help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Endo, T.
Right arrow Articles by Onaya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Endo, T.
Right arrow Articles by Onaya, T.
Molecular Endocrinology 11 (11): 1747-1755
Copyright © 1997 by The Endocrine Society

Thyroid Transcription Factor-1 Activates the Promoter Activity of Rat Thyroid Na+/I- Symporter Gene

Toyoshi Endo, Masahiro Kaneshige, Minoru Nakazato, Masayuki Ohmori, Norikazu Harii and Toshimasa Onaya

Third Department of Internal Medicine, Yamanashi Medical University, Tamaho, Yamanashi 409–38, Japan


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have cloned 15 kbp of rat thyroid Na+/I- symporter gene from liver genomic library, which contains 6 kbp upstream sequence from the translation initiation site. Southern blot analysis of the genomic DNA from the liver has revealed that thyroid Na+/I- symporter gene is the single gene in the rat. To study the tissue-selective expression mechanism of the gene, we at first determined the transcriptional start site of the gene. Results of a rapid amplification of cDNA end procedure as well as that of primer extension analysis indicated that the transcriptional start sites clustered between -96, -95, and -93 bp of the gene (A in ATG is designated as +1). Chimeras containing 1.9 kbp (-1967 to -46 bp) of the 5'-flanking sequence of the Na+/I- symporter gene and luciferase gene expressed significant enzyme activity when transfected into a rat thyroid cell line, FRTL-5, but little activity was observed in BRL-3A rat liver cells. Deletion analysis of the constructs indicated that a minimal region, exhibiting promoter activity and cell specificity, is located between -291 and -134 bp of the gene. Deoxyribonuclease I footprinting shows that nuclear extracts from FRTL-5, but not BRL-3A, cells protect a region between -245 and -230 bp. Electrophoretic mobility shift assays have demonstrated that nuclear extracts from FRTL-5 cells formed a specific DNA-protein complex with an oligonucleotide probe corresponding to -250 to -211 bp of the gene, but that from BRL-3A cells did not, suggesting that thyrocyte-selective nuclear factors bind to the region. When the nuclear extracts from FRTL-5 cells were preincubated with antibody against thyroid transcription factor-1 (TTF-1), homeodomain containing nuclear protein, formation of the complex was abolished and the band was supershifted. We also found that the probe formed a DNA-protein complex with the recombinant TTF-1 homeodomain, and mutations of the binding site eliminated factor binding. When pRc/CMV-TTF-1 was cotransfected with the minimal promoter fragment of thyroid Na+/I- symporter gene into FRT cells, which express no TTF-1, it caused a significant increase in the transcriptional activity of the reporter construct, but not of the construct having mutated TTF-1-binding element. These results suggest that TTF-1 confers the cell-selective expression of Na+/I- symporter gene in thyrocytes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Thyroid gland is unique in its ability to accumulate iodide, and the process is the first step of the hormonogenesis. Iodide excess or deficiency largely affects thyroid function (1, 2) and, in thyroid tumor, the process is important for its diagnosis and radioiodine therapy (3). Therefore, iodide uptake mechanism by thyrocytes has been studied extensively (4, 5, 6, 7, 8), and recent studies have revealed that the transport of iodide is catalyzed by Na+/I- symporter (NIS) (9).

Very recently, Dai et al. (10) succeeded in cloning of rat NIS cDNA and have revealed that it encodes an intrinsic membrane protein with 12 putative transmembrane domains (10). By Northern analysis, they identified NIS mRNA in the thyroid, but not in the liver, kidney, intestine, brain, or heart, suggesting that the gene is primarily expressed in thyrocytes.

Recent studies have revealed that three genes encoding thyroid-specific proteins, thyroglobulin (Tg), thyroid peroxidase (TPO), and TSH receptor (TSH-R), are regulated by thyroid transcription factor-1 (TTF-1) and/or Pax-8 (11). TTF-1, which belongs to a family of homeobox-containing genes in Drosophila NK2 protein (12), is expressed in adult rat thyroid, lung, and restricted regions of the forebrain (13). Pax-8, a member of the murine family of paired box-containing genes (Pax genes), is present in adult rat thyroid and kidney (14). Therefore, simultaneous presence of TTF-1 and Pax-8 is a specific feature of thyroid follicular cells (11).

The structures of Tg and TPO promoters are very similar to each other. TTF-1 and Pax-8 bind to some specific region, site C, of both promoters, and DNA sequences recognized by both factors largely overlap (11). It has been believed that TTF-1 and Pax-8 could be used as alternatives to each other depending on functional requirements of Tg and TPO promoters (15). On the other hand, the structure of TSH-R promoter is different from that of Tg and TPO (16). TSH-R promoter lacks the Pax-8-binding site, and the gene expression depends on TTF-1 and other factors that interact with cAMP response element (CRE) (17, 18).

To investigate the structure and function of NIS gene, we have isolated rat NIS gene, defined its transcription start sites, and determined its promoter region. We also studied cell-selective expression mechanism of NIS gene in thyrocytes.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Isolation and Sequencing of the Genomic Fragment Containing the 5'-Franking Sequence of the Rat NIS Gene
Four positive plaques were isolated by screening rat liver genomic library (1.5 x 106 plaques) with 32P-labeled rat NIS cDNA (-29 to 1975 bp; in the remainder of the report, the A in the ATG initiation codon is designated as +1). A restriction map of one of the positive clones (Clone-KT3, 15 kbp long) is shown in Fig. 1aGo. Since KT3 as well as rat NIS cDNA contain only one cutting site for SacII, the genomic fragment possesses 6 kbp of upstream sequence from the translation initiation site. After ligating Clone-KT3 into pBluescript SK (pBS-NIS·KT3), we determined its nucleotide sequence from -2264 bp to +114 bp of the gene (DDBJ, EMBL, and NCBI accession No. D89570).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. Cloning of Rat NIS Gene

a, Schematic representation of one of the clones (KT-3) of rat NIS gene fragment. Restriction sites are shown as follows: N, NotI; Sp, SpeI; X, XbaI; SII, SacII; Sm, SmaI; SI, SacI; M, MluI. The translational initiation site (ATG) is indicated by arrows. b, Total Southern blot analysis of rat liver genomic DNA. Rat liver DNA (20 µg) (lanes 2 and 4) and pBS-KT3 (10 ng) (lanes 1 and 3) were digested with SpeI (lanes 1 and 2) and SmaI (lanes 3 and 4). After being electrophoresed on agarose gel and transferred to the cellulose acetate membrane, they were hybridized with 32P-labeled SmaI-SmaI fragment from pBS-KT3.

 
We then performed total Southern blot analysis of the rat liver genomic DNA. When the genomic DNA as well as pBS-NIS·KT3 were digested by SpeI or SmaI and then hybridized with 3 kbp of 32P-labeled SmaI-SmaI fragment from KT3, only one band, the size of which was identical to that from pBS-NIS ·KT3, was detected for each digestion (Fig. 1bGo). The results indicate that there is a single NIS gene in the rat genome.

Determination of the Transcriptional Start Sites
To identify the transcriptional start sites of NIS gene, we at first performed a rapid amplification of cDNA ends (RACE) procedure using mRNA from functional rat thyroid cells, FRTL-5 (19) (see Materials and Methods). Using anchor primer and NIS gene-specific primer (GSP1), we obtained the major PCR products, the size of which was about 150 bp. After isolation and subcloning, 10 positive clones were identified and sequenced. 5'-Ends of these clones were mapped as follows; -96 bp (five clones), -95 bp (three clones), and -93 bp (two clones). In these clones, we could not find any intronic sequence between their 5'-end and the ATG initiation codon.

Primer extension analysis was performed to validate the results from the RACE procedure. As shown in Fig. 2aGo, extension products were observed only with the FRTL-5 cell poly (A)+ RNA, but not with that of BRL-3A cells. The major transcriptional initiation sites were also mapped at -96, -95, and -93 bp.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 2. The Transcriptional Start Sites and 5'-Flanking Sequence of Rat NIS Gene

a, Primer extension analysis for determining the transcriptional start sites of the NIS gene. The end-labeled GSP-2 was hybridized to 10 µg poly(A)+ RNAs from BRL-3A (lane 1) and FRTL-5 (lane 2) cells. The primer was extended by AMV RT, and the products were analyzed on polyacrylamide gel. A sequence ladder, using the same primer, was run in parallel. The major transcription initiation sites are indicated by arrows. b, Nucleotide sequence of the 5'-flanking region of the rat NIS gene. The transcription start sites are indicated by arrows. TATA-like motif and GC box motif are marked by solid circles and dashed line, respectively.

 
Figure 2bGo shows the nucleotide sequence of 5'-flanking sequence (-400 to -1) of the NIS gene. The region is GC rich (62%), and a TATA-like sequence, AATAAAT, is located in -125 to -119 bp. Thirty base pairs further upstream, there exists a GC box motif (from -152 to -149 bp), but we could not find a consensus sequence for CRE or thyroid hormone response element in this portion.

These results indicate that the major start sites were -96, -95, and -93 bp. This conclusion is supported below by demonstrating that they are encompassed in a region with promoter activity.

Identification of Cell-Selective Promoter Activity in the 5'-Flanking Region of Rat NIS Gene
Chimeric constructs were made in which 1.9 kbp of the 5'-flanking region, or deletions thereof, were ligated to the luciferase reporter gene. By electroporation, each was transiently transfected into FRTL-5 and BRL-3A cells. The pNIS-Luc {Delta}-1968 expressed significant luciferase activity when transfected into FRTL-5 cells, compared with the promoterless control, pGL2 Basic (Fig. 3Go). The level of transient expression of pNIS-Luc {Delta}-1968 in BRL-3A cells was below 5% of that in FRTL-5 cells.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Promoter Activity of Rat NIS-Luciferase Chimeric Plasmids

Luciferase (Luc) activity in cell lysates from FRTL-5 ({blacksquare}) and BRL-3A({square}) cells 72 or 48 h, respectively, after transfection with the NIS-Luc deletion mutants as indicated. All cells were cotransfected with plasmid pCH110-ß Gal, and the transfection efficiency was normalized to ß-Gal. The activity is expressed as relative units of luciferase per unit of ß-galactosidase, and the values are the mean ± SE for three separate experiments.

 
5'-Deletion mutants, pNIS-Luc{Delta}-1550, which remove the sequence from -1968 to -1551 bp, showed similar activity to the pNIS-Luc {Delta}-1968 construct, but 5'-deletion mutants, pNIS-Luc {Delta}-1129, {Delta}-621, {Delta}-476, {Delta}-370, and {Delta}-291 expressed higher levels of luciferase activity, 1.8-, 3.5-, 4.2-, 3.5-, and 1.9-fold, respectively, than that of pNIS-Luc {Delta}-1968. However, further deletion of 5'-end pNIS-Luc{Delta}-134 showed little promoter activity. Therefore, the smallest region necessary for cell-selective promoter activity of rat NIS gene is -291 to -135 bp, and the region is encompassed by pNIS-Luc {Delta}-291.

TTF-1 Binds to the 5'-Flanking Region of NIS Gene and Stimulates Its Minimal Promoter Activity
Nuclear extracts from FRTL-5 cells as well as those from FRT or BRL-3A cells were incubated with a probe spanning nucleotides -290 to -185 bp, and the resultant complexes were evaluated in DNase I protection assay (Fig. 4aGo). Nuclear extracts from FRTL-5 cells protected the region between nucleotides -245 to -230 bp. In contrast, this region was not similarly protected by nuclear extracts from FRT cells, also derived from rat thyroid epithelial cells, which contain a trace amount of Pax-8 but not TTF-1 (15, 18, 20, 21, 22, 23), or BRL-3A cells.



View larger version (67K):
[in this window]
[in a new window]
 
Figure 4. DNase I Protection Assay of the Promoter Region of the Rat NIS Gene from -290 to -185 bp by Nuclear Extracts from FRTL-5, FRT, BRL-3A Cells, and TTF-1 HD Protein

a, Lane 1 contains the G + A ladder determined by Maxam and Gilbert sequence reaction. Lane 2 is unprotected probe digested with DNase I (Free). Other lanes contain the probe preincubated with nuclear extracts from FRTL-5 cells, FRT or BRL-3A cells, or BSA. b, Lane 1: G + A; lane 2, free; lane 3, nuclear extracts from FRTL-5 cells; lane 4, probe was preincubated with 50 ng bacterial expressed TTF-1 HD protein.

 
We then performed electrophoretic mobility shift assays (EMSAs) using oligonucleotides that contain the sequence protected by nuclear extracts from FRTL-5 cells. Oligo-W spanning -250 to -211 bp, which includes the protected area, formed a specific protein-DNA complex with extracts from FRTL-5 cells, but not with extracts from FRT or BRL-3A cells (Fig. 5aGo). Formation of the complex was inhibited by the homologous unlabeled oligonucleotide (self-competition) and also by Oligo-DS, which contains the TTF-1 binding site on a TSH-R promoter (18, 24) (Fig. 5bGo). Since the extracts from FRT cells do not contain TTF-1 and Oligo-DS interacts with TTF-1 but not with Pax-8 (18, 24), the results suggest that TTF-1 might be involved in the formation of the complex. Indeed, when the nuclear extracts from FRTL-5 cells were preincubated with antiserum to TTF-1, the complex was supershifted (Fig. 5cGo). Next, we prepared prokaryotic expressed and purified TTF-1 homeodomain (HD) to examine its binding ability to Oligo-W. TTF-1 HD protein formed a protein-DNA complex with the probe, and mutation of the putative TTF-1 binding sequence, GTTC, to GTGA eliminated TTF-1 HD binding (Fig. 5dGo). To confirm the TTF-1 binding ability to the region between nucleotides -245 to -230 bp, we repeated the DNase I protection assay using TTF-1 HD protein. TTF-1 HD protein also protected the region between -248 to -230 bp of the gene (Fig. 4bGo).



View larger version (53K):
[in this window]
[in a new window]
 
Figure 5. EMSAs with Oligo-W, Oligo-M, and Oligo-DS

a, Nuclear extracts from FRTL-5, FRT, and BRL-3A (BRL) were incubated with radiolabeled Oligo-W (wild type), which corresponds to -250 to -211 bp of the NIS gene. b, Nuclear extracts from FRTL-5 cells were incubated in the presence of unlabeled self-competitor (250-fold, lane 2), unlabeled Oligo-DS, which contains downstream TTF-1 binding site of TSH-R promoter (250-fold, lane 3), or absence of the competitor (lane 1). c, Radiolabeled Oligo-W was incubated in the absence (lane 1) or presence of anti-TTF-1 serum (1:250, lane 2) or preimmune serum (PIS) (1:250, lane 3). d, Ability of recombinant TTF-1 HD protein to form a protein-DNA complex with radiolabeled synthetic oligonucleotides, Oligo-W and Oligo-M. The recombinant TTF-1 HD protein (50 ng) was incubated with radiolabeled Oligo-W (lane 1) or with radiolabeled Oligo-M (mutant type). EMSAs were performed as described in Materials and Methods. Arrows on the left of each gel set denote the specific protein-DNA complexes and the arrow on the right is the up-shifted complex.

 
Next, to investigate whether TTF-1 is truly involved in the transcriptional expression mechanism of NIS gene, we cotransfected pRc/CMV-TTF-1 with pNIS-Luc {Delta}-291 into FRT cells. TTF-1 significantly increased the luciferase activity expressed by pNIS-Luc {Delta}-291 (Fig. 6aGo). However, when we also mutagenized the putative TTF-1-binding sequence, GTTC, to GTGA of pNIS-Luc {Delta}-291, TTF-1 failed to transactivate the mutated promoter (pNIS-Luc {Delta}-291 M) activity in FRT cells (Fig. 6bGo).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 6. Transactivation by TTF-1 of the pNIS-Luc {Delta}-291 or {Delta}-291 M in FRT Cells

a, pNIS-Luc {Delta}-291 (10 µg) spanning -291 to -36 bp of rat NIS genomic sequence was cotransfected with pRc/CMV-TTF-1 as indicated or the same amount of pRc/CMV in FRT cells. Luciferase activities are expressed in arbitrary units and presented as mean ± SE for three separate experiments. b, Ten micrograms of pNIS-Luc {Delta}-291 (wild), pNIS-Luc {Delta}-291 M (mutant), and pGL2 Basic (pGL2b) were cotransfected with 1 µg pRc/CMV-TTF-1 or pRc/CMV into FRT. All cells were cotransfected with pCH110-ß Gal to normalize the transfection efficiency. Significance of the increase of the activity is noted by one (P < 0.05) or two (P < 0.01) stars (*).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In the present report, the 5'-flanking region of the rat NIS gene has been isolated and characterized. Results of RACE as well as that of primer extension analysis revealed that the major transcription sites were mapped at -96, -95, and -93 bp relative to the ATG initiation codon. In the first report of rat NIS cDNA cloning, Dai et al. (10) stated that their cDNA had a 5'-untranslated region of 109 bp nucleotides. However, comparison of their published sequence with our genomic sequence of NIS suggests that the most 5'-end of their cDNA corresponds to -84 bp of the gene and that the further upstream sequence of the insert they cloned is probably some multiple cloning sequence. Therefore, the existence of transcription initiation sites in this locus is consistent with their report.

Sequential deletion mutants of rat NIS-luciferase chimeras have revealed that minimal promoter activity is encompassed within the sequence between -291 to -135 bp relative to the ATG codon. In addition, comparison of the minimal promoter activity in thyroid cells with that in the liver cells suggests that this region is important for cell-selective expression of NIS gene.

It has been reported that thyroid iodide transport activity is markedly stimulated by TSH and (Bu)2cAMP (4, 5, 6, 7). So, we searched for the existence of CRE in this portion. However, we could not find the CRE consensus or CRE-like sequence in this minimal promoter region and also in more upstream portion (from -2264 to -380 bp of the gene). Therefore, if TSH or (Bu)2cAMP stimulates the gene expression of NIS, it is likely that they enhance it via non-CRE-mediated mechanism.

Our additional concern is the thyroid-selective expression mechanism of rat NIS gene, because Dai et al. (10) identified NIS mRNA in the thyroid, but not in other tissues. In the thyroid, it has been revealed that genes of thyroid-specific proteins such as Tg, TPO, and TSH-R are regulated by TTF-1 and/or Pax-8 (11). In Tg and TPO promoters, overlapping binding sites for TTF-1 and Pax-8, dominated as site C, are similarly arranged, and both factors compete for their target promoters (14, 15), which leads to modulation of the ratio of Tg and TPO mRNAs depending on physiological requirement. Adjacent to the site C region is TTF-2, another thyroid-specific transcription factor binding sites in Tg and TPO promoters (21, 22, 23). TTF-2 is involved in hormonal regulation of the expression of these genes (25, 26). On the other hand, TSH-R gene transcribed not only in the thyroid but also in nonthyroidal tissues (27), and structure of TSH-R promoter is different from those of Tg and TPO promoters (16). The presence of only one binding site for TTF-1 and lack of binding sites for Pax-8 and TTF-2 suggest that molecular events responsible for the thyroid-specific expression of Tg and TPO do not operate in TSH-R gene in the thyroid. Recently, it has been reported that TTF-1 and other factors that interact with CRE are involved in the expression of TSH-R gene in the thyroid (28, 29).

These lines of evidence, as well as the previous report that not only thyroid glands, but also salivary glands and gastric mucosa possess iodide uptake activity (30), prompted us to study the structure of the NIS gene and also the role of TTF-1 in the tissue-selective expression mechanism of rat NIS gene in the thyroid. The results of EMSA and DNase I footprinting analysis, as well as that of cotransfection assay, have suggested that TTF-1 is also involved in the thyrocyte-selective expression mechanism of the NIS gene.

The DNA sequence of the NIS gene protected by DNase I and the results of EMSAs with Oligo-M (Fig. 5Go) suggest that the sequence 5'-GTTC-3' in the sense strand, accordingly, 5'-CAAG-3' in the antisense strand, spanning from -240 to -237 bp, is important for its TTF-1 binding. Damante et al. (31) identified the TTF-1 binding site as minimally CAAG (31) in the sense strand, but in no case 5'-GTTC-3'. Our data suggest, however, that 5'-CAAG-3' in the antisense strand has a binding ability to TTF-1.

However, TTF-1 exerts only a modest effect on NIS transcriptional activity, like that on TSH-R promoter (17, 18). In addition, the minimal promoter activity of NIS gene, pNIS-Luc {Delta}-291, in FRT cells is about 4-fold higher than in BRL-3A cells even in the absence of TTF-1 (data not shown). The results suggest the possibility that factor(s) other than TTF-1, as in the case of the TSH-R gene, might also be involved in the expression of NIS gene in the thyroid. Identification and characterization of these factors remain to be clarified.

It is well known that iodide deficiency or excess largely influences the thyroid function and induces variable pathological changes in the thyroid (1, 2). Furthermore, if differentiated thyroid cancer tissues retained iodide uptake activity, administration of 131I is very useful for their therapy (3). Very recently, we have demonstrated that autoantibody against NIS frequently exists in the sera from patients with autoimmune thyroid disease (32, 33). In these contexts, analysis of the expression mechanism of NIS might contribute to our further understanding of the role of iodide and its transporter in the pathophysiology of the various thyroid diseases.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cloning of Rat NIS Gene
EMBL3-liver genomic library (CLONTECH Lab. Inc. RL1022j, Palo Alto, CA) from adult male Sprague-Dawley rats was screened for NIS gene using 32P-labeled rat NIS cDNA that contains full coding sequence (10, 32). Positive clones were subcloned into pBluescript (Stratagene Cloning Systems, La Jolla, CA). Selected restriction fragments were further subcloned into pBluescript or M13 phage and sequenced by the dideoxynucleotide method.

RACE and Primer Extension Analysis
RACE was performed using 5'-RACE System [GIBCO BRL (Life Technologies, Inc., Gaithersburg, MD)] to determine the 5'-end of the NIS mRNA. Poly (A)+ RNA (2 µg) from FRTL-5 cells (16) cultured in the presence of TSH was used to synthesize the first strand cDNA with the first primer (GSP1) (5'-AAGTCGTCGGCACTGCGTTG). After TdT tailing of the cDNA, PCR amplification of dC-tailed cDNA was performed using anchor primer (5'-CUACUACUACUAGGCCACGCGTCGACTAGTACG GGIIGGGIIGGG IIG) and NIS-specific second primer, GSP2 (5'-TCGGATCCCTCCATGGAG ACAGGTGACT). PCR reaction was carried out at 94 C (1 min), 55 C (2 min), and 74 C (2 min) for 30 cycles using a Perkin-Elmer Cetus Thermal Cycler. PCR products were then ligated into pCR II vector (Invitrogen, San Diego, CA) and further subcloned into M13 phage for sequencing.

Primer extension analysis was performed as described previously (34) using GSP1 as a primer. The primer was labeled with [{gamma}-32P]ATP using T4 nucleotide kinase (Takara Shuzo Co., Tokyo, Japan). The primer was hybridized with Poly (A)+ RNA from FRTL-5 cells or BRL-3A rat liver cells (18) at 42 C overnight and extended with avian myeloblastosis virus (AMV) reverse transcriptase (Takara Shuzo Co.) for 2 h at 37 C. The resulting products were analyzed on 8% polyacrylamide-8.3 M urea gel in parallel with a sequencing reaction generated with the extension primer.

Reporter Plasmids and cDNA Expression Vectors
A 1932 bp SacI-AatII fragment (from -1968 to -36 bp) and MluI-AatII fragment (-624 to -36 bp) of rat NIS genomic upstream sequence were cloned to SacI-BglII and MluI-BglII sites of pGL2-Basic vector (Promega Co., Madison, WI) (these constructs are designated as pNIS-Luc {Delta}-1968 and pNIS-Luc {Delta}-621). pNIS-Luc {Delta}-1550 and {Delta}-1128 were obtained by internal deletion of pNIS-Luc {Delta}-1968, and pNIS-Luc {Delta}-476, -370, -291, and -134 were from pNIS-Luc {Delta}-621. The TTF-1 binding site on NIS promoter was mutagenized by PCR with the mismatched primers MP1(5'-GGGGTACCTATACGGAACAAGCCCTAGATGTGGGAGAAAGGGTCAGGA GACACGAGTGTGACCCCACCCCGAC), and MP2 (5'-GTACAGATCTGACGTCGGGGA CTCTCG GTC), to obtain the pNIS-Luc {Delta}-291 M construct. Rat TTF-1 cDNA ligated into pRc/CMV was kindly donated by Professor R. Di Lauro, Naples, Italy.

Recombinant TTF-1 HD, DNase I Protection Analysis and EMSA
The cDNA corresponding to the homeobox of TTF-1 (12) was amplified by PCR using oligos 5'-TATCTGCAGCACGCCGGAAGCGTCGGG-3' and 5'AGACAA GCTTCTGCTGCGCCGCC-3'. The amplified cDNA (222 bp) was cut with PstI and HindIII and cloned into pTrcHis B (Invitrogen). The cDNA encodes 68 amino acids of TTF-1 HD, which is the same as the recombinant TTF-1 HD reported by Guazzi et al. (12). The plasmid was then used to transform the BL21 pLysS strain. Recombinations were grown at 37 C, inducted by 1 mM isopropyl-ß-D-thiogalactopyranoside, and the protein was purified using ProBond column (Invitrogen).

DNase I protection analysis was performed as previously described (15). In brief, NIS genomic fragment from -290 to -185 bp was synthesized by PCR and was subcloned into pBluescript SK. After end-labeling with [a-32P]dCTP and Klenow fragment, the plasmid was cut with HindIII and was purified on 5% native polyacrylamide gel. For DNase I footprinting, 30 µg of nuclear extracts or 50 ng of TTF-1 HD were incubated for 15 min at room temperature in 25 mM HEPES/KOH at pH 7.6 containing 5 mM MgCl2, 34 mM KCl, and 1 µg poly(deoxyinosinic-deoxycytidylic)acid. Extracts were then incubated 20 min in the presence of the probe (50,000 cpm) in a 20 µl reaction volume. The DNA probe was digested with 1 U of DNase I (Promega) for 1 min at room temperature before the addition of 80 µl of stop solution (20 mM Tris-HCl, pH 8.0, 250 mM NaCl, 20 mM EDTA, 0.5% SDS, 10 µg proteinase K, and 4 µg sonicated calf thymus DNA). After incubation at 37 C for 15 min, the digested products were phenol extracted, ethanol precipitated, and separated on 8% sequencing gel.

Oligos used for EMSAs were as follows. Oligo-W (wild type): 5'-AGACAC GAGTGTTCCCCCACCCCGACTGCCCGCACCCCTG-3', which corresponds to -250 to -211 bp of the NIS gene; Oligo-M: 5'-AGACACGAGTGTGACCCCACCCCGACTG CCCGCACCCCTG-3', which is the mutant type of Oligo-W; Oligo-DS: 5'-GTTCG CCTCGTGAACTCTCGGAGAGG, which contains the sequence of the downstream TTF-1 binding site of the TSH-R promoter (19, 20). EMSAs were performed as described previously (18) as follows: 1 µg nuclear extract from FRTL-5, FRT, and BRL-3A cells or 50 ng recombinant TTF-1 HD were incubated in a 30 µl reaction volume for 20 min at room temperature, with or without unlabeled competitor oligonucleotides in the following buffer: 10 mM Tris-HCl, pH 7.6, 50 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 1 mM EDTA, 12.5% glycerol, 0.1% Triton X-100, and 1 µg poly(deoxyinosinic-deoxycytidylic)acid. End-labeled probe, 50,000 cpm (0.5 ng DNA), was added and incubated for an additional 20 min at room temperature. DNA-protein complexes were separated on 5% native polyacrylamide gel.

Nuclear extracts from FRTL-5, FRT, and BRL-3A cells were prepared as described (18). Antibody to TTF-1 was produced in rabbits by using purified recombinant partial rat TTF-1 residue, corresponding to 1 to 126 amino acids, expressed in bacteria with pGEX-2T (Pharmacia Biotech, Uppsala, Sweden) as an antigen. The ability and specificity of the antibody were reported previously (35).

Transfection and Luciferase Reporter Assay
FRTL-5 cells (ATCC CRL 8305) cultured in the presence or absence of TSH, FRT cells, and BRL-3A cells (ATCC CRL 14429) were grown to 80% confluency. FRT cells, which are known to contain Pax-8 but not TTF-1 (15, 18, 20, 21, 22, 23), were kindly donated from Dr. L. D. Kohn (NIH, Bethesda). These cells were transfected by an electroporation technique (Gene Pulser, Bio-Rad Laboratories, Hercules, CA). Ten milligrams of pNIS-Luc {Delta}-1968 or equivalent molar amount of the deletion mutant, or pGL2-Basic, were introduced into the cells together with pCH110 ß-Gal to correct for variability in transfection efficiency. Cells were pulsed (300 V for FRTL-5 and FRT cells; 270 V for BRL-3A cells, 960 µFarads), plated (6 x 106 cells per dish) and cultured for 72 h in the case of FRTL-5 cells or 48 h for FRT and BRL-3A cells. All transfections were carried out in triplicate batches using at least two different DNA preparations. Cells were lysed by three to four freez-thaw cycles and centrifuged at 4 C in a microfuge for 5 min. Luciferase assay was performed as described previously (36). ß-Galactosidase assay was carried out according to Sambrook et al. (34). Statistical analysis was performed by paired t test.


    FOOTNOTES
 
Address requests for reprints to: Toshimasa Onaya, Third Department of Internal Medicine, Yamanashi Medical University, Tamaho, Yamanashi 409–38, Japan.

Received for publication May 19, 1997. Accepted for publication July 28, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Vagenakis AG, Braverman LE 1975 Adverse effects of iodides on thyroid function. Med Clin North Am 59:1075–1088[Medline]
  2. Delange F 1994 The disorders induced by iodide deficiency. Thyroid 4:107–128[Medline]
  3. Krishnamurthy GT, Blahd WH 1977 Radioiodine I-131 therapy in the management of thyroid cancer. Cancer 40:195–202[CrossRef][Medline]
  4. Halmi N, Granner D, Doughman D, Peters B, Muller G 1959 Biphasic effect of TSH on thyroidal iodide collection in rats. Endocrinology 67:70–81
  5. Wilson B, Raghupathy E, Tonoue T, Tong W 1968 TSH-like actions of dibutyryl cAMP on isolated bovine thyroid cells. Endocrinology 83:877–884[Abstract/Free Full Text]
  6. Knopp J, Stolc V, Ting W 1970 Evidence for the induction of iodide transport in bovine thyroid cells treated with thyroid-stimulating hormone or dibutyryl cyclic adenosine 3', 5'-monophosphate. J Biol Chem 245:4403–4408[Abstract/Free Full Text]
  7. Weiss SJ, Philip NJ, Ambesi-Impiombato FS, Grollman EF 1984 Thyrotropin-stimulated iodide transport mediated by adenosine 3', 5'-monophosphate and dependent on protein synthesis. Endocrinology 114:4403–4408
  8. Carrasco N 1993 Iodide transport in the thyroid gland. Biochim Biophys Acta 1154:65–82[Medline]
  9. O’Neill B, Magnolato D, Semenza G 1987 The electrogenic, Na+-dependent I- transport system in plasma membrane vesicles from thyroid glands. Biochim Biophys Acta 896:263–274[Medline]
  10. Dai G, Levy O, Carrasco N 1996 Cloning and characterization of the thyroid iodide transporter. Nature 379:458–460[CrossRef][Medline]
  11. Damante G, Di Lauro R 1994 Thyroid-specific gene expression. Biochim Biophys Acta 1218:255–266[Medline]
  12. Guazzi S, Price M, De Felice M Damante G, Mattei M-G, Di Lauro R 1990 Thyroid nuclear factor 1 (TTF-1) contains a homeodomain and displays a novel DNA binding specificity. EMBO J 9:3631–3639[Medline]
  13. Lazzaro D, Price, M, De Felice M, Di Lauro R 1991 The transcription factor TTF-1 is expressed at the onset of thyroid and lung morphogenesis and restricted regions of the foetal brain. Development 113:1093–1104[Abstract]
  14. Plachov D, Chowdhury K, Walther C, Simon D, Guenet J-L, Gruss P 1990 Pax-8, a murine paired box gene expressed in the developing excretory system and thyroid gland. Development 110:1–11[Abstract]
  15. Zannini M, Fransis-Lang H, Plachov D, Di Lauro R 1992 Pax-8, a paired domain containing protein, binds to a sequence overlapping the recognition site of a homeodomain and activates transcription from two thyroid-specific promoters. Mol Cell Biol 12:4230–4241[Abstract/Free Full Text]
  16. Ikuyama S, Niller HH, Shimura H, Akamizu T, Kohn LD 1992 Characterization of the 5'-flanking region of the rat thyrotropin receptor gene. Mol Endocrinol 6:793–804[Abstract/Free Full Text]
  17. Civitareale D, Castelli MP, Falasca P, Saiardi A 1993 Thyroid transcription factor 1 activates the promoter of the thyrotropin receptor gene. Mol Endocrinol 7:1589–1559[Abstract/Free Full Text]
  18. Shimura H, Okajima F, Ikuyama S, Shimura Y, Kimura S, Saji M, Kohn LD 1994 Thyroid-specific expression and cyclic adenosine 3', 5' monophosphate autoregulation of the thyrotropin receptor gene involves thyroid transcription factor-1. Mol Endocrinol 8:1049–1069[Abstract/Free Full Text]
  19. Ambesi-Impiombato FS 1980 U.S. Patent No. 4,608,341
  20. Musti AM, Ursini VM, Avvedimento EV, Zimarino V, Di Lauro R 1987 A cell type specific factor recognizes the rat thyroglobulin promoter. Nucleic Acids Res 15:8149–8166[Abstract/Free Full Text]
  21. Civitareale D, Lonigro R, Sinclair AJ, Di Lauro R 1989 A thyroid-specific nuclear protein essential for tissue-specific expression of the thyroglobulin promoter. EMBO J 8:3537–2542
  22. Sinclair AJ, Lonigro R, Civitareale D, Ghibelli L, Di Lauro R 1990 The tissue-specific expression of the thyroglobulin gene requires interaction between thyroid-specific and ubiquitous factors. Eur J Biochem 193:311–318[Medline]
  23. Francis-Lang H, Price M, Polycarpou-Schwarz M, Di Lauro R 1992 Cell-type-specific expression of the rat thyroperoxidase promoter indicates common mechanisms for thyroid-specific gene expression. Mol Cel Biol 12:576–588[Abstract/Free Full Text]
  24. Ohmori M, Shimura H, Shimura Y, Ikuyama S, Kohn LD 1995 Characterization of an upstream thyroid transcription factor-1 binding site in the thyrotropin receptor promoter. Endocrinology 136:269–282[Abstract]
  25. Santisteban P, Acebron A, Polycarpou-Schwarz M, Di Lauro R 1992 Insulin and insulin-like growth factor I regulate a thyroid-specific nuclear protein that binds to thyroglobulin promoter. Mol Endocrinol 6:1310–1317[Abstract/Free Full Text]
  26. Aza-Blank P, Di Lauro R, Santisteban P 1993 Identification of a cis-regulatory element and a thyroid-specific nuclear factor mediating the hormonal regulation of rat thyroid peroxidase promoter activity. Mol Endocrinol 7:1297–1306[Abstract/Free Full Text]
  27. Endo T, Ohta K, Haraguchi K, Oanaya T 1995 Cloning and functional expression of a thyrotropin receptor cDNA from rat fat cells. J Biol Chem 270:10833–10837[Abstract/Free Full Text]
  28. Shimura H, Shimura Y, Ohmori M, Ikuyama S, Kohn LD 1995 Single strand DNA binding proteins and thyroid transcription factor-1 cojointly regulate thyrotropin receptor gene expression. Mol Endocrinol 9:527–539[Abstract/Free Full Text]
  29. Ohmori M, Ohta M, Shimura H, Shimura Y, Suzuki K, Kohn LD 1996 Cloning of the single strand DNA-binding protein important for maximal expression and thyrotropin(TSH)-induced negative regulation of the TSH receptor. Mol Endocrinol 10:1407–1424[Abstract/Free Full Text]
  30. Wolff J 1964 Transport of iodide and other anions in the thyroid gland. Physiol Rev 44:45–90[Free Full Text]
  31. Damante G, Fabbro D, Pellizzari L, Guazzi S, Polycarpou-Schwartz M, Cauci S, Quadrifoglio S, Di Lauro R 1994 Sequence-specific DNA recognition by thyroid transcription factor-1 homeodomain. Nucleic Acids Res 22:3075–3083[Abstract/Free Full Text]
  32. Endo T, Kogai T, Nakazato M, Saito T, Kaneshige M, Onaya T 1996 Autoantibody against Na-/I-symporter in the sera of patients with autoimmune thyroid disease. Biochem Biophys Res Commun 224:92–95[CrossRef][Medline]
  33. Endo T, Kaneshige M, Nakazato M, Kogai T, Saito T, Onaya T 1996 Autoantibody against thyroid iodide transporter in the sera from patients with Hashimoto’s thyroiditis possesses iodide transport inhibitory activity. Biochem Biophys Res Commun 228:199–202[CrossRef][Medline]
  34. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning-A Laboratory Manual, ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  35. Saito T, Endo T, Nakazato M, Kogai T, Onaya T 1997 Thyroid-stumulating hormone-induced down regulation of thyroid transcription factor 1 in rat thyroid FRTL-5 cells. Endocrinology 138:602–606[Abstract/Free Full Text]
  36. de Wet JR, Wood KV, DeLuca M, Helsinki DR, Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells. Mol Cell Biol 7:725–737[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
S. Hoshi, N. Hoshi, M. Okamoto, J. Paiz, T. Kusakabe, J. M. Ward, and S. Kimura
Role of NKX2-1 in N-bis(2-hydroxypropyl)-nitrosamine-induced thyroid adenoma in mice
Carcinogenesis, September 1, 2009; 30(9): 1614 - 1619.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H.-D. Song, J. Liang, J.-Y. Shi, S.-X. Zhao, Z. Liu, J.-J. Zhao, Y.-D. Peng, G.-Q. Gao, J. Tao, C.-M. Pan, et al.
Functional SNPs in the SCGB3A2 promoter are associated with susceptibility to Graves' disease
Hum. Mol. Genet., March 15, 2009; 18(6): 1156 - 1170.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
T. Kogai, S. Sajid-Crockett, L. S Newmarch, Y.-Y. Liu, and G. A Brent
Phosphoinositide-3-kinase inhibition induces sodium/iodide symporter expression in rat thyroid cells and human papillary thyroid cancer cells
J. Endocrinol., November 1, 2008; 199(2): 243 - 252.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. S. Fenton, K. M. Marion, and J. M. Hershman
Identification of Cyclic Adenosine 3',5'-Monophosphate Response Element Modulator as an Activator of the Human Sodium/Iodide Symporter Upstream Enhancer
Endocrinology, May 1, 2008; 149(5): 2592 - 2606.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
L. Fozzatti, M. L Velez, A. M Lucero, J. P Nicola, I. D Mascanfroni, D. R Maccio, C. G Pellizas, G. A Roth, and A. M Masini-Repiso
Endogenous thyrocyte-produced nitric oxide inhibits iodide uptake and thyroid-specific gene expression in FRTL-5 thyroid cells
J. Endocrinol., March 1, 2007; 192(3): 627 - 637.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
G. Riesco-Eizaguirre and P. Santisteban
A perspective view of sodium iodide symporter research and its clinical implications.
Eur. J. Endocrinol., October 1, 2006; 155(4): 495 - 512.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
T Kogai, K Taki, and G A Brent
Enhancement of sodium/iodide symporter expression in thyroid and breast cancer.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 797 - 826.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Kusakabe, A. Kawaguchi, N. Hoshi, R. Kawaguchi, S. Hoshi, and S. Kimura
Thyroid-Specific Enhancer-Binding Protein/NKX2.1 Is Required for the Maintenance of Ordered Architecture and Function of the Differentiated Thyroid
Mol. Endocrinol., August 1, 2006; 20(8): 1796 - 1809.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
R. Opitz, A. Trubiroha, C. Lorenz, I. Lutz, S. Hartmann, T. Blank, T. Braunbeck, and W. Kloas
Expression of sodium-iodide symporter mRNA in the thyroid gland of Xenopus laevis tadpoles: developmental expression, effects of antithyroidal compounds, and regulation by TSH.
J. Endocrinol., July 1, 2006; 190(1): 157 - 170.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. L. Velez, E. Costamagna, E. T. Kimura, L. Fozzatti, C. G. Pellizas, M. M. Montesinos, A. M. Lucero, A. H. Coleoni, P. Santisteban, and A. M. Masini-Repiso
Bacterial Lipopolysaccharide Stimulates the Thyrotropin-Dependent Thyroglobulin Gene Expression at the Transcriptional Level by Involving the Transcription Factors Thyroid Transcription Factor-1 and Paired Box Domain Transcription Factor 8
Endocrinology, July 1, 2006; 147(7): 3260 - 3275.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Srisodsai, R. Kurotani, Y. Chiba, F. Sheikh, H. A. Young, R. P. Donnelly, and S. Kimura
Interleukin-10 Induces Uteroglobin-related Protein (UGRP) 1 Gene Expression in Lung Epithelial Cells through Homeodomain Transcription Factor T/EBP/NKX2.1
J. Biol. Chem., December 24, 2004; 279(52): 54358 - 54368.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. T. Chun, V. Di Dato, B. D'Andrea, M. Zannini, and R. Di Lauro
The CRE-Like Element Inside the 5'-Upstream Region of the Rat Sodium/Iodide Symporter Gene Interacts with Diverse Classes of b-Zip Molecules that Regulate Transcriptional Activities through Strong Synergy with Pax-8
Mol. Endocrinol., November 1, 2004; 18(11): 2817 - 2829.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Furuya, H. Shimura, A. Miyazaki, K. Taki, K. Ohta, K. Haraguchi, T. Onaya, T. Endo, and T. Kobayashi
Adenovirus-Mediated Transfer of Thyroid Transcription Factor-1 Induces Radioiodide Organification and Retention in Thyroid Cancer Cells
Endocrinology, November 1, 2004; 145(11): 5397 - 5405.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Dentice, C. Luongo, A. Elefante, R. Romino, R. Ambrosio, M. Vitale, G. Rossi, G. Fenzi, and D. Salvatore
Transcription Factor Nkx-2.5 Induces Sodium/Iodide Symporter Gene Expression and Participates in Retinoic Acid- and Lactation-Induced Transcription in Mammary Cells
Mol. Cell. Biol., September 15, 2004; 24(18): 7863 - 7877.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Furuya, H. Shimura, H. Suzuki, K. Taki, K. Ohta, K. Haraguchi, T. Onaya, T. Endo, and T. Kobayashi
Histone Deacetylase Inhibitors Restore Radioiodide Uptake and Retention in Poorly Differentiated and Anaplastic Thyroid Cancer Cells by Expression of the Sodium/Iodide Symporter Thyroperoxidase and Thyroglobulin
Endocrinology, June 1, 2004; 145(6): 2865 - 2875.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-S. Park, J. A. Whitsett, T. Di Palma, J.-H. Hong, M. B. Yaffe, and M. Zannini
TAZ Interacts with TTF-1 and Regulates Expression of Surfactant Protein-C
J. Biol. Chem., April 23, 2004; 279(17): 17384 - 17390.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Costamagna, B. Garcia, and P. Santisteban
The Functional Interaction between the Paired Domain Transcription Factor Pax8 and Smad3 Is Involved in Transforming Growth Factor-{beta} Repression of the Sodium/Iodide Symporter Gene
J. Biol. Chem., January 30, 2004; 279(5): 3439 - 3446.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. C. Moeller, S. Kimura, T. Kusakabe, X.-H. Liao, J. Van Sande, and S. Refetoff
Hypothyroidism in Thyroid Transcription Factor 1 Haploinsufficiency Is Caused by Reduced Expression of the Thyroid-Stimulating Hormone Receptor
Mol. Endocrinol., November 1, 2003; 17(11): 2295 - 2302.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
O. Dohan, A. De la Vieja, V. Paroder, C. Riedel, M. Artani, M. Reed, C. S. Ginter, and N. Carrasco
The Sodium/Iodide Symporter (NIS): Characterization, Regulation, and Medical Significance
Endocr. Rev., February 1, 2003; 24(1): 48 - 77.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Taki, T. Kogai, Y. Kanamoto, J. M. Hershman, and G. A. Brent
A Thyroid-Specific Far-Upstream Enhancer in the Human Sodium/Iodide Symporter Gene Requires Pax-8 Binding and Cyclic Adenosine 3',5'-Monophosphate Response Element-Like Sequence Binding Proteins for Full Activity and Is Differentially Regulated in Normal and Thyroid Cancer Cells
Mol. Endocrinol., October 1, 2002; 16(10): 2266 - 2282.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L.-H. Wang, R. Chmelik, and M. Nirenberg
Sequence-specific DNA binding by the vnd/NK-2 homeodomain of Drosophila
PNAS, October 1, 2002; 99(20): 12721 - 12726.
[Abstract] [Full Text] [PDF]


Home page
Vet PatholHome page
J. A. Ramos-Vara, M. A. Miller, G. C. Johnson, and L. W. Pace
Immunohistochemical Detection of Thyroid Transcription Factor-1, Thyroglobulin, and Calcitonin in Canine Normal, Hyperplastic, and Neoplastic Thyroid Gland
Vet. Pathol., July 1, 2002; 39(4): 480 - 487.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. Garcia and P. Santisteban
PI3K Is Involved in the IGF-I Inhibition of TSH-Induced Sodium/Iodide Symporter Gene Expression
Mol. Endocrinol., February 1, 2002; 16(2): 342 - 352.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Tonacchera, P. Viacava, P. Agretti, G. de Marco, A. Perri, C. di Cosmo, M. de Servi, P. Miccoli, F. Lippi, A. G. Naccarato, et al.
Benign Nonfunctioning Thyroid Adenomas Are Characterized by a Defective Targeting to Cell Membrane or a Reduced Expression of the Sodium Iodide Symporter Protein
J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 352 - 357.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Niimi, K. Nagashima, J. M. Ward, P. Minoo, D. B. Zimonjic, N. C. Popescu, and S. Kimura
claudin-18, a Novel Downstream Target Gene for the T/EBP/NKX2.1 Homeodomain Transcription Factor, Encodes Lung- and Stomach-Specific Isoforms through Alternative Splicing
Mol. Cell. Biol., November 1, 2001; 21(21): 7380 - 7390.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Niimi, C. L. Keck-Waggoner, N. C. Popescu, Y. Zhou, R. C. Levitt, and S. Kimura
UGRP1, a Uteroglobin/Clara Cell Secretory Protein-Related Protein, Is a Novel Lung-Enriched Downstream Target Gene for the T/EBP/NKX2.1 Homeodomain Transcription Factor
Mol. Endocrinol., November 1, 2001; 15(11): 2021 - 2036.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Kogai, J. M. Hershman, K. Motomura, T. Endo, T. Onaya, and G. A. Brent
Differential Regulation of the Human Sodium/Iodide Symporter Gene Promoter in Papillary Thyroid Carcinoma Cell Lines and Normal Thyroid Cells
Endocrinology, August 1, 2001; 142(8): 3369 - 3379.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Shimura, H. Suzuki, A. Miyazaki, F. Furuya, K. Ohta, K. Haraguchi, T. Endo, and T. Onaya
Transcriptional Activation of the Thyroglobulin Promoter Directing Suicide Gene Expression by Thyroid Transcription Factor-1 in Thyroid Cancer Cells
Cancer Res., May 1, 2001; 61(9): 3640 - 3646.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
B. Gereben, D. Salvatore, J. W. Harney, H. M. Tu, and P. R. Larsen
The Human, but Not Rat, dio2 Gene Is Stimulated by Thyroid Transcription Factor-1 (TTF-1)
Mol. Endocrinol., January 1, 2001; 15(1): 112 - 124.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
M. Nakazato, H.-K. Chung, L. Ulianich, A. Grassadonia, K. Suzuki, and L. D. Kohn
Thyroglobulin Repression of Thyroid Transcription Factor 1 (TTF-1) Gene Expression Is Mediated by Decreased DNA Binding of Nuclear Factor I Proteins Which Control Constitutive TTF-1 Expression
Mol. Cell. Biol., November 15, 2000; 20(22): 8499 - 8512.
[Abstract] [Full Text]


Home page
Physiol. Rev.Home page
A. De la Vieja, O. Dohan, O. Levy, and N. Carrasco
Molecular Analysis of the Sodium/Iodide Symporter: Impact on Thyroid and Extrathyroid Pathophysiology
Physiol Rev, July 1, 2000; 80(3): 1083 - 1105.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Losada, J. A. Tovar, H. M. Xia, J. A. Diez-Pardo, and P. Santisteban
Down-Regulation of Thyroid Transcription Factor-1 Gene Expression in Fetal Lung Hypoplasia Is Restored by Glucocorticoids
Endocrinology, June 1, 2000; 141(6): 2166 - 2173.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Missero, M. T. Pirro, and R. Di Lauro
Multiple Ras Downstream Pathways Mediate Functional Repression of the Homeobox Gene Product TTF-1
Mol. Cell. Biol., April 15, 2000; 20(8): 2783 - 2793.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Spitzweg, W. Joba, K. Schriever, J. R. Goellner, J. C. Morris, and A. E. Heufelder
Analysis of Human Sodium Iodide Symporter Immunoreactivity in Human Exocrine Glands
J. Clin. Endocrinol. Metab., November 1, 1999; 84(11): 4178 - 4184.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
K. Suzuki, A. Mori, J. Saito, E. Moriyama, L. Ullianich, and L. D. Kohn
Follicular Thyroglobulin Suppresses Iodide Uptake by Suppressing Expression of the Sodium/Iodide Symporter Gene
Endocrinology, November 1, 1999; 140(11): 5422 - 5430.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
M. Ohmori, N. Harii, T. Endo, and T. Onaya
Tumor Necrosis Factor-{alpha} Regulation of Thyroid Transcription Factor-1 and Pax-8 in Rat Thyroid FRTL-5 Cells
Endocrinology, October 1, 1999; 140(10): 4651 - 4658.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
L. Ulianich, K. Suzuki, A. Mori, M. Nakazato, M. Pietrarelli, P. Goldsmith, F. Pacifico, E. Consiglio, S. Formisano, and L. D. Kohn
Follicular Thyroglobulin (TG) Suppression of Thyroid-restricted Genes Involves the Apical Membrane Asialoglycoprotein Receptor and TG Phosphorylation
J. Biol. Chem., August 27, 1999; 274(35): 25099 - 25107.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Spitzweg, S. Zhang, E. R. Bergert, M. R. Castro, B. McIver, A. E. Heufelder, D. J. Tindall, C. Y. F. Young, and J. C. Morris
Prostate-specific Antigen (PSA) Promoter-driven Androgen-inducible Expression of Sodium Iodide Symporter in Prostate Cancer Cell Lines
Cancer Res., May 1, 1999; 59(9): 2136 - 2141.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Ohno, M. Zannini, O. Levy, N. Carrasco, and R. di Lauro
The Paired-Domain Transcription Factor Pax8 Binds to the Upstream Enhancer of the Rat Sodium/Iodide Symporter Gene and Participates in Both Thyroid-Specific and Cyclic-AMP-Dependent Transcription
Mol. Cell. Biol., March 1, 1999; 19(3): 2051 - 2060.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. R. Shaw-White, M. D. Bruno, and J. A. Whitsett
GATA-6 Activates Transcription of Thyroid Transcription Factor-1
J. Biol. Chem., January 29, 1999; 274(5): 2658 - 2664.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Suzuki, S. Lavaroni, A. Mori, F. Okajima, S. Kimura, R. Katoh, A. Kawaoi, and L. D. Kohn
Thyroid Transcription Factor 1 Is Calcium Modulated and Coordinately Regulates Genes Involved in Calcium Homeostasis in C Cells
Mol. Cell. Biol., December 1, 1998; 18(12): 7410 - 7422.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
K.-Y. Ryu, Q. Tong, and S. M. Jhiang
Promoter Characterization of the Human Na+/I- Symporter
J. Clin. Endocrinol. Metab., September 1, 1998; 83(9): 3247 - 3251.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Suzuki, S. Lavaroni, A. Mori, M. Ohta, J. Saito, M. Pietrarelli, D. S. Singer, S. Kimura, R. Katoh, A. Kawaoi, et al.
Autoregulation of thyroid-specific gene transcription by thyroglobulin
PNAS, July 7, 1998; 95(14): 8251 - 8256.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. A. Velasco, A. Acebron, M. Zannini, J. MartIn-Perez, R. Di Lauro, and P. Santisteban
Ha-ras Interference with Thyroid Cell Differentiation Is Associated with a Down-Regulation of Thyroid Transcription Factor-1 Phosphorylation
Endocrinology, June 1, 1998; 139(6): 2796 - 2802.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Ohmori, T. Endo, N. Harii, and T. Onaya
A Novel Thyroid Transcription Factor Is Essential for Thyrotropin-Induced Up-Regulation of Na+/I- Symporter Gene Expression
Mol. Endocrinol., May 1, 1998; 12(5): 727 - 736.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Spitzweg, W. Joba, W. Eisenmenger, and A. E. Heufelder
Analysis of Human Sodium Iodide Symporter Gene Expression in Extrathyroidal Tissues and Cloning of Its Complementary Deoxyribonucleic Acids from Salivary Gland, Mammary Gland, and Gastric Mucosa
J. Clin. Endocrinol. Metab., May 1, 1998; 83(5): 1746 - 1751.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
C. Missero, M. T. Pirro, S. Simeone, M. Pischetola, and R. Di Lauro
The DNA Glycosylase T:G Mismatch-specific Thymine DNA Glycosylase Represses Thyroid Transcription Factor-1-activated Transcription
J. Biol. Chem., August 31, 2001; 276(36): 33569 - 33575.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Kogai, J. J. Schultz, L. S. Johnson, M. Huang, and G. A. Brent
Retinoic acid induces sodium/iodide symporter gene expression and radioiodide uptake in the MCF-7 breast cancer cell line
PNAS, July 18, 2000; 97(15): 8519 - 8524.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Endo, T.
Right arrow Articles by Onaya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Endo, T.
Right arrow Articles by Onaya, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals