Molecular Endocrinology 11 (11): 1608-1617
Copyright © 1997 by The Endocrine Society
Analysis of the Role of E2A-Encoded Proteins in Insulin Gene Transcription
Arun Sharma1,
Eva Henderson,
Laura Gamer2,
Yuan Zhuang and
Roland Stein
Department of Molecular Physiology and Biophysics (A.S., E.H.,
R.S),
Department of Cell Biology (L.G., R. S.),
Vanderbilt University Medical Center, Nashville, Tennessee 37232,
Fred Hutchinson Cancer Research Center (Y.Z.), Howard Hughes
Medical Institute, Seattle, Washington 98104,
Department of
Immunology (Y.Z.), Duke University Medical Center, Durham, North
Carolina 27710
 |
ABSTRACT
|
|---|
Pancreatic ß-cell type-specific
transcription of the insulin gene is mediated, in part, by factors in
the basic helix-loop-helix (bHLH) family that act on a site within the
insulin enhancer, termed the E1-box. Expression from this element is
regulated by a heteromeric protein complex containing ubiquitous
(i.e. the E2A- and HEB-encoded proteins) and islet-enriched
members of the bHLH family. Recent studies indicate that the E2A- and
HEB-encoded proteins contain a transactivation domain, termed AD2, that
functions more efficiently in transfected ß-cell lines. In the
present report, we extend this observation by demonstrating that
expression of full-length E2A proteins (E47, E12, and E2/5) activates
insulin E element-directed transcription in a ß-cell line-selective
manner. Stimulation required functional interactions with other key
insulin gene transcription factors, including its islet bHLH partner as
well as those that act on the RIPE3b1 and RIPE3a2 elements of the
insulin gene enhancer. The conserved AD2 domain in the E2A proteins was
essential in this process. The effect of the E2A- and HEB-encoded
proteins on insulin gene expression was also analyzed in mice lacking a
functional E2A or HEB gene. There was no apparent difference in insulin
production between wild type, heterozygote, and homozygous mutant E2A
or HEB mice. These results suggest that neither the E2A- or HEB-encoded
proteins are essential for insulin transcription and that one factor
can substitute for the other to impart normal insulin E1 activator
function in mutant animals.
 |
INTRODUCTION
|
|---|
Pancreatic ß-cell-specific transcription of the insulin gene is
mediated by cis-acting elements located within the insulin
gene enhancer region, which is found between nucleotides -340 to -91
relative to the transcription start site (1). Detailed mutational
analysis of this region has identified three conserved elements, termed
A3 (-201 to -196 bp) (2, 3, 4), RIPE3b1 (-115 to -107 bp) (5), and E1
(-100 to -91 bp) (6, 7, 8), that are essential in selective expression.
[The insulin cis-elements are labeled in accordance with
the nomenclature proposed by German et al. (9).] The
distinct factors that act at each of these sites appear to mediate
synergistic activation of the insulin enhancer.
The activators that regulate A3 and E1 element-directed transcription
within the ß-cell have recently been isolated. The RIPE3b1 gene
(cDNA) has not yet been isolated. The A3 element is regulated by the
IPF-1/STF-1/IDX-1 protein (3, 10, 11), a homeoprotein that is
selectively expressed in cells of the pancreas and duodenum (12). The
gene has been renamed pdx-1 (for pancreatic and duodenal homeobox
gene-1) by the International Committee on Standardized Genetic
Nomenclature for Mice and will be referred to as such here. PDX-1 also
appears to be important for somatostatin transcription in islet
-cells (13, 14). Interestingly, homozygous pdx-1 mutant mice fail to
form a pancreas (15, 16), and the enteroendocrine cells in the duodenum
are also affected (16). The positive regulator of E1-directed
expression is composed of proteins in the basic helix-loop-helix (bHLH)
family (5, 17, 18, 19, 20, 21, 22). This insulin gene activator is characteristic of
other tissue-specific complexes of the bHLH class, as it functions as a
heteromeric complex between generally distributed and
tissue-enriched proteins. INSAF (21) and BETA2 (22) are distinct
islet-enriched bHLH proteins present in E1 activator complexes. (The
BETA2 homolog isolated from Xenopus was called NeuroD (23).
This factor will be referred to as BETA2/NeuroD here.) The E2A-
(17, 18, 19) and HEB- (20) encoded gene products are two distinct,
documented members of the generally distributed bHLH protein family
contained in the E1 activator, but it is also possible that the closely
related E22 gene products (24) are also present. Importantly, the
E2A-encoded proteins are the major generally distributed bHLH activity
contained in this bHLH complex (20).
The myogenic bHLH activators (i.e. MyoD, myogenin,
myf-5, and MRF4) are also members of this tissue-specific family (25, 26). Activation by the myogenic (27, 28) and insulin gene (29) bHLH
activators are both inhibited by the c-jun protein.
Inhibition in ß-cells is targeted to a transactivation domain that is
structurally and functionally conserved between the E2A-
(i.e. E47, E12, and E2/5), E22, and HEB-encoded gene
products (29, 30). This activation domain, which is termed AD2, is
located between amino acids 345 to 408 in E47 (29, 30, 31). Analysis of
fusion constructs between E47 and the DNA-binding domain of the
Saccharomyces cerevisiae GAL4 transcription factor also
indicates that the AD2 region is preferentially activated in islet
-
and ß-cells (29, 31). In contrast, the other activation domain of
E47, which spans amino acids 183 (AD1) (30, 31), does not appear to
be regulated by cell-specific factors (29, 31). Inactivation of the E2A
(33, 34) or HEB (35) gene products by homologous recombination
demonstrated that these generally distributed factors play an essential
role in B-lymphocyte development. The effect of these knockouts on
insulin gene expression was not analyzed in these mutant mice. However,
E2A antisense experiments have shown that the E47, E12, and E2/5
proteins are essential for insulin transcription in pancreatic ß-cell
lines (36).
Here we show that the E2A- and HEB-encoded proteins have functionally
equivalent roles in insulin gene expression. Thus, expression of the
E2A-encoded proteins was shown to activate insulin enhancer-directed
transcription in a ß-cell line-specific manner. Stimulation required
functional interactions with other key insulin gene activators,
including RIPE3b1. The preferential activation observed with the E2A
proteins was primarily mediated by the conserved AD2 activation domain.
In contrast to the results in cultured cells, we found that insulin
expression was unaffected in E2A or HEB mutant mice, indicating that
neither of their gene products was essential for insulin gene
expression. These results indicate that the E2A- and HEB-encoded
proteins have functional redundant roles in the insulin E1
activator.
 |
RESULTS
|
|---|
E47 Potentiates Insulin Enhancer-Driven Expression in ß-Cells
To directly determine whether the transactivation properties of
the E2A proteins were influenced by factors enriched in islet
ß-cells, we analyzed the effect of E47 on insulin enhancer-driven
chloramphenicol acetyltransferase (CAT) reporter gene expression in an
insulin producing- (HIT T-15) and noninsulin (HeLa) producing-cell
line. Two different rat insulin II E1-dependent CAT reporter plasmids
were used in this analysis. -238 wild type (WT) CAT contained
5'-flanking enhancer/promoter sequences from -238 to +2 bp, and RIPE3
CAT from -126 to -86 bp (Fig. 1A
). The
RIPE3 CAT expression plasmid contains three copies of the -126
to -86 bp region inserted directly upstream of the ovalbumin TATA box
in a CAT expression vector, pOVCAT-50 (5). This mini-enhancer unit
recapitulates the islet ß cell-selective expression pattern observed
for the intact insulin enhancer in both transient transfection (5) and
transgenic (37) experiments.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 1. E47 Stimulates Insulin Enhancer-Driven Expression
in HIT T-15 ß Cells
A, Schematic representation of the 5'-flanking rat insulin II sequences
in -238 WT CAT and RIPE3 CAT. The shaded boxes
represent insulin enhancer sequences, and the thick solid
lines refer to insulin promoter sequences. The insulin
sequences in -238WT and RIPE3 span -238 to +2 bp and -126 to -86
bp, respectively. The location of the A3 (-201 to -196 bp), RIPE3b1
(-115 to -107 bp), and E1 (-100 to -91 bp) elements is shown. B,
The RIPE3 CAT and -238 WT CAT were either transfected alone or with
CMV E47. RIPE3 CAT contains three copies of the -126 to -86 bp region
inserted in its normal orientation directly upstream of the ovalbumin
TATA box in a CAT expression vector, pOVCAT-50 (5). The CAT activity in
each sample was normalized to the LUC activity from the cotransfected
pSV2 LUC plasmid. Results are represented as normalized CAT
activity ± SD. Fold activation by E47 is expressed as
the ratio of the CAT activity in the presence of CMV E47 divided by the
level of CAT activity in the absence of CMV E47.
|
|
The -238 WT CAT and RIPE3 CAT were both expressed more efficiently in
the insulin producing HIT T-15 ß-cell line than in HeLa (Fig. 1B
).
These results are consistent with previous observations demonstrating
the key role of ß-cell-enriched factors acting at the A3, RIPE3b1,
and E1 elements on insulin enhancer-driven transcription (2, 3, 4, 5, 6, 7, 8).
Expression from both -238 WT CAT and RIPE3 CAT were potentiated by E47
in HIT T-15 cells (Fig. 1
). In contrast, E47 had no affect on insulin
enhancer-driven activity in HeLa cells. The inability of E47 to
activate in HeLa cells presumably results from the absence of insulin
gene activator factors, such as RIPE3b1 and the islet-enriched bHLH
factors, and/or the presence of inhibitory factors such as the protein
kinase that prevents E47 homodimer-mediated activation in non-B
lymphocyte lineages (38).
AD2 Is the Principal Mediator of E47 Transcriptional Activation in
ß-Cells
Based on the apparent importance in ß-cells of the AD2 region on
E47 activation (29, 31), we evaluated the potential role of this domain
in RIPE3 CAT activation in HIT T-15 cells using WT E47 and mutants
defective in AD1, AD2, or AD1 and AD2 activation domain function. E47
stimulation was more severely effected in the AD2 mutant when compared
with the AD1 mutant (Fig. 2
). As
expected, the AD1/AD2 double mutant completely prevented enhancement.
These results established that the activation domains of E47 play an
important role in insulin enhancer activation in ß-cells.
Furthermore, that AD2 is more crucial to this response.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 2. The AD2 Domain in E47 Is Crucial for
Transactivation in HIT T-15 ß Cells
RIPE3 CAT in the presence of wild type and mutant E2A-encoded proteins.
Diagrammatic representation of the E47, E12, and E2/5 proteins shows
the positions of the activation domains (AD) and bHLH domain. The
N-terminal activation domain (AD1; black box) is located
between amino acids 183 (27, 34) and the activation domain (AD2;
gray box) that functions preferentially in ß cells is
found between amino acids 345408 (29, 31). The bHLH region in E47 is
located between amino acids 539597 (39, 40). HIT T-15 cells were
cotransfected with RIPE3 CAT, and either the CMV E2A expression vector
or CMV4, and pSV2 LUC. The location of the E47 mutation within the E47
AD1m, E47 AD2m, and E47 AD1/AD2m expression products is described in
Materials and Methods. The normalized results are
expressed as the ratio of the CAT activity in the presence of CMV E2A
divided by the level of CAT activity in the absence of CMV E2A. Each
value is the mean ± SD calculated from at least three
independent transfections.
|
|
E47 Acts through the E1 Activator
We next analyzed whether two other well characterized E2A-encoded
products, E12 and E2/5, which differ from E47 in either their
DNA-binding or transactivation properties, could activate RIPE3 CAT
expression in HIT T-15 cells. The E12 and E47 proteins differ only in
their C-terminal bHLH sequences (24, 39), but this change precludes E12
from binding effectively to DNA as a homomeric complex (40). The amino
acid sequence of E2/5 is essentially identical to E47, except that the
first 44 amino acids of E47 and AD1 function are missing (24, 41).
RIPE3 CAT activity was stimulated by both E2/5 and E12 in HIT T-15
cells (Fig. 2
). Since stimulation by E12 was only slightly less
effective then E47, the transfected E2A proteins may bind and activate
in association with their islet-enriched bHLH partners.
To directly determine how E47 effected insulin E1 element binding, a
gel shift experiment was conducted with an E1 element probe and
extracts prepared from HIT T-15 cells transfected with a E47:FLAG
tagged fusion protein (Fig. 3
). E47:FLAG
also augmented RIPE3 CAT activity in a ß-cell-specific fashion (data
not shown). Three protein-E1 element DNA complexes, labeled as E1, USF,
and A, are routinely detected in ß-cell extracts (42). The E1 and USF
complexes contain the E1 activator and the adenovirus type 2 upstream
stimulatory transcription factor (USF), respectively (42). There was no
effect on the mobility of the E1 element binding complexes in E47:FLAG
extracts, although there was an increase in E1 activator binding levels
(Fig. 3
). The E1 complex was specifically supershifted by a polyclonal
antibody raised to the FLAG epitope in E47:FLAG-transfected HIT T-15
extracts. This appears to be a specific reaction, since E47 antisera
also supershifted this complex whereas the FLAG antisera had no effect
in nontransfected extracts (Fig. 3
). Previous results have demonstrated
that the E1 complex is composed of both islet-enriched
[i.e. BETA2 (22) and INSAF(21)] and the E2A- or
HEB-proteins (17, 18, 19, 20). Since E1 activator binding levels were increased
in E47:FLAG-transfected HIT T15 extracts, these results indicate that
E47 activates insulin enhancer-mediated expression by associating with
its islet-enriched bHLH partner.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 3. Gel Shift Analysis Showing the Change in E1 Binding
Levels in E47-FLAG-Tagged Transfected HIT T-15 ß-Cells
Binding reactions were conducted using a [32P]E1 probe
and HIT T-15 nuclear extracts prepared from vector alone (lanes 1 and
2) or HTLV E47:FLAG (lanes 3 through 5) transfected cells. The E1, USF,
and A bands discussed in the text are labeled. The addition of either
the FLAG or E2A antisera specifically supershifted (SS) the E1
complex.
|
|
The E1, RIPE3a2, and RIPE3b1 Binding Sites Appear to be Required
for E47 Activation in ß-Cells
Our results strongly suggest that the E1 element of the insulin
enhancer is targeted for E47 activation in HIT T-15 cells. In addition
to the E1 element (-100 to -91 bp) in the RIPE3 transcription unit
(-126 to -86 bp), there are two other mutationally sensitive insulin
control elements, RIPE3b1 (-115 to -107 bp) and RIPE3a2 (-108 to
-99 bp) (5, 43). These factors synergistically activate RIPE3
transcription to approximately the level mediated by the intact rat
insulin II enhancer (5).
To identify the element(s) targeted for E47-mediated activation within
this region of the enhancer, we analyzed the effect of E47 on
expression from RIPE3 CAT constructs containing binding site mutations
in either the E1, RIPE3a2, or RIPE3b1 elements (Fig. 4
). As expected, stimulation by E47 was
prevented in the E1 mutant. However, activation was also blocked in the
RIPE3a2 and RIPE3b1 mutants. Although each of these RIPE3 mutants
reduced expression in HIT T-15 cells (Fig. 4
and 5 , they do not
effect the ß-cell-specific transcription pattern of the construct (5, 44). Our results suggest that functional interactions between the E1
activator and the factors that bind to the RIPE3a2 and RIPE3b1 elements
provide maximal enhancer activity in ß-cells. This hypothesis is also
consistent with results of Naya et al. (22), who suggested
that interactions between the E1 and RIPE3b1 activators are required
for cooperative activation of the RIPE3 transcription unit. These
investigators did not examine the effect of the RIPE3a2 activator on
this response.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 4. Effect of Mutagenesis of the RIPE3b1, RIPE3a2, and
E1 Elements on E47 Activation
A, The sequences in the RIPE3b1 (-115 to -107 bp), RIPE3a2 (-108 to
-99 bp), and E1 (-100 to -91 bp) elements within the RIPE3
transcription unit are shown. The boxes span the
residues required in protein binding (5). The mutations that eliminate
protein binding are shown. HIT T-15 cells were transfected with RIPE3,
RIPE3 E1m (the mutant in the E1 binding site), RIPE3a2m (the mutant in
the RIPE3a2 binding site), RIPE3b1m (the mutant in the RIPE3b1 binding
site), and either the CMV E47 expression vector or CMV4, and pSV2 LUC.
Quantitative analyses of the normalized CAT activity are presented
± SD. Fold activation by E47 is expressed as the ratio of
the CAT activity in the presence of CMV E47 divided by the level of CAT
activity in the absence of CMV E47.
|
|
Mice Lacking the E2A and HEB Gene Products Synthesize and
Secrete Normal Levels of Insulin
We have shown that overexpressing the E2A-encoded
proteins potentiates insulin gene expression in HIT T-15 ß-cells by
increasing the levels of the insulin E1 activator complex. Furthermore,
that activation requires the AD2 region conserved in HEB, the other
generally distributed bHLH factor present in the E1 activator. The
importance of the E2A proteins in insulin expression was also supported
by the antisense experiments of Vierra and Nelson (36), which
demonstrated that inhibiting E2A-encoded protein production attenuated
insulin gene expression. All of these results have been conducted in
transformed ß-cell lines.
To begin to investigate the role the E2A and HEB proteins play in
insulin transcription in animals, we analyzed how insulin production
was effected in mice lacking a functional gene. Previous studies with
these E2A (33, 34) and HEB (35) knockout mice have demonstrated that
these products were important for B lymphocyte development.
To assess possible defects in islet function of E2A mutant mice, we
stained pancreas sections with antibodies against the hormonal products
expressed in islet ß (insulin),
(glucagon), and
(somatostatin) cells. The immunohistochemical staining patterns from
the mutant mice were indistinguishable from those of control mice (Fig. 5
). Furthermore, plasma insulin levels in
the E2A and HEB gene knockouts were also essentially the same as the
control (Fig. 6
). Based upon the apparent
normal morphology and physiological status of islet ß-cells in mutant
mice, we conclude that E1 activator function is unaffected in the E2A
and HEB knockouts as a result of functional redundancy between these
bHLH factors.

View larger version (97K):
[in this window]
[in a new window]
|
Figure 5. Islet Hormone Expression in E2A Wild Type and
Mutant Mice
Photomicrograph illustrates immunohistochemical staining
(black) of insulin (A and B), glucagon (C and D), and
somatostatin (E and F) in pancreas sections from 3-week-old mice.
Column 1, Wild type E2A+/E2A+(+/+); 2,
homozygous E2Am/E2Am(-/-). The magnification
is approximately 30x.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Figure 6. Normal Plasma Insulin Levels Are Produced in Mice
Lacking a Functional E2A or HEB Gene
Plasma insulin levels were determined from tail blood samples from
3-week-old, wild type (+/+), heterozygous (±), and homozygous (-/-)
E2A and HEB mutant mice. The number of animals (n) used is shown. Mice
homozygous for the HEB mutation normally die within 2 weeks (35), which
enabled us to collect blood from only one such mouse. Importantly,
insulin levels were similar between the HEB+/+,
HEB±, and HEB-/- animals. The results are
presented as the mean ± SE from the groups containing
at least three animals.
|
|
 |
DISCUSSION
|
|---|
The function of the generally distributed E2A- and
HEB-encoded proteins in insulin E1 activator function was analyzed in
both transfection experiments performed with insulin-producing and
-nonproducing cell lines and in knockout mice. Our results indicate
that functional interactions between these generally distributed
factors and other distinct enhancer-binding factors mediate insulin
enhancer activity. Furthermore, that the AD2 region of the E2A and HEB
proteins plays a key role in mediating transcriptional activation of
the insulin gene in ß cells. The lack of any discernible
abnormalities in insulin gene expression in mice lacking a functional
E2A or HEB gene suggests that these ubiquitously distributed bHLH
factors can substitute for one another in mediating E1 activation in
mutant animals.
Most of the tissue-specific bHLH activators are heteromeric complexes
composed of the E2A, HEB, or E22 proteins in association with a
tissue-specific bHLH protein. The best characterized example of the
latter class is an activator of skeletal muscle differentiation, MyoD
(25, 26, 27, 28), while in ß-cells the representatives are BETA2/NeuroD and
INSAF. We found that overexpression of the E2A proteins stimulated
insulin-enhancer activity in a ß-cell-specific fashion. Activation
resulted from increased E1 activator levels as a consequence of E2A
associating with its islet bHLH partner. Interestingly, BETA2/NeuroD is
expressed at approximately 5-fold higher levels than the E2A gene
products in islet ß-cells (45), indicating that E2A products may also
be limiting for E1 activation in vivo.
Activation by E47 in ß-cells was primarily mediated by its AD2
region, which consists of a unique loop-helix motif that is
structurally and functionally conserved in the HEB and E22 proteins
(30). As previous studies have shown that AD2 activity is
preferentially active in pancreatic
- and ß-cell lines (29, 31),
our results would indicate that islet-enriched factors play a key role
in modifying the transactivation capacity of this region in these
generally expressed proteins.
The pancreatic ß-cell type-specific expression pattern observed for
the insulin enhancer can be recapitulated by multimerizing the
sequences spanned by the RIPE3 transcription unit (-126 to -86 bp)
(5). E47 activation was not only prevented by site-specific mutations
within the E1 binding site but also at the islet-enriched RIPE3b1 and
generally distributed RIPE3a2 activator sites. These results indicate
that specific interactions between the various ubiquitous and
islet-enriched factors are required for synergistic activation of the
RIPE3 transcription unit.
The function of the E2A and HEB proteins in insulin expression in
vivo was investigated in mutant mice carrying a targeted null
mutation. Mice lacking a functional E2A gene exhibited no morphological
or physiological abnormalities in islet ß-cells. There was also no
difference in circulating insulin levels between wild type and
homozygous E2A or HEB mutant mice. We conclude that neither of these
bHLH factors is essential for insulin expression. In contrast, Vierra
and Nelson (36) proposed, as a result of their E2A antisense
experiments performed in ß-cell lines, that the E2A proteins were
indispensable. However, since the entire E12 cDNA was present in the
E2A antisense expression vector used in these in vitro
experiments, it is possible that the levels of both E2A and HEB were
reduced in these studies (36). Unfortunately, reagents that could
distinguish expression of E2A from E2A-related gene products were not
used. Alternatively, it is also possible that a functionally redundant
factor(s) is able to act in place of E2A in vivo, but the
mechanism that mediates this response does not occur in
vitro.
We propose that compensation between the E2A and HEB proteins allows
normal insulin gene expression in mutant mice. Yet, it is also
conceivable that E22 may be in this complex; as a consequence, we
cannot rule out the possibility that this factor also has an important
functional role in the ß-cell. Interestingly, B lymphocyte cell
development is effected in E2A (33, 34), HEB (35), and E22 (35)
mutant mice, whereas there were no obvious abnormalities in skeletal
muscle differentiation. Together, these results indicate that similar
regulatory mechanisms are used to retain insulin and myogenic E
activator function in E2A or HEB mutant mice.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture and DNA Transfection
The HIT T-15 cell line was maintained in DMEM (GIBCO/BRL,
Gaithersburg, MD) supplemented with 15% (vol/vol) horse serum, 2.5%
(vol/vol) FBS, and 50 µg each of streptomycin and penicillin per ml;
HeLa cell lines were maintained in the same medium supplemented with
10% FCS. Approximately 12 h before transfection, HIT T-15 and
HeLa cells were plated at densities of 2 x 106 and
0.5 x 106 cells, respectively, per
100-mm2 plate. Transfection of plasmid DNA was performed
using the calcium phosphate coprecipitation procedure (7). HIT T-15 and
HeLa cell transfections (11 µg total DNA) were performed using 2 µg
of either -238 CAT, RIPE3 CAT, or pOVCAT-50 (control plasmid) and 8
µg of a cytomegalovirus (CMV) E2A expression plasmid or CMV4 (carrier
DNA) and 1 µg of pSV2 LUC. HIT T-15 cells were also exposed to 20%
glycerol for 2 min, 4 h after the addition of the calcium
phosphate DNA precipitates. A luciferase (LUC) reporter plasmid, pSV2
LUC, was used as an internal control (46). The transfected cells were
harvested after 48 h, and LUC and CAT enzymatic assays were
performed as described by De Wet et al. (46) and Nordeen
et al. (47), respectively. The CAT activity from the insulin
expression plasmids was normalized to pSV2 LUC activity. pOVCAT-50
activity (825 ± 95 cpm) was subtracted from the RIPE3 activity.
The cotransfected CMV E47 expression plasmid had no effect on pSV2 LUC
or pOVCAT-50 activity (data not shown). Each transfection was repeated
a number of times with at least two different plasmid preparations.
DNA Constructs
The construction of the RIPE3 CAT (5) and -238 WT CAT (43)
expression plasmids has been described previously. The AD1, AD2, and
AD1/AD2 double mutants were constructed in the context of full-length
E47 from the AD1 [E2A AD1 mutant 2 (32)] and AD2 [E2A AD2 337E/338R
(30)] mutant expression plasmids. Activation domain activity has been
significantly compromised by a change in amino acids 19 (Leu to Arg)
and 21 (Phe to Arg) in the AD1 mutant, and amino acids 337 (Ala to Glu)
and 338 (Ile to Ser) in the AD2 mutant. E47, E47 mutant, and E12 cDNAs
were inserted into the CMV enhancer-driven expression vector, CMV4
(48). The E47:FLAG chimera contains an eight-amino acid FLAG epitope at
the C-terminal end of the full-length E47 protein. The E47:FLAG protein
was expressed from the human T cell leukemia virus (HTLV) promoter in
the vector PXS.
Electrophoretic Mobility Shift Assays
Nuclear extracts were prepared as described (49) from HIT T-15
cells transfected with 10 µg of either HTLV E47:FLAG or CMV4 DNA.
Approximately 10 µg extract protein were used per gel mobility shift
sample. A double-stranded oligonucleotide probe to the rat insulin II
E1-element (-104 TCTGGCCATCTGCTGATCCT -85) binding site was
end-labeled using [
-32P]dATP (6,000 Ci/mmol) and the
Klenow fragment of Escherichia coli DNA polymerase I and
used as probe. The anti-E2A and anti-FLAG (IBI) antibodies (1 µl)
were preincubated with extract protein for 20 min at room temperature
before initiation of the DNA-binding reactions. The binding reactions
were conducted at 4 C under conditions described previously (42).
Samples were subjected to electrophoretic separation on a 4%
nondenaturing polyacrylamide gel at 200 V for 1.52 h using the high
ionic strength PAGE conditions (42). The gel was then dried, and
labeled DNA-protein complexes were localized by autoradiography.
Random Plasma Insulin Estimation
Tail blood (
20 µl) was collected from wild type,
heterozygote, and E2A and HEB homozygous mutant mice. The E2A (33) and
HEB (35) genes were disrupted in mutant mice by replacing the bHLH
domain with the PGK-neo gene. This mutation eliminated the DNA-binding
and dimerization properties of the bHLH proteins encoded by the gene.
Plasma insulin levels were measured using an RIA analysis kit (Linco
Research, St. Louis, MO).
Immunohistochemical Analysis
Pancreas sections from the wild type, heterozygote, and
homozygous E2A mutant mice were prepared as described elsewhere (3).
Immunochemical detection of insulin, glucagon, and somatostatin
staining was determined using hormore- specific primary antibodies and
an alkaline phosphatase-linked secondary antibody (3). Staining was
visualized after incubation with the alkaline phosphatase substrate,
nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate. Antibodies
were used at the following dilutions: guinea pig antibovine insulin
(Linco Research Inc., St. Louis, MO), 1:400; rabbit antihuman glucagon
(Calbiochem, San Diego, CA), 1:12,000; rabbit antihuman somatostatin
(Peninsula Labs, Belmont, CA), 1:8,000.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. Yi Qiu, Susan Samaras, and Kuo-Liang Wu for
constructive criticism of the manuscript, Steven Sanders for technical
assistance, and Drs. Melanie Quong and Cornelius Murre for the E12
mutant expression plasmids and polyclonal E2A antisera. These studies
were conducted in collaboration with the late Harold Weintraub.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Roland Stein, Department of Molecular Physiology and Biophysics, Vanderbilt University Medical School, Room 706, Light Hall, Nashville, Tennessee 37232.
This work was supported by NIH Grant RO1 DK-4985206 (to R.S.), and
partial support was also derived from the Vanderbilt University
Diabetes Research and Training Center Molecular Biology Core Laboratory
(Public Health Service Grant P60 DK-20593 from the NIH).
1 Present address: Joslin Diabetes Center, Boston, Massachusetts 02215. 
2 Present address: Genetics Institute, 87 Cambridge Park Drive, Cambridge,
Massachusetts 02140. 
{smhd3}Note Added in Proof
During review of this manuscript, another report was published that
analyzes the importance of the E2A-encoded products in insulin gene
transcription in vivo (Itkinansari P, Bain G, Beattie GM,
Murre C, Hayek A, Levine F 1996 E2A gene products are not required for
insulin gene expression. Endocrinology 137:35403543)
Received for publication June 11, 1997.
Accepted for publication July 11, 1997.
 |
REFERENCES
|
|---|
-
Stein R 1993 Factors regulating insulin gene
transcription. Trends Endocrinol Metab 4:96100[Medline]
-
German MS, Moss LG, Wang, J, Rutter, WJ 1992 The
insulin and islet amyloid polypeptide genes contain similar
cell-specific promoter elements that bind identical ß-cell nuclear
complexes. Mol Cell Biol 12:17771788[Abstract/Free Full Text]
-
Peshavaria M, Gamer L, Henderson E, Teitelman G, Wright CVE,
Stein R 1994 XlHbox 8, an endoderm-specific Xenopus
homeodomain protein, is closely related to a mammalian insulin gene
transcription factor. Mol Endocrinol 8:806816[Abstract]
-
Petersen HV, Serup P, Leonard J, Michelsen BK, Madsen OD 1994 Transcriptional regulation of the human insulin gene is dependent of
the homeodomain proteins STF1/IPF1 acting through the CT boxes. Proc
Natl Acad Sci USA 91:1046510469[Abstract/Free Full Text]
-
Shieh S-Y, Tsai M-J 1991 Cell-specific and ubiquitous factors
are responsible for the enhancer activity of the rat insulin II gene.
J Biol Chem 266:1670816714[Abstract/Free Full Text]
-
Karlsson O, Edlund T, Moss JB, Rutter, WJ, Walker MD 1987 A
mutational analysis of the insulin gene transcription control region:
expression in beta cells is dependent on two related sequences within
the enhancer. Proc Natl Acad Sci USA 84:88198823[Abstract/Free Full Text]
-
Whelan J, Poon D, Weil PA, Stein R 1989 Pancreatic
ß-cell-type-specific expression of the rat insulin II gene is
controlled by positive and negative transcriptional elements. Mol Cell
Biol 9:32533259[Abstract/Free Full Text]
-
Crowe DT, Tsai, M-J 1989 Mutagenesis of the rat insulin II
5'-flanking region defines sequences important for expression in HIT
cells. Mol Cell Biol 9:17841789[Abstract/Free Full Text]
-
German M, Ashcroft S, Docherty K, Edlund H, Edlund T,
Goodison S, Imura H, Kennedy G, Madsen O, Melloul D, Moss L, Olson K,
Permutt MA, Philippe J, Robertson RP, Rutter WJ, Serup P, Stein R,
Steiner D, Tsai M-J, Walker MD 1995 The insulin promoter: a simplified
nomenclature. Diabetes 44:10021004[Medline]
-
Ohlsson H, Karlsson K, Edlund T 1993 IPF-1, a
homeodomain-containing transactivator of the insulin gene. EMBO J 12:42514259[Medline]
-
Peers B, Leonard J, Sharma S, Teitelman G, Montiminy MR 1995 Insulin expression in pancreatic islet cells relies on cooperative
interactions between the helix loop helix factor E47 and the homeobox
factor STF-1. Mol Endocrinol 8:17981806[Abstract]
-
Guz Y, Montminy MR, Stein R, Leonard J, Gamer LW, Wright CVE,
Teitelman G 1995 Expression of murine STF-1, a putative insulin gene
transcription factor, in ß-cells of pancreas, duodenal epithelium and
pancreatic exocrine and endocrine progenitors during ontogeny.
Development 121:1118[Abstract]
-
Leonard J, Peers B, Johnson T, Ferrere K, Lee S, Montminy
M 1993 Characterization of somatostatin transactivating factor-1, a
novel homeobox factor that stimulates somatostatin expression in
pancreatic islet cells. Mol Endocrinol 7:12751283[Abstract]
-
Miller CP, McGehee Jr RE, Habener JF 1994 IDX-1: a new
homeodomain transcription factor expressed in rat pancreatic islets and
duodenum that transactivates the somatostatin gene. EMBO J 13:11451156[Medline]
-
Jonsson J, Carlsson L, Edlund T, Edlund H 1994 Insulin-promoter-factor 1 is required for pancreas development in mice.
Nature 371:606609[CrossRef][Medline]
-
Offield MF, Jetton TL, Stein R, Labosky T, Ray M, Magnuson
M, Hogan B, Wright, CVE 1996 PDX-1 is required for development of the
pancreas and differentiation of the rostral duodenum. Development 122:983995[Abstract]
-
Aronheim A, Ohlsson H, Park CW, Edlund T, Walker MD 1991 Distribution and characterization of helix-loop-helix enhancer-binding
proteins from pancreatic beta cells and lymphocytes. Nucleic Acids Res 19:38933899[Abstract/Free Full Text]
-
Cordle SR, Henderson E, Masuoka H, Weil PA, Stein R 1991 Pancreatic ß-cell-type-specific transcription of the insulin gene is
mediated by basic helix-loop-helix DNA-binding proteins. Mol Cell Biol 11:17341738[Abstract/Free Full Text]
-
German MS, Blanar MA Nelson C, Moss LG, Rutter WJ 1991 Two
related helix-loop-helix proteins participate in separate cell-specific
complexes that bind the insulin enhancer. Mol Endocrinol 5:292299[Abstract]
-
Peyton M, Moss L, Tsai, M-J 1994 Two distinct class A
helix-loop-helix transcription factors, E2A and BETA 1, form separate
DNA-binding complexes on the insulin E-box. J Biol Chem 269:2593625941[Abstract/Free Full Text]
-
Robinson GLWG, Cordle SR, Henderson E, Weil PA, Teitelman G,
Stein R 1994 A novel, pancreatic islet specific transcription factor
that binds to and activates expression mediated through insulin
enhancer ICE sequences. Mol Cell Biol 14:67046714[Abstract/Free Full Text]
-
Naya FJ, Stellrecht CMM, Tsai M-J 1995 Tissue-specific
regulation of the insulin gene by a novel basic helix-loop-helix
transcription factor. Genes Dev 9:10091019[Abstract/Free Full Text]
-
Lee JE, Hollenberg SM, Snider L, Turner DL, Lipnick N,
Weintraub H 1995 Conversion of Xenopus ectoderm into neurons
by NeuroD, a basic helix-loop-helix protein. Science 268:836844[Abstract/Free Full Text]
-
Henthorn P, Kiledjian M, Kadesch T 1990 Two distinct
transcription factors that bind the immunoglobulin enhancer µE5/
E2
motif. Science 247:467470[Abstract/Free Full Text]
-
Lassar, AB, Davis RL, Wright WE, Kadesch T, Murre C, Voronova
A, Baltimore D, Weintraub H 1991 Functional activity of myogenic HLH
proteins requires hetero-oligomerization with E12/E47-like proteins
in vivo. Cell 66:305315[CrossRef][Medline]
-
Murre C, Baltimore D 1992 In: McKnight SL, Yamamoto KR (eds),
Transcriptional Regulation. Cold Spring Harbor Laboratory Press,
Plainview, NY, pp 861879
-
Bengal E, Ransone L, Scharfmann R, Dwarki VJ, Tapscott SJ,
Weintraub H, Verma IM 1992 Functional antagonism between
c-jun and MyoD proteins: a direct physical association. Cell 68:507519[CrossRef][Medline]
-
Li Li, Chambard J-C, Karin M, Olson EN 1992 Fos and
Jun repress transcriptional activation by myogenin and MyoD:
the amino terminus of jun can mediate repression. Genes Dev 6:676689[Abstract/Free Full Text]
-
Robinson, GLWG, Henderson E, Massari ME, Murre C, Stein R 1995 c-Jun inhibits Insulin Control Element mediated
transcription by affecting the transactivation potential of the E2A
gene products. Mol Cell Biol 15:13981404[Abstract]
-
Quong MW, Massari ME, Zwart R, Murre C 1993 A new
transcriptional-activation motif restricted to a class of
helix-loop-helix proteins is functionally conserved in both yeast and
mammalian cells. Mol Cell Biol 13:792800[Abstract/Free Full Text]
-
Aronheim A, Shiran R, Rosen A, Walker MD 1993 The E2A gene
product contains two separable and functionally distinct transcription
activation domains. Proc Natl Acad Sci USA 90:80638067[Abstract/Free Full Text]
-
Massari ME, Jennings PA, Murre C 1996 The AD1 transactivation
domain of E2A contains a highly conserved helix which is required for
its activity in both Saccharomyces cerevisiae and mammalian
cells. Mol Cell Biol 16:121129[Abstract]
-
Zhuang Y, Soriano P, Weintraub H 1994 The helix-loop-helix
gene E2A is required for B cell formation. Cell 79:875884[CrossRef][Medline]
-
Bain G, Maandag E, Izon D, Amsen D, Kruisbeek A, Weintraub B,
Krop I, Schissel M, Feeney A, van Roon M, van der Valk M, te Riele H,
Berns A, Murre C 1994 E2A proteins are required for proper B cell
development and initiation of immunoglobulin gene rearrangements. Cell 79:885892[CrossRef][Medline]
-
Zhuang Y, Cheng P, Weintraub H 1996 B-lymphocyte development
is regulated by the combined dosage of three basic helix-loop-helix
genes, E2A, E22, and HEB. Mol Cell Biol 16:28982905[Abstract]
-
Vierra, CA, Nelson C 1995 The Pan basic heleix-loop-helix
proteins are required for insulin gene expression. Mol Endocrinol 9:6471[Abstract]
-
Stellrecht CMM, Demayo FJ, Finegold MJ, Tsai M-J 1997 Tissue-specific and developmental regulation of the rat insulin II gene
enhancer, RIPE3, in transgenic mice. J Biol Chem 272:35673572[Abstract/Free Full Text]
-
Sloan SR, Shen CP, McCarrick-Walmsley R, Kadesch, T 1996 Phosphorylation of E47 as a potential determinant of B-cell-specific
activity. Mol Cell Biol 16:69006908[Abstract]
-
Murre C, McCaw PS, Vaessin H, Cudy M, Jan LY, Jan YN, Cabrera
CV, Buskin J, Hasuschka SD, Lassar AB, Weintraub H, Baltimore D 1989 Interactions between heterologous helix-loop-helix proteins generate
complexes that bind specifically to a common DNA sequence. Cell 58:537544[CrossRef][Medline]
-
Sun X-H, Baltimore D 1991 An inhibitory domain of E12
transcription factor prevents DNA binding in E12 homodimers but not
E12 heterodimers. Cell 64:459470[CrossRef][Medline]
-
Henthorn P, McCarrick-Walmsley R, Kadesch T 1990 Sequence of
the cDNA encoding ITF-1, a positive-acting transcription factor.
Nucleic Acids Res 18:677[Free Full Text]
-
Whelan J, Cordle SR, Henderson E, Weil PA, Stein R 1990 Identification of a pancreatic ß-cell insulin gene transcription
factor that binds to and appears to activate cell-type-specific
expression: its possible relationship to other cellular factors that
bind to a common insulin gene sequence. Mol Cell Biol 10:15641572[Abstract/Free Full Text]
-
Cordle S, Whelan J, Henderson E, Masuoka H, Weil PA, Stein R 1991 Insulin gene expression in non-expressing cells appears to be
regulated by multiple, distinct, negative acting control elements. Mol
Cell Biol 11:28812886[Abstract/Free Full Text]
-
Robinson GLWG, Cordle SR, Henderson E, Weil PA, Teitelman G,
Stein R 1994 Analysis of transcription regulatory signals of the
insulin gene: expression of the trans-active factor that
stimulates insulin control element mediated expression precedes insulin
gene transcription. J Biol Chem 269:24522460[Abstract/Free Full Text]
-
Jensen J, Serup P, Karlsen C, Nielsen TF, Madsen OD 1996 mRNA
profiling of rat islet tumors reveals Nkx 6.1 as a beta-cell-specific
homeodomain transcription factor. J Biol Chem 271:1874918758[Abstract/Free Full Text]
-
De Wet JR, Wood KV, DeLuca M, Helinski DR, Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells.
Mol Cell Biol 7:725737[Abstract/Free Full Text]
-
Nordeen SK, Green PPI II, Fowles DM 1987 Laboratory
Methods. A Rapid, Sensitive, and Inexpensive Assay for Chloramphenicol
Acetyltransferase. DNA 6:173178[Medline]
-
Andersson S, Davis DL, Dahlback H, Jornvall H, Russell
DW 1989 Cloning, structure and expression of the mitochondrial
cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic
enzyme. J Biol Chem 264:82228229[Abstract/Free Full Text]
-
Schreiber E, Matthias P, Muller MM, Schaffner W 1989 Rapid
detection of octamer binding proteins with mini-extracts prepared
from a small number of cells. Nucleic Acids Res 17:6419[Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
J. E. Smith III and C. Cronmiller
The Drosophila daughterless gene autoregulates and is controlled by both positive and negative cis regulation
Development,
December 1, 2001;
128(23):
4705 - 4714.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-P. Huang, M. Liu, H. M. El-Hodiri, K. Chu, M. Jamrich, and M.-J. Tsai
Regulation of the Pancreatic Islet-Specific Gene BETA2 (neuroD) by Neurogenin 3
Mol. Cell. Biol.,
May 1, 2000;
20(9):
3292 - 3307.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. K. Thomas, K.-M. Yao, M. S. Tenser, G. G. Wong, and J. F. Habener
Bridge-1, a Novel PDZ-Domain Coactivator of E2A-Mediated Regulation of Insulin Gene Transcription
Mol. Cell. Biol.,
December 1, 1999;
19(12):
8492 - 8504.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Seijffers, O. Ben-David, Y. Cohen, A. Karasik, M. Berezin, C. B. Newgard, and S. Ferber
Increase in PDX-1 Levels Suppresses Insulin Gene Expression in RIN 1046-38 Cells
Endocrinology,
July 1, 1999;
140(7):
3311 - 3317.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y. Qiu, A. Sharma, and R. Stein
p300 Mediates Transcriptional Stimulation by the Basic Helix-Loop-Helix Activators of the Insulin Gene
Mol. Cell. Biol.,
May 1, 1998;
18(5):
2957 - 2964.
[Abstract]
[Full Text]
|
 |
|