help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Budworth, P. R.
Right arrow Articles by Nilson, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Budworth, P. R.
Right arrow Articles by Nilson, J. H.
Molecular Endocrinology 11 (11): 1669-1680
Copyright © 1997 by The Endocrine Society

Multiple Characteristics of a Pentameric Regulatory Array Endow the Human {alpha}-Subunit Glycoprotein Hormone Promoter with Trophoblast Specificity and Maximal Activity

Paul R. Budworth, Patrick G. Quinn and John H. Nilson

Department of Pharmacology (P.R.B., J.H.N.), School of Medicine, Case Western Reserve University, Cleveland, Ohio 44106,
Department of Cellular and Molecular Physiology (P.G.Q.), The Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Trophoblast-specific expression of the human {alpha}-subunit glycoprotein hormone gene requires a tightly linked array of five different regulatory elements [trophoblast-specific element (TSE), {alpha}-activating element ({alpha}ACT), a tandem cAMP response element (CRE), junctional regulatory element (JRE), and a CCAAT box]. We examined their contextual contributions to trophoblast-specific expression by using transfection assays to evaluate activity of systematic block replacement mutations made within the 1500-bp 5'-flanking region of the human {alpha}-subunit gene. While all five elements were required for full activity, only the TSE and JRE displayed trophoblast specificity. Interestingly, the TSE-binding protein has limited tissue distribution whereas a JRE-binding protein appears trophoblast specific. Likewise, replacement studies with an AP-1 element that binds heterodimers of jun and fos indicated that this element was incapable of compensating for either the tandem CRE or JRE. This preference for both CRE- and JRE-binding proteins provides another avenue for configuring an {alpha}-subunit promoter with trophoblast specificity. Additional analysis with a cAMP response element binding protein (CREB)-Gal4 fusion protein further underscored the importance of CREB as well as suggested that transcriptional contributions come from both the DNA-binding domain and transactivation domain of this protein. We also examined the interactive nature of the pentameric array by placing a 15-bp random sequence between each element. Remarkably, only the insertion 3' of the CCAAT box diminished promoter activity. This suggested the absence of direct interactions between the transcriptional factors that bind each element in the array. It also suggested that the CCAAT box is position-dependent relative to the TATA box. This position dependence appeared cell-specific, as it was not manifest in a gonadotrope cell line ({alpha}T3–1 cells). Thus, the CCAAT box also has tissue-specific characteristics that assist in targeting expression of the {alpha}-subunit gene to trophoblasts. Together, these data suggest that multiple characteristics of a complex pentameric array of regulatory elements endow the {alpha}-subunit promoter with trophoblast specificity and maximal activity.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
LH, FSH, TSH, and CG belong to a family of heterodimeric glycoprotein hormones (1). Although the ß-subunit confers functional specificity to each glycoprotein hormone, activity requires heterodimerization with an {alpha}-subunit encoded by a single copy gene (1). In primates, synthesis of the full complement of heterodimeric glycoprotein hormones requires that expression of the {alpha}-subunit gene occurs at discrete times in cytotrophoblasts of the placenta, cells of the hypophyseal placode adjacent to the anterior neuropore, and in gonadotropes and thyrotropes of the pituitary (2, 3). This complex temporal and spatial pattern probably involves mechanisms that activate and then restrict expression of the {alpha}-subunit gene (3). Herein, we focus on the mechanism underlying trophoblast-specific expression.

Full activity of the {alpha}-subunit promoter in trophoblasts requires five different regulatory elements located between -180 and -80 of the 5'-flanking region of the {alpha}-subunit gene [trophoblast-specific element (TSE), {alpha}-activating element ({alpha}ACT), tandem cAMP response element (CRE), junctional regulatory element (JRE), CCAAT] (4, 5, 6, 7, 8, 9, 10, 11, 12). These elements have been separated into three different domains; the upstream regulatory domain (URE; contains the TSE and {alpha}ACT), tandem CRE, and a downstream regulatory domain (DRE) that includes both the JRE and CCAAT box (Fig. 1Go) (4).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. Sequence of the Human {alpha} 5'-Flanking Region from -180 to -80

Cis-acting elements that enhance expression of the {alpha}-subunit gene in trophoblast are listed. Bases outlined were replaced with an AP-1 core sequence (TGACTCA) or replaced with a null mutation. The TSE and {alpha}ACT together form the URE (upstream regulatory element), while the JRE and CCAAT box form the DRE (distal regulatory element).

 
The URE (4, 6) was portrayed originally as a single element and emphasized for its importance in directing trophoblast-specific expression. Alone, the URE had little activity. However, when linked to tandem CRE, the URE displayed transcriptional activity only in cell lines derived from choriocarcinomas (4, 6, 7, 12). Consequently, the URE and CREs together were designated as a composite placenta-specific enhancer or PSE (6).

The URE has since been reported to bind several proteins and divided into two domains; the TSE and the {alpha}ACT (13, 14). The TSE resides between -182 and -159 and binds a protein (the TSE binding protein or TSEB) originally thought to be restricted to trophoblasts (6, 13). A recent report, however, suggests that TSEB may be AP-2 (15), a transcriptional factor detected in several different cell types (16). Thus, TSEB cannot be regarded as strictly trophoblast-specific.

The {alpha}ACT, located between -161 to -141, contains a consensus GATA binding site. GATA-2 and GATA-3 are present in choriocarcinoma cells, and both bind {alpha}ACT (17, 18).

Additional studies (4, 14, 19) indicated that another factor can functionally substitute for TSEB. Since the binding site for this factor spans both the TSE and {alpha}ACT, it has been designated as URE binding protein 1 or UREB1 (14). In short, the URE is a complex element that can be subdivided into at least three overlapping protein-binding sites. While each site is functionally significant, no single site displays clear dominance.

A tandem CRE is located immediately downstream of {alpha}ACT. Placing a 5- or 10-bp insertion between the tandem CRE disrupts their homotypic synergism (20), suggesting that the CRE-binding proteins (CREBs) interact directly with each other. The CREs also interact synergistically with the URE as well as with one another in stimulating promoter activity (6, 7, 12). It remains unclear, however, whether the synergistic relationship between the URE- and CRE-binding proteins involves a direct interaction.

In most mammals, including lower primates, the {alpha}-subunit promoter contains only one homolog of the tandem CRE found in higher primates (21). This homolog contains a single C to T transition that disrupts the palindrome (TGACGTCA) required for binding of CREB (5). {alpha}-Subunit promoters with this transition are inactive in trophoblasts but work well in gonadotropes (5, 21, 22, 23, 24). Furthermore, activity in trophoblasts can be conferred to the bovine {alpha}-subunit promoter by restoring the palindrome in the CRE homolog with a single T-to-C transition (5). Together, these observations led to the hypothesis that the CRE was essential for trophoblast-specific expression of the {alpha}-subunit gene (21).

Although a functional CRE is required for activity of the {alpha}-subunit promoter in trophoblasts, a functional URE is also required. This is illustrated best in mice where two {alpha}-subunit alleles have been identified. One contains a functional CRE whereas the other contains the same C-to-T transition found in other mammalian {alpha}-subunit promoters. Neither allele is expressed in mouse placenta; both promoters are also inactive when analyzed by transfection in choriocarcinoma cells (24). Subsequent studies indicated that the mouse {alpha}-subunit promoter also lacks binding sites for TSE-binding protein (TSEB) (AP-2) and GATA (13, 14), further underscoring that trophoblast-specific expression requires both a composite URE and tandem CRE.

The DRE contains at least two regulatory elements, the JRE and a CCAAT box. The JRE resides between -120 and -100 bp of the {alpha}-subunit promoter, abutting, but not overlapping, the 3'-most functional boundary of the tandem CRE. Mutations within the JRE attenuate activity in trophoblasts (25) but not in gonadotropes (26), suggesting that the JRE may be trophoblast-specific. The mechanism for this specificity, however, has remained unclear, as the factor that binds the JRE appeared to be the same in several cell lines (25).

The CCAAT box located between -100 and -80 also contributes to activity of the {alpha}-subunit promoter in trophoblasts and in other cell lines where the promoter displays limited activity (11). The {alpha}-subunit CCAAT box appears to bind a protein [{alpha}-CCAAT binding factor ({alpha}CBF) distinct from previously characterized CCAAT-binding factors (11)]. It remains to be determined whether the JRE and CCAAT box interact with one another or whether this downstream regulatory domain interacts directly with the tandem CRE.

Collectively, the studies described above suggest that targeted expression of the {alpha}-subunit gene in trophoblasts occur through a complex combinatorial code formed by five different regulatory elements. While these elements have been characterized individually or as selected pairs on a minimal promoter, no study has systematically evaluated the interactions among all five regulatory elements in the context of the human {alpha}-subunit promoter. Furthermore, since none of the elements appear to bind a protein(s) unique to trophoblasts, it remains unclear how this pentameric array directs expression of the {alpha}-subunit gene to trophoblasts. Because each element makes a significant contribution to promoter activity in trophoblasts, we considered the possibility that multiple features of this pentameric array collectively form a unique trophoblast-specific code. Herein, we report results from systematic analyses of the contribution of each of the members of this pentameric array that confirms this prediction.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Two of the Five Regulatory Elements Display Trophoblast Specificity
Full activity of the human {alpha}-promoter in trophoblasts requires all five of the elements underscored in Fig. 1Go. To evaluate the relative contribution of each element and selected pairs of elements, we used a functional assay that preserves the spatial integrity of this region. This was achieved by using the proximal 1500-bp 5'-flanking region of the human {alpha}-subunit gene as the promoter context. Each element, or select combinations, was replaced with a block mutation devoid of protein-binding activity. This approach permits comparative evaluation of the impact of each element in the pentameric array within the same experimental paradigm and allows a relative ranking of both its strength and tissue specificity.

Figure 2Go depicts the activity of each block replacement mutant after transfection into cell lines derived from the following tumor tissue: trophoblast (BeWo), gonadotrope ({alpha}T3–1), or breast (MCF-7). Three functional classes of effects can be categorized. Mutations in the TSE and JRE are trophoblast specific. In contrast, {alpha}ACT and the CRE mutations have global effects, affecting activity in all three cell lines, with the greatest impact occurring in BeWo cells. Finally, the CCAAT box mutation reduced promoter activity in trophoblast and breast cell lines, suggesting that this element has limited cell specificity.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Two of the Five Regulatory Elements Display Trophoblast Specificity

The five regulatory elements of the human {alpha}-promoter are displayed on top. Regulatory elements replaced with a null mutation are depicted in black. Constructs were transfected into BeWo, {alpha}T3–1, and MCF-7 cells. ND, Not determined. Activity is expressed relative to the wt promoter in each cell line. Values represent the means ± SEM.

 
As expected, the tandem CRE offers the strongest individual contribution to transcription. Although a triple mutation involving the TSE, {alpha}ACT, and tandem CRE was not included in this panel of vectors, the extreme low level of activity of the TSE/{alpha}ACT double mutant and almost nondetectable activity of the tandem CRE mutant are consistent with the previously reported synergistic relationship between the URE and CRE (6). For trophoblasts, this can be regarded as an extreme form of synergism as both the URE (TSE/{alpha}ACT) and tandem CRE clearly depend on one another; placing a mutation in one is akin to ablation of both.

The JRE and CCAAT box reside within the DRE, a region of the {alpha}-subunit promoter traditionally regarded as important for basal activity (4). Interestingly, mutation of both the CCAAT box and JRE reduces activity of the {alpha}-subunit promoter to 16% in BeWo cells. This double mutant illustrates that alone the URE/CRE composite element, formerly referred to as the placenta-specific enhancer [PSE (6)] contributes only 16% of the activity normally associated with the intact {alpha}-subunit promoter. This further underscores the importance of the JRE and CCAAT box and their relationship to upstream elements.

Double mutations in the TSE and JRE were also made. This mutation reduces promoter activity to 15% in BeWo cells, but has virtually no effect in {alpha}T3–1 cells (Fig. 2Go), providing additional evidence for the trophoblast specificity of the TSE and JRE. However, without the tandem CRE, promoter activity is virtually undetectable. Thus, taken together, the systematic block replacement studies define a pentameric array of regulatory elements that together set the transcriptional tone of the {alpha}-subunit promoter in trophoblasts.

The JRE Binds a Protein Unique to Trophoblasts
Given the trophoblast-specific property of the JRE, we next determined whether choriocarcinoma cells express a tissue-specific protein that binds to this element. Previously, we reported that a JRE-binding protein can be detected by electrophoretic mobility shift assay (EMSA) in choriocarcinoma cells and in several different nontrophoblastic cell lines including HeLa and HepG2 (25). Such a protein can also be detected by EMSA in {alpha}T3–1 and MCF-7 cells (Fig. 3Go). Subsequent analysis by Southwestern blot, however, revealed that the 40-kDa protein detected in BeWo cells was undetectable in {alpha}T3–1 or MCF-7 cells (Fig. 4Go). This indicates that the BeWo cells contain a distinct JRE-binding activity not found in other cell types. If so, this would explain the trophoblast-specific effect of the JRE. Additional experiments will be necessary to determine whether this binding activity represents a monomeric or heteromeric protein(s).



View larger version (79K):
[in this window]
[in a new window]
 
Figure 3. EMSA Detects JRE-Binding Proteins in Nuclear Extracts from Choriocarcinoma and Nonchoriocarcinoma Cell Lines

Radiolabled probe corresponded to the JRE (-120 to -90) of human {alpha}-subunit promoter as shown on top. Wild type and nonspecific unlabeled competitors were added at 150-fold molar excess where indicated. The arrow denotes JRE-binding proteins.

 


View larger version (69K):
[in this window]
[in a new window]
 
Figure 4. Southwestern Blot Detects JRE-Binding Proteins Only in Nuclear Extracts from Choriocarcinoma Cells

Forty micrograms of nuclear extract from BeWo (B), {alpha}T3–1 (T), or MCF-7 (M) cells were resolved on an SDS-polyacrylamide gel with a 4% stacking gel and 10% resolving gel. After transfer to nitrocellulose membranes, bound proteins were renatured, blocked, and probed with radiolabeled JRE (-120/-90). Competitors were added at 200-fold excess. Molecular weight markers are indicated on the right. The arrow designates JRF with a molecular mass of approximately 40 kDa.

 
Systematic Replacement with an AP-1 Element Discloses Both Site-Specific Promiscuity and Stringency
The strong relationship between the five regulatory elements suggested that their cognate binding factors might form a unique multi-element code that confers trophoblast specificity to the {alpha}-subunit promoter. To address the stringency of this code, we systematically replaced each of the five regulatory elements with a consensus AP-1 site that preferentially binds jun/fos heterodimers. The native {alpha}-subunit promoter lacks a consensus AP-1 sequence and is not known to bind jun/fos heterodimers. Thus, this strategy tests whether a heterologous transcription factor can substitute for any of the native factors that collectively bind to this composite element.

Effects of replacement with AP-1 were site- and cell-dependent. AP-1 functionally replaced the TSE, {alpha}ACT, and CCAAT box in BeWo cells (Fig. 5Go). In striking contrast, AP-1 failed to functionally replace either the tandem CRE or the JRE. The requirement for the tandem CRE appears restricted to trophoblasts, as AP-1 partially restored activity to the {alpha}-subunit promoter in {alpha}T3–1 cells. Together, the above data suggest that functional activity of the pentameric array of regulatory elements in trophoblasts displays a strong preference for CRE- and JRE-binding proteins.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 5. Systematic Replacement with an AP-1 Element Discloses a Stringency for the CRE and JRE

Mutations with an AP-1 site are shown for each regulatory element as detailed in Fig. 1Go. Activity of each mutant construct is expressed relative to the wild type 1500-bp human {alpha}-subunit promoter. Values represent means ± SEM.

 
The DNA-Binding Domain, the Constitutive Activation Domain, and Serine 133 of CREB Are Required for Full Activity of the Human {alpha}-Subunit Promoter in Trophoblasts
Since CREB is known to bind the tandem CRE of the {alpha}-subunit promoter (27, 28), we addressed whether specific domains were required for activity. To eliminate endogenous CREB from the transfection paradigm, we constructed a reporter vector where the tandem 18-bp CREs were replaced by tandem 17-bp GAL4 DNA-binding sites (H{alpha}GAL4). We then used a series of expression constructs that fuse either the transactivation domain of CREB, or selected internal deletions, to the DNA-binding domain of GAL4. The reporter and expression vectors were then cotransfected into BeWo cells with another vector that encodes the catalytic subunit of protein kinase A (RSV-C{alpha}) (29).

As shown in Fig. 6Go, the parent fusion protein (CRG), which contains the entire transactivation domain of CREB, serves as the reference for H{alpha}GAL4 promoter activity. The Q1 domain of CRG ({delta}11/86) does not appear to be involved as it can be deleted without any loss of activity. In contrast, a mutation in Serine 133 (S133A), or deletion of the constitutive activation domain (CAD, {delta}166), prevented the CREB fusion proteins from activating the human {alpha}-subunit promoter. In fact, the activity of these mutant vectors was indistinguishable from a vector that expresses the GAL4 DNA-binding domain alone ({delta}57). Cotransfecting the CRG expression vectors with a reporter containing the wild type {alpha}-subunit promoter had no effect on activity (data not shown), indicating the specificity of the CRG effect.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 6. The DNA Binding Domain, the Constitutive Activation Domain, and Serine 133 of CREB Are Required for Full Activity of the Human {alpha}-Subunit Promoter in Trophoblasts

The human {alpha} GAL4 promoter contained two GAL4 DNA binding sites replacing the tandem CRE. Wild type and mutant forms of CRG expression plasmids used in the transfection are shown at the left. CRG contains the entire transactivation domain of CREB fused to Gal4 DNA-binding domain. {delta}11/86 has the Q1 domain of CREB deleted. S133A has serine 133 of CREB replaced with alanine. {delta}166 has the CAD deleted and {delta}57 just contains the Gal4 DNA-binding domain. The inset displays effect of either the CRG and {delta}57 expression vectors on a co-transfected reporter vector containing a minimal promoter linked to 5 GAL4 sites (5XGT). Transfections also included a PKC vector. Values represent the means ± SEM.

 
Activity of the H{alpha}GAL4 promoter transfected with the CRG expression vector had a third of the activity of the wild type {alpha}-subunit promoter. This was probably not due to diminished concentrations of fusion protein since all the fusion proteins were readily detected by Western blot (data not shown). Likewise, a minimal promoter containing five GAL4 DNA-binding sites (5xGT) transfected with CRG elevated expression of the reporter by almost 80-fold when compared with the effects observed with {delta}57 (Fig. 6Go, inset). Thus, the CRG fusion protein only partially compensates for the CREB when regulating activity of the 1500 bp human {alpha}-promoter.

Because all of the CRG expression vectors lack the DNA-binding domain of CREB, we suggest that this domain may play an important role in conferring full activity to the {alpha}-subunit promoter. This may occur via intra- and/or intermolecular interactions, consistent with the known cooperative binding of CREB to the tandem CRE (20). The data also indicate that Serine 133 and the CAD are necessary for full activity of the CREB fusion protein. Previous reports indicate that Serine 133 is required for CREB interaction with the CREB binding protein (CBP) (30). Likewise, CAD has been shown to interact specifically with transcription factors TFIIB and TFIID (31), and in particular with TAF 110 of TFIID (32). Therefore, these proteins represent likely downstream targets for the CREBs of the {alpha}-subunit promoter.

Systematic Insertion of a 15-bp Spacer Defines a CCAAT Box with Positional Dependence Unique to Trophoblasts
The composite functional array generated by the five regulatory elements in trophoblasts implies the possibility of a direct interaction between their cognate DNA-binding proteins. Rather than test this possibility further by constructing an even larger spectrum of multiple block mutations, we opted instead to introduce systematic 15-bp spacer mutations that separate each of the five regulatory elements from one another and from the TATA box by a helix rotation of 1.5 turns. If there are stereospecific interactions between the proteins that bind these sites, then altering their spatial relationships should have an impact on promoter activity.

The 15-bp insertions failed to diminish promoter activity in BeWo cells when placed between either the TSE and {alpha}ACT, {alpha}ACT and tandem CRE, the JRE and tandem CRE, or the JRE and CCAAT box (Fig. 7Go). This suggests that the interactions generated by these elements in trophoblasts do not require direct stereospecific interactions among their cognate DNA-binding proteins. Inserting 15-bp spacer mutations between the TSE, {alpha}ACT, CREs, and JRE also had no impact on {alpha}-subunit promoter activity in {alpha}T3–1 cells (Fig. 7Go). This was expected as the TSE and JRE have no functional activity in gonadotropes. Furthermore, although {alpha}ACT and the CREs contribute to promoter activity in gonadotropes, they appear to do so independently of each other (26).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 7. Systematic Insertion of a 15-bp Spacer Defines a CCAAT Box with Positional Dependence Unique to Trophoblasts

A, Random nucleotides (15 bp) were placed between each of the five regulatory elements of the human {alpha}-subunit promoter. Activity of each insert was reported relative to the wild type human {alpha}-subunit promoter in BeWo cells. B, Insertions (15 bp) were placed between each of the elements in {alpha}T3–1 cells as described above.

 
The only 15-bp insertion that disrupted promoter activity in BeWo cells was that placed 3' of the CCAAT box. This mutation decreased activity to 43% of wild type in BeWo cells but had virtually no impact in {alpha}T3–1 cells (Fig. 7Go). This dichotomy was expected since the CCAAT box has no functional activity in {alpha}T3–1 cells (Fig. 2Go). Furthermore, functional CCAAT boxes often display positional dependence relative to the transcription start site in most promoters (33). It is also unlikely that decreased activity in BeWo cells was a result of mutating a functional site adjacent to the CCAAT box because mutagenesis and EMSA characterizations have failed to reveal the presence of such an element (11). Interestingly, however, the overall complex must have a spatial restriction since the use of 36 bp spacers attenuated promoter activity at each insertion point (data not shown).

Together these results suggest that the five regulatory elements can be viewed as a functional unit with the CCAAT box displaying a cell-specific positional dependence relative to the TATA box. The lack of direct interactions between these regulatory elements, coupled with CCAAT box positional dependence, suggests instead that the pentameric array interacts as a unit with components of the core transcription complex. In this regard, it is notable that there are no known regulatory elements with functional activity in trophoblasts located between the CCAAT and TATA box.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
This is the first time that the impacts of all the elements required for full activity of the human {alpha}-subunit promoter in trophoblasts have been examined within a context that preserves their spatial configuration. Given their compact alignment, we were surprised that trophoblast specificity appears not to depend on direct interactions between each of the different regulatory elements. In addition, although one of the elements (JRE) appears to bind a protein unique to trophoblasts, its individual contribution to promoter activity is modest when compared with the others. Thus, this pentameric composite element has additional features that together endow the {alpha}-subunit promoter with trophoblast specificity and maximal activity.

When activities of {alpha}-subunit promoters with pair-wise mutations are summarized (Fig. 8Go), a clear hierarchy emerges that helps explain how each pair affects maximal transcription. Removal of the tandem CRE renders an {alpha}-subunit promoter with essentially no activity. This clearly establishes the tandem CRE as a major determinant of promoter activity. When taken alone, it also suggests that the remaining elements make only marginal contributions to promoter activity. This cannot be true, however, as activity of the other mutant promoters containing a tandem CRE is much less than expected. For example, removing the URE (TSE and {alpha}ACT) leaves the promoter with only 5% residual activity. If the tandem CREs were acting independently, activity should exceed 99%. Similarly, 16% activity remains upon mutation of the JRE and CCAAT box. This suggests that multiple facilitated interactions underlie the activity of each member of the composite element. These interactions likely involve components of the core transcriptional complex since there are no readily detectable direct interactions between the members of the pentameric array.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 8. Pairwise Mutations Disclose a Hierarchy of Transcriptional Effects for the URE, Tandem CRE, and DRE

A schematic diagram of the wild type human {alpha}-subunit promoter is displayed on the top with relative transcriptional value of 100%. Schematics of mutant promoters are shown immediately below with their relative transcriptional value compared with wild type. The absence of an element pair denotes the presence of a random nucleotide substitution that destroys activity. The relative values were obtained from the data presented in Fig. 2Go.

 
Initial studies (4, 6) focused on the TSE as playing a key role in trophoblast-specific expression largely because it was presumed to bind a transcription factor unique to trophoblasts. Emerging data, however, suggest that AP-2, or a closely related homolog, normally occupies this site (15) (data not shown). In addition, when the five regulatory elements were evaluated for their individual contributions by site-specific mutation, the TSE had the least impact, accounting for only 40% of total promoter activity (Fig. 2Go). Thus, in the complete absence of this site, appreciable promoter activity remains, suggesting the need for additional mechanisms that confer trophoblast specificity.

The JRE binds proteins present in nuclear extracts from a variety of tissues but contributes to {alpha}-subunit promoter activity only in trophoblasts. Significantly, however, this functional activity correlates with the binding of a protein specifically expressed in trophoblasts (Fig. 4Go). Thus, the JRE-binding factor appears to be the only cell-specific protein that binds to the pentameric array. Analysis of JRE binding site (TAATTACA) uncovered a homology to the consensus sequence of CDX-2, a member of the Drosophila Caudal family of homeotic genes (34). A mammalian homolog of CDX-2 is expressed specifically in the placenta and intestinal epithelium in mice (35, 36). This raises the possibility that trophoblasts may contain a JRE-binding protein immunologically related to CDX-2.

Deletion of the JRE, like the TSE, results in an {alpha}-subunit promoter with appreciable activity (Fig. 2Go), suggesting that alone it cannot account for the full trophoblast-specific character of the {alpha}-subunit promoter. Mutating both the TSE and JRE results in a promoter with even less activity (Fig. 2Go). Although this combination of elements provides a greater degree of trophoblast specificity, significant nontrophoblastic activity still remains.

In contrast to the TSE and JRE, the {alpha}ACT site accounts for approximately 80% of the total promoter activity, ranking second only to the tandem CRE (Fig. 2Go). Thus, {alpha}ACT plays an important role in setting the transcriptional tone of the {alpha}-subunit promoter. This element, however, is like the TSE in that its cognate DNA-binding proteins (GATA-2, GATA-3) are expressed in more than one cell type. (18). For example, GATA-2 and GATA-3 are expressed in trophoblasts and erythroid cells (17, 18). {alpha}ACT also contributes to {alpha}-subunit promoter activity in both gonadotropes and trophoblasts (17, 26). This further underscores the need for additional mechanisms that determine trophoblast specificity.

The tandem CRE and JRE offer another avenue for conferring trophoblast-specific activity to the {alpha}-subunit promoter. Substitution studies with the AP-1 element (Fig. 5Go) indicated that activity of the {alpha}-subunit promoter in trophoblasts exhibits a relatively stringent requirement for CRE- and JRE-binding proteins as compared with the proteins that bind the other members of the composite element. Unlike the functional JRE-binding protein that appears unique to trophoblasts, the CREBs are ubiquitous, present in virtually every tissue. Yet, the inability to substitute for either the JRE- or CRE-binding proteins suggest that their presence adds an additional trophoblast-specific property. For example, the TSE- and JRE-binding proteins may make unique contacts with components of the downstream transcriptional complex that are themselves trophoblast-specific. The recent description of tissue-specific TAFs supports this possibility (37).

The positional dependence of the CCAAT box adds a final intriguing idiosyncratic property to the five-element array. This element is active in trophoblasts but not gonadotropes. Thus, occupancy of the CCAAT box may provide another level of cell specificity through establishment of a critical proximity that permits the CCAAT box-binding factor, and other proteins that bind to members of the pentameric array, to interact with components of the downstream transcriptional complex. For example, CREB can interact directly with CBP, TAF110, and TFIIB (30, 31, 32). Thus, it is possible that the CCAAT-binding protein, along with other URE- and DRE-binding proteins, either potentiates this interaction or, alternatively, exposes a unique domain of CREB that allows a subsequent interaction with a specific TAF unique to trophoblasts.

Based on the above, we conclude that trophoblast-specific expression of the {alpha}-subunit occurs through the use of a composite regulatory element composed of five distinct binding sites for transcriptional factors. This pentameric array achieves trophoblast specificity through multiple characteristics that include the binding of a trophoblast-specific protein with relatively weak activity rather than relying on a single regulatory element that binds a dominant trophoblast-specific protein. The development of such a complex regulatory code may reflect the complex temporal and spatial pattern of expression of the {alpha}-subunit gene that includes cytotrophoblasts of the placenta, cells of the hypophyseal placode adjacent to the anterior neuropore, and gonadotropes and thyrotropes of the pituitary (2, 3). In this regard, it is interesting to note that a wide variety of tumors ectopically secrete high levels of {alpha}-subunit (38). Since there is ample evidence of transcriptional cooperativity among the elements of the pentameric array, it seems likely that small changes in the concentration of any of the cognate DNA-binding proteins could have a dramatic impact on activity of the {alpha}-subunit promoter. If so, then ectopic expression of the {alpha}-subunit gene in tumors may well be caused by small changes in the concentration of one or more of the DNA-binding proteins of the pentameric array.

The high incidence of ectopic secretion of the {alpha}-subunit may reflect an inherent limitation of a composite regulatory region that binds transcriptional factors with a range of tissue distributions from potentially unique (JRE-binding protein), to limited ({alpha}ACT- and TSE-binding proteins), to generalized (CREBs). In other words, while a combinatorial scheme may direct high level expression of a specific gene to several different cell types, this may occur at the expense of low level expression in nontarget cell types. For the {alpha}-subunit gene the consequence of this expression may be minimal, as synthesis of a biologically active glycoprotein hormone requires simultaneous expression of an appropriate ß-subunit gene. When viewed from this perspective, it is tempting to speculate that the pentameric array of {alpha}-subunit regulatory elements provides a means for directing high levels of expression in trophoblasts that comes at the expense of low levels of ectopic expression in many different cell types.

In summary, additional studies will be required to explain how the macromolecular complex that forms over the pentameric array of regulatory elements communicates with the core transcriptional machinery to direct high levels of {alpha}-subunit gene expression to trophoblasts. The complexity and positional dependence of the regulatory elements suggest that exploring individual elements out of context would eliminate the unique characteristics of this functional unit. Therefore, definitive experiments will most likely come from a continued contextual analysis of this composite array of regulatory elements.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid Clones
All plasmid DNAs were prepared from overnight cultures of bacteria using Qiagen DNA plasmid columns according to the suppliers protocol (Qiagen, Chatsworth, CA). Oligonucleotides were purchased from Midland Scientific (Midland, TX). The human {alpha}-subunit promoter was isolated from pH{alpha}(-1500/+48)CAT (12). To form a unique restriction site at each end of the promoter, partial digestion with HindIII was performed, filled in by treatment with Klenow fragment of DNA polymerase I, and ligated to generate a NheI site at the 5'-end of the human {alpha}-promoter. This resulted in only one HindIII site at the 3'-end of the promoter. This H{alpha}CAT vector was then digested with KpnI and HindIII, and the 1500-bp promoter was cloned 5' of luciferase reporter vector in pGene Light-2 Basic (Promega, Madison, WI) to generate H{alpha}(-1500) Luc.

Generation of each of the mutant constructs was performed by PCR using Deep Vent DNA polymerase (New England Biolabs, Beverly, MA). To minimize formation of a new and unexpected element, the sequence or each null mutant was a restriction site chosen to remove all the wild type sequence. Three separate PCR reactions were performed for each clone. The first set of reactions was independent employing two different sets of primers, but forming an overlap region in the sequence amplified. The upstream reaction used an oligonucleotide homologous to the -312 to -284 region of the human {alpha} 5'-flanking region (Pust-1) and a 3'-oligonucleotide with the correct mutations. The downstream reaction used a 5'-oligonucleotide complementary to the 3'-mutant oligonucleotide from the upstream reaction and a 3'-oligonucleotide (Luc-1, GGCCATGACAACCATTTTACCTTCTGCGGTT) complementary to the 5'-end of the luciferase gene. The two products of the first set of PCR reactions were resolved by electrophoresis in a 6% polyacrylamide gel in 1x Tris-boric acid-EDTA (TBE) and stained with ethidium bromide. The two overlapping fragments were then mixed together and subjected to a third PCR reaction utilizing Pust-1 and Luc-1 as the 5'- and 3'-primers. The products of this reaction were digested with SnaB I and HindIII and gel isolated. The unique SnaB I and HindIII sites are located at -250 and +48, respectively, in the human {alpha}- promoter. This unique fragment was then ligated into H{alpha}(-1500)Luc digested with SnaB I and HindIII.

The double mutant H{alpha}(dbTRE)Luc replacing the TSE and {alpha}ACT elements with AP-1 sites was cloned by utilizing H{alpha}(TRE1)Luc (AP-1 replacement of the TSE) as the plasmid amplified in a PCR reaction using (TGACTCACCATGGGGGTTGAAA-TGACTCATATGCAAATTGACGT) and Luc-1 primers as the 5'- and 3'-oligonucleotides, respectively. The 5'-oligonucleotide contained a NcoI restriction site adjacent to the first AP-1 site and a NdeI site 3' of the second AP-1 site. The PCR product was digested with NcoI and HindIII and gel isolated. The cloned DNA was ligated into the H{alpha}(TRE1)Luc digested with NcoI and HindIII. The plasmid containing four AP-1 sites was cloned similarly as H{alpha}(dbTRE)Luc with the exception that the plasmid amplified in the PCR reaction was H{alpha}(-1500)Luc with the CREs already replaced with TREs.

The null act promoter was isolated from the µ9 clone of H{alpha}(-200)CAT previously reported (14). This plasmid was digested with SauI and HindIII, and the DNA fragment was gel isolated and cloned into H{alpha}(-1500)CAT to place the mutation in the context of the 1500-bp promoter. The full length promoter containing the null act mutation was digested with NheI and HindIII and ligated into pGene Light-2 Basic.

Null mutation of the tse was achieved using two independent rounds of PCR. For the upstream reaction Pust-1 and a complementary µVI oligonucleotide (14) were used with H{alpha}(-1500)Luc. A separate downstream reaction was performed using H{alpha}(-200)CAT µVI block replacement vector with µVI oligonucleotide (14) and BJSCAT, a homologous primer flanking the CAT gene. The gel-isolated bands of the correct size from both PCR reactions were combined and subjected to a third PCR reaction with Pust-1 and BJSCAT as the primers. The DNA was digested with SnaB I and HindIII and ligated into H{alpha}(-1500)Luc.

The null mutation for the tandem CREs in the H{alpha}(-1500)Luc vector was cloned with two GAL4 DNA-binding sites replacing the tandem CRE. An oligonucleotide from -180 to -100 of human {alpha}-promoter containing the tandem GAL4 DNA binding sites was annealed to a complementary oligonucleotide spanning -121 to -100 and filled in using Klenow. This DNA fragment was ligated to a 145-bp fragment of the human {alpha} promoter (-99 to +48) with RsaI and HindIII ends. The ligated product was digested with SauI/HindIII and gel isolated. This insert was ligated into H{alpha}(-1500)CAT digested with SauI/HindIII. The H({alpha}-1500)CAT plasmid was digested with NheI/HindIII, and the {alpha}-promoter was cloned into pGene Light-2 Basic.

The 15-bp random nucleotide insertions were constructed using two rounds of PCR. For the first round, the upstream reaction contained a 5'-Pust-1 primer and a 3'-primer containing a random 15-bp insertion with a Not-1 restriction site (TTTGCGGCCGCAACA). The downstream reaction used a 5'-primer complementary to the 15-bp insertion and a 3' Luc-1 primer. The PCR fragments of both reactions were gel isolated and combined for a third PCR reaction using Pust-1 and Luc-1 oligonucleotides.

The 36-bp random nucleotide vectors were constructed from the 15-bp insertion vectors. The 15-bp insertion vectors were digested with Not-1, treated with calf intestinal alkaline phosphatase (Boehringer Mannheim, Indianapolis, IN), gel isolated, and electroeluted. A 21-bp oligonucleotide containing Not-1 ends (GGCCAGGTACCGAGCTCTTAC) was kinased and ligated to these plasmids.

The CREB/GAL4 fusion cDNA constructs were previously described (29). Briefly, the cDNA for the transactivation domain of CREB 341 [amino acids (aa) 1–277] was inserted 5' to the GAL4 DNA-binding domain (aa 4–147). All CREB expression vectors were lacking the DNA-binding domain of CREB (aa 280–341) to form CRG. A deletion of the Q1 region removed aa 11–86 of CRG. The S133A expression vector contained a serine to alanine substitution at position 133. The CAD mutation deleted amino acids 166–279. The GAL4 expression vector {delta}57 contained the first eight amino acids of CREB fused to the GAL4 DNA-binding domain. The PKAc (RSV-C{alpha}) vector expresses the catalytic subunit of protein kinase A (29).

All clones were confirmed by sequencing using Sequenase 2.0 sequencing kit from USB (Cleveland, OH).

Cell Culture
BeWo, {alpha}T3–1, and MCF-7 cells were grown in monolayer cultures. BeWo and {alpha}T3–1 cells were maintained in culture as previously described (26). MCF-7 cells were grown in DMEM supplemented with 10% FBS, penicillin, and streptomycin.

Transfection Analysis
Cells were plated onto 35-mm plates at a density of either 120,000 (BeWo), 100,000 (MCF-7), or 170,000 ({alpha}T3–1) cells per well. The day after plating, the cells were transfected using lipofectamine reagent as described by the supplier (GIBCO BRL, Gaithersburg, MD). Each construct was transfected in triplicate with each well containing 1.25 µg reporter DNA, 0.25 µg RSV-ß-galactosidase vector, and 5 µl lipofectamine. Where indicated, 31.5 ng PKAc was also transfected. BeWo and MCF-7 cells were incubated for 4 h with the DNA/lipofectamine solution and then replaced with complete medium. The {alpha}T3–1 cells were incubated for 16 h with DNA/lipofectamine before replacement with complete medium.

Cells were harvested 44 h after beginning the transfection as previously described for both luciferase and ß-galactosidase (26).

Gel Mobility Shift Assay and Southwestern Blot Analysis
Nuclear extracts were prepared from BeWo, {alpha}T3–1, and MCF-7 cells according to the method of Dignam et al. (39). Protein concentrations were determined by the method of Bradford (40).

The electrophoretic mobility shift assay was modified from that described previously (26). Reactions contained labeled probe (30 fmol), 7–8 µg nuclear extract, 1 µg poly(deoxyinosinic-deoxycytidylic)acid (Pharmacia Biotech, Piscataway, NJ), 200 ng salmon sperm DNA, and 200 ng Escherichia coli DNA in buffer containing 12.5 mM HEPES (pH 7.9), 25 mM KCl, 10 mM MgCl2, and 0.5 mM dithiothreitol to bring the final volume to 20 µl. Unlabeled competitors were included at 150–200 molar excess of the labeled probe. Reactions were carried out for 20 min on ice and separated on 4% polyacrylamide gels in 0.25x TBE (1x TBE = 50 mM Tris, 50 mM boric acid, and 1 mM EDTA) at 4 C. Gels were transferred to Whatman paper, dried, and exposed to NEF-496 film (NEN Research Products, Boston, MA). Southwestern Blot analysis was performed using a procedure previously described (26).


    FOOTNOTES
 
Address requests for reprints to: John Nilson, Department of Pharmacology, School of Medicine, Case Western Reserve University, 2109 Adelbert Road, Cleveland, Ohio 44106-4965.

This work was supported by NIH Grants DK-28559 (to J.H.N.) DK-43871 (to P.G.Q.), and HD-07900–02 (to P.R.B.).

Received for publication May 14, 1997. Accepted for publication July 14, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Pierce J, Parsons TF 1981 Glycoprotein hormones: structure, function. Annu Rev Biochem 50:465–495[CrossRef][Medline]
  2. Simmons DM, Voss JW, Inghraham HA, Holloway JM, Broide RS, Rosenfeld MG, Swanson LW 1990 Pituitary cell phenotypes involve cell-specific Pit-1 mRNA translation and synergistic interactions with other classes of transcription factors. Genes Dev 4:695–711[Abstract/Free Full Text]
  3. Voss JW, Rosenfeld MG 1992 Anterior pituitary development: short tales from dwarf mice. Cell 70:527–530[CrossRef][Medline]
  4. Jameson JL, Hollenberg A 1993 Regulation of chorionic gonadotropin gene expression. Endocr Rev 14:203–221[CrossRef][Medline]
  5. Bokar JA, Keri RA, Farmerie TA, Fenstermaker RA, Andersen B, Hamernik DL, Yun J, Wagner T, Nilson JH 1989 Expression of the glycoprotein hormone {alpha}-subunit gene in the placenta requires a functional cyclic AMP responsive element, whereas a different cis-acting element mediates pituitary-specific expression. Mol Cell Biol 9:5113–5122[Abstract/Free Full Text]
  6. Delegeane AM, Ferland LH, Mellon PL 1987 Tissue-specific enhancer of the human glycoprotein hormone {alpha}-subunit gene: dependence on cyclic AMP-inducible elements. Mol Cell Biol 7:3994–4002[Abstract/Free Full Text]
  7. Deutsch PJ, Jameson JL, Habener JF 1987 Cyclic AMP responsiveness of human gonadotropin-{alpha} gene transcription is directed by a repeated 18-base pair enhancer. J Biol Chem 262:12169–12174[Abstract/Free Full Text]
  8. Nilson JH, Bokar JA, Clay CM, Farmerie TA, Fenstermaker RA, Hamernik DL, Keri RA 1991 Different combinations of regulatory elements may explain why placenta-specific expression of the glycoprotein hormone {alpha}- subunit gene occurs only in primates and horses. Biol Reprod 44:231–237[Abstract]
  9. Jameson JL, Albanese C, Habener JF 1989 Distinct adjacent protein-binding domains in the glycoprotein hormone {alpha} subunit gene interact independently with a cAMP-responsive enhancer. J Biol Chem 264:16190–16196[Abstract/Free Full Text]
  10. Jameson JL, Jaffe RC, Deutsch PJ, Albanese C, Habener JF 1988 The gonadotropin {alpha}-gene contains multiple protein binding domains that interact to modulate basal and cAMP-responsive transcription. J Biol Chem 263:9879–9886[Abstract/Free Full Text]
  11. Kennedy GC, Andersen B, Nilson JH 1990 The human {alpha} subunit glycoprotein hormone gene utilizes a unique CCAAT binding factor. J Biol Chem 265:6279–6285[Abstract/Free Full Text]
  12. Silver BJ, Bokar J, Virgin JB, Valen E, Milsted A, Nilson JH 1987 Cyclic AMP regulation of the human glycoprotein hormone {alpha}-gene is mediated by an 18 base pair element. Proc Natl Acad Sci USA 84:2198–2202[Abstract/Free Full Text]
  13. Steger DJ, Altschmied J, Buscher M, Mellon PL 1991 Evolution of placenta-specific gene expression: comparison of the equine and human gonadotropin {alpha}-subunit genes. Mol Endocrinol 5:243–255[CrossRef][Medline]
  14. Pittman RH, Clay CM, Farmerie TA, Nilson JH 1994 Functional analysis of the placenta-specific enhancer of the human glycoprotein hormone {alpha} subunit gene: emergence of a new element. J Biol Chem 269:19360–19368[Abstract/Free Full Text]
  15. Steger DJ, LiCalsi C, Mellon P, Trophoblast-specific element binding protein is closely related to transcription factor activator protein 2. Program of the 77th Annual Meeting of The Endocrine Society, Washington DC, 1995 (Abstract 426)
  16. Williams T, Tjian R 1991 Analysis of the DNA-binding and activation properties of the human transcription factor AP-2. Genes Dev 5:670–682[Abstract/Free Full Text]
  17. Steger DJ, Hecht JH, Mellon PL 1994 GATA-binding proteins regulate the human gonadotropin {alpha}-subunit gene in the placenta and pituitary gland. Mol Cell Biol 14:5592–5602[Abstract/Free Full Text]
  18. Dorfman DM, Wilson DB, Bruns GAP, Orkin SH 1992 Human transcription factor gata-2. J Biol Chem 267:1279–1285[Abstract/Free Full Text]
  19. Jameson JL, Powers AC, Gallagher GD, Habener JF 1989 Enhancer and promotor element interactions dictate cyclic adenosine monophosphate mediated and cell-specific expression of the glycoprotein hormone {alpha}-gene. Mol Endocrinol 3:763–772[CrossRef][Medline]
  20. Andersen B, Kennedy GC, Hamernik DL, Bokar JA, Bohinski R, Nilson JH 1990 Amplification of the transcription signal mediated by the tandem cAMP response elements of the glycoprotein hormone {alpha}-subunit gene occurs through several distinct mechanisms. Mol Endocrinol 4:573–582[CrossRef][Medline]
  21. Fenstermaker RA, Farmerie TA, Clay CM, Hamernik DL, Nilson JH 1990 Different combinations of regulatory elements may account for expression of the glycoprotein hormone {alpha} subunit gene in primate and horse placenta. Mol Endocrinol 4:1480–1487[CrossRef][Medline]
  22. Hamernik DL, Keri RA, Clay CM, Clay JN, Sherman GB, Sawyer Jr HR, Nett TM, Nilson JH 1992 Gonadotrope- and thyrotrope-specific expression of the human and bovine glycoprotein hormone {alpha}-subunit genes is regulated by distinct cis-acting elements. Mol Endocrinol 6:1745–1755[Abstract]
  23. Kendall SK, Saunders TL, Jin L, Lloyd RV, Glode LM, Nett TM, Keri RA, Nilson JH, Camper SA 1991 Targeted ablation of pituitary gonadotropes in transgenic mice. Mol Endocrinol 5:2025–2036[CrossRef][Medline]
  24. Schoderbek WE, Kim KW, Ridgway EC, Mellon PL, Maurer RA 1992 Analysis of DNA sequences required for pituitary-specific expression of the glycoprotein hormone alpha-subunit gene. Mol Endocrinol 6:893–903[Abstract]
  25. Andersen B, Kennedy GC, Nilson JH 1990 A cis-acting element located between the cAMP response elements and CCAAT box augments cell-specific expression of the glycoprotein hormone {alpha} subunit gene. J Biol Chem 265:21874–21880[Abstract/Free Full Text]
  26. Heckert LL, Schultz K, Nilson JH 1995 Different composite regulatory elements direct expression of the human {alpha} subunit gene to pituitary and placenta. J Biol Chem 270:26497–26504[Abstract/Free Full Text]
  27. Heckert LL, Schultz K, Nilson JH 1996 The cAMP response elements of the {alpha} subunit gene bind similar proteins in trophoblasts and gondatropes but have distinct functional sequence requirements. J Biol Chem 271:31650–31656[Abstract/Free Full Text]
  28. Hoeffler JP, Meter TE, Yun Y, Jameson JL, Habener JF 1988 Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science 242:1430–1433[Abstract/Free Full Text]
  29. Quinn PG 1993 Distinct activation domains within cAMP response element-binding protein (CREB) mediate basal and cAMP-stimulated transcription. J Biol Chem 268:16999–17009[Abstract/Free Full Text]
  30. Chrivia JC, Kwok RPS, Lamb N, Hagiwara M, Montminy MR, Goodman RH 1993 Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365:855–859[CrossRef][Medline]
  31. Xing L, Gopal VK, Quinn PG 1995 cAMP response element-binding protein (CREB) interacts with transcription factors IIB and IID. J Biol Chem 270:17488–17493[Abstract/Free Full Text]
  32. Ferreri K, Gill G, Montminy M 1994 The cAMP-regulated transcription factor CREB interacts with a component of the TFIID complex. Proc Natl Acad Sci USA 91:1210–1213[Abstract/Free Full Text]
  33. Bucher P, Trifonov EN 1988 CCAAT box revisited: bidirectionality, location and context. J Biomol Struct Dynam 5:1231–1236[Medline]
  34. Jin T, Drucker DJ 1996 Activation of proglucagon gene transcription through a novel promoter element by the caudal-related homeodomain protein cdx-2/3. Mol Cell Biol 16:19–28[Abstract]
  35. Beck F, Erler T, Russel A, James R 1995 Expression of Cdx-2 in the mouse embryo and placenta: possible role in patterning of the extra-embryonic membranes. Dev Dynam 204:219–227[Medline]
  36. Suh E, Traber PG 1996 An intestine-specific homeobox gene regulates proliferation and differentiation. Mol Cell Biol 16:619–625[Abstract]
  37. Dikstein R, Zhou S, Tjian R 1996 Human TAF11105 is a cell type-specific TF11D subunit related to hTAF11130. Cell 87:137–146[CrossRef][Medline]
  38. Ruddon R, Anderson C, Meade-Cobun K 1980 Stimulation of synthesis and secretion of chorionic gonadotropin subunits by eutopic and ectopic hormone-producing human cell lines. Cancer Res 40:4519–4523[Abstract/Free Full Text]
  39. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  40. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–256[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
R. Sasson, S. H. Luu, V. G. Thackray, and P. L. Mellon
Glucocorticoids Induce Human Glycoprotein Hormone {alpha}-Subunit Gene Expression in the Gonadotrope
Endocrinology, July 1, 2008; 149(7): 3643 - 3655.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. W. Schubert, A. Abendroth, K. Kilian, T. Vogler, B. Mayr, I. Knerr, and S. Hashemolhosseini
bZIP-Type transcription factors CREB and OASIS bind and stimulate the promoter of the mammalian transcription factor GCMa/Gcm1 in trophoblast cells
Nucleic Acids Res., June 1, 2008; 36(11): 3834 - 3846.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
T. Sato, K. Kitahara, T. Susa, T. Kato, and Y. Kato
Pituitary transcription factor Prop-1 stimulates porcine pituitary glycoprotein hormone {alpha} subunit gene expression.
J. Mol. Endocrinol., October 1, 2006; 37(2): 341 - 352.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. S. Jorgensen, C. C. Quirk, and J. H. Nilson
Multiple and Overlapping Combinatorial Codes Orchestrate Hormonal Responsiveness and Dictate Cell-Specific Expression of the Genes Encoding Luteinizing Hormone
Endocr. Rev., August 1, 2004; 25(4): 521 - 542.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. P. Holland, S. P. Bliss, K. A. Berghorn, and M. S. Roberson
A Role for CCAAT/Enhancer-Binding Protein {beta} in the Basal Regulation of the Distal-Less 3 Gene Promoter in Placental Cells
Endocrinology, March 1, 2004; 145(3): 1096 - 1105.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. L. Duval, A. Jean, and A. Gutierrez-Hartmann
Ras Signaling and Transcriptional Synergy at a Flexible Ets-1/Pit-1 Composite DNA Element Is Defined by the Assembly of Selective Activation Domains
J. Biol. Chem., October 10, 2003; 278(41): 39684 - 39696.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. P. Gobin, P. Biesta, J. E. M. de Steenwinkel, G. Datema, and P. J. Van den Elsen
HLA-G Transactivation by cAMP-response Element-binding Protein (CREB). AN ALTERNATIVE TRANSACTIVATION PATHWAY TO THE CONSERVED MAJOR HISTOCOMPATIBILITY COMPLEX (MHC) CLASS I REGULATORY ROUTES
J. Biol. Chem., October 11, 2002; 277(42): 39525 - 39531.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. S. Jorgensen and J. H. Nilson
AR Suppresses Transcription of the {alpha} Glycoprotein Hormone Subunit Gene Through Protein-Protein Interactions with cJun and Activation Transcription Factor 2
Mol. Endocrinol., September 1, 2001; 15(9): 1496 - 1504.