorticoid receptor
could block T3-mediated transcriptional activity but had
little if any effect on repression of basal transcription by unliganded
TR (58). In addition, TR binding to the HRE is enhanced by association
with TR auxiliary proteins, and it is clear that these proteins play an
important role in T3 mediated transcription (59, 60).
Our results demonstrate that liganded TR can interact with a sequence
present in the PR promoter and regulate transactivation from that
promoter. That the hypothalamus has neurons containing ER, PR, and TR
further raises the possibility that TR can directly interact with the
PR promoter to regulate its activity. Such interactions among hormonal
systems are biologically relevant given the implications that
circulating TH can have on reproductive behavior.
 |
MATERIALS AND METHODS
|
|---|
All general reagents were of molecular biology grade and were
purchased from Sigma Chemical Co. (St. Louis, MO), Fisher Scientific
(Houston, TX), and Promega (Madison, WI). Custom oligonucleotides were
purchased from Oligos Etc Inc (Wilsonville, OR). DNA restriction and
modifying enzymes were obtained from Boeringer Mannheim (Indianapolis,
IN). 32P-radiolabeled nucleotides and
[14C]chloramphenicol were from DuPont/New England Nuclear
Corp (Boston, MA). Sera, antibiotics, and other cell culture reagents
were from Sigma and GIBCO/BRL (Gaithersberg, MD).
Electrophoretic Mobility Shift Assays
All animal studies were conducted in accord with the principles
and procedures outlined in "Guidelines for care and use of
experimental animals." Sprague-Dawley rats used for EMSA experiments
were maintained in a 12-h light, 12-h dark cycle and fed water and chow
ad libitum. Ovariectomy and gonadectomy were performed by
the supplier (Charles River, Wilmington, MA) and hormone treatments
were carried out 10 days after surgery. Estradiol benzoate (Sigma Co,
St Louis, MO) was dissolved in vehicle (sesame oil). Three hours after
hormone treatment, rats were treated by CO2 narcosis and
decapitated.
Due to its availability at the outset of these studies, initial
DNA-binding analysis was carried out using the rabbit PR ERE (+698/723)
as probe. Subsequent studies involving transcriptional regulation were
done using the equivalent sequence identified from the rat PR promoter,
after cloning in our laboratory. Nuclear extracts from the hypothalamus
of male and female rats were prepared as described previously (61). Ten
picomoles of double-stranded oligonucleotide, which had been annealed
previously, were labeled by T4 polynucleotide kinase with
[
-32P]ATP, and 20,000 cpm (510 fmol) were incubated
together with 10 µg nuclear extract for 30 min at room temperature
along with 1 µg poly(deoxyinosinic-deoxycytidylic)acid in a final
reaction volume of 20 µl of a buffer consisting of 10 mM
HEPES (pH 7.8), 10% glycerol, 50 mM KCl, 0.1
mM EDTA, and 5 mM phenylmethylsulfonyl
fluoride. Where appropriate, double-stranded cold competitor
oligonucleotide was added to the extract for 15 min at room temperature
before addition of labeled probe. The entire reaction mixture was
electrophoresed through a 5% polyacrylamide gel in 0.5x
Tris-borate-EDTA for 23 h at
150 V. Gels were dried and subjected
to autoradiography at -70 C. For experiments involving antibodies, the
reaction mixture was incubated with antibodies (1 µl) at 4 C
overnight before addition of labeled probe. Where indicated, purified
protein was used instead of hypothalamic extracts and treated under
similar conditions as described above. The rat TR
protein was from a
crude extract from a baculovirus-expressed TR in Sf9 cells. The human
ER was prepared from a Sf9 cell extract and purified by ERE-affinity
chromatography, and the purity was estimated at greater than 90%.
Oligomers and Plasmid Construction
The following oligonucleotides were used as either nuclear
protein-binding sites or competitors in gel retardation assays.
PR ERE: 5'GTTCAGGTCGACATGACTGAGGTGAAGGC-A3'
Consensus ERE: 5'AATTCGTCCAAAGTCAGGTCACAGTGACCTGATCAAAGTT3'
DR4: 5'ACTTATTGAGGTCACACTAGGTCAAGTTACG3'
Fig 2H
: 5'TTATTGACCCCAGCTGAGGTCAAGTTACG3'
PR ERE constructs containing one, two, or three copies of the rat ERE
sequence were made by annealing the following combinations of
single-stranded oligomers and ligating the resultant double-stranded
oligomers via their compatible overhangs into the vector digested with
the appropriate restriction enzymes. All cloning was done using
standard techniques (62). Thus, oligos 1 and 2 were annealed and
ligated via their compatible ends into the CAT vector previously
digested with HindIII and SalI. Oligos 3 and 4
were then annealed and ligated via their compatible ends into the CAT
vector already containing one copy of the PR ERE previously digested
with SalI and XbaI. Finally, oligos 5 and 6 were
annealed and ligated via their compatible ends into the CAT vector
already containing two copies of the PR ERE previously digested with
XbaI and BamHI. Correct orientation of the
inserted DNA fragments was confirmed by sequencing and restriction
digest analysis.
1. 5'AGCTTAAAAGGGGATCTCGGGTCGTCATGACTGA-GCTGCAGGCAAATG3' and
2. 5'TCGACCTTTGCCTGCAGCTCAGTCATGACGACCC-GAGATCCCCTTTTA3'.
3. 5'TCGACAAAAGGGGATCTCGGGTCGTCATGACTGA-GCTGCAGGCAAAGT3' and
4. 5'CTAGACTTTGCCTGCAGCTCAGTCATGACGACCC-GAGATCCCCTTTTG3'.
5. 5'CTAGAAAAAGGGGATCTCGGGTCGTCATGACTGA-GCTGCAGGCAAAGG3' and
6. 5'GATCCCTTTGCCTGCAGCTCAGTCATGACGACCC-GAGATCCCCTTTTT3'.
Cell Culture and CAT Assays
For transfection and subsequent CAT assays the African Green
Monkey kidney cell line CV-1 was used and maintained in DMEM
supplemented with 10% FBS, 100 µg/ml glutamine. Before transfection,
cells were plated on 60-mm plates and grown to 6080% confluency in
phenol red-free DMEM supplemented with 5% charcoal-stripped FBS. All
media included penicillin (100 U/ml) and streptomycin (100 µg/ml).
Transfection studies were carried out using the calcium phosphate
procedure described previously (63). Each plate received 10 µg CAT
reporter plasmid and 2 µg receptor expression plasmid. When the dose
response of TRß expression plasmids was tested, 5 µg, 10 µg, or
15 µg receptor expression plasmid were added to each 60-mm plate.
Supercoiled plasmid DNA was prepared using plasmid DNA preparation kits
(Qiagen, Chatsworth, CA). A ß-galactosidase reporter plasmid
(Promega, Madison, WI) was included in the transfection for
normalization between samples. Bluescript SK-plasmid was added to the
transfection mixture, so that 20 µg DNA were applied to each plate.
Media were removed 1214 h after addition of DNA and replaced with 5%
stripped FBS medium supplemented with vehicle, 17-ß-estradiol
(E2), T3, or both, after a 30-min incubation in
medium containing 5% stripped serum. Cells were harvested after
24 h and lysed by repeated freeze-thawing in 0.25 M
Tris, pH 7.8. CAT assays were carried out as previously described (63).
CAT assays were normalized by either protein content via the Bradford
procedure (64) or by ß-galactosidase activity for each sample. All
assays were visualized by autoradiography using
[14C]chloramphenicol (50 Ci/mmol), and the conversion of
chloramphenicol to acetylated forms was quantified by liquid
scintillation counting of TLC-separated material.
Staining for ß-Galactosidase Activity
CV-1 cells were plated on 60-mm plates and grown to 6080%
confluency and transfected with 2 µg TR
and 10 µg of the PR
promoter sequence spanning -1400 to +700 attached to a
ß-galactosidase reporter gene. Cells were then treated with
T3 or vehicle for 24 h. Cells were fixed in a 2%
formaldehyde, 0.2% gluteraldehyde solution and stained in a solution
containing X-gal (40 mg/ml in dimethyl formamide) to give a final
concentration of 1 mg/ml. In addition, the staining solution contained
5 mM K ferricyanide, 5 mM K ferrocyanide, and 2
mM MgCL2. This solution was used to detect
ß-galactosidase activity.
Statistics
The data are expressed as the mean ± SEM and
were analyzed by ANOVA, with multiple comparisons by the method of
Newman-Keuls when ANOVA was significant (P <
0.01).
 |
ACKNOWLEDGMENTS
|
|---|
We are thankful to Dr. A. Notides for the purified ER and to Dr.
G. Greene for the ER-specific antibody H222.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Dr. Roderick E. M. Scott, Department of Neurobiology and Behavior, Rockefeller University, 1230 York Avenue, New York, New York 10021.
This work was supported by NIH Grant HD-0571 (to D.W.P.) and Endocrine
Research Training Grant 2T32DK07313 (to R.E.M.S.).
Received for publication December 30, 1996.
Revision received June 25, 1997.
Accepted for publication July 7, 1997.
 |
REFERENCES
|
|---|
-
Pfaff DW, Schwartz-Giblin S 1994 In: Knobil E, Neill J
(eds) The Physiology of Reproduction, ed 2. Raven Press, New York, pp
107220
-
Evans RM 1988 The steroid and thyroid hormone receptor
superfamily. Science 240:889895[Abstract/Free Full Text]
-
Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G,
Kazuhiko U, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The
nuclear receptor superfamily: the second decade. Cell 83:835839[CrossRef][Medline]
-
Glass CK 1994 Differential recognition of target genes by
nuclear receptor monomers, dimers, and heterodimers. Endocr Rev 15:391407[CrossRef][Medline]
-
Yamamoto KR, 1985 Steroid receptor regulated transcription of
specific genes and gene networks. Annu Rev Genet 19:209252[CrossRef][Medline]
-
Beato M 1989 Gene regulation by steroid hormones. Cell 56:335344[CrossRef][Medline]
-
Landers JP, Spelsberg TC, 1992 New concepts in steroid
hormone action: transcription factors, proto-oncogenes, and the cascade
model for steroid regulation of gene expression. Crit Rev Eukar Gene
Exp 2:1963[Medline]
-
Freedman LP, Luisi BF 1993 On the mechanism of DNA binding by
nuclear hormone receptors: a structural and functional perspective. J
Cell Biochem 51:140150[CrossRef][Medline]
-
MacLusky NJ, McEwen BS 1980 Progestin receptors in rat brain:
distribution and properties of cytoplasmic progestin binding sites.
Endocrinology 106:192201[Abstract]
-
Parsons B, MacLusky, NJ, Krey, L, Pfaff DW, McEwen BS 1980 The
temporal relationship between estrogen-inducible progestin receptors in
the female rat brain and the time course of estrogen activation of
mating behavior. Endocrinology 107:774779[Medline]
-
Romano GJ, Krust A, Pfaff DW 1989 Expression and estrogen
regulation of progesterone receptor mRNA in neurons of the mediobasal
hypothalamus: an in situ hybridization study. Mol Endocrinol 3:12951300[Abstract]
-
Whalen RE 1974 Estrogen-progesterone induction of mating in
female rats. Horm Behav 5:157162[CrossRef][Medline]
-
Olster DH, Blaustein JD 1988 Progesterone facilitation of
lordosis in male and female rats following priming with estradiol
pulses. Horm Behav 22:294304[CrossRef][Medline]
-
Ogawa S, Olazabal UE, Parhar IS, Pfaff DW 1994 Effects of
intrahypothalamic administration of antisense DNA for progesterone
receptor mRNA on repoductive behavior and progesterone receptor
immunoreactivity in female rat. J Neurosci 14:17661774[Abstract]
-
Brown TJ, Blaustein JD 1984 Inhibition of sexual behavior in
female guinea pigs by a progestin receptor antagonist. Brain Res 301:343349[CrossRef][Medline]
-
Vathy IU, Etgen AM, Barfield RJ 1989 Actions of RU 38486 on
progesterone facilitation and sequential inhibition of rat estrous
behavior: correlation with neural progestin receptor levels. Horm Behav 23:4356[CrossRef][Medline]
-
Parsons B, Rainbow TC, Maclusky NJ, McEwen BS 1982 Progestin
receptors in rat hypothalamic and limbic nuclei. J Neurosci 2:1446452[Abstract]
-
Rainbow TC, Parsons B, McEwen BS, 1982 Sex differences in rat
oestrogen and progestin receptors. Nature 300:648649[CrossRef][Medline]
-
Brown TJ, Clark AS, MacLusky NJ 1987 Regional sex differences
in progesterone receptor induction in the rat hypothalamus: effects of
various doses of estradiol benzoate. J Neurosci 7:25292536[Abstract]
-
Lauber AH, Romano GJ, Pfaff DW 1991 Sex difference in
estradiol regulation of progestin receptor mRNA in rat mediobasal
hypothalamus as demonstrated by in situ hybridization.
Neuroendocrinology 53:608613[Medline]
-
Negro-Vilar A, Tesone M, Johnston CA, Depaolo L, Justin SN 1984 Sex differences in regulation of gonadotropin secretion:
involvement of central monoaminergic and peptidergic systems and brain
steroid receptors. In: Sexual Differentiation: Basic and Clinical
Aspects. Raven Press, New York, pp 107118
-
Glass CK, Holloway JM, Devary OV, Rosenfeld MG 1988 The
thyroid hormone receptor binds with opposite transcriptional effects to
a common sequence motif in thyroid hormone and estrogen response
elements. Cell 54:313323[CrossRef][Medline]
-
Zhou-Li F, 1992 Antiestrogens prevent the stimulatory effects
of L-triiodothyronine on cell proliferation. Endocrinology 130:11451152[Abstract]
-
Zhou-Li F 1993 Interference between estradiol and
L-triiodothryonine in the control of proliferaton of a pituitary tumor
cell line. J Steroid Biochem Mol Biol 45:275279[CrossRef][Medline]
-
Hoar RM, Goy RW, Young WC 1957 Loci of action of thyroid
hormone on reproduction in the female guinea pig. Endocrinology 60:337346
-
Piacsek BE, Nazian SJ, Thermal influences on sexual maturation
in the rat. In: Gilmore D, Cooke B (eds) Environmental Factors in
Mammalian Reproduction. McMillan, London, pp 215231
-
Bronson FH 1985 Mammalian reproduction: an ecological
perspective. Biol Reprod 31:126[Abstract]
-
Schneider JE, Wade GN 1990 Effects of diet and body fat on
cold-induced anestrus in syrian hamsters. Am J Physiol
259:R1198R1204
-
Dellovade TL, Zhu Y-S, Krey L, Pfaff DW 1996 Thyroid hormone
and estrogen interact to regulate behavior. Proc Natl Acad Sci USA 93:1258112586[Abstract/Free Full Text]
-
Kraus WL, Montano MM, Katzenellenbogen BS 1993 Cloning of the
rat progesterone receptor gene 5'-region and identification of two
functionally distinct promoters. Mol Endocrinol 7:16031616[Abstract]
-
Wu-Peng XS, Pfaff DW, Estrogen regulation of the rat
progesterone receptor (PR) gene. Program of the 24th Annual Meeting of
the Society for Neuroscience, Miami Beach, FL, 1994, p 56 (Abstract
30.20)
-
Scott REM, Wu-Peng XS, Yen PM, Chin WW, Pfaff DW, Hypothalamic
nuclear DNA binding, activity of a progesterone receptor promoter
estrogen response element. Program of the 10th International Congress
of Endocrinology, San Francisco, 1996, p 139 (Abstract P117)
-
Kraus WL, Montano MM, Katzenellenbogen 1994 Identification of
multiple, widely spaced estrogen-responsive regions in the rat
progesterone receptor gene. Mol Endocrinol 8:952969[Abstract]
-
Queen C, Baltimore D 1983 Immunoglobulin gene transcription is
activated by downstream sequence elements. Cell 33:741748[CrossRef][Medline]
-
Sap J, De Magistris L, Stunnenberg H, Vennstrom B 1990 A major
thyroid hormone response element in the third intron of the rat growth
hormone gene. EMBO J 9:887896[Medline]
-
Savouret, JF, Bailly A, Misrahi M, Rauch M, Redeuilh G,
Chauchereau A, Milgrom E 1991 Characterization of the hormone
responsive element involved in the regulation of the progesterone
receptor gene. EMBO J 10:18751883[Medline]
-
Segars JH, Marks MS, HirschfeldS, Driggers PH, Martinez E,
Grippo JF, Wahli W, Ozato K 1993 Inhibition of estrogen-responsive gene
activation by the retinoic x receptor ß: evidence for multiple
inhibitory pathways. Mol Cell Biol 13:22582268[Abstract/Free Full Text]
-
Yen PM, Ikeda M, Wilcox EC, Brubaker JH, Spanjaard RA,
Sugawara A, Chin WW 1994 Half site arrangement of hybrid glucocorticoid
and thyroid hormone response elements specifies thyroid hormone
receptor complex binding to DNA and transcriptional activity. J
Biol Chem 269:1270412709[Abstract/Free Full Text]
-
Gronemeyer H 1991 Transcription activation by estrogen and
progesterone receptors. Annu Rev Genet 25:89123[CrossRef][Medline]
-
Savouret J-F, Rauch M, Redeuilh G, Sokhavuth S, Chauchereau A,
Woodruff K, Parker MG, Milgrom E 1994 Interplay between estrogens,
progestins, retinoic acid and AP-1 on a single regulatory site in the
progesterone receptor gene. J Biol Chem 269:2895528962[Abstract/Free Full Text]
-
Lauber AH, Romano GJ, Mobbs CV, Pfaff DW 1990 Estradiol
regulation of estrogen receptor messenger ribonucleic acid in rat
mediobasal hypothalamus: an in situ hybridization study.
J Neuroendocrinol 2:605611[CrossRef]
-
Blaustein JD, Lehman MN, Turcotte JC, Greene G 1992 Estrogen
receptors in dendrites and axon terminals in the guinea pig
hypothalamus. Endocrinology 131:281290[Abstract]
-
Simerly RB, Chang C, Muramutsa M, Swanson LW 1990 Distribution
of androgen and estrogen receptor mRNA-containing cells in the rat
brain: an in situ hybridization study. J Comp Neurol 294:7695[CrossRef][Medline]
-
Zhu, Y-S, Yen PM, Chin WW, Pfaff DW 1996 Estrogen and thyroid
hormone interaction on regulation of gene expression. Proc Natl Acad
Sci USA 93:1258712592[Abstract/Free Full Text]
-
Cook CB, Kakucska I, Lechan RM, Koenig RJ 1992 Expression of
thyroid hormone receptor ß2 in rat hypothalamus. Endocrinology 130:10771079[Abstract]
-
Bradley DJ, Towle HC, Young S 1992 Spatial and temporal
expression of
- and ß-thyroid hormone receptor mRNAs, including
the ß2-subtype, in the developing mammalian nervous system. J
Neurosci 12:22882302[Abstract]
-
Lechan RM, QIY, Berrodin TJ, Davis KD, Schwartz HL, Strait KA,
Oppenheimer JH, Lazar MA 1993 Immunocytochemical delineation of thyroid
hormone receptor ß2-like immunoreactivity in the rat central nervous
system. Endocrinology 132:24612469[Abstract]
-
Mader S, Leroy P, Chen J-Y, Chambon P 1993 Multiple parameters
control the selectivity of nuclear receptors for their response
elements. J Biol Chem 268:591600[Abstract/Free Full Text]
-
Forman BS, Marc B, Yang C-R, Stanley F, Casenova J, Samuals HH 1988 c-erbA protooncogenes mediate thyroid hormone-dependent and
independant regulation of the rat growth hormone and prolactin genes.
Mol Endocrinol 2:902911[Abstract]
-
Spanjaard RA, Nyugen VYP, Chin WW 1995 Repression of
glucocorticoid receptor-mediated transcriptional activation by
unliganded thyroid hormone receptor (TR) is TR isoform-specific.
Endocrinology 136:50845092[Abstract]
-
Yen PM, Chin WW 1994 Molecular mechanisms of dominant negative
activity by nuclear hormone receptors. Mol Endocrinol 8:14501454[CrossRef][Medline]
-
Tung L, Mohamed MK, Hoeffler JP, Takimoto GS, Horwitz KB 1990 Antagonist-occupied human progesterone B-receptors activate
transcription without binding to progesterone response elements and are
dominantly inhibited by A-receptors. Mol Endocrinol 7:12561265[Abstract]
-
Vegeto E, Shahbaz MM, Wen DX, Goldman ME, OMalley BW,
McDonnell DP 1993 Human progesterone receptor A form is a cell- and
promoter-specific repressor of human progesterone receptor B function.
Mol Endocrinol 7:12441255[Abstract]
-
Sakai DD, Helms S, Carlsted-Duke J, Gustafsson JA, Rottman FM,
Yamamoto KR 1988 Hormone-mediated repression: a negative glucocorticoid
response element from the bovine prolactin gene. Genes Dev 2:11441154[Abstract/Free Full Text]
-
Yang-Yen HF, Chambard JL, Sun YL, Smeal T, Schmidt, TJ, Drouin
J, Karin M 1990 Transcriptional interference between c-Jun and the
glucocorticoid receptor: mutual inhibition of the DNA binding due to
direct protein-protein interactions. Cell 62:12051215[CrossRef][Medline]
-
Konig H, Ponta H, Rahmsdorf HJ, Herrlich P 1992 Interference
between pathway-specific transcription factors: glucocorticoids
antagonize phorbol ester-induced AP-1 activity without altering AP-1
site occupation in vivo. EMBO J 11:22412246[Medline]
-
Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung
L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:11671177[Abstract]
-
Yen PM, Wilcox EC, Chin WW 1995 Steroid hormone receptors
selectively affect transcriptional activation but not basal repression
by thyroid hormone receptors. Endocrinology 136:440445[Abstract]
-
Yen PM, Darling DS, Cater RL, Forgione M, Umeda PK, Chin WW 1992 Triiodothryonine (T3) decreases binding to DNA by T3-receptor
homodimers but not receptor- auxiliary protein heterodimers. J
Biol Chem 267:35653568[Abstract/Free Full Text]
-
Sande S, Privalsky ML 1996 Identification of TRACs (T3
receptor associated cofactors), a family of cofactors that associate
with and modulate the activity of nuclear hormone receptors. Mol
Endocrinol 10:813829[Abstract]
-
Zhu Y-S, Pfaff DW 1994 Protein-DNA binding assay for analysis
of steroid sensitive neurons in mammalian brain. Methods Neurosci 22:245264
-
Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A
Laboratory Manual, ed 2. Cold Spring Harbor Press, Cold Spring Harbor,
NY
-
Gorman C 1985 High efficiency gene transfer into mammalian
cells. In: Glover DM (ed) DNA Cloning: A Practical Approach. IRL Press,
Washington DC, vol 3:143190
-
Bradford MM 1976 A rapid and sensitive method for the
quantification of microgram quantites of protein utilizing the
principle of protein-dye binding. Anal Biochem 72:248254[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
R. O'Lone, M. C. Frith, E. K. Karlsson, and U. Hansen
Genomic Targets of Nuclear Estrogen Receptors
Mol. Endocrinol.,
August 1, 2004;
18(8):
1859 - 1875.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Vasudevan, S. Ogawa, and D. Pfaff
Estrogen and Thyroid Hormone Receptor Interactions: Physiological Flexibility by Molecular Specificity
Physiol Rev,
October 1, 2002;
82(4):
923 - 944.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Fitts, R. M. Klein, and C. A. Powers
Estrogen and Tamoxifen Interplay with T3 in Male Rats: Pharmacologically Distinct Classes of Estrogen Responses Affecting Growth, Bone, and Lipid Metabolism, and Their Relation to Serum GH and IGF-I
Endocrinology,
October 1, 2001;
142(10):
4223 - 4235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q.-L. Li, E. Jansen, G. A. Brent, and T. C. Friedman
Regulation of prohormone convertase 1 (PC1) by thyroid hormone
Am J Physiol Endocrinol Metab,
January 1, 2001;
280(1):
E160 - E170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q.-L. Li, E. Jansen, G. A. Brent, S. Naqvi, J. F. Wilber, and T. C. Friedman
Interactions between the Prohormone Convertase 2 Promoter and the Thyroid Hormone Receptor
Endocrinology,
September 1, 2000;
141(9):
3256 - 3266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kurita, K.-j. Lee, P. S. Cooke, J. A. Taylor, D. B. Lubahn, and G. R. Cunha
Paracrine Regulation of Epithelial Progesterone Receptor by Estradiol in the Mouse Female Reproductive Tract
Biol Reprod,
April 1, 2000;
62(4):
821 - 830.
[Abstract]
[Full Text]
|
 |
|