| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
-Subunit Glycoprotein Hormone Promoter with Trophoblast Specificity and Maximal Activity
Department of Pharmacology (P.R.B., J.H.N.), School of
Medicine, Case Western Reserve University, Cleveland, Ohio
44106,
Department of Cellular and Molecular Physiology
(P.G.Q.), The Pennsylvania State University College of Medicine,
Hershey, Pennsylvania 17033
| ABSTRACT |
|---|
|
|
|---|
-subunit glycoprotein hormone gene requires a tightly linked array
of five different regulatory elements [trophoblast-specific element
(TSE),
-activating element (
ACT), a tandem cAMP response element
(CRE), junctional regulatory element (JRE), and a CCAAT box]. We
examined their contextual contributions to trophoblast-specific
expression by using transfection assays to evaluate activity of
systematic block replacement mutations made within the 1500-bp
5'-flanking region of the human
-subunit gene. While all five
elements were required for full activity, only the TSE and JRE
displayed trophoblast specificity. Interestingly, the TSE-binding
protein has limited tissue distribution whereas a JRE-binding protein
appears trophoblast specific. Likewise, replacement studies with an
AP-1 element that binds heterodimers of jun and
fos indicated that this element was incapable of
compensating for either the tandem CRE or JRE. This preference for both
CRE- and JRE-binding proteins provides another avenue for configuring
an
-subunit promoter with trophoblast specificity. Additional
analysis with a cAMP response element binding protein (CREB)-Gal4
fusion protein further underscored the importance of CREB as well as
suggested that transcriptional contributions come from both the
DNA-binding domain and transactivation domain of this protein. We also
examined the interactive nature of the pentameric array by placing a
15-bp random sequence between each element. Remarkably, only the
insertion 3' of the CCAAT box diminished promoter activity. This
suggested the absence of direct interactions between the
transcriptional factors that bind each element in the array. It also
suggested that the CCAAT box is position-dependent relative to the TATA
box. This position dependence appeared cell-specific, as it was not
manifest in a gonadotrope cell line (
T31 cells). Thus, the CCAAT
box also has tissue-specific characteristics that assist in targeting
expression of the
-subunit gene to trophoblasts. Together, these
data suggest that multiple characteristics of a complex pentameric
array of regulatory elements endow the
-subunit promoter with
trophoblast specificity and maximal activity. | INTRODUCTION |
|---|
|
|
|---|
-subunit encoded by a single copy gene
(1). In primates, synthesis of the full complement of heterodimeric
glycoprotein hormones requires that expression of the
-subunit gene
occurs at discrete times in cytotrophoblasts of the placenta, cells of
the hypophyseal placode adjacent to the anterior neuropore, and in
gonadotropes and thyrotropes of the pituitary (2, 3). This complex
temporal and spatial pattern probably involves mechanisms that activate
and then restrict expression of the
-subunit gene (3). Herein, we
focus on the mechanism underlying trophoblast-specific expression.
Full activity of the
-subunit promoter in trophoblasts
requires five different regulatory elements located between -180 and
-80 of the 5'-flanking region of the
-subunit gene
[trophoblast-specific element (TSE),
-activating element (
ACT),
tandem cAMP response element (CRE), junctional regulatory element
(JRE), CCAAT] (4, 5, 6, 7, 8, 9, 10, 11, 12). These elements have been separated into three
different domains; the upstream regulatory domain (URE; contains the
TSE and
ACT), tandem CRE, and a downstream regulatory domain (DRE)
that includes both the JRE and CCAAT box (Fig. 1
) (4).
|
The URE has since been reported to bind several proteins and divided
into two domains; the TSE and the
ACT (13, 14). The TSE resides
between -182 and -159 and binds a protein (the TSE binding protein or
TSEB) originally thought to be restricted to trophoblasts (6, 13). A
recent report, however, suggests that TSEB may be AP-2 (15), a
transcriptional factor detected in several different cell types (16).
Thus, TSEB cannot be regarded as strictly trophoblast-specific.
The
ACT, located between -161 to -141, contains a consensus GATA
binding site. GATA-2 and GATA-3 are present in choriocarcinoma cells,
and both bind
ACT (17, 18).
Additional studies (4, 14, 19) indicated that another factor can
functionally substitute for TSEB. Since the binding site for this
factor spans both the TSE and
ACT, it has been designated as URE
binding protein 1 or UREB1 (14). In short, the URE is a complex element
that can be subdivided into at least three overlapping protein-binding
sites. While each site is functionally significant, no single site
displays clear dominance.
A tandem CRE is located immediately downstream of
ACT. Placing a 5-
or 10-bp insertion between the tandem CRE disrupts their homotypic
synergism (20), suggesting that the CRE-binding proteins (CREBs)
interact directly with each other. The CREs also interact
synergistically with the URE as well as with one another in stimulating
promoter activity (6, 7, 12). It remains unclear, however, whether the
synergistic relationship between the URE- and CRE-binding proteins
involves a direct interaction.
In most mammals, including lower primates, the
-subunit
promoter contains only one homolog of the tandem CRE found in higher
primates (21). This homolog contains a single C to T transition that
disrupts the palindrome (TGACGTCA) required for binding of
CREB (5).
-Subunit promoters with this transition are inactive in
trophoblasts but work well in gonadotropes (5, 21, 22, 23, 24). Furthermore,
activity in trophoblasts can be conferred to the bovine
-subunit
promoter by restoring the palindrome in the CRE homolog with a single
T-to-C transition (5). Together, these observations led to the
hypothesis that the CRE was essential for trophoblast-specific
expression of the
-subunit gene (21).
Although a functional CRE is required for activity of the
-subunit
promoter in trophoblasts, a functional URE is also required. This is
illustrated best in mice where two
-subunit alleles have been
identified. One contains a functional CRE whereas the other contains
the same C-to-T transition found in other mammalian
-subunit
promoters. Neither allele is expressed in mouse placenta; both
promoters are also inactive when analyzed by transfection in
choriocarcinoma cells (24). Subsequent studies indicated that the mouse
-subunit promoter also lacks binding sites for TSE-binding protein
(TSEB) (AP-2) and GATA (13, 14), further underscoring that
trophoblast-specific expression requires both a composite URE and
tandem CRE.
The DRE contains at least two regulatory elements, the JRE and a CCAAT
box. The JRE resides between -120 and -100 bp of the
-subunit
promoter, abutting, but not overlapping, the 3'-most functional
boundary of the tandem CRE. Mutations within the JRE attenuate activity
in trophoblasts (25) but not in gonadotropes (26), suggesting that the
JRE may be trophoblast-specific. The mechanism for this specificity,
however, has remained unclear, as the factor that binds the JRE
appeared to be the same in several cell lines (25).
The CCAAT box located between -100 and -80 also contributes to
activity of the
-subunit promoter in trophoblasts and in other cell
lines where the promoter displays limited activity (11). The
-subunit CCAAT box appears to bind a protein [
-CCAAT binding
factor (
CBF) distinct from previously characterized CCAAT-binding
factors (11)]. It remains to be determined whether the JRE and CCAAT
box interact with one another or whether this downstream regulatory
domain interacts directly with the tandem CRE.
Collectively, the studies described above suggest that targeted
expression of the
-subunit gene in trophoblasts occur through a
complex combinatorial code formed by five different regulatory
elements. While these elements have been characterized individually or
as selected pairs on a minimal promoter, no study has systematically
evaluated the interactions among all five regulatory elements in the
context of the human
-subunit promoter. Furthermore, since none of
the elements appear to bind a protein(s) unique to trophoblasts, it
remains unclear how this pentameric array directs expression of the
-subunit gene to trophoblasts. Because each element makes a
significant contribution to promoter activity in trophoblasts, we
considered the possibility that multiple features of this pentameric
array collectively form a unique trophoblast-specific code. Herein, we
report results from systematic analyses of the contribution of each of
the members of this pentameric array that confirms this prediction.
| RESULTS |
|---|
|
|
|---|
-promoter in trophoblasts requires
all five of the elements underscored in Fig. 1
-subunit gene as the promoter context. Each
element, or select combinations, was replaced with a block mutation
devoid of protein-binding activity. This approach permits comparative
evaluation of the impact of each element in the pentameric array within
the same experimental paradigm and allows a relative ranking of both
its strength and tissue specificity.
Figure 2
depicts the activity of each
block replacement mutant after transfection into cell lines derived
from the following tumor tissue: trophoblast (BeWo), gonadotrope
(
T31), or breast (MCF-7). Three functional classes of effects can
be categorized. Mutations in the TSE and JRE are trophoblast specific.
In contrast,
ACT and the CRE mutations have global effects,
affecting activity in all three cell lines, with the greatest impact
occurring in BeWo cells. Finally, the CCAAT box mutation reduced
promoter activity in trophoblast and breast cell lines, suggesting that
this element has limited cell specificity.
|
ACT, and tandem CRE was not included in this panel of vectors,
the extreme low level of activity of the TSE/
ACT double mutant and
almost nondetectable activity of the tandem CRE mutant are consistent
with the previously reported synergistic relationship between the URE
and CRE (6). For trophoblasts, this can be regarded as an extreme form
of synergism as both the URE (TSE/
ACT) and tandem CRE clearly depend
on one another; placing a mutation in one is akin to ablation of
both.
The JRE and CCAAT box reside within the DRE, a region of the
-subunit promoter traditionally regarded as important for basal
activity (4). Interestingly, mutation of both the CCAAT box and JRE
reduces activity of the
-subunit promoter to 16% in BeWo cells.
This double mutant illustrates that alone the URE/CRE composite
element, formerly referred to as the placenta-specific enhancer [PSE
(6)] contributes only 16% of the activity normally associated with
the intact
-subunit promoter. This further underscores the
importance of the JRE and CCAAT box and their relationship to upstream
elements.
Double mutations in the TSE and JRE were also made. This mutation
reduces promoter activity to 15% in BeWo cells, but has virtually no
effect in
T31 cells (Fig. 2
), providing additional evidence for
the trophoblast specificity of the TSE and JRE. However, without the
tandem CRE, promoter activity is virtually undetectable. Thus, taken
together, the systematic block replacement studies define a pentameric
array of regulatory elements that together set the transcriptional tone
of the
-subunit promoter in trophoblasts.
The JRE Binds a Protein Unique to Trophoblasts
Given the trophoblast-specific property of the JRE, we next
determined whether choriocarcinoma cells express a tissue-specific
protein that binds to this element. Previously, we reported that a
JRE-binding protein can be detected by electrophoretic mobility shift
assay (EMSA) in choriocarcinoma cells and in several different
nontrophoblastic cell lines including HeLa and HepG2 (25). Such a
protein can also be detected by EMSA in
T31 and MCF-7 cells (Fig. 3
). Subsequent analysis by Southwestern
blot, however, revealed that the 40-kDa protein detected in BeWo cells
was undetectable in
T31 or MCF-7 cells (Fig. 4
). This indicates that the BeWo cells
contain a distinct JRE-binding activity not found in other cell types.
If so, this would explain the trophoblast-specific effect of the JRE.
Additional experiments will be necessary to determine whether this
binding activity represents a monomeric or heteromeric protein(s).
|
|
-subunit promoter. To address the stringency of this code, we
systematically replaced each of the five regulatory elements with a
consensus AP-1 site that preferentially binds jun/fos
heterodimers. The native
-subunit promoter lacks a consensus AP-1
sequence and is not known to bind jun/fos heterodimers.
Thus, this strategy tests whether a heterologous transcription factor
can substitute for any of the native factors that collectively bind to
this composite element.
Effects of replacement with AP-1 were site- and cell-dependent. AP-1
functionally replaced the TSE,
ACT, and CCAAT box in BeWo cells
(Fig. 5
). In striking contrast, AP-1
failed to functionally replace either the tandem CRE or the JRE. The
requirement for the tandem CRE appears restricted to trophoblasts, as
AP-1 partially restored activity to the
-subunit promoter in
T31 cells. Together, the above data suggest that functional
activity of the pentameric array of regulatory elements in trophoblasts
displays a strong preference for CRE- and JRE-binding proteins.
|
-Subunit Promoter in Trophoblasts
-subunit
promoter (27, 28), we addressed whether specific domains were required
for activity. To eliminate endogenous CREB from the transfection
paradigm, we constructed a reporter vector where the tandem 18-bp CREs
were replaced by tandem 17-bp GAL4 DNA-binding sites (H
GAL4). We
then used a series of expression constructs that fuse either the
transactivation domain of CREB, or selected internal deletions, to the
DNA-binding domain of GAL4. The reporter and expression vectors were
then cotransfected into BeWo cells with another vector that encodes the
catalytic subunit of protein kinase A (RSV-C
) (29).
As shown in Fig. 6
, the parent fusion
protein (CRG), which contains the entire transactivation domain of
CREB, serves as the reference for H
GAL4 promoter activity. The Q1
domain of CRG (
11/86) does not appear to be involved as it can be
deleted without any loss of activity. In contrast, a mutation in Serine
133 (S133A), or deletion of the constitutive activation domain (CAD,
166), prevented the CREB fusion proteins from activating the human
-subunit promoter. In fact, the activity of these mutant vectors was
indistinguishable from a vector that expresses the GAL4 DNA-binding
domain alone (
57). Cotransfecting the CRG expression vectors with a
reporter containing the wild type
-subunit promoter had no effect on
activity (data not shown), indicating the specificity of the CRG
effect.
|
GAL4 promoter transfected with the CRG expression
vector had a third of the activity of the wild type
-subunit
promoter. This was probably not due to diminished concentrations of
fusion protein since all the fusion proteins were readily detected by
Western blot (data not shown). Likewise, a minimal promoter containing
five GAL4 DNA-binding sites (5xGT) transfected with CRG elevated
expression of the reporter by almost 80-fold when compared with the
effects observed with
57 (Fig. 6
-promoter.
Because all of the CRG expression vectors lack the DNA-binding domain
of CREB, we suggest that this domain may play an important role in
conferring full activity to the
-subunit promoter. This may occur
via intra- and/or intermolecular interactions, consistent with the
known cooperative binding of CREB to the tandem CRE (20). The data also
indicate that Serine 133 and the CAD are necessary for full activity of
the CREB fusion protein. Previous reports indicate that Serine 133 is
required for CREB interaction with the CREB binding protein (CBP) (30).
Likewise, CAD has been shown to interact specifically with
transcription factors TFIIB and TFIID (31), and in particular with TAF
110 of TFIID (32). Therefore, these proteins represent likely
downstream targets for the CREBs of the
-subunit promoter.
Systematic Insertion of a 15-bp Spacer Defines a CCAAT Box with
Positional Dependence Unique to Trophoblasts
The composite functional array generated by the five regulatory
elements in trophoblasts implies the possibility of a direct
interaction between their cognate DNA-binding proteins. Rather than
test this possibility further by constructing an even larger spectrum
of multiple block mutations, we opted instead to introduce systematic
15-bp spacer mutations that separate each of the five regulatory
elements from one another and from the TATA box by a helix rotation of
1.5 turns. If there are stereospecific interactions between the
proteins that bind these sites, then altering their spatial
relationships should have an impact on promoter activity.
The 15-bp insertions failed to diminish promoter activity in BeWo cells
when placed between either the TSE and
ACT,
ACT and tandem CRE,
the JRE and tandem CRE, or the JRE and CCAAT box (Fig. 7
). This suggests that the interactions
generated by these elements in trophoblasts do not require direct
stereospecific interactions among their cognate DNA-binding proteins.
Inserting 15-bp spacer mutations between the TSE,
ACT, CREs, and JRE
also had no impact on
-subunit promoter activity in
T31 cells
(Fig. 7
). This was expected as the TSE and JRE have no functional
activity in gonadotropes. Furthermore, although
ACT and the CREs
contribute to promoter activity in gonadotropes, they appear to do so
independently of each other (26).
|
T31 cells (Fig. 7
T31 cells (Fig. 2Together these results suggest that the five regulatory elements can be viewed as a functional unit with the CCAAT box displaying a cell-specific positional dependence relative to the TATA box. The lack of direct interactions between these regulatory elements, coupled with CCAAT box positional dependence, suggests instead that the pentameric array interacts as a unit with components of the core transcription complex. In this regard, it is notable that there are no known regulatory elements with functional activity in trophoblasts located between the CCAAT and TATA box.
| DISCUSSION |
|---|
|
|
|---|
-subunit promoter in
trophoblasts have been examined within a context that preserves their
spatial configuration. Given their compact alignment, we were surprised
that trophoblast specificity appears not to depend on direct
interactions between each of the different regulatory elements. In
addition, although one of the elements (JRE) appears to bind a protein
unique to trophoblasts, its individual contribution to promoter
activity is modest when compared with the others. Thus, this pentameric
composite element has additional features that together endow the
-subunit promoter with trophoblast specificity and maximal
activity.
When activities of
-subunit promoters with pair-wise mutations are
summarized (Fig. 8
), a clear hierarchy
emerges that helps explain how each pair affects maximal transcription.
Removal of the tandem CRE renders an
-subunit promoter with
essentially no activity. This clearly establishes the tandem CRE as a
major determinant of promoter activity. When taken alone, it also
suggests that the remaining elements make only marginal contributions
to promoter activity. This cannot be true, however, as activity of the
other mutant promoters containing a tandem CRE is much less than
expected. For example, removing the URE (TSE and
ACT) leaves the
promoter with only 5% residual activity. If the tandem CREs were
acting independently, activity should exceed 99%. Similarly, 16%
activity remains upon mutation of the JRE and CCAAT box. This suggests
that multiple facilitated interactions underlie the activity of each
member of the composite element. These interactions likely involve
components of the core transcriptional complex since there are no
readily detectable direct interactions between the members of the
pentameric array.
|
The JRE binds proteins present in nuclear extracts from a variety of
tissues but contributes to
-subunit promoter activity only in
trophoblasts. Significantly, however, this functional activity
correlates with the binding of a protein specifically expressed in
trophoblasts (Fig. 4
). Thus, the JRE-binding factor appears to be the
only cell-specific protein that binds to the pentameric array. Analysis
of JRE binding site (TAATTACA) uncovered a homology to the consensus
sequence of CDX-2, a member of the Drosophila Caudal family
of homeotic genes (34). A mammalian homolog of CDX-2 is expressed
specifically in the placenta and intestinal epithelium in mice (35, 36). This raises the possibility that trophoblasts may contain a
JRE-binding protein immunologically related to CDX-2.
Deletion of the JRE, like the TSE, results in an
-subunit promoter
with appreciable activity (Fig. 2
), suggesting that alone it cannot
account for the full trophoblast-specific character of the
-subunit
promoter. Mutating both the TSE and JRE results in a promoter with even
less activity (Fig. 2
). Although this combination of elements provides
a greater degree of trophoblast specificity, significant
nontrophoblastic activity still remains.
In contrast to the TSE and JRE, the
ACT site accounts for
approximately 80% of the total promoter activity, ranking second only
to the tandem CRE (Fig. 2
). Thus,
ACT plays an important role in
setting the transcriptional tone of the
-subunit promoter. This
element, however, is like the TSE in that its cognate DNA-binding
proteins (GATA-2, GATA-3) are expressed in more than one cell type.
(18). For example, GATA-2 and GATA-3 are expressed in trophoblasts and
erythroid cells (17, 18).
ACT also contributes to
-subunit
promoter activity in both gonadotropes and trophoblasts (17, 26). This
further underscores the need for additional mechanisms that determine
trophoblast specificity.
The tandem CRE and JRE offer another avenue for conferring
trophoblast-specific activity to the
-subunit promoter. Substitution
studies with the AP-1 element (Fig. 5
) indicated that activity of the
-subunit promoter in trophoblasts exhibits a relatively stringent
requirement for CRE- and JRE-binding proteins as compared with the
proteins that bind the other members of the composite element. Unlike
the functional JRE-binding protein that appears unique to trophoblasts,
the CREBs are ubiquitous, present in virtually every tissue. Yet, the
inability to substitute for either the JRE- or CRE-binding proteins
suggest that their presence adds an additional trophoblast-specific
property. For example, the TSE- and JRE-binding proteins may make
unique contacts with components of the downstream transcriptional
complex that are themselves trophoblast-specific. The recent
description of tissue-specific TAFs supports this possibility (37).
The positional dependence of the CCAAT box adds a final intriguing idiosyncratic property to the five-element array. This element is active in trophoblasts but not gonadotropes. Thus, occupancy of the CCAAT box may provide another level of cell specificity through establishment of a critical proximity that permits the CCAAT box-binding factor, and other proteins that bind to members of the pentameric array, to interact with components of the downstream transcriptional complex. For example, CREB can interact directly with CBP, TAF110, and TFIIB (30, 31, 32). Thus, it is possible that the CCAAT-binding protein, along with other URE- and DRE-binding proteins, either potentiates this interaction or, alternatively, exposes a unique domain of CREB that allows a subsequent interaction with a specific TAF unique to trophoblasts.
Based on the above, we conclude that trophoblast-specific expression of
the
-subunit occurs through the use of a composite regulatory
element composed of five distinct binding sites for transcriptional
factors. This pentameric array achieves trophoblast specificity through
multiple characteristics that include the binding of a
trophoblast-specific protein with relatively weak activity rather than
relying on a single regulatory element that binds a dominant
trophoblast-specific protein. The development of such a complex
regulatory code may reflect the complex temporal and spatial pattern of
expression of the
-subunit gene that includes cytotrophoblasts of
the placenta, cells of the hypophyseal placode adjacent to the anterior
neuropore, and gonadotropes and thyrotropes of the pituitary (2, 3). In
this regard, it is interesting to note that a wide variety of tumors
ectopically secrete high levels of
-subunit (38). Since there is
ample evidence of transcriptional cooperativity among the elements of
the pentameric array, it seems likely that small changes in the
concentration of any of the cognate DNA-binding proteins could have a
dramatic impact on activity of the
-subunit promoter. If so, then
ectopic expression of the
-subunit gene in tumors may well be caused
by small changes in the concentration of one or more of the DNA-binding
proteins of the pentameric array.
The high incidence of ectopic secretion of the
-subunit may reflect
an inherent limitation of a composite regulatory region that binds
transcriptional factors with a range of tissue distributions from
potentially unique (JRE-binding protein), to limited (
ACT- and
TSE-binding proteins), to generalized (CREBs). In other words, while a
combinatorial scheme may direct high level expression of a specific
gene to several different cell types, this may occur at the expense of
low level expression in nontarget cell types. For the
-subunit gene
the consequence of this expression may be minimal, as synthesis of a
biologically active glycoprotein hormone requires simultaneous
expression of an appropriate ß-subunit gene. When viewed from this
perspective, it is tempting to speculate that the pentameric array of
-subunit regulatory elements provides a means for directing high
levels of expression in trophoblasts that comes at the expense of low
levels of ectopic expression in many different cell types.
In summary, additional studies will be required to explain how the
macromolecular complex that forms over the pentameric array of
regulatory elements communicates with the core transcriptional
machinery to direct high levels of
-subunit gene expression to
trophoblasts. The complexity and positional dependence of the
regulatory elements suggest that exploring individual elements out of
context would eliminate the unique characteristics of this functional
unit. Therefore, definitive experiments will most likely come from a
continued contextual analysis of this composite array of regulatory
elements.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-subunit promoter was
isolated from pH
(-1500/+48)CAT (12). To form a unique restriction
site at each end of the promoter, partial digestion with
HindIII was performed, filled in by treatment with Klenow
fragment of DNA polymerase I, and ligated to generate a NheI
site at the 5'-end of the human
-promoter. This resulted in only one
HindIII site at the 3'-end of the promoter. This H
CAT
vector was then digested with KpnI and HindIII,
and the 1500-bp promoter was cloned 5' of luciferase reporter vector in
pGene Light-2 Basic (Promega, Madison, WI) to generate H
(-1500)
Luc.
Generation of each of the mutant constructs was performed by PCR using
Deep Vent DNA polymerase (New England Biolabs, Beverly, MA). To
minimize formation of a new and unexpected element, the sequence or
each null mutant was a restriction site chosen to remove all the wild
type sequence. Three separate PCR reactions were performed for each
clone. The first set of reactions was independent employing two
different sets of primers, but forming an overlap region in the
sequence amplified. The upstream reaction used an oligonucleotide
homologous to the -312 to -284 region of the human
5'-flanking
region (Pust-1) and a 3'-oligonucleotide with the correct mutations.
The downstream reaction used a 5'-oligonucleotide complementary to the
3'-mutant oligonucleotide from the upstream reaction and a
3'-oligonucleotide (Luc-1, GGCCATGACAACCATTTTACCTTCTGCGGTT)
complementary to the 5'-end of the luciferase gene. The two products of
the first set of PCR reactions were resolved by electrophoresis in a
6% polyacrylamide gel in 1x Tris-boric acid-EDTA (TBE) and stained
with ethidium bromide. The two overlapping fragments were then mixed
together and subjected to a third PCR reaction utilizing Pust-1 and
Luc-1 as the 5'- and 3'-primers. The products of this reaction were
digested with SnaB I and HindIII and gel
isolated. The unique SnaB I and HindIII sites are
located at -250 and +48, respectively, in the human
- promoter.
This unique fragment was then ligated into H
(-1500)Luc digested
with SnaB I and HindIII.
The double mutant H
(dbTRE)Luc replacing the TSE and
ACT
elements with AP-1 sites was cloned by utilizing H
(TRE1)Luc (AP-1
replacement of the TSE) as the plasmid amplified in a PCR reaction
using (TGACTCACCATGGGGGTTGAAA-TGACTCATATGCAAATTGACGT) and Luc-1 primers
as the 5'- and 3'-oligonucleotides, respectively. The
5'-oligonucleotide contained a NcoI restriction site
adjacent to the first AP-1 site and a NdeI site 3' of the
second AP-1 site. The PCR product was digested with NcoI and
HindIII and gel isolated. The cloned DNA was ligated into
the H
(TRE1)Luc digested with NcoI and HindIII.
The plasmid containing four AP-1 sites was cloned similarly as
H
(dbTRE)Luc with the exception that the plasmid amplified in the PCR
reaction was H
(-1500)Luc with the CREs already replaced with
TREs.
The null act promoter was isolated from the µ9 clone of
H
(-200)CAT previously reported (14). This plasmid was digested with
SauI and HindIII, and the DNA fragment was gel
isolated and cloned into H
(-1500)CAT to place the mutation in the
context of the 1500-bp promoter. The full length promoter containing
the null act mutation was digested with NheI and
HindIII and ligated into pGene Light-2 Basic.
Null mutation of the tse was achieved using two independent
rounds of PCR. For the upstream reaction Pust-1 and a complementary
µVI oligonucleotide (14) were used with H
(-1500)Luc. A separate
downstream reaction was performed using H
(-200)CAT µVI block
replacement vector with µVI oligonucleotide (14) and BJSCAT, a
homologous primer flanking the CAT gene. The gel-isolated bands of the
correct size from both PCR reactions were combined and subjected to a
third PCR reaction with Pust-1 and BJSCAT as the primers. The DNA was
digested with SnaB I and HindIII and ligated into
H
(-1500)Luc.
The null mutation for the tandem CREs in the H
(-1500)Luc vector was
cloned with two GAL4 DNA-binding sites replacing the tandem CRE. An
oligonucleotide from -180 to -100 of human
-promoter containing
the tandem GAL4 DNA binding sites was annealed to a complementary
oligonucleotide spanning -121 to -100 and filled in using Klenow.
This DNA fragment was ligated to a 145-bp fragment of the human
promoter (-99 to +48) with RsaI and HindIII
ends. The ligated product was digested with
SauI/HindIII and gel isolated. This insert was
ligated into H
(-1500)CAT digested with
SauI/HindIII. The H(
-1500)CAT plasmid was
digested with NheI/HindIII, and the
-promoter
was cloned into pGene Light-2 Basic.
The 15-bp random nucleotide insertions were constructed using two rounds of PCR. For the first round, the upstream reaction contained a 5'-Pust-1 primer and a 3'-primer containing a random 15-bp insertion with a Not-1 restriction site (TTTGCGGCCGCAACA). The downstream reaction used a 5'-primer complementary to the 15-bp insertion and a 3' Luc-1 primer. The PCR fragments of both reactions were gel isolated and combined for a third PCR reaction using Pust-1 and Luc-1 oligonucleotides.
The 36-bp random nucleotide vectors were constructed from the 15-bp insertion vectors. The 15-bp insertion vectors were digested with Not-1, treated with calf intestinal alkaline phosphatase (Boehringer Mannheim, Indianapolis, IN), gel isolated, and electroeluted. A 21-bp oligonucleotide containing Not-1 ends (GGCCAGGTACCGAGCTCTTAC) was kinased and ligated to these plasmids.
The CREB/GAL4 fusion cDNA constructs were previously described (29).
Briefly, the cDNA for the transactivation domain of CREB 341 [amino
acids (aa) 1277] was inserted 5' to the GAL4 DNA-binding domain (aa
4147). All CREB expression vectors were lacking the DNA-binding
domain of CREB (aa 280341) to form CRG. A deletion of the Q1 region
removed aa 1186 of CRG. The S133A expression vector contained a
serine to alanine substitution at position 133. The CAD mutation
deleted amino acids 166279. The GAL4 expression vector
57
contained the first eight amino acids of CREB fused to the GAL4
DNA-binding domain. The PKAc (RSV-C
) vector expresses the catalytic
subunit of protein kinase A (29).
All clones were confirmed by sequencing using Sequenase 2.0 sequencing kit from USB (Cleveland, OH).
Cell Culture
BeWo,
T31, and MCF-7 cells were grown in monolayer
cultures. BeWo and
T31 cells were maintained in culture as
previously described (26). MCF-7 cells were grown in DMEM supplemented
with 10% FBS, penicillin, and streptomycin.
Transfection Analysis
Cells were plated onto 35-mm plates at a density of either
120,000 (BeWo), 100,000 (MCF-7), or 170,000 (
T31) cells per well.
The day after plating, the cells were transfected using lipofectamine
reagent as described by the supplier (GIBCO BRL, Gaithersburg, MD).
Each construct was transfected in triplicate with each well containing
1.25 µg reporter DNA, 0.25 µg RSV-ß-galactosidase vector, and 5
µl lipofectamine. Where indicated, 31.5 ng PKAc was also transfected.
BeWo and MCF-7 cells were incubated for 4 h with the
DNA/lipofectamine solution and then replaced with complete medium. The
T31 cells were incubated for 16 h with DNA/lipofectamine
before replacement with complete medium.
Cells were harvested 44 h after beginning the transfection as previously described for both luciferase and ß-galactosidase (26).
Gel Mobility Shift Assay and Southwestern Blot Analysis
Nuclear extracts were prepared from BeWo,
T31, and MCF-7
cells according to the method of Dignam et al. (39). Protein
concentrations were determined by the method of Bradford (40).
The electrophoretic mobility shift assay was modified from that described previously (26). Reactions contained labeled probe (30 fmol), 78 µg nuclear extract, 1 µg poly(deoxyinosinic-deoxycytidylic)acid (Pharmacia Biotech, Piscataway, NJ), 200 ng salmon sperm DNA, and 200 ng Escherichia coli DNA in buffer containing 12.5 mM HEPES (pH 7.9), 25 mM KCl, 10 mM MgCl2, and 0.5 mM dithiothreitol to bring the final volume to 20 µl. Unlabeled competitors were included at 150200 molar excess of the labeled probe. Reactions were carried out for 20 min on ice and separated on 4% polyacrylamide gels in 0.25x TBE (1x TBE = 50 mM Tris, 50 mM boric acid, and 1 mM EDTA) at 4 C. Gels were transferred to Whatman paper, dried, and exposed to NEF-496 film (NEN Research Products, Boston, MA). Southwestern Blot analysis was performed using a procedure previously described (26).
| FOOTNOTES |
|---|
This work was supported by NIH Grants DK-28559 (to J.H.N.) DK-43871 (to P.G.Q.), and HD-0790002 (to P.R.B.).
Received for publication May 14, 1997. Accepted for publication July 14, 1997.
| REFERENCES |
|---|
|
|
|---|
-subunit gene in the placenta requires a
functional cyclic AMP responsive element, whereas a different
cis-acting element mediates pituitary-specific expression.
Mol Cell Biol 9:51135122
-subunit gene: dependence
on cyclic AMP-inducible elements. Mol Cell Biol 7:39944002
gene transcription is directed
by a repeated 18-base pair enhancer. J Biol Chem 262:1216912174
- subunit gene occurs only in primates and
horses. Biol Reprod 44:231237[Abstract]
subunit
gene interact independently with a cAMP-responsive enhancer.
J Biol Chem 264:1619016196
-gene contains multiple protein binding domains
that interact to modulate basal and cAMP-responsive transcription.
J Biol Chem 263:98799886
subunit
glycoprotein hormone gene utilizes a unique CCAAT binding factor.
J Biol Chem 265:62796285
-gene
is mediated by an 18 base pair element. Proc Natl Acad Sci USA 84:21982202
-subunit genes. Mol Endocrinol 5:243255
subunit gene: emergence of a new element. J Biol Chem 269:1936019368
-subunit gene in the placenta and
pituitary gland. Mol Cell Biol 14:55925602
-gene. Mol Endocrinol 3:763772
-subunit gene occurs through several distinct mechanisms. Mol
Endocrinol 4:573582
subunit gene in primate and
horse placenta. Mol Endocrinol 4:14801487
-subunit
genes is regulated by distinct cis-acting elements. Mol
Endocrinol 6:17451755
subunit gene. J Biol Chem 265:2187421880
subunit gene to
pituitary and placenta. J Biol Chem 270:2649726504
subunit gene bind similar proteins in trophoblasts
and gondatropes but have distinct functional sequence requirements.
J Biol Chem 271:3165031656This article has been cited by other articles:
![]() |
R. Sasson, S. H. Luu, V. G. Thackray, and P. L. Mellon Glucocorticoids Induce Human Glycoprotein Hormone {alpha}-Subunit Gene Expression in the Gonadotrope Endocrinology, July 1, 2008; 149(7): 3643 - 3655. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Schubert, A. Abendroth, K. Kilian, T. Vogler, B. Mayr, I. Knerr, and S. Hashemolhosseini bZIP-Type transcription factors CREB and OASIS bind and stimulate the promoter of the mammalian transcription factor GCMa/Gcm1 in trophoblast cells Nucleic Acids Res., June 1, 2008; 36(11): 3834 - 3846. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sato, K. Kitahara, T. Susa, T. Kato, and Y. Kato Pituitary transcription factor Prop-1 stimulates porcine pituitary glycoprotein hormone {alpha} subunit gene expression. J. Mol. Endocrinol., October 1, 2006; 37(2): 341 - 352. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Jorgensen, C. C. Quirk, and J. H. Nilson Multiple and Overlapping Combinatorial Codes Orchestrate Hormonal Responsiveness and Dictate Cell-Specific Expression of the Genes Encoding Luteinizing Hormone Endocr. Rev., August 1, 2004; 25(4): 521 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Holland, S. P. Bliss, K. A. Berghorn, and M. S. Roberson A Role for CCAAT/Enhancer-Binding Protein {beta} in the Basal Regulation of the Distal-Less 3 Gene Promoter in Placental Cells Endocrinology, March 1, 2004; 145(3): 1096 - 1105. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Duval, A. Jean, and A. Gutierrez-Hartmann Ras Signaling and Transcriptional Synergy at a Flexible Ets-1/Pit-1 Composite DNA Element Is Defined by the Assembly of Selective Activation Domains J. Biol. Chem., October 10, 2003; 278(41): 39684 - 39696. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. P. Gobin, P. Biesta, J. E. M. de Steenwinkel, G. Datema, and P. J. Van den Elsen HLA-G Transactivation by cAMP-response Element-binding Protein (CREB). AN ALTERNATIVE TRANSACTIVATION PATHWAY TO THE CONSERVED MAJOR HISTOCOMPATIBILITY COMPLEX (MHC) CLASS I REGULATORY ROUTES J. Biol. Chem., October 11, 2002; 277(42): 39525 - 39531. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Jorgensen and J. H. Nilson AR Suppresses Transcription of the {alpha} Glycoprotein Hormone Subunit Gene Through Protein-Protein Interactions with cJun and Activation Transcription Factor 2 Mol. Endocrinol., September 1, 2001; 15(9): 1496 - 1504. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Knofler, L. Saleh, S. Bauer, R. Vasicek, G. Griesinger, H. Strohmer, H. Helmer, and P. Husslein Promoter Elements and Transcription Factors Involved in Differentiation-Dependent Human Chorionic Gonadotrophin-{alpha} Messenger Ribonucleic Acid Expression of Term Villous Trophoblasts Endocrinology, October 1, 2000; 141(10): 3737 - 3748. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Roberson, M. Ban, T. Zhang, and J. M. Mulvaney Role of the Cyclic AMP Response Element Binding Complex and Activation of Mitogen-Activated Protein Kinases in Synergistic Activation of the Glycoprotein Hormone alpha Subunit Gene by Epidermal Growth Factor and Forskolin Mol. Cell. Biol., May 15, 2000; 20(10): 3331 - 3344. [Abstract] [Full Text] |
||||
![]() |
M. Knofler What factors regulate HCG production in Down's syndrome pregnancies?: Regulation of HCG during normal gestation and in pregnancies affected by Down's syndrome Mol. Hum. Reprod., October 1, 1999; 5(10): 895 - 897. [Full Text] [PDF] |
||||
![]() |
M. Knofler, L. Saleh, H. Strohmer, P. Husslein, and M. F. Wolschek Cyclic AMP- and differentiation-dependent regulation of the proximal {alpha}HCG gene promoter in term villous trophoblasts Mol. Hum. Reprod., June 1, 1999; 5(6): 573 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sun and M. L. Duckworth Identification of a Placental-Specific Enhancer in the Rat Placental Lactogen II Gene That Contains Binding Sites for Members of the Ets and AP-1 (Activator Protein 1) Families of Transcription Factors Mol. Endocrinol., March 1, 1999; 13(3): 385 - 399. [Abstract] [Full Text] |
||||
![]() |
A. Kamat, J. L. Alcorn, C. Kunczt, and C. R. Mendelson Characterization of the Regulatory Regions of the Human Aromatase (P450arom) Gene Involved in Placenta-Specific Expression Mol. Endocrinol., November 1, 1998; 12(11): 1764 - 1777. [Abstract] [Full Text] |
||||
![]() |
D. Yeagley, J. M. Agati, and P. G. Quinn A Tripartite Array of Transcription Factor Binding Sites Mediates cAMP Induction of Phosphoenolpyruvate Carboxykinase Gene Transcription and Its Inhibition by Insulin J. Biol. Chem., July 24, 1998; 273(30): 18743 - 18750. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Roberson, S. Meermann, M. I. Morasso, J. M. Mulvaney-Musa, and T. Zhang A Role for the Homeobox Protein Distal-less 3 in the Activation of the Glycoprotein Hormone alpha Subunit Gene in Choriocarcinoma Cells J. Biol. Chem., March 23, 2001; 276(13): 10016 - 10024. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |