help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Warner, D. R.
Right arrow Articles by Weinstein, L. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Warner, D. R.
Right arrow Articles by Weinstein, L. S.
Molecular Endocrinology 11 (11): 1718-1727
Copyright © 1997 by The Endocrine Society

A Novel Mutation Adjacent to the Switch III Domain of Gs{alpha} in a Patient with Pseudohypoparathyroidism

Dennis R. Warner, Pablo V. Gejman, Regina M. Collins and Lee S. Weinstein

Membrane Biochemistry Section (D.R.W.), Laboratory of Molecular and Cellular Neurobiology, National Institute of Neurological Disorders and Stroke, Clinical Neurogenetics Branch (P.V.G.), National Institute of Mental Health, Metabolic Diseases Branch (R.M.C., L.S.W.), National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
A novel Gs{alpha} mutation encoding the substitution of arginine for serine 250 (Gs{alpha} S250R) was identified in a patient with pseudohypoparathyroidism type Ia. Both Gs activity and Gs{alpha} expression were decreased by about 50% in erythrocyte membranes from the affected patient. The cDNA of this Gs{alpha} mutant, as well as one in which the S250 residue is deleted (Gs{alpha}-{Delta}S250), was generated, and the biochemical properties of the products of in vitro transcription/translation were examined. Both mutants had a sedimentation coefficient similar to that of wild type Gs{alpha} (~3.7S) when kept at 0 C after synthesis. However when maintained for 1–2 h at 30–37 C, both mutants aggregated to a material sedimenting at ~6.3S or greater (Gs{alpha}-S250R to a greater extent than Gs{alpha}-{Delta}S250), while wild type Gs{alpha} sedimented at ~3.7S, suggesting that the mutants were thermolabile. Incubation in the presence of high doses of guanine nucleotide partially prevented heat denaturation of Gs{alpha} {Delta}S250 but had no protective effect on Gs{alpha}-S250R. Sucrose density gradient centrifugation at 0 C in the presence and absence of ß{gamma}-dimers demonstrated that, in contrast to wild type Gs{alpha}, neither mutant could interact with ß{gamma}. Trypsin protection assays revealed no protection of Gs{alpha}-S250R by GTP{gamma}S or AlF4- at any temperature. GTP{gamma}S conferred modest protection of Gs{alpha}-{Delta}S250 (~50% of wild-type Gs{alpha}) at 30 C but none at 37 C, while AlF4- conferred slight protection at 20 C but none at 30 C or above. Consistent with this result, Gs{alpha}-{Delta}S250 was able to stimulate adenylyl cyclase at 30 C when reconstituted with cyc- membranes in the presence of GTP{gamma}S but not in the presence of AlF4-. Gs{alpha}-S250R showed no ability to stimulate adenylyl cyclase in the presence of either agent. Stable transfection of mutant and wild-type Gs{alpha} into cyc- S49 lymphoma cells revealed that the majority of wild type Gs{alpha} localized to membranes, while little or no membrane localization occurred for either mutant. Modeling of Gs{alpha} based upon the crystal structure of Gt{alpha} or Gi{alpha} suggests that Ser250 interacts with several residues within and around the conserved NKXD motif, which directly interacts with the guanine ring of bound GDP or GTP. It is therefore possible that substitution or deletion of this residue may alter guanine nucleotide binding, which could lead to thermolability and impaired function.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Heterotrimeric G proteins1 couple heptahelical receptors (receptors with seven membrane-spanning regions) to intracellular effectors and are composed of three subunits, {alpha}, ß, and {gamma} (reviewed in Refs. 1–3). In the inactive state the {alpha}-subunit is associated with a tightly but noncovalently bound ß{gamma}-dimer. Binding of hormone to receptor effects a conformational change in the G protein {alpha}-subunit causing it to release GDP with concomitant binding of the activator GTP and dissociation from ß{gamma}. The GTP-bound {alpha}-subunit can then interact with specific enzymes or ion channels. For the stimulatory G protein, GS, these include the stimulation of adenylyl cyclase and modulation of ion channels (4, 5). In addition, the ß{gamma}-subunit itself can modulate effectors (6). Hydrolysis of bound GTP by an intrinsic GTPase activity returns the {alpha}-subunit to the basal, GDP-bound, state. Recently, x-ray crystallography has revealed details of the structure of heterotrimeric G-proteins (specifically, Gt{alpha} and Gi{alpha}1) and allowed prediction of a GTPase mechanism by comparing the activated (GTP{gamma}S- or AlF4- bound) and unactivated (GDP-bound) species (7, 8, 9, 10, 11, 12). Gt{alpha} and Gi{alpha}1 have two domains, one with a ras-like conformation encoding the structural elements necessary for guanine nucleotide binding/hydrolysis and effector interaction. The other domain is predominantly helical and may function to inhibit the release of GDP in the inactive state (11). Upon GTP binding, an active conformation is attained by the movement of three regions (named switch I, II, and III) to perform the functions associated with activation (10). Switches I and II contain the residues that position the catalytic water molecule, while switch II contains residues that, along with the amino terminus, interact with the ß{gamma}-subunit. Switch III appears to play no direct role in GTP hydrolysis, but stabilizes switch II while in the GTP-bound state and also provides contact points with the helical domain, important for the high affinity binding of GTP (7).

Heterozygous inactivating mutations of the gene encoding Gs{alpha} (GNAS1) are the molecular basis for Albright hereditary osteodystrophy (AHO, Refs. 13 and 14), a syndrome characterized by short stature, obesity, and in some cases, subcutaneous ossifications and mental retardation. Within AHO kindreds, patients may have the somatic features of AHO alone (pseudopseudohypoparathyroidism, PPHP) or AHO in association with resistance to multiple hormones (e.g. PTH or TSH) that activate Gs-coupled pathways in their target tissues [pseudohypoparathyroidism (PHP) type Ia] (1). Gs{alpha} mutations that lead to PHP type Ia and PPHP are heterogeneous and may affect GNAS1 mRNA processing or produce inactive or altered proteins (15). One example of the latter includes a C-terminal mutation of Gs{alpha} (Arg385->His substitution)2 found in PHP type Ia that uncouples it from receptors (16). A Gs{alpha} mutation that causes both testotoxicosis, AHO, and resistance to PTH and TSH encodes an Ala366->Ser substitution and interferes with guanine nucleotide binding (17), resulting in thermolability at normal body temperature but activation at the slightly lower testicular temperature. Recently, an Arg231->His substitution of Gs{alpha} was reported by Farfel et al. (18), which disturbs the interaction with ß{gamma} or alters the receptor-induced conformational change, but leaves the remaining functions intact (18). We have identified a novel Gs{alpha} missense mutant from a patient with PHP type Ia and AHO where Ser250 is substituted with an Arg residue. This mutant Gs{alpha} does not bind ß{gamma} or stimulate adenylyl cyclase and is thermolabile. Based on sequence homology with Gt{alpha} and Gi{alpha}1, Ser250 in Gs{alpha} is predicted to be positioned between switches II and III, at the juxtaposition of three ß-sheets, ß4, ß5, and ß6, which come together at the GDP-binding pocket (10). Modeling suggests that the mutation may alter the tertiary structure of the guanine nucleotide-binding pocket, resulting in defective guanine nucleotide binding, manifested as an enhanced thermolability.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Examination of erythrocyte membranes from the affected patient with PHP type Ia revealed an approximate 50% deficiency in both Gs bioactivity, as measured by the cyc- reconstitution assay, and expression of Gs{alpha} protein, as determined by immunoblot (see Fig. 1Go). The patient’s mother, who does not have clinical evidence of AHO or hormone resistance and who does not have a GNAS1 mutation (see below), showed no decrease in Gs bioactivity or expression. The GNAS1 gene was screened for mutations by denaturing gradient gel electrophoresis (DGGE) analysis of PCR-amplified genomic DNA fragments encompassing GNAS1 exons 2–13 and their intron-exon splice junctions (14, 19). DGGE analysis of a genomic fragment encompassing GNAS1 exons 10 and 11, which was amplified from the patient’s genomic DNA, revealed a wild type band and two slower migrating bands that were not present in the mother’s sample or in numerous other normal control or patient samples (see Fig. 2Go). By direct sequencing of the genomic DNA fragment (see Fig. 3Go), the patient was shown to have a heterozygous single base substitution (C to G) within the coding region of exon 10 that encodes the substitution of Arg for Ser at codon 250 (Gs{alpha}-S250R). This mutation creates an EcoRII restriction site. Digestion of PCR-amplified genomic DNA fragments with EcoRII confirmed the presence of the mutation in the patient and its absence in her unaffected mother (data not shown). The biochemical and genetic results confirm the diagnosis of PHP type Ia.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 1. Immunoblot of Erythrocyte Membranes with RM Antibody

Erythrocyte membranes (5 µg protein/lane) were electrophoresed and transferred to nylon membranes as described in Materials and Methods. Filters were incubated with RM antibody (2 µg/ml) raised to the C-terminal decapeptide of Gs{alpha} and I125 protein A (0.1 µCi/ml) and exposed to x-ray film overnight. The single 45-kDa short form of Gs{alpha} is present in membranes from a normal subject (N), the patient’s unaffected mother (M), and the affected patient (PHP) with significantly decreased amount of Gs{alpha} in the patient. The bands were quantified with a PhosphorImager, and the amount of Gs{alpha} membrane protein expressed as a percent of the mean of four normal subjects is shown in the middle panel. Below is the Gs functional activity of each sample determined by measuring adenylyl cyclase stimulation by isoproterenol (10 µM) and GTP (10 µM) after reconstitution with cyc- membranes. Data are expressed as the percent of the mean of four normal subjects.

 


View larger version (62K):
[in this window]
[in a new window]
 
Figure 2. DGGE Analysis of the GNAS1 Exon 10–11 Genomic Fragment with a GC Clamp Attached to the 3'-End

Genomic DNA fragments encompassing GNAS1 exons 10 and 11 were PCR-amplified with a GC clamp attached to the 3'-end to increase the sensitivity of DGGE. The oligonucleotide primers used for PCR were 5'-AAGAATTCTTAGGGATCAGGGTCGCTGCTC-3' (upstream primer) and 5'CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCCATGAACAGCCAGCAAGAGTGGA 3' (downstream primer with GC clamp) with the underlined sequences complementary to the GNAS1 gene (14, 19). DNA fragments were analyzed by DGGE as previously described (14). The patient (PHP) sample had a wild type band present in normals as well as two slowly migrating bands. The patient’s unaffected mother (M) showed only the wild type band. Electrophoresis of DNA samples in a nondenaturing 5% acrylamide gel revealed only a single band (data not shown).

 


View larger version (38K):
[in this window]
[in a new window]
 
Figure 3. Direct Sequencing of the Exon 10–11 Genomic Fragment

Genomic DNA was amplified by PCR using the same oligonucleotides as for DGGE and directly sequenced. Whereas the direct sequence of genomic DNA amplified from a normal subject (left) reveals only an AGC triplet at codon 250 (Ser), the corresponding sequence in the affected patient (PHP, right) reveals a G and C at the third position of the codon. This indicates a heterozygous single base substitution that encodes the substitution of Arg (AGG) for Ser (AGC) at codon 250 (19). The mutation creates a new EcoRII restriction site, and the presence of the mutation in the PHP patient was confirmed with an EcoRII restriction digest (data not shown).

 
RNA from whole blood was isolated, and the relative expression of the mutant and wild type allele in the patient was assessed by analysis of RT-PCR products. Direct sequencing of RT-PCR product amplified from RNA of the patient showed that the mutant and wild type allele were equivalently expressed (data not shown). EcoRII digests of cloned RT-PCR products showed eight of 18 clones to be mutant, consistent with equal expression of both alleles. In contrast, as noted above, the expression of Gs{alpha} protein in membranes is only 50%. Results in stably transfected cyc- cells (see below) suggests that this is not likely due to accumulation of the mutant protein in the cytosol.

We cloned Gs{alpha}-S250R into the transcription vector pBluescript for in vitro transcription/translation and into the transfection vector, pZEM228c for expression in S49 cyc- cells. We also created another Gs{alpha} Ser250 mutant in which this residue was deleted (Gs{alpha}-{Delta}S250). We characterized both this mutant and Gs{alpha}-S250R after in vitro translation and after expression in S49 cyc- cells. Gs{alpha}-S250R was refractory toward stimulation of adenylyl cyclase, both after in vitro translation/cyc- reconstitution and after stable expression in cyc- (Table 1Go). Like Gs{alpha}-S250R, Gs{alpha}-{Delta}S250 was unable to stimulate adenylyl cyclase in cyc- transfectants. However, Gs{alpha}-{Delta}S250 did exhibit low but reproducible activity after in vitro translation/cyc- reconstitution in response to GTP{gamma}S, but not AlF4- (Table 1Go). Additionally, accumulation of cAMP in Gs{alpha}-{Delta}S250/cyc- cells after stimulation with either isoproterenol or cholera toxin was similar to mock-transfected cyc- cells (data not presented). Immunoblotting of stable cyc- transfectant homogenates after centrifugation at 100,000 x g for 1 h shows that only small amounts of both wild type and mutant Gs{alpha} accumulated in the cytosolic fraction (Fig. 4Go). Only wild-type Gs{alpha} showed significant accumulation in the membrane fraction.


View this table:
[in this window]
[in a new window]
 
Table 1. Stimulation of Adenylyl Cyclase by Gs{alpha} Mutants1

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. Western Blot Analysis of Membrane and Cytosol Fractions of S49 cyc- Transfectants

Cyc- cells transfected with Gs{alpha}-S250R, Gs{alpha}-{Delta}S250, wild type Gs{alpha}, or with vector alone (mock) were collected after induction with 75 µM ZnSO4 for 12–16 h, homogenized, and separated into membrane (M) and cytosol (C) fractions by centrifugation at 100,000 x g for 1 h. Equal portions of each fraction (13 µg) were separated by SDS-PAGE, transferred to nylon membranes, and analyzed by immunoblotting with RM antibody and [125I]protein A as described in Materials and Methods. The Gs{alpha} bands are designated with an arrow.

 
In our initial experiments with in vitro translated Gs{alpha}-{Delta}S250 and Gs{alpha}-S250R, we observed that they exhibited an unusual gradient profile in response to mild heat treatment (Fig. 5Go, top two panels). When in vitro translates of Gs{alpha}-{Delta}S250 or Gs{alpha}-S250R were held on ice for 1–2 h, the gradient profile was virtually the same as that obtained for wild type Gs{alpha}, with a peak migrating with a sedimentation coefficient of ~3.7S.3 However, after 1–2 h at either 30 C or 37 C, most of the protein was present in a ~6.3S or higher peak of material. Wild type Gs{alpha} was stable for at least 2 h at 37 C, giving a profile similar to that for wild type held on ice for the same length of time. In the presence of excess GDP or GTP{gamma}S, a small proportion of Gs{alpha}-{Delta}S250 was able to maintain the 3.7S conformation. However, guanine nucleotides had no effect on Gs{alpha}-S250R (not shown). To determine whether the stable 3.7S conformation of Gs{alpha}-{Delta}S250 and Gs{alpha}-S250R observed on ice could bind ß{gamma}, in vitro translates were mixed with purified bovine brain ß{gamma} and held on ice for 1–2 h and then centrifuged through a 5–20% sucrose gradient (Fig. 5Go, bottom panel). Although wild type Gs{alpha} shifted completely into a peak of ~5.0S heterotrimer, there was no influence by ß{gamma} on the gradient profile of either Gs{alpha}-{Delta}S250 or Gs{alpha}-S250R, suggesting that neither mutant is capable of interacting with ß{gamma}.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 5. Sucrose Density Gradient Analysis of in Vitro Translated Gs{alpha}-S250R, Gs{alpha}-{Delta}S250, and Wild Type Gs{alpha}

Mutant or wild type Gs{alpha} translation products (2.5 µl) were prepared as described in Materials and Methods. The top two panels show the gradient profiles of each {alpha}-subunit after incubation at 0 C ({circ}), 30 C ({square}), or 37 C ({triangleup}) for 1 h (Gs{alpha}-S250R) or 2 h (Gs{alpha}-{Delta}S250 and wild type Gs{alpha}). The samples were centrifuged through a 200 µl 5–20% (wt/vol) sucrose gradient for 1 h at 436,000 x g. Gradients were fractionated from the top at 6 µl per fraction, and every other fraction was analyzed by SDS-PAGE and PhosphorImaging. Each data point is the amount of Gs{alpha} expressed as a percent of total Gs{alpha} fractionated from that gradient. The autoradiogram in the top panel is representative of the data obtained for Gs{alpha}-S250R held at 0 C or 37 C for 1 h. In the bottom panel, in vitro translated Gs{alpha} was mixed with 20 µg/ml ß{gamma} and incubated on ice for 1–2 h before centrifugation through sucrose gradients as described above. Values along the top are the position and sedimentation coefficients (s020,w) of standard proteins (carbonic anhydrase, 2.8; ovalbumin, 3.7; and globulin, 7.2). The arrows along the right side of the autoradiograms mark the position of full-length Gs{alpha} (52 kDa). The smaller molecular mass products result from initiation of protein synthesis at downstream methionine codons as these are immune precipitated with a C-terminal antibody (data not shown).

 
We examined the ability of AlF4- or GTP{gamma}S to protect the mutant and wild type Gs{alpha} from trypsin digestion, which is a function of the ability of each agent to bind to Gs{alpha} and induce the active conformation (20). Gs{alpha}-{Delta}S250, Gs{alpha}-S250R, or Gs{alpha}-wild-type in vitro translates were equilibrated with AlF4- or 100 µM GTP{gamma}S for 2 h at various temperatures and then digested with trypsin (Fig. 6Go). Wild-type Gs{alpha} was well protected by AlF4- and GTP{gamma}S. Gs{alpha}-{Delta}S250 exhibited low protection in the presence of AlF4- up to 20 C, dropping to <1% at higher temperatures (30–37 C). GTP{gamma}S was a better ligand, approaching 50% of the level seen with wild type Gs{alpha}, when equilibrated at 30 C. However, at 37 C protection fell off, consistent with the complete denaturation observed at higher temperatures by sucrose density gradient centrifugation. Gs{alpha}-S250R was protected at a level of less than 1% with either AlF4- or GTP{gamma}S, suggesting that this mutant is more severely affected than Gs{alpha}-{Delta}S250.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 6. Trypsinolysis of in Vitro Translated Gs{alpha}-S250R, Gs{alpha}-{Delta}S250, and Wild Type Gs{alpha} in the Presence of AlF4- or GTP{gamma}S as a Function of Temperature

Gs{alpha}-S250R, Gs{alpha}-{Delta}S250, and wild type Gs{alpha} were translated in vitro as described in Materials and Methods. Samples of in vitro translates (1–2.5 µl) were equilibrated for 2 h with AlF4- + 100 µM GDP or 100 µM GTP{gamma}S at the indicated temperature in 20 mM HEPES, pH 8.0, 10 mM MgCl2, 1 mM EDTA, and 1 mM DTT. Trypsin digestion was initiated with 200 µg/ml tosyl-L-phenylalanine chloromethyl ketone (TPCK)-trypsin, incubated for 5 min at 20 C, and terminated by boiling in sample buffer. The digestion products were separated by SDS-PAGE, after which dried gels were exposed first to a phosphor storage plate for quantification by PhosphorImaging and then to x-ray film for autoradiography. A representative autoradiogram is presented showing protection from trypsinolysis of wild type Gs{alpha} and Gs{alpha}-{Delta}S250 in the presence of AlF4-. The bottom panel shows graphically the protection from trypsinolysis of wild type Gs{alpha}, Gs{alpha}-S250R, and Gs{alpha}-{Delta}S250 conferred by AlF4- ({circ}) or GTP{gamma}S (•) as a function of temperature. Protection is defined as the amount of 38 kDa trypsin-resistant core expressed as a percent of full-length, undigested Gs{alpha}. The graphic data are presented as an average ± range for two experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We identified a heterozygous missense mutation (Gs{alpha}-S250R) in a severely affected patient with PHP type Ia. This mutation, as well as a mutation that deletes serine 250 (Gs{alpha}-{Delta}S250), encodes a Gs{alpha} protein with severely impaired function. Gs{alpha}-S250R was unable to attain the active conformation or stimulate adenylyl cyclase in the presence of AlF4- or GTP{gamma}S. In contrast, Gs{alpha}-{Delta}S250 was capable of stimulating adenylyl cyclase to some extent at 30 C in the presence of GTP{gamma}S but not in the presence of AlF4-. Consistent with this result, GTP{gamma}S was able to partially protect Gs{alpha}-{Delta}S250 from trypsin digestion at 30 C but AlF4- could not.

The results of sucrose gradient centrifugation experiments suggest that the gross conformation of both mutants is similar to that of wild type Gs{alpha} at 0 C. Both, however, appear to be thermolabile at higher temperatures (Gs{alpha}-S250R to a greater extent than Gs{alpha}-{Delta}S250). Preliminary characterization of another Gs{alpha} mutant (Gs{alpha}-R258W) shows it to be thermolabile at 37 C. However, high concentrations of guanine nucleotide protect Gs{alpha}-R258W from heat denaturation (D. R. Warner and L. S. Weinstein, manuscript in preparation). In contrast, high concentrations of guanine nucleotide did not protect Gs{alpha}-S250R from heat denaturation and protected Gs{alpha}-{Delta}S250 only slightly (data not shown), suggesting that the capacity of these mutants to bind guanine nucleotide is impaired. Impaired guanine nucleotide binding has been previously shown to be associated with thermolability in a Gs{alpha} mutant (Gs{alpha}-A366S, 17 . The results of sucrose density gradient experiments are consistent with the results of the trypsin protection assay, which suggests that Gs{alpha}-S250R is unable to bind guanine nucleotide at all while Gs{alpha}-{Delta}S250 can bind guanine nucleotide with low affinity and undergo the conformational switch. The decrease in protection by AlF4- at 30 C suggests that GDP binds to Gs{alpha}-{Delta}S250 less well than GTP{gamma}S at this temperature. However, based upon these results, we cannot rule out that the Ser250 mutants are thermolabile and cannot switch to the active conformation despite normal guanine nucleotide binding.

Neither mutant was able to interact with ß{gamma} dimers, even at low temperatures. Impaired guanine nucleotide binding is one possible explanation for the inability to form heterotrimer. It is also possible that mutation of serine 250 has a more direct effect on the switch II region, which directly interacts with ß{gamma} (8, 9). The inability of the S250 mutants to localize to membranes when stably transfected into cyc- cells may at least partially be the direct result of their inability to interact with ß{gamma}. The lack of interaction with ß{gamma} may also alter palmitoylation (21), although some experiments suggest that Gs{alpha} can interact with membranes in the absence of palmitoylation (22, 23). It also appears that Gs{alpha}-S250R does not localize to membranes in cells of the affected patient since the level of Gs{alpha} protein in erythrocyte membranes from the patient is only 50% of that from normal subjects.

A molecular model of Gs{alpha} was generated based upon the crystal structure of the {alpha}-subunit of the heterotrimeric G protein transducin (Gt{alpha}) to determine how these mutations may lead to abnormal function. This residue is located at the C terminus of the ß4 sheet adjacent to a highly conserved serine residue (Ser251) between the switch II and III regions of the GTPase domain (10, 12). Analysis of the Gs{alpha} model using the computer program Look, version 2.0 (Molecular Applications Group, Palo Alto, CA; see Fig. 7Go) reveals direct contacts between Ser250 and Leu266 in the {alpha}3-helix, Leu291 and Asn292 in the ß5-sheet, Leu297 in the {alpha}G-helix, and Ile341 in the {alpha}4-helix. Asn292 is the first residue of the conserved NKXD motif present in the GTPase superfamily members that interacts with the guanine nucleotide ring (24), where Asn, Lys, and Asp are strictly conserved, and X denotes a nonconserved residue. Residues 291 through 297 form a loop around the side chain of Ser250. These interactions of Ser250 with Leu291, Asn292, and Leu297 may function to stabilize contacts of the conserved NKXD residues (Asn292, Lys293, and Asp295) to the guanine ring or provide rigidity to this portion of the guanine nucleotide-binding pocket. Analysis of a Gs{alpha} model based upon Gi{alpha}1 shows similar results. Also, analysis of the Gt{alpha} crystal structure showed that the residue in the position corresponding to Gs{alpha} Ser250 (Leu223) made similar interactions with residues in the NKXD sequence except for an additional interaction with Lys267. Lys267 is the nonconserved residue in the NKXD motif of Gt{alpha}. It is interesting to note that the majority of heterotrimeric G{alpha}-subunits have Leu in the position analogous to Gs{alpha} Ser250, and in virtually all of these {alpha}-subunits the nonconserved residue in the NKXD motif is Lys (Lys267 in Gt{alpha}). In contrast, in Gs{alpha}, Gln is the nonconserved residue, and our model does not predict a direct interaction of this residue with Ser250.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 7. Molecular Modeling of Gs{alpha} Highlighting the Interactions of Ser250

A model of Gs{alpha} was constructed with Look as described in Materials and Methods using the coordinates of GDP-bound Gt{alpha}. Ser250 is in the center with the ß-hydroxyl group in red and the ß-carbon in gray. The backbone atoms of Ser250 are not visible. The residues that are predicted to contact Ser250 are shown in yellow. All others within the Leu291-Leu297 loop are colored red. The surrounding residues are shown as the {alpha}-carbon trace. The only other potential interaction, with Leu266, is not shown.

 
Examination of the sequence of 82 heterotrimeric G protein {alpha}-subunits (release 33 of the Swiss protein database) reveals that in all sequences the residue analogous to Ser250 is restricted to one of five uncharged residues (Ile, Ser, Met, Leu, and Cys). Substitution of a charged residue in this position, as in the case of Gs{alpha}-S250R, might completely disrupt interactions of this residue with the {alpha}3- and {alpha}4-helices and the NKXD region. In Gs{alpha}-{Delta}S250, since the next residue in the sequence is also a serine, the deletion may only result in an improper alignment of the remaining residues with preservation of the integrity of the guanine nucleotide-binding pocket. Therefore this mutant still demonstrates some activity under certain conditions.

The {alpha}4-helix is thought to comprise part of the receptor contact site and transmit conformational changes to residues that interact directly with GDP and induce guanine nucleotide exchange (25). It is tempting to speculate that the S250 mutants may result in an overall conformation that is attained during formation of the ternary complex with receptor, resulting in decreased guanine nucleotide affinity and consequently thermolability. In conclusion, the mutation of Ser250 in this PHP type Ia patient highlights a residue that is likely to be important in maintaining the integrity of the guanine nucleotide binding pocket.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Patient
The patient is a 44-yr-old black female with a diagnosis of PHP type Ia. She was born prematurely at 8 months after an otherwise normal gestation at a weight of 4 lb, 11 oz. She was critically ill, requiring hospitalization for 1 month after birth. She required two more subsequent admissions over the first 6 months for regurgitation and pneumonia with episodic apnea. At age 6 months she weighed only 8 lb but began to grow slowly. In early childhood she developed gradual obesity and was delayed in her developmental milestones. At age 10, subcutaneous calcifications were noted and hypocalcemia, hyperphosphatemia, and hypothyroidism were diagnosed. Lack of a calcemic or phosphaturic response to exogenous infusion of bovine parathyroid extract confirmed the diagnosis of PHP. At age 12 she was referred to the NIH. On physical examination, notable features included brachydactyly of multiple bones in the hands and feet, short stature, obesity, depressed nasal bridge, and palpable subcutaneous calcifications. She suffers from moderately severe mental retardation. Baseline and provocative endocrine testing confirmed resistance to PTH and TSH. Although the response of GH to provocative testing was normal, somatomedin C levels were below the normal limits on two occasions. The patient also had primary amenorrhea with mildly deficient sexual development. Gonadotropin responses to GnRH were normal. The patient also had a decreased plasma cAMP response to glucagon infusion, although the glycemic response was normal. Karyotype was 46 XX (t 13;15). The patient has three siblings who are clinically normal and are presently unavailable for testing. Neither parent (nor any of their ancestors) have clinical or biochemical features of PHP. The patient’s mother has primary hyperparathyroidism and a thyroid nodule. The patient’s father is presently unavailable for testing.

Preparation of Erythrocyte Membranes and Determination of Gs Activity
Erythrocyte membranes were prepared from the patient, her mother, and four normal subjects, as previously described (26), and frozen in aliquots at -70 C. Erythrocyte membranes were reconstituted with membranes from mutant S49 mouse lymphomas cells (cyc-, which lack Gs{alpha} expression) and adenylyl cyclase activity in the presence of isoproterenol (10 µM), and GTP (10 µM) was determined as previously described (26). Protein was determined by the method of Bradford (Bio-Rad Laboratories, Hercules, CA).

Immunoblots
Erythrocyte membranes were heat-denatured in SDS-mercaptoethanol loading buffer. Samples (equal amounts of protein and sample volume per lane) were electrophoresed in 10% tricine-SDS gels (Novex, San Diego, CA) and transferred to polyvinylidene difluoride (PVDF) filters (Immobilon-P) by electroblotting. Filters were blocked in Tris-buffered-saline (TBS) with 0.5% Tween-20 (TBST) and 1% BSA at 25 C for 1 h. Filters were then incubated with affinity-purified RM antibody (2 µg/ml), directed to the carboxy-terminal decapeptide of Gs{alpha} (27), in TBST, 1% BSA overnight at 25 C. After three washes in TBST, filters were incubated for 2 h in TBST, 1% BSA with [125I]protein A (NEN/DuPont, Boston, MA), 0.1 µCi/ml, and then rewashed three times with TBST. Filters were exposed to x-ray film, and bands were quantified with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).

DNA Isolation and Genetic Analysis
Genomic DNA was isolated from whole blood and screened for mutations within GNAS1 using PCR and denaturing gradient gel electrophoresis (DGGE) as previously described (14). PCR fragments were purified using Centricon 100 filters (Amicon, Beverly, MA) and directly sequenced using the Sequenase kit (U.S. Biochemical, Cleveland, OH).

RT-PCR
RNA was isolated from 100-µl aliquots of whole blood using the Catrimox-lithium chloride method (Iowa Biotechnology Corp., Coralville, IA). Crude RNA pellets were digested with DNAse I (amplification grade, BRL, Rockville, MD) in a 10-µl reaction for 15 min at 25 C. Samples were heated at 65 C for 15 min after addition of 20 mM EDTA (1 µl). Downstream oligonucleotide primer (50 pmol) was added, and the samples were heated at 65 C for 2 min and placed on ice. RNA samples (6 µl of template-primer mixture) were reverse transcribed at 45 C for 1 h in 25 µl reaction mixtures containing 1 µl AMV reverse transcriptase (SuperScript II, BRL), deoxynucleotide triphosphates (0.8 mM each), 1 µl RNAse inhibitor (BRL), 10 mM dithiothreitol (DTT), and reaction buffer supplied by the manufacturer. Negative control reactions without RT were also run for each sample. RT reactions were heated to 72 C for 5 min and 5 µl added to 100 µl PCR reactions containing deoxynucleotide triphosphates, 200 µM each, upstream and downstream oligonucleotide primers, 0.5 mM each, 0.01% (wt/vol) gelatin, 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2, and 2.5 U Taq polymerase (Perkin Elmer, Norwalk, CT). Amplification consisted of denaturation at 94 C for 5 min followed by 30 cycles consisting of annealing at 58 C for 45 sec, primer extension at 72 C for 1 min, and denaturation at 94 C for 1 min and 1 final cycle with a 3-min primer extension. For amplification of the GNAS1 exon 10 coding region the primers were: upstream, 5'-ATGTTTGACGTGGGTGGCCAGC-3'; downstream, 5'-CACAGAGAT-GGTGCGCAGCCAT-3' (19).

Cloning of Gs{alpha} Mutants
RT-PCR fragments encompassing exon 10 of Gs{alpha} were cloned by digestion with HincII and Sse8387I and ligated into the transcription vector pBluescript II (Stratagene, La Jolla, CA) that contained wild type human Gs{alpha} with the same fragment removed. Mutations were verified by DNA sequencing and synthesis of full-length Gs{alpha} tested by in vitro translation and immune precipitation with RM antibody. For transfection into cyc-, the cDNA was subcloned into pZEM228c under control of the metallothionein promotor (28).

Transfection of Cyc- Cells with Gs{alpha} Constructs
The cyc- variant of S49 murine lymphoma cells was grown in DMEM supplemented with 10% heat-inactivated horse serum and, for transfected cells, 125 µg/ml (active) G-418 (Geneticin, GIBCO/BRL, Gaithersburg, MD). Before transfection, Gs{alpha}-pZEM228c was linearized with AatII and sterilized by ethanol precipitation. Cyc- cells were prepared for transfection by two washes with ice-cold Dulbecco’s PBS (Ca+2 and Mg+2 free) and suspended at 1 x 108 cells/ml in the same buffer. Cells, (4 x 107 cells in 400 µl) were placed in an ice-cold electroporation cuvette (BTX, Inc., San Diego, CA; P/N 620), mixed with 20–25 µg vector DNA, and immediately electroporated using a BTX model 600 Electro Cell Manipulator with the following settings: charging voltage, 500 V; capacitance, 200 microfarads; and resistance, R10 (720 ohms). Using these conditions, the average field strength for each sample was ~800 V/cm, and the pulse length was ~2.6 msec. After electroporation, cells were held on ice for 10 min and then suspended in 6 ml DMEM and placed in an incubator with a 5% CO2 atmosphere. The next day, 14 ml of fresh media, supplemented with 400 µg/ml active G-418, and 20% conditioned media were added. Every 3–5 days, 50% of the medium was replaced with fresh medium. After approximately 1 month in culture, G-418-resistant cells were either tested without further manipulation or cloned in soft agar as described previously (29). After inducing Gs{alpha} expression with 75 µM ZnSO4 for 12–16 h, postnuclear supernatant fractions were prepared according to Salomon and Bourne (30). The postnuclear supernatant fraction was centrifuged for 1 h at 50,000 rpm (108,920 x g at rmax) in a Beckman TL-100 centrifuge with a TLA100.2 rotor (Beckman Instruments, Fullerton, CA). The supernatant was removed and the pellet was suspended in 20 mM HEPES, pH 8.0, 2 mM MgCl2, 1 mM EDTA, 0.5 µg/ml leupeptin, 2 µg/ml aprotinin, and 100 µg/ml soybean trypsin inhibitor, and both fractions were adjusted to 10% glycerol and stored at -80 C until needed. Supernatant and membrane proteins were separated on 10% gels by SDS-PAGE and transferred to Immobilon-P membranes that were probed with RM antiserum as described above.

Adenylyl Cyclase Assays
Postnuclear supernatants fractions from zinc-induced transfected cyc- cells were assayed for adenylyl cyclase activity according to Kassis et al. (31). Reactions were for 15 min at 30 C, and [32P]cAMP was purified and measured as described previously (32). For in vitro translated Gs{alpha} subunits, stimulation of adenylyl cyclase was measured after reconstitution into purified cyc- plasma membranes (33). Stimulation and [32P]cAMP quantification were the same as described above.

In Vitro Translation and Gradient Centrifugation
[35S]methionine-labeled Gs{alpha} was prepared by coupled in vitro transcription and translation as described previously (34). Rate zonal centrifugation was performed on 5–20% linear sucrose gradients (200 µl volume) made up in 20 mM HEPES, pH 8.0, 1 mM EDTA, 1 mM DTT, 50 mM GDP, 100 mM NaCl, 1 mM MgCl2, and 0.1% Lubrol-PX. Sample volume was 10 µl, which included 2.5–4 µl of the translation reaction, 0.1% Lubrol-PX, 1 mM GDP, and, when present, 20 µg/ml ß{gamma}. The samples were centrifuged for 1 h at 100,000 rpm (436,000 x g at rmax) at 4 C in a Beckman TL-100 centrifuge with a TLA100.2 fixed angle rotor. The gradients were fractionated with a Brandel microfractionator, model FR-115X (Brandel, Gaithersburg, MD), at 6 µl per fraction. After an equal volume of twice concentrated Laemmli sample buffer (35) was added, the samples were boiled for 5 min and analyzed by 10% SDS-PAGE. Gels were fixed in 10% acetic acid/25% methanol/1% glycerol for 1 h, dried, and then exposed to a storage phosphor screen (Molecular Dynamics, Sunnyvale, CA). After 1–2 days, data were collected with a Molecular Dynamics PhosphorImager, model 445 S1, and analyzed with Image Quant software (Molecular Dynamics).

Trypsin Digests
In vitro translates ([35S]methionine-labeled, 1–2.5 µl) were incubated for 1–2 h in 20 mM HEPES, pH 8.0, 10 mM MgCl2, 1 mM EDTA, and 1 mM DTT, with or without 10 mM NaF/10 µM AlCl3/100 µM GDP or 100 µM GTP{gamma}S. Tosyl-L-phenylalanine chloromethyl ketone-trypsin was then added to a final concentration of 200 µg/ml. Digestions were carried out for 5 min at 20 C before addition of sample buffer (30) followed by boiling for 5 min. Samples were analyzed by SDS-PAGE and phosphorimaging as described above for the sucrose gradient samples. For visualization of the data an autoradiogram also was made.

Construction of Gs{alpha} Model
The primary sequence of Gs{alpha}-1 (19) was aligned with that of Gt{alpha} from the Brookhaven National Laboratory (ID code, 1TAG) and modeled with the SegMod module of Look (Molecular Applications Group, Palo Alto, CA) using 500 rounds of energy minimization. The root mean square deviation of the {alpha}-carbons of the modeled Gs{alpha} from Gt{alpha} was 0.94 Å.


    ACKNOWLEDGMENTS
 
The authors acknowledge the excellent technical assistance provided by Kenny C. Lai, Nadine American, Randy Lee, Shuhua Yu, and Dawen Yu. The authors also thank Dr. Robert Pearlstein for helpful advice with Look.


    FOOTNOTES
 
Address requests for reprints to: Dennis R. Warner, Membrane Biochemistry Section, Laboratory of Molecular and Cellular Neurobiology, National Institute of Neurological Disorders and Stroke, Building 49, Room 2A28, National Institutes of Health, Bethesda, Maryland 20892-4440.

1 The abbreviations used are: G protein, guanine nucleotide binding protein; Gs, stimulatory G protein; Gs{alpha}-S250R, mutant of Gs with serine250 to arginine substitution; Gs{alpha}-{Delta}S250, mutant of Gs in which serine-250 was deleted; GNAS1, human gene encoding Gs{alpha}; AlF4-, mixture of 10 µM AlCl3 and 10 mM NaF; GTP{gamma}S, guanosine-5'-O-(3-thiotriphosphate). Back

2 All numbering is based on the Gs{alpha}-1 sequence reported by Kozasa et al. (19 ). Back

3 The actual value for Gs{alpha} is 2.8S-3.15S and 4.55S-4.7S for the heterotrimer (36 37 ). The resolving power of a sucrose gradient in a fixed angle rotor is inferior to that centrifuged in a swinging bucket rotor. Speed was traded for resolving power and, therefore, the measured sedimentation coefficients are less accurate. Back

Received for publication April 29, 1997. Revision received July 24, 1997. Accepted for publication July 25, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Spiegel AM, Shenker A, Weinstein LS 1992 Receptor-effector coupling by G-proteins: implications for normal and abnormal signal transduction. Endocr Rev 13:536–565[CrossRef][Medline]
  2. Neer EJ, Clapham DE 1988 Roles of G protein subunits in transmembrane signalling. Nature 333:129–134[CrossRef][Medline]
  3. Birnbaumer L, Abramowitz J, Brown AM 1990 Receptor-effector coupling by G proteins. Biochim Biophys Acta 1031:163–224[Medline]
  4. Yatani A, Codina J, Imoto Y, Reeves P, Birnbaumer L, Brown AM 1987 A G protein directly regulates mammalian cardiac calcium channels. Science 238:1288–1292[Abstract/Free Full Text]
  5. Schreibmayer W, Dessauer W, Vorobiov D, Gilman AG, Lester HA, Davidson N, Dascal N 1996 Inhibition of an inwardly rectifying K+ channel by G-protein {alpha}-subunits. Nature 380:624–627[CrossRef][Medline]
  6. Clapham DE, Neer E 1993 New roles for ß{gamma}-dimers in transmembrane signalling. Nature 365:403–406[CrossRef][Medline]
  7. Mixon MB, Lee E, Coleman DE, Berghuis AM, Gilman AG, Sprang SR 1995 Tertiary and quaternary structural changes in Gi{alpha}1. Science 270:954–960[Abstract/Free Full Text]
  8. Wall MA, Coleman DE, Lee E, Iniguez-Lluhl JA, Posner BA, Gilman AG, Sprang SR 1995 The structure of the G protein heterotrimer Gi{alpha}1ß1{gamma}2. Cell 83:1047–1058[CrossRef][Medline]
  9. Lambright DG, Sondek J, Bohm A, Skiba NP, Hamm HE, Sigler PB 1996 The 2.0A crystal structure of a heterotrimeric G protein. Nature 379:311–319[CrossRef][Medline]
  10. Lambright DG, Noel JP, Hamm HE, Sigler PB 1994 Structural determinants for activation of the {alpha}-subunit of a heterotrimeric G protein. Nature 369:621- 628[CrossRef][Medline]
  11. Noel JP, Hamm HE, Sigler PB 1993 The 2.2Å crystal structure of a transducin-{alpha} complexed with GTP{gamma}S. Nature 366:654–663[CrossRef][Medline]
  12. Coleman DE, Berghius AM, Lee E, Linder ME, Gilman AG, Sprang SR 1994 Structures of active conformations of Gi{alpha}1 and the mechanism of GTP hydrolysis. Science 265:1405–1412[Abstract/Free Full Text]
  13. Patten JL, Johns DR, Valle D, Eil C, Gruppuso PA, Steele G, Smallwood PM, Levine MA 1990 Mutation in the gene encoding the stimulatory G protein adenylate cyclase in Albright’s hereditary osteodystrophy. N Engl J Med 322:1412–1419[Abstract]
  14. Weinstein LS, Gejman PV, Friedman E, Kadowaki T, Collins RM, Gershon ES, Spiegel AM 1990 Mutations of the Gs alpha subunit gene in Albright hereditary osetodystrophy detected by denaturing gradient gel electrophoresis. Proc Natl Acad Sci USA 87:8287–8290[Abstract/Free Full Text]
  15. Levine MA, Schwindinger WF, Downs RW, Moses AM 1994 Pseudohypoparathyroidism: clinical, biochemical, and molecular features. In: Bilezikion JP, Levine MA, Marcus R (eds) The Parathyroids. Raven Press, New York
  16. Schwindinger WF, Miric A, Zimmerman D, Levine MA 1994 A novel Gs{alpha} mutant in a patient with Albright hereditary osetodystrophy uncouples cell surface receptors from adenylyl cyclase. J Biol Chem 269:25387–25391[Abstract/Free Full Text]
  17. Iiri T, Herzmark P, Nakamoto JM, Van Dop C, Bourne HR 1994 Rapid GDP release from Gs{alpha} in patients with gain and loss of endocrine function. Nature 371:164–168[CrossRef][Medline]
  18. Farfel Z, Iiri T, Shapira H, Roitman A, Mouallem M, Bourne HR 1996 Pseudohypoparathyroidism, a novel mutation in the ß{gamma}-contact region of Gs{alpha} impairs receptor stimulation. J Biol Chem 271:19653–19655[Abstract/Free Full Text]
  19. Kozasa T, Itoh H, Tsukamoto T, Kaziro Y 1988 Isolation and characterization of the human Gs{alpha} gene. Proc Natl Acad Sci USA 85:2081–2085[Abstract/Free Full Text]
  20. Miller RT, Masters SB, Sullivan KA, Beiderman B, Bourne HR 1988 A mutation that prevents GTP-dependent activation of the {alpha} chain of Gs. Nature 344:712–715[CrossRef]
  21. Iiri T, Backlund Jr PS, Jones TLZ, Wedegaertner PB, Bourne HR 1996 Reciprocal regulation of Gs{alpha} by palmitate and the ß{gamma} subunit. Proc Natl Acad Sci USA 93:14592–14597[Abstract/Free Full Text]
  22. Degtyarev MY, Spiegel AM, Jones TLZ 1993 The G protein {alpha}s subunit incorporates [3H]palmitic acid and mutation of cysteine-3 prevents this modification. Biochemistry 32:8057–8061[CrossRef][Medline]
  23. Mumby SM, Kleuss C, Gilman AG 1994 Receptor regulation of G-protein palmitoylation. Proc Natl Acad Sci USA 91:2800–2804[Abstract/Free Full Text]
  24. Price SR, Barber A, Moss J 1990 ADP-ribosylating toxins and G- proteins. In: Moss J, Vaughan M (eds) Insights into Signal Transduction. American Society Microbiology, Washington, DC, pp 397–424
  25. Onrust R, Herzmark P, Chi P, Garcia PB, Lichtarge O, Kingsley C, Bourne HR 1997 Receptor and ß{gamma} binding sites in the {alpha} subunit of the retinal G protein transducin. Science 275:381–384[Abstract/Free Full Text]
  26. Levine MA, Downs Jr W, Singer M, Marx SJ, Aurbach GD, Spiegel AM 1980 Deficient activity of guanine nucleotide regulatory protein in erythrocytes from patients with pseudohypoparathyroidism. Biochem Biophys Res Commun 94:1319–1324[CrossRef][Medline]
  27. Simonds WF, Goldsmith PK, Woodard CJ, Unson CG, Spiegel AM 1989 Receptor and effector interactions of Gs. Functional studies with antibodies to the alpha S carboxyl-terminal peptide. FEBS Lett 249:189–194[CrossRef][Medline]
  28. Shapiro RA, Scherer NM, Habecker BA, Subers EM, Nathanson NM 1988 Isolation, sequence, and functional expression of the mouse M1 muscarinic acetylcholine receptor gene. J Biol Chem 263:18397–18403[Abstract/Free Full Text]
  29. van Daalen Wetters T, Coffino P 1987 Cultured S49 mouse T lymphoma cells. Methods Enzymol 151:9–19[Medline]
  30. Salomon MR, Bourne HR 1981 Novel S49 lymphoma variants with aberrant cyclic AMP metabolism. Mol Pharmacol 19:109–116[Abstract/Free Full Text]
  31. Kassis S, Henneberry RC, Fishman PH 1984 Induction of catecholamine-responsive adenylate cyclase in HeLa cells by sodium butyrate: evidence for a more efficient stimulatory regulatory component. J Biol Chem 259:4910–4916[Abstract/Free Full Text]
  32. Salomon Y, Londos C, Rodbell M 1974 A highly sensitive adenylate cyclase assay. Anal Biochem 58:541–548[CrossRef][Medline]
  33. Sternweis PC, Northup JK, Smigel MD, Gilman AG 1981 The regulatory component of adenylate cyclase. Purification and properties. J Biol Chem 256:11517–11526[Abstract/Free Full Text]
  34. Warner DR, Okuya S, Rebois RV 1996 Altered Gs{alpha} N-terminus affects Gs activity and interaction with the Gß{gamma} subunit complex in cell membranes but not in solution. Cell Signal 8:43–53[CrossRef][Medline]
  35. Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685[CrossRef][Medline]
  36. Hanski E, Sternweis PC, Northup JK, Dromerick AW, Gilman AG 1981 The regulatory component of adenylate cyclase. J Biol Chem 256:12911–12919[Abstract/Free Full Text]
  37. Neer EJ, Wolf LG, Gill DM 1987 The stimulatory guanine-nucleotide regulatory unit of adenylate cyclase from bovine cerebral cortex. Biochem J 241:325–336[Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Makita, J. Sato, P. Rondard, H. Fukamachi, Y. Yuasa, M. A. Aldred, M. Hashimoto, T. Fujita, and T. Iiri
Human Gs{alpha} mutant causes pseudohypoparathyroidism type Ia/neonatal diarrhea, a potential cell-specific role of the palmitoylation cycle
PNAS, October 30, 2007; 104(44): 17424 - 17429.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
L. S. Weinstein, S. Yu, D. R. Warner, and J. Liu
Endocrine Manifestations of Stimulatory G Protein {alpha}-Subunit Mutations and the Role of Genomic Imprinting
Endocr. Rev., October 1, 2001; 22(5): 675 - 705.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
W. Ahrens, O. Hiort, P. Staedt, T. Kirschner, C. Marschke, and K. Kruse
Analysis of the GNAS1 Gene in Albright's Hereditary Osteodystrophy
J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 4630 - 4634.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Mantovani, R. Romoli, G. Weber, V. Brunelli, E. De Menis, S. Beccio, P. Beck-Peccoz, and A. Spada
Mutational Analysis of GNAS1 in Patients with Pseudohypoparathyroidism: Identification of Two Novel Mutations
J. Clin. Endocrinol. Metab., November 1, 2000; 85(11): 4243 - 4248.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
J. Liu, S. Yu, D. Litman, W. Chen, and L. S. Weinstein
Identification of a Methylation Imprint Mark within the Mouse Gnas Locus
Mol. Cell. Biol., August 15, 2000; 20(16): 5808 - 5817.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. S. Weinstein, S. Yu, and C. A. Ecelbarger
Variable imprinting of the heterotrimeric G protein Gs alpha -subunit within different segments of the nephron
Am J Physiol Renal Physiol, April 1, 2000; 278(4): F507 - F514.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. Yu, S. Yu, V. Schuster, K. Kruse, C. L. Clericuzio, and L. S. Weinstein
Identification of Two Novel Deletion Mutations within the Gs{alpha} Gene (GNAS1) in Albright Hereditary Osteodystrophy
J. Clin. Endocrinol. Metab., September 1, 1999; 84(9): 3254 - 3259.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. R. Warner and L. S. Weinstein
A mutation in the heterotrimeric stimulatory guanine nucleotide binding protein alpha -subunit with impaired receptor-mediated activation because of elevated GTPase activity
PNAS, April 13, 1999; 96(8): 4268 - 4272.
[Abstract] [Full Text]