help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sharma, A.
Right arrow Articles by Stein, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sharma, A.
Right arrow Articles by Stein, R.
Molecular Endocrinology 11 (11): 1608-1617
Copyright © 1997 by The Endocrine Society

Analysis of the Role of E2A-Encoded Proteins in Insulin Gene Transcription

Arun Sharma1, Eva Henderson, Laura Gamer2, Yuan Zhuang and Roland Stein

Department of Molecular Physiology and Biophysics (A.S., E.H., R.S),
Department of Cell Biology (L.G., R. S.), Vanderbilt University Medical Center, Nashville, Tennessee 37232,
Fred Hutchinson Cancer Research Center (Y.Z.), Howard Hughes Medical Institute, Seattle, Washington 98104,
Department of Immunology (Y.Z.), Duke University Medical Center, Durham, North Carolina 27710


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Pancreatic ß-cell type-specific transcription of the insulin gene is mediated, in part, by factors in the basic helix-loop-helix (bHLH) family that act on a site within the insulin enhancer, termed the E1-box. Expression from this element is regulated by a heteromeric protein complex containing ubiquitous (i.e. the E2A- and HEB-encoded proteins) and islet-enriched members of the bHLH family. Recent studies indicate that the E2A- and HEB-encoded proteins contain a transactivation domain, termed AD2, that functions more efficiently in transfected ß-cell lines. In the present report, we extend this observation by demonstrating that expression of full-length E2A proteins (E47, E12, and E2/5) activates insulin E element-directed transcription in a ß-cell line-selective manner. Stimulation required functional interactions with other key insulin gene transcription factors, including its islet bHLH partner as well as those that act on the RIPE3b1 and RIPE3a2 elements of the insulin gene enhancer. The conserved AD2 domain in the E2A proteins was essential in this process. The effect of the E2A- and HEB-encoded proteins on insulin gene expression was also analyzed in mice lacking a functional E2A or HEB gene. There was no apparent difference in insulin production between wild type, heterozygote, and homozygous mutant E2A or HEB mice. These results suggest that neither the E2A- or HEB-encoded proteins are essential for insulin transcription and that one factor can substitute for the other to impart normal insulin E1 activator function in mutant animals.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Pancreatic ß-cell-specific transcription of the insulin gene is mediated by cis-acting elements located within the insulin gene enhancer region, which is found between nucleotides -340 to -91 relative to the transcription start site (1). Detailed mutational analysis of this region has identified three conserved elements, termed A3 (-201 to -196 bp) (2, 3, 4), RIPE3b1 (-115 to -107 bp) (5), and E1 (-100 to -91 bp) (6, 7, 8), that are essential in selective expression. [The insulin cis-elements are labeled in accordance with the nomenclature proposed by German et al. (9).] The distinct factors that act at each of these sites appear to mediate synergistic activation of the insulin enhancer.

The activators that regulate A3 and E1 element-directed transcription within the ß-cell have recently been isolated. The RIPE3b1 gene (cDNA) has not yet been isolated. The A3 element is regulated by the IPF-1/STF-1/IDX-1 protein (3, 10, 11), a homeoprotein that is selectively expressed in cells of the pancreas and duodenum (12). The gene has been renamed pdx-1 (for pancreatic and duodenal homeobox gene-1) by the International Committee on Standardized Genetic Nomenclature for Mice and will be referred to as such here. PDX-1 also appears to be important for somatostatin transcription in islet {delta}-cells (13, 14). Interestingly, homozygous pdx-1 mutant mice fail to form a pancreas (15, 16), and the enteroendocrine cells in the duodenum are also affected (16). The positive regulator of E1-directed expression is composed of proteins in the basic helix-loop-helix (bHLH) family (5, 17, 18, 19, 20, 21, 22). This insulin gene activator is characteristic of other tissue-specific complexes of the bHLH class, as it functions as a heteromeric complex between generally distributed and tissue-enriched proteins. INSAF (21) and BETA2 (22) are distinct islet-enriched bHLH proteins present in E1 activator complexes. (The BETA2 homolog isolated from Xenopus was called NeuroD (23). This factor will be referred to as BETA2/NeuroD here.) The E2A- (17, 18, 19) and HEB- (20) encoded gene products are two distinct, documented members of the generally distributed bHLH protein family contained in the E1 activator, but it is also possible that the closely related E2–2 gene products (24) are also present. Importantly, the E2A-encoded proteins are the major generally distributed bHLH activity contained in this bHLH complex (20).

The myogenic bHLH activators (i.e. MyoD, myogenin, myf-5, and MRF4) are also members of this tissue-specific family (25, 26). Activation by the myogenic (27, 28) and insulin gene (29) bHLH activators are both inhibited by the c-jun protein. Inhibition in ß-cells is targeted to a transactivation domain that is structurally and functionally conserved between the E2A- (i.e. E47, E12, and E2/5), E2–2, and HEB-encoded gene products (29, 30). This activation domain, which is termed AD2, is located between amino acids 345 to 408 in E47 (29, 30, 31). Analysis of fusion constructs between E47 and the DNA-binding domain of the Saccharomyces cerevisiae GAL4 transcription factor also indicates that the AD2 region is preferentially activated in islet {alpha}- and ß-cells (29, 31). In contrast, the other activation domain of E47, which spans amino acids 1–83 (AD1) (30, 31), does not appear to be regulated by cell-specific factors (29, 31). Inactivation of the E2A (33, 34) or HEB (35) gene products by homologous recombination demonstrated that these generally distributed factors play an essential role in B-lymphocyte development. The effect of these knockouts on insulin gene expression was not analyzed in these mutant mice. However, E2A antisense experiments have shown that the E47, E12, and E2/5 proteins are essential for insulin transcription in pancreatic ß-cell lines (36).

Here we show that the E2A- and HEB-encoded proteins have functionally equivalent roles in insulin gene expression. Thus, expression of the E2A-encoded proteins was shown to activate insulin enhancer-directed transcription in a ß-cell line-specific manner. Stimulation required functional interactions with other key insulin gene activators, including RIPE3b1. The preferential activation observed with the E2A proteins was primarily mediated by the conserved AD2 activation domain. In contrast to the results in cultured cells, we found that insulin expression was unaffected in E2A or HEB mutant mice, indicating that neither of their gene products was essential for insulin gene expression. These results indicate that the E2A- and HEB-encoded proteins have functional redundant roles in the insulin E1 activator.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
E47 Potentiates Insulin Enhancer-Driven Expression in ß-Cells
To directly determine whether the transactivation properties of the E2A proteins were influenced by factors enriched in islet ß-cells, we analyzed the effect of E47 on insulin enhancer-driven chloramphenicol acetyltransferase (CAT) reporter gene expression in an insulin producing- (HIT T-15) and noninsulin (HeLa) producing-cell line. Two different rat insulin II E1-dependent CAT reporter plasmids were used in this analysis. -238 wild type (WT) CAT contained 5'-flanking enhancer/promoter sequences from -238 to +2 bp, and RIPE3 CAT from -126 to -86 bp (Fig. 1AGo). The RIPE3 CAT expression plasmid contains three copies of the -126 to -86 bp region inserted directly upstream of the ovalbumin TATA box in a CAT expression vector, pOVCAT-50 (5). This mini-enhancer unit recapitulates the islet ß cell-selective expression pattern observed for the intact insulin enhancer in both transient transfection (5) and transgenic (37) experiments.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. E47 Stimulates Insulin Enhancer-Driven Expression in HIT T-15 ß Cells

A, Schematic representation of the 5'-flanking rat insulin II sequences in -238 WT CAT and RIPE3 CAT. The shaded boxes represent insulin enhancer sequences, and the thick solid lines refer to insulin promoter sequences. The insulin sequences in -238WT and RIPE3 span -238 to +2 bp and -126 to -86 bp, respectively. The location of the A3 (-201 to -196 bp), RIPE3b1 (-115 to -107 bp), and E1 (-100 to -91 bp) elements is shown. B, The RIPE3 CAT and -238 WT CAT were either transfected alone or with CMV E47. RIPE3 CAT contains three copies of the -126 to -86 bp region inserted in its normal orientation directly upstream of the ovalbumin TATA box in a CAT expression vector, pOVCAT-50 (5). The CAT activity in each sample was normalized to the LUC activity from the cotransfected pSV2 LUC plasmid. Results are represented as normalized CAT activity ± SD. Fold activation by E47 is expressed as the ratio of the CAT activity in the presence of CMV E47 divided by the level of CAT activity in the absence of CMV E47.

 
The -238 WT CAT and RIPE3 CAT were both expressed more efficiently in the insulin producing HIT T-15 ß-cell line than in HeLa (Fig. 1BGo). These results are consistent with previous observations demonstrating the key role of ß-cell-enriched factors acting at the A3, RIPE3b1, and E1 elements on insulin enhancer-driven transcription (2, 3, 4, 5, 6, 7, 8). Expression from both -238 WT CAT and RIPE3 CAT were potentiated by E47 in HIT T-15 cells (Fig. 1Go). In contrast, E47 had no affect on insulin enhancer-driven activity in HeLa cells. The inability of E47 to activate in HeLa cells presumably results from the absence of insulin gene activator factors, such as RIPE3b1 and the islet-enriched bHLH factors, and/or the presence of inhibitory factors such as the protein kinase that prevents E47 homodimer-mediated activation in non-B lymphocyte lineages (38).

AD2 Is the Principal Mediator of E47 Transcriptional Activation in ß-Cells
Based on the apparent importance in ß-cells of the AD2 region on E47 activation (29, 31), we evaluated the potential role of this domain in RIPE3 CAT activation in HIT T-15 cells using WT E47 and mutants defective in AD1, AD2, or AD1 and AD2 activation domain function. E47 stimulation was more severely effected in the AD2 mutant when compared with the AD1 mutant (Fig. 2Go). As expected, the AD1/AD2 double mutant completely prevented enhancement. These results established that the activation domains of E47 play an important role in insulin enhancer activation in ß-cells. Furthermore, that AD2 is more crucial to this response.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. The AD2 Domain in E47 Is Crucial for Transactivation in HIT T-15 ß Cells

RIPE3 CAT in the presence of wild type and mutant E2A-encoded proteins. Diagrammatic representation of the E47, E12, and E2/5 proteins shows the positions of the activation domains (AD) and bHLH domain. The N-terminal activation domain (AD1; black box) is located between amino acids 1–83 (27, 34) and the activation domain (AD2; gray box) that functions preferentially in ß cells is found between amino acids 345–408 (29, 31). The bHLH region in E47 is located between amino acids 539–597 (39, 40). HIT T-15 cells were cotransfected with RIPE3 CAT, and either the CMV E2A expression vector or CMV4, and pSV2 LUC. The location of the E47 mutation within the E47 AD1m, E47 AD2m, and E47 AD1/AD2m expression products is described in Materials and Methods. The normalized results are expressed as the ratio of the CAT activity in the presence of CMV E2A divided by the level of CAT activity in the absence of CMV E2A. Each value is the mean ± SD calculated from at least three independent transfections.

 
E47 Acts through the E1 Activator
We next analyzed whether two other well characterized E2A-encoded products, E12 and E2/5, which differ from E47 in either their DNA-binding or transactivation properties, could activate RIPE3 CAT expression in HIT T-15 cells. The E12 and E47 proteins differ only in their C-terminal bHLH sequences (24, 39), but this change precludes E12 from binding effectively to DNA as a homomeric complex (40). The amino acid sequence of E2/5 is essentially identical to E47, except that the first 44 amino acids of E47 and AD1 function are missing (24, 41).

RIPE3 CAT activity was stimulated by both E2/5 and E12 in HIT T-15 cells (Fig. 2Go). Since stimulation by E12 was only slightly less effective then E47, the transfected E2A proteins may bind and activate in association with their islet-enriched bHLH partners.

To directly determine how E47 effected insulin E1 element binding, a gel shift experiment was conducted with an E1 element probe and extracts prepared from HIT T-15 cells transfected with a E47:FLAG tagged fusion protein (Fig. 3Go). E47:FLAG also augmented RIPE3 CAT activity in a ß-cell-specific fashion (data not shown). Three protein-E1 element DNA complexes, labeled as E1, USF, and A, are routinely detected in ß-cell extracts (42). The E1 and USF complexes contain the E1 activator and the adenovirus type 2 upstream stimulatory transcription factor (USF), respectively (42). There was no effect on the mobility of the E1 element binding complexes in E47:FLAG extracts, although there was an increase in E1 activator binding levels (Fig. 3Go). The E1 complex was specifically supershifted by a polyclonal antibody raised to the FLAG epitope in E47:FLAG-transfected HIT T-15 extracts. This appears to be a specific reaction, since E47 antisera also supershifted this complex whereas the FLAG antisera had no effect in nontransfected extracts (Fig. 3Go). Previous results have demonstrated that the E1 complex is composed of both islet-enriched [i.e. BETA2 (22) and INSAF(21)] and the E2A- or HEB-proteins (17, 18, 19, 20). Since E1 activator binding levels were increased in E47:FLAG-transfected HIT T15 extracts, these results indicate that E47 activates insulin enhancer-mediated expression by associating with its islet-enriched bHLH partner.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Gel Shift Analysis Showing the Change in E1 Binding Levels in E47-FLAG-Tagged Transfected HIT T-15 ß-Cells

Binding reactions were conducted using a [32P]E1 probe and HIT T-15 nuclear extracts prepared from vector alone (lanes 1 and 2) or HTLV E47:FLAG (lanes 3 through 5) transfected cells. The E1, USF, and A bands discussed in the text are labeled. The addition of either the {alpha}FLAG or {alpha}E2A antisera specifically supershifted (SS) the E1 complex.

 
The E1, RIPE3a2, and RIPE3b1 Binding Sites Appear to be Required for E47 Activation in ß-Cells
Our results strongly suggest that the E1 element of the insulin enhancer is targeted for E47 activation in HIT T-15 cells. In addition to the E1 element (-100 to -91 bp) in the RIPE3 transcription unit (-126 to -86 bp), there are two other mutationally sensitive insulin control elements, RIPE3b1 (-115 to -107 bp) and RIPE3a2 (-108 to -99 bp) (5, 43). These factors synergistically activate RIPE3 transcription to approximately the level mediated by the intact rat insulin II enhancer (5).

To identify the element(s) targeted for E47-mediated activation within this region of the enhancer, we analyzed the effect of E47 on expression from RIPE3 CAT constructs containing binding site mutations in either the E1, RIPE3a2, or RIPE3b1 elements (Fig. 4Go). As expected, stimulation by E47 was prevented in the E1 mutant. However, activation was also blocked in the RIPE3a2 and RIPE3b1 mutants. Although each of these RIPE3 mutants reduced expression in HIT T-15 cells (Fig. 4Go and 5 , they do not effect the ß-cell-specific transcription pattern of the construct (5, 44). Our results suggest that functional interactions between the E1 activator and the factors that bind to the RIPE3a2 and RIPE3b1 elements provide maximal enhancer activity in ß-cells. This hypothesis is also consistent with results of Naya et al. (22), who suggested that interactions between the E1 and RIPE3b1 activators are required for cooperative activation of the RIPE3 transcription unit. These investigators did not examine the effect of the RIPE3a2 activator on this response.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. Effect of Mutagenesis of the RIPE3b1, RIPE3a2, and E1 Elements on E47 Activation

A, The sequences in the RIPE3b1 (-115 to -107 bp), RIPE3a2 (-108 to -99 bp), and E1 (-100 to -91 bp) elements within the RIPE3 transcription unit are shown. The boxes span the residues required in protein binding (5). The mutations that eliminate protein binding are shown. HIT T-15 cells were transfected with RIPE3, RIPE3 E1m (the mutant in the E1 binding site), RIPE3a2m (the mutant in the RIPE3a2 binding site), RIPE3b1m (the mutant in the RIPE3b1 binding site), and either the CMV E47 expression vector or CMV4, and pSV2 LUC. Quantitative analyses of the normalized CAT activity are presented ± SD. Fold activation by E47 is expressed as the ratio of the CAT activity in the presence of CMV E47 divided by the level of CAT activity in the absence of CMV E47.

 
Mice Lacking the E2A and HEB Gene Products Synthesize and Secrete Normal Levels of Insulin
We have shown that overexpressing the E2A-encoded proteins potentiates insulin gene expression in HIT T-15 ß-cells by increasing the levels of the insulin E1 activator complex. Furthermore, that activation requires the AD2 region conserved in HEB, the other generally distributed bHLH factor present in the E1 activator. The importance of the E2A proteins in insulin expression was also supported by the antisense experiments of Vierra and Nelson (36), which demonstrated that inhibiting E2A-encoded protein production attenuated insulin gene expression. All of these results have been conducted in transformed ß-cell lines.

To begin to investigate the role the E2A and HEB proteins play in insulin transcription in animals, we analyzed how insulin production was effected in mice lacking a functional gene. Previous studies with these E2A (33, 34) and HEB (35) knockout mice have demonstrated that these products were important for B lymphocyte development.

To assess possible defects in islet function of E2A mutant mice, we stained pancreas sections with antibodies against the hormonal products expressed in islet ß (insulin), {alpha} (glucagon), and {delta} (somatostatin) cells. The immunohistochemical staining patterns from the mutant mice were indistinguishable from those of control mice (Fig. 5Go). Furthermore, plasma insulin levels in the E2A and HEB gene knockouts were also essentially the same as the control (Fig. 6Go). Based upon the apparent normal morphology and physiological status of islet ß-cells in mutant mice, we conclude that E1 activator function is unaffected in the E2A and HEB knockouts as a result of functional redundancy between these bHLH factors.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 5. Islet Hormone Expression in E2A Wild Type and Mutant Mice

Photomicrograph illustrates immunohistochemical staining (black) of insulin (A and B), glucagon (C and D), and somatostatin (E and F) in pancreas sections from 3-week-old mice. Column 1, Wild type E2A+/E2A+(+/+); 2, homozygous E2Am/E2Am(-/-). The magnification is approximately 30x.

 


View larger version (12K):
[in this window]
[in a new window]
 
Figure 6. Normal Plasma Insulin Levels Are Produced in Mice Lacking a Functional E2A or HEB Gene

Plasma insulin levels were determined from tail blood samples from 3-week-old, wild type (+/+), heterozygous (±), and homozygous (-/-) E2A and HEB mutant mice. The number of animals (n) used is shown. Mice homozygous for the HEB mutation normally die within 2 weeks (35), which enabled us to collect blood from only one such mouse. Importantly, insulin levels were similar between the HEB+/+, HEB±, and HEB-/- animals. The results are presented as the mean ± SE from the groups containing at least three animals.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The function of the generally distributed E2A- and HEB-encoded proteins in insulin E1 activator function was analyzed in both transfection experiments performed with insulin-producing and -nonproducing cell lines and in knockout mice. Our results indicate that functional interactions between these generally distributed factors and other distinct enhancer-binding factors mediate insulin enhancer activity. Furthermore, that the AD2 region of the E2A and HEB proteins plays a key role in mediating transcriptional activation of the insulin gene in ß cells. The lack of any discernible abnormalities in insulin gene expression in mice lacking a functional E2A or HEB gene suggests that these ubiquitously distributed bHLH factors can substitute for one another in mediating E1 activation in mutant animals.

Most of the tissue-specific bHLH activators are heteromeric complexes composed of the E2A, HEB, or E2–2 proteins in association with a tissue-specific bHLH protein. The best characterized example of the latter class is an activator of skeletal muscle differentiation, MyoD (25, 26, 27, 28), while in ß-cells the representatives are BETA2/NeuroD and INSAF. We found that overexpression of the E2A proteins stimulated insulin-enhancer activity in a ß-cell-specific fashion. Activation resulted from increased E1 activator levels as a consequence of E2A associating with its islet bHLH partner. Interestingly, BETA2/NeuroD is expressed at approximately 5-fold higher levels than the E2A gene products in islet ß-cells (45), indicating that E2A products may also be limiting for E1 activation in vivo.

Activation by E47 in ß-cells was primarily mediated by its AD2 region, which consists of a unique loop-helix motif that is structurally and functionally conserved in the HEB and E2–2 proteins (30). As previous studies have shown that AD2 activity is preferentially active in pancreatic {alpha}- and ß-cell lines (29, 31), our results would indicate that islet-enriched factors play a key role in modifying the transactivation capacity of this region in these generally expressed proteins.

The pancreatic ß-cell type-specific expression pattern observed for the insulin enhancer can be recapitulated by multimerizing the sequences spanned by the RIPE3 transcription unit (-126 to -86 bp) (5). E47 activation was not only prevented by site-specific mutations within the E1 binding site but also at the islet-enriched RIPE3b1 and generally distributed RIPE3a2 activator sites. These results indicate that specific interactions between the various ubiquitous and islet-enriched factors are required for synergistic activation of the RIPE3 transcription unit.

The function of the E2A and HEB proteins in insulin expression in vivo was investigated in mutant mice carrying a targeted null mutation. Mice lacking a functional E2A gene exhibited no morphological or physiological abnormalities in islet ß-cells. There was also no difference in circulating insulin levels between wild type and homozygous E2A or HEB mutant mice. We conclude that neither of these bHLH factors is essential for insulin expression. In contrast, Vierra and Nelson (36) proposed, as a result of their E2A antisense experiments performed in ß-cell lines, that the E2A proteins were indispensable. However, since the entire E12 cDNA was present in the E2A antisense expression vector used in these in vitro experiments, it is possible that the levels of both E2A and HEB were reduced in these studies (36). Unfortunately, reagents that could distinguish expression of E2A from E2A-related gene products were not used. Alternatively, it is also possible that a functionally redundant factor(s) is able to act in place of E2A in vivo, but the mechanism that mediates this response does not occur in vitro.

We propose that compensation between the E2A and HEB proteins allows normal insulin gene expression in mutant mice. Yet, it is also conceivable that E2–2 may be in this complex; as a consequence, we cannot rule out the possibility that this factor also has an important functional role in the ß-cell. Interestingly, B lymphocyte cell development is effected in E2A (33, 34), HEB (35), and E2–2 (35) mutant mice, whereas there were no obvious abnormalities in skeletal muscle differentiation. Together, these results indicate that similar regulatory mechanisms are used to retain insulin and myogenic E activator function in E2A or HEB mutant mice.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture and DNA Transfection
The HIT T-15 cell line was maintained in DMEM (GIBCO/BRL, Gaithersburg, MD) supplemented with 15% (vol/vol) horse serum, 2.5% (vol/vol) FBS, and 50 µg each of streptomycin and penicillin per ml; HeLa cell lines were maintained in the same medium supplemented with 10% FCS. Approximately 12 h before transfection, HIT T-15 and HeLa cells were plated at densities of 2 x 106 and 0.5 x 106 cells, respectively, per 100-mm2 plate. Transfection of plasmid DNA was performed using the calcium phosphate coprecipitation procedure (7). HIT T-15 and HeLa cell transfections (11 µg total DNA) were performed using 2 µg of either -238 CAT, RIPE3 CAT, or pOVCAT-50 (control plasmid) and 8 µg of a cytomegalovirus (CMV) E2A expression plasmid or CMV4 (carrier DNA) and 1 µg of pSV2 LUC. HIT T-15 cells were also exposed to 20% glycerol for 2 min, 4 h after the addition of the calcium phosphate DNA precipitates. A luciferase (LUC) reporter plasmid, pSV2 LUC, was used as an internal control (46). The transfected cells were harvested after 48 h, and LUC and CAT enzymatic assays were performed as described by De Wet et al. (46) and Nordeen et al. (47), respectively. The CAT activity from the insulin expression plasmids was normalized to pSV2 LUC activity. pOVCAT-50 activity (825 ± 95 cpm) was subtracted from the RIPE3 activity. The cotransfected CMV E47 expression plasmid had no effect on pSV2 LUC or pOVCAT-50 activity (data not shown). Each transfection was repeated a number of times with at least two different plasmid preparations.

DNA Constructs
The construction of the RIPE3 CAT (5) and -238 WT CAT (43) expression plasmids has been described previously. The AD1, AD2, and AD1/AD2 double mutants were constructed in the context of full-length E47 from the AD1 [E2A AD1 mutant 2 (32)] and AD2 [E2A AD2 337E/338R (30)] mutant expression plasmids. Activation domain activity has been significantly compromised by a change in amino acids 19 (Leu to Arg) and 21 (Phe to Arg) in the AD1 mutant, and amino acids 337 (Ala to Glu) and 338 (Ile to Ser) in the AD2 mutant. E47, E47 mutant, and E12 cDNAs were inserted into the CMV enhancer-driven expression vector, CMV4 (48). The E47:FLAG chimera contains an eight-amino acid FLAG epitope at the C-terminal end of the full-length E47 protein. The E47:FLAG protein was expressed from the human T cell leukemia virus (HTLV) promoter in the vector PXS.

Electrophoretic Mobility Shift Assays
Nuclear extracts were prepared as described (49) from HIT T-15 cells transfected with 10 µg of either HTLV E47:FLAG or CMV4 DNA. Approximately 10 µg extract protein were used per gel mobility shift sample. A double-stranded oligonucleotide probe to the rat insulin II E1-element (-104 TCTGGCCATCTGCTGATCCT -85) binding site was end-labeled using [{alpha}-32P]dATP (6,000 Ci/mmol) and the Klenow fragment of Escherichia coli DNA polymerase I and used as probe. The anti-E2A and anti-FLAG (IBI) antibodies (1 µl) were preincubated with extract protein for 20 min at room temperature before initiation of the DNA-binding reactions. The binding reactions were conducted at 4 C under conditions described previously (42). Samples were subjected to electrophoretic separation on a 4% nondenaturing polyacrylamide gel at 200 V for 1.5–2 h using the high ionic strength PAGE conditions (42). The gel was then dried, and labeled DNA-protein complexes were localized by autoradiography.

Random Plasma Insulin Estimation
Tail blood (~20 µl) was collected from wild type, heterozygote, and E2A and HEB homozygous mutant mice. The E2A (33) and HEB (35) genes were disrupted in mutant mice by replacing the bHLH domain with the PGK-neo gene. This mutation eliminated the DNA-binding and dimerization properties of the bHLH proteins encoded by the gene. Plasma insulin levels were measured using an RIA analysis kit (Linco Research, St. Louis, MO).

Immunohistochemical Analysis
Pancreas sections from the wild type, heterozygote, and homozygous E2A mutant mice were prepared as described elsewhere (3). Immunochemical detection of insulin, glucagon, and somatostatin staining was determined using hormore- specific primary antibodies and an alkaline phosphatase-linked secondary antibody (3). Staining was visualized after incubation with the alkaline phosphatase substrate, nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate. Antibodies were used at the following dilutions: guinea pig antibovine insulin (Linco Research Inc., St. Louis, MO), 1:400; rabbit antihuman glucagon (Calbiochem, San Diego, CA), 1:12,000; rabbit antihuman somatostatin (Peninsula Labs, Belmont, CA), 1:8,000.


    ACKNOWLEDGMENTS
 
We thank Drs. Yi Qiu, Susan Samaras, and Kuo-Liang Wu for constructive criticism of the manuscript, Steven Sanders for technical assistance, and Drs. Melanie Quong and Cornelius Murre for the E12 mutant expression plasmids and polyclonal E2A antisera. These studies were conducted in collaboration with the late Harold Weintraub.


    FOOTNOTES
 
Address requests for reprints to: Roland Stein, Department of Molecular Physiology and Biophysics, Vanderbilt University Medical School, Room 706, Light Hall, Nashville, Tennessee 37232.

This work was supported by NIH Grant RO1 DK-49852–06 (to R.S.), and partial support was also derived from the Vanderbilt University Diabetes Research and Training Center Molecular Biology Core Laboratory (Public Health Service Grant P60 DK-20593 from the NIH).

1 Present address: Joslin Diabetes Center, Boston, Massachusetts 02215. Back

2 Present address: Genetics Institute, 87 Cambridge Park Drive, Cambridge, Massachusetts 02140. Back

{smhd3}Note Added in Proof

During review of this manuscript, another report was published that analyzes the importance of the E2A-encoded products in insulin gene transcription in vivo (Itkinansari P, Bain G, Beattie GM, Murre C, Hayek A, Levine F 1996 E2A gene products are not required for insulin gene expression. Endocrinology 137:3540–3543)

Received for publication June 11, 1997. Accepted for publication July 11, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Stein R 1993 Factors regulating insulin gene transcription. Trends Endocrinol Metab 4:96–100[Medline]
  2. German MS, Moss LG, Wang, J, Rutter, WJ 1992 The insulin and islet amyloid polypeptide genes contain similar cell-specific promoter elements that bind identical ß-cell nuclear complexes. Mol Cell Biol 12:1777–1788[Abstract/Free Full Text]
  3. Peshavaria M, Gamer L, Henderson E, Teitelman G, Wright CVE, Stein R 1994 XlHbox 8, an endoderm-specific Xenopus homeodomain protein, is closely related to a mammalian insulin gene transcription factor. Mol Endocrinol 8:806–816[Abstract]
  4. Petersen HV, Serup P, Leonard J, Michelsen BK, Madsen OD 1994 Transcriptional regulation of the human insulin gene is dependent of the homeodomain proteins STF1/IPF1 acting through the CT boxes. Proc Natl Acad Sci USA 91:10465–10469[Abstract/Free Full Text]
  5. Shieh S-Y, Tsai M-J 1991 Cell-specific and ubiquitous factors are responsible for the enhancer activity of the rat insulin II gene. J Biol Chem 266:16708–16714[Abstract/Free Full Text]
  6. Karlsson O, Edlund T, Moss JB, Rutter, WJ, Walker MD 1987 A mutational analysis of the insulin gene transcription control region: expression in beta cells is dependent on two related sequences within the enhancer. Proc Natl Acad Sci USA 84:8819–8823[Abstract/Free Full Text]
  7. Whelan J, Poon D, Weil PA, Stein R 1989 Pancreatic ß-cell-type-specific expression of the rat insulin II gene is controlled by positive and negative transcriptional elements. Mol Cell Biol 9:3253–3259[Abstract/Free Full Text]
  8. Crowe DT, Tsai, M-J 1989 Mutagenesis of the rat insulin II 5'-flanking region defines sequences important for expression in HIT cells. Mol Cell Biol 9:1784–1789[Abstract/Free Full Text]
  9. German M, Ashcroft S, Docherty K, Edlund H, Edlund T, Goodison S, Imura H, Kennedy G, Madsen O, Melloul D, Moss L, Olson K, Permutt MA, Philippe J, Robertson RP, Rutter WJ, Serup P, Stein R, Steiner D, Tsai M-J, Walker MD 1995 The insulin promoter: a simplified nomenclature. Diabetes 44:1002–1004[Medline]
  10. Ohlsson H, Karlsson K, Edlund T 1993 IPF-1, a homeodomain-containing transactivator of the insulin gene. EMBO J 12:4251–4259[Medline]
  11. Peers B, Leonard J, Sharma S, Teitelman G, Montiminy MR 1995 Insulin expression in pancreatic islet cells relies on cooperative interactions between the helix loop helix factor E47 and the homeobox factor STF-1. Mol Endocrinol 8:1798–1806[Abstract]
  12. Guz Y, Montminy MR, Stein R, Leonard J, Gamer LW, Wright CVE, Teitelman G 1995 Expression of murine STF-1, a putative insulin gene transcription factor, in ß-cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121:11–18[Abstract]
  13. Leonard J, Peers B, Johnson T, Ferrere K, Lee S, Montminy M 1993 Characterization of somatostatin transactivating factor-1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells. Mol Endocrinol 7:1275–1283[Abstract]
  14. Miller CP, McGehee Jr RE, Habener JF 1994 IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO J 13:1145–1156[Medline]
  15. Jonsson J, Carlsson L, Edlund T, Edlund H 1994 Insulin-promoter-factor 1 is required for pancreas development in mice. Nature 371:606–609[CrossRef][Medline]
  16. Offield MF, Jetton TL, Stein R, Labosky T, Ray M, Magnuson M, Hogan B, Wright, CVE 1996 PDX-1 is required for development of the pancreas and differentiation of the rostral duodenum. Development 122:983–995[Abstract]
  17. Aronheim A, Ohlsson H, Park CW, Edlund T, Walker MD 1991 Distribution and characterization of helix-loop-helix enhancer-binding proteins from pancreatic beta cells and lymphocytes. Nucleic Acids Res 19:3893–3899[Abstract/Free Full Text]
  18. Cordle SR, Henderson E, Masuoka H, Weil PA, Stein R 1991 Pancreatic ß-cell-type-specific transcription of the insulin gene is mediated by basic helix-loop-helix DNA-binding proteins. Mol Cell Biol 11:1734–1738[Abstract/Free Full Text]
  19. German MS, Blanar MA Nelson C, Moss LG, Rutter WJ 1991 Two related helix-loop-helix proteins participate in separate cell-specific complexes that bind the insulin enhancer. Mol Endocrinol 5:292–299[Abstract]
  20. Peyton M, Moss L, Tsai, M-J 1994 Two distinct class A helix-loop-helix transcription factors, E2A and BETA 1, form separate DNA-binding complexes on the insulin E-box. J Biol Chem 269:25936–25941[Abstract/Free Full Text]
  21. Robinson GLWG, Cordle SR, Henderson E, Weil PA, Teitelman G, Stein R 1994 A novel, pancreatic islet specific transcription factor that binds to and activates expression mediated through insulin enhancer ICE sequences. Mol Cell Biol 14:6704–6714[Abstract/Free Full Text]
  22. Naya FJ, Stellrecht CMM, Tsai M-J 1995 Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dev 9:1009–1019[Abstract/Free Full Text]
  23. Lee JE, Hollenberg SM, Snider L, Turner DL, Lipnick N, Weintraub H 1995 Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein. Science 268:836–844[Abstract/Free Full Text]
  24. Henthorn P, Kiledjian M, Kadesch T 1990 Two distinct transcription factors that bind the immunoglobulin enhancer µE5/{kappa}E2 motif. Science 247:467–470[Abstract/Free Full Text]
  25. Lassar, AB, Davis RL, Wright WE, Kadesch T, Murre C, Voronova A, Baltimore D, Weintraub H 1991 Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like proteins in vivo. Cell 66:305–315[CrossRef][Medline]
  26. Murre C, Baltimore D 1992 In: McKnight SL, Yamamoto KR (eds), Transcriptional Regulation. Cold Spring Harbor Laboratory Press, Plainview, NY, pp 861–879
  27. Bengal E, Ransone L, Scharfmann R, Dwarki VJ, Tapscott SJ, Weintraub H, Verma IM 1992 Functional antagonism between c-jun and MyoD proteins: a direct physical association. Cell 68:507–519[CrossRef][Medline]
  28. Li Li, Chambard J-C, Karin M, Olson EN 1992 Fos and Jun repress transcriptional activation by myogenin and MyoD: the amino terminus of jun can mediate repression. Genes Dev 6:676–689[Abstract/Free Full Text]
  29. Robinson, GLWG, Henderson E, Massari ME, Murre C, Stein R 1995 c-Jun inhibits Insulin Control Element mediated transcription by affecting the transactivation potential of the E2A gene products. Mol Cell Biol 15:1398–1404[Abstract]
  30. Quong MW, Massari ME, Zwart R, Murre C 1993 A new transcriptional-activation motif restricted to a class of helix-loop-helix proteins is functionally conserved in both yeast and mammalian cells. Mol Cell Biol 13:792–800[Abstract/Free Full Text]
  31. Aronheim A, Shiran R, Rosen A, Walker MD 1993 The E2A gene product contains two separable and functionally distinct transcription activation domains. Proc Natl Acad Sci USA 90:8063–8067[Abstract/Free Full Text]
  32. Massari ME, Jennings PA, Murre C 1996 The AD1 transactivation domain of E2A contains a highly conserved helix which is required for its activity in both Saccharomyces cerevisiae and mammalian cells. Mol Cell Biol 16:121–129[Abstract]
  33. Zhuang Y, Soriano P, Weintraub H 1994 The helix-loop-helix gene E2A is required for B cell formation. Cell 79:875–884[CrossRef][Medline]
  34. Bain G, Maandag E, Izon D, Amsen D, Kruisbeek A, Weintraub B, Krop I, Schissel M, Feeney A, van Roon M, van der Valk M, te Riele H, Berns A, Murre C 1994 E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements. Cell 79:885–892[CrossRef][Medline]
  35. Zhuang Y, Cheng P, Weintraub H 1996 B-lymphocyte development is regulated by the combined dosage of three basic helix-loop-helix genes, E2A, E2–2, and HEB. Mol Cell Biol 16:2898–2905[Abstract]
  36. Vierra, CA, Nelson C 1995 The Pan basic heleix-loop-helix proteins are required for insulin gene expression. Mol Endocrinol 9:64–71[Abstract]
  37. Stellrecht CMM, Demayo FJ, Finegold MJ, Tsai M-J 1997 Tissue-specific and developmental regulation of the rat insulin II gene enhancer, RIPE3, in transgenic mice. J Biol Chem 272:3567–3572[Abstract/Free Full Text]
  38. Sloan SR, Shen CP, McCarrick-Walmsley R, Kadesch, T 1996 Phosphorylation of E47 as a potential determinant of B-cell-specific activity. Mol Cell Biol 16:6900–6908[Abstract]
  39. Murre C, McCaw PS, Vaessin H, Cudy M, Jan LY, Jan YN, Cabrera CV, Buskin J, Hasuschka SD, Lassar AB, Weintraub H, Baltimore D 1989 Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell 58:537–544[CrossRef][Medline]
  40. Sun X-H, Baltimore D 1991 An inhibitory domain of E12 transcription factor prevents DNA binding in E12 homodimers but not E12 heterodimers. Cell 64:459–470[CrossRef][Medline]
  41. Henthorn P, McCarrick-Walmsley R, Kadesch T 1990 Sequence of the cDNA encoding ITF-1, a positive-acting transcription factor. Nucleic Acids Res 18:677[Free Full Text]
  42. Whelan J, Cordle SR, Henderson E, Weil PA, Stein R 1990 Identification of a pancreatic ß-cell insulin gene transcription factor that binds to and appears to activate cell-type-specific expression: its possible relationship to other cellular factors that bind to a common insulin gene sequence. Mol Cell Biol 10:1564–1572[Abstract/Free Full Text]
  43. Cordle S, Whelan J, Henderson E, Masuoka H, Weil PA, Stein R 1991 Insulin gene expression in non-expressing cells appears to be regulated by multiple, distinct, negative acting control elements. Mol Cell Biol 11:2881–2886[Abstract/Free Full Text]
  44. Robinson GLWG, Cordle SR, Henderson E, Weil PA, Teitelman G, Stein R 1994 Analysis of transcription regulatory signals of the insulin gene: expression of the trans-active factor that stimulates insulin control element mediated expression precedes insulin gene transcription. J Biol Chem 269:2452–2460[Abstract/Free Full Text]
  45. Jensen J, Serup P, Karlsen C, Nielsen TF, Madsen OD 1996 mRNA profiling of rat islet tumors reveals Nkx 6.1 as a beta-cell-specific homeodomain transcription factor. J Biol Chem 271:18749–18758[Abstract/Free Full Text]
  46. De Wet JR, Wood KV, DeLuca M, Helinski DR, Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells. Mol Cell Biol 7:725–737[Abstract/Free Full Text]
  47. Nordeen SK, Green PPI II, Fowles DM 1987 Laboratory Methods. A Rapid, Sensitive, and Inexpensive Assay for Chloramphenicol Acetyltransferase. DNA 6:173–178[Medline]
  48. Andersson S, Davis DL, Dahlback H, Jornvall H, Russell DW 1989 Cloning, structure and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme. J Biol Chem 264:8222–8229[Abstract/Free Full Text]
  49. Schreiber E, Matthias P, Muller MM, Schaffner W 1989 Rapid detection of octamer binding proteins with ‘mini-extracts’ prepared from a small number of cells. Nucleic Acids Res 17:6419[Free Full Text]



This article has been cited by other articles:


Home page
DevelopmentHome page
J. E. Smith III and C. Cronmiller
The Drosophila daughterless gene autoregulates and is controlled by both positive and negative cis regulation
Development, December 1, 2001; 128(23): 4705 - 4714.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H.-P. Huang, M. Liu, H. M. El-Hodiri, K. Chu, M. Jamrich, and M.-J. Tsai
Regulation of the Pancreatic Islet-Specific Gene BETA2 (neuroD) by Neurogenin 3
Mol. Cell. Biol., May 1, 2000; 20(9): 3292 - 3307.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
M. K. Thomas, K.-M. Yao, M. S. Tenser, G. G. Wong, and J. F. Habener
Bridge-1, a Novel PDZ-Domain Coactivator of E2A-Mediated Regulation of Insulin Gene Transcription
Mol. Cell. Biol., December 1, 1999; 19(12): 8492 - 8504.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Seijffers, O. Ben-David, Y. Cohen, A. Karasik, M. Berezin, C. B. Newgard, and S. Ferber
Increase in PDX-1 Levels Suppresses Insulin Gene Expression in RIN 1046-38 Cells
Endocrinology, July 1, 1999; 140(7): 3311 - 3317.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
Y. Qiu, A. Sharma, and R. Stein
p300 Mediates Transcriptional Stimulation by the Basic Helix-Loop-Helix Activators of the Insulin Gene
Mol. Cell. Biol., May 1, 1998; 18(5): 2957 - 2964.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sharma, A.
Right arrow Articles by Stein, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sharma, A.
Right arrow Articles by Stein, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals