| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Third Department of Internal Medicine, Yamanashi Medical University, Tamaho, Yamanashi 40938, Japan
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Very recently, Dai et al. (10) succeeded in cloning of rat NIS cDNA and have revealed that it encodes an intrinsic membrane protein with 12 putative transmembrane domains (10). By Northern analysis, they identified NIS mRNA in the thyroid, but not in the liver, kidney, intestine, brain, or heart, suggesting that the gene is primarily expressed in thyrocytes.
Recent studies have revealed that three genes encoding thyroid-specific proteins, thyroglobulin (Tg), thyroid peroxidase (TPO), and TSH receptor (TSH-R), are regulated by thyroid transcription factor-1 (TTF-1) and/or Pax-8 (11). TTF-1, which belongs to a family of homeobox-containing genes in Drosophila NK2 protein (12), is expressed in adult rat thyroid, lung, and restricted regions of the forebrain (13). Pax-8, a member of the murine family of paired box-containing genes (Pax genes), is present in adult rat thyroid and kidney (14). Therefore, simultaneous presence of TTF-1 and Pax-8 is a specific feature of thyroid follicular cells (11).
The structures of Tg and TPO promoters are very similar to each other. TTF-1 and Pax-8 bind to some specific region, site C, of both promoters, and DNA sequences recognized by both factors largely overlap (11). It has been believed that TTF-1 and Pax-8 could be used as alternatives to each other depending on functional requirements of Tg and TPO promoters (15). On the other hand, the structure of TSH-R promoter is different from that of Tg and TPO (16). TSH-R promoter lacks the Pax-8-binding site, and the gene expression depends on TTF-1 and other factors that interact with cAMP response element (CRE) (17, 18).
To investigate the structure and function of NIS gene, we have isolated rat NIS gene, defined its transcription start sites, and determined its promoter region. We also studied cell-selective expression mechanism of NIS gene in thyrocytes.
| RESULTS |
|---|
|
|
|---|
|
Determination of the Transcriptional Start Sites
To identify the transcriptional start sites of NIS gene, we at
first performed a rapid amplification of cDNA ends (RACE) procedure
using mRNA from functional rat thyroid cells, FRTL-5 (19) (see
Materials and Methods). Using anchor primer and NIS
gene-specific primer (GSP1), we obtained the major PCR products, the
size of which was about 150 bp. After isolation and subcloning, 10
positive clones were identified and sequenced. 5'-Ends of these clones
were mapped as follows; -96 bp (five clones), -95 bp (three clones),
and -93 bp (two clones). In these clones, we could not find any
intronic sequence between their 5'-end and the ATG initiation
codon.
Primer extension analysis was performed to validate the results from
the RACE procedure. As shown in Fig. 2a
, extension products were observed only with the FRTL-5 cell poly
(A)+ RNA, but not with that of BRL-3A cells. The major
transcriptional initiation sites were also mapped at -96, -95, and
-93 bp.
|
These results indicate that the major start sites were -96, -95, and -93 bp. This conclusion is supported below by demonstrating that they are encompassed in a region with promoter activity.
Identification of Cell-Selective Promoter Activity in the
5'-Flanking Region of Rat NIS Gene
Chimeric constructs were made in which 1.9 kbp of the 5'-flanking
region, or deletions thereof, were ligated to the luciferase reporter
gene. By electroporation, each was transiently transfected into FRTL-5
and BRL-3A cells. The pNIS-Luc
-1968 expressed significant
luciferase activity when transfected into FRTL-5 cells, compared with
the promoterless control, pGL2 Basic (Fig. 3
). The level of transient expression of
pNIS-Luc
-1968 in BRL-3A cells was below 5% of that in FRTL-5
cells.
|
-1550, which remove the sequence
from -1968 to -1551 bp, showed similar activity to the pNIS-Luc
-1968 construct, but 5'-deletion mutants, pNIS-Luc
-1129,
-621,
-476,
-370, and
-291 expressed higher levels of
luciferase activity, 1.8-, 3.5-, 4.2-, 3.5-, and 1.9-fold,
respectively, than that of pNIS-Luc
-1968. However, further deletion
of 5'-end pNIS-Luc
-134 showed little promoter activity. Therefore,
the smallest region necessary for cell-selective promoter activity of
rat NIS gene is -291 to -135 bp, and the region is encompassed by
pNIS-Luc
-291.
TTF-1 Binds to the 5'-Flanking Region of NIS Gene and
Stimulates Its Minimal Promoter Activity
Nuclear extracts from FRTL-5 cells as well as those from
FRT or BRL-3A cells were incubated with a probe spanning nucleotides
-290 to -185 bp, and the resultant complexes were evaluated in DNase
I protection assay (Fig. 4a
). Nuclear
extracts from FRTL-5 cells protected the region between nucleotides
-245 to -230 bp. In contrast, this region was not similarly protected
by nuclear extracts from FRT cells, also derived from rat thyroid
epithelial cells, which contain a trace amount of Pax-8 but not TTF-1
(15, 18, 20, 21, 22, 23), or BRL-3A cells.
|
|
-291 into FRT cells. TTF-1 significantly
increased the luciferase activity expressed by pNIS-Luc
-291 (Fig. 6a
-291,
TTF-1 failed to transactivate the mutated promoter (pNIS-Luc
-291
M) activity in FRT cells (Fig. 6b
|
| DISCUSSION |
|---|
|
|
|---|
Sequential deletion mutants of rat NIS-luciferase chimeras have revealed that minimal promoter activity is encompassed within the sequence between -291 to -135 bp relative to the ATG codon. In addition, comparison of the minimal promoter activity in thyroid cells with that in the liver cells suggests that this region is important for cell-selective expression of NIS gene.
It has been reported that thyroid iodide transport activity is markedly stimulated by TSH and (Bu)2cAMP (4, 5, 6, 7). So, we searched for the existence of CRE in this portion. However, we could not find the CRE consensus or CRE-like sequence in this minimal promoter region and also in more upstream portion (from -2264 to -380 bp of the gene). Therefore, if TSH or (Bu)2cAMP stimulates the gene expression of NIS, it is likely that they enhance it via non-CRE-mediated mechanism.
Our additional concern is the thyroid-selective expression mechanism of rat NIS gene, because Dai et al. (10) identified NIS mRNA in the thyroid, but not in other tissues. In the thyroid, it has been revealed that genes of thyroid-specific proteins such as Tg, TPO, and TSH-R are regulated by TTF-1 and/or Pax-8 (11). In Tg and TPO promoters, overlapping binding sites for TTF-1 and Pax-8, dominated as site C, are similarly arranged, and both factors compete for their target promoters (14, 15), which leads to modulation of the ratio of Tg and TPO mRNAs depending on physiological requirement. Adjacent to the site C region is TTF-2, another thyroid-specific transcription factor binding sites in Tg and TPO promoters (21, 22, 23). TTF-2 is involved in hormonal regulation of the expression of these genes (25, 26). On the other hand, TSH-R gene transcribed not only in the thyroid but also in nonthyroidal tissues (27), and structure of TSH-R promoter is different from those of Tg and TPO promoters (16). The presence of only one binding site for TTF-1 and lack of binding sites for Pax-8 and TTF-2 suggest that molecular events responsible for the thyroid-specific expression of Tg and TPO do not operate in TSH-R gene in the thyroid. Recently, it has been reported that TTF-1 and other factors that interact with CRE are involved in the expression of TSH-R gene in the thyroid (28, 29).
These lines of evidence, as well as the previous report that not only thyroid glands, but also salivary glands and gastric mucosa possess iodide uptake activity (30), prompted us to study the structure of the NIS gene and also the role of TTF-1 in the tissue-selective expression mechanism of rat NIS gene in the thyroid. The results of EMSA and DNase I footprinting analysis, as well as that of cotransfection assay, have suggested that TTF-1 is also involved in the thyrocyte-selective expression mechanism of the NIS gene.
The DNA sequence of the NIS gene protected by DNase I and the results
of EMSAs with Oligo-M (Fig. 5
) suggest that the sequence 5'-GTTC-3' in
the sense strand, accordingly, 5'-CAAG-3' in the antisense strand,
spanning from -240 to -237 bp, is important for its TTF-1 binding.
Damante et al. (31) identified the TTF-1 binding site as
minimally CAAG (31) in the sense strand, but in no case 5'-GTTC-3'. Our
data suggest, however, that 5'-CAAG-3' in the antisense strand has a
binding ability to TTF-1.
However, TTF-1 exerts only a modest effect on NIS transcriptional
activity, like that on TSH-R promoter (17, 18). In addition, the
minimal promoter activity of NIS gene, pNIS-Luc
-291, in FRT cells
is about 4-fold higher than in BRL-3A cells even in the absence of
TTF-1 (data not shown). The results suggest the possibility that
factor(s) other than TTF-1, as in the case of the TSH-R gene, might
also be involved in the expression of NIS gene in the thyroid.
Identification and characterization of these factors remain to be
clarified.
It is well known that iodide deficiency or excess largely influences the thyroid function and induces variable pathological changes in the thyroid (1, 2). Furthermore, if differentiated thyroid cancer tissues retained iodide uptake activity, administration of 131I is very useful for their therapy (3). Very recently, we have demonstrated that autoantibody against NIS frequently exists in the sera from patients with autoimmune thyroid disease (32, 33). In these contexts, analysis of the expression mechanism of NIS might contribute to our further understanding of the role of iodide and its transporter in the pathophysiology of the various thyroid diseases.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RACE and Primer Extension Analysis
RACE was performed using 5'-RACE System [GIBCO BRL (Life
Technologies, Inc., Gaithersburg, MD)] to determine the 5'-end of the
NIS mRNA. Poly (A)+ RNA (2 µg) from FRTL-5 cells (16)
cultured in the presence of TSH was used to synthesize the first strand
cDNA with the first primer (GSP1) (5'-AAGTCGTCGGCACTGCGTTG). After TdT
tailing of the cDNA, PCR amplification of dC-tailed cDNA was performed
using anchor primer (5'-CUACUACUACUAGGCCACGCGTCGACTAGTACG
GGIIGGGIIGGG IIG) and NIS-specific second primer, GSP2
(5'-TCGGATCCCTCCATGGAG ACAGGTGACT). PCR reaction was carried out at 94
C (1 min), 55 C (2 min), and 74 C (2 min) for 30 cycles using a
Perkin-Elmer Cetus Thermal Cycler. PCR products were then ligated into
pCR II vector (Invitrogen, San Diego, CA) and further subcloned into
M13 phage for sequencing.
Primer extension analysis was performed as described previously (34)
using GSP1 as a primer. The primer was labeled with
[
-32P]ATP using T4 nucleotide kinase (Takara Shuzo
Co., Tokyo, Japan). The primer was hybridized with Poly
(A)+ RNA from FRTL-5 cells or BRL-3A rat liver cells (18)
at 42 C overnight and extended with avian myeloblastosis virus (AMV)
reverse transcriptase (Takara Shuzo Co.) for 2 h at 37 C. The
resulting products were analyzed on 8% polyacrylamide-8.3
M urea gel in parallel with a sequencing reaction generated
with the extension primer.
Reporter Plasmids and cDNA Expression Vectors
A 1932 bp SacI-AatII fragment (from -1968
to -36 bp) and MluI-AatII fragment (-624 to
-36 bp) of rat NIS genomic upstream sequence were cloned to
SacI-BglII and MluI-BglII
sites of pGL2-Basic vector (Promega Co., Madison, WI) (these constructs
are designated as pNIS-Luc
-1968 and pNIS-Luc
-621). pNIS-Luc
-1550 and
-1128 were obtained by internal deletion of pNIS-Luc
-1968, and pNIS-Luc
-476, -370, -291, and -134 were from pNIS-Luc
-621. The TTF-1 binding site on NIS promoter was mutagenized by PCR
with the mismatched primers
MP1(5'-GGGGTACCTATACGGAACAAGCCCTAGATGTGGGAGAAAGGGTCAGGA
GACACGAGTGTGACCCCACCCCGAC), and MP2 (5'-GTACAGATCTGACGTCGGGGA
CTCTCG GTC), to obtain the pNIS-Luc
-291 M
construct. Rat TTF-1 cDNA ligated into pRc/CMV was kindly donated by
Professor R. Di Lauro, Naples, Italy.
Recombinant TTF-1 HD, DNase I Protection Analysis and EMSA
The cDNA corresponding to the homeobox of TTF-1 (12) was
amplified by PCR using oligos 5'-TATCTGCAGCACGCCGGAAGCGTCGGG-3' and
5'AGACAA GCTTCTGCTGCGCCGCC-3'. The amplified cDNA (222 bp) was cut with
PstI and HindIII and cloned into pTrcHis B
(Invitrogen). The cDNA encodes 68 amino acids of TTF-1 HD, which is the
same as the recombinant TTF-1 HD reported by Guazzi et al.
(12). The plasmid was then used to transform the BL21 pLysS strain.
Recombinations were grown at 37 C, inducted by 1 mM
isopropyl-ß-D-thiogalactopyranoside, and the protein was
purified using ProBond column (Invitrogen).
DNase I protection analysis was performed as previously described (15). In brief, NIS genomic fragment from -290 to -185 bp was synthesized by PCR and was subcloned into pBluescript SK. After end-labeling with [a-32P]dCTP and Klenow fragment, the plasmid was cut with HindIII and was purified on 5% native polyacrylamide gel. For DNase I footprinting, 30 µg of nuclear extracts or 50 ng of TTF-1 HD were incubated for 15 min at room temperature in 25 mM HEPES/KOH at pH 7.6 containing 5 mM MgCl2, 34 mM KCl, and 1 µg poly(deoxyinosinic-deoxycytidylic)acid. Extracts were then incubated 20 min in the presence of the probe (50,000 cpm) in a 20 µl reaction volume. The DNA probe was digested with 1 U of DNase I (Promega) for 1 min at room temperature before the addition of 80 µl of stop solution (20 mM Tris-HCl, pH 8.0, 250 mM NaCl, 20 mM EDTA, 0.5% SDS, 10 µg proteinase K, and 4 µg sonicated calf thymus DNA). After incubation at 37 C for 15 min, the digested products were phenol extracted, ethanol precipitated, and separated on 8% sequencing gel.
Oligos used for EMSAs were as follows. Oligo-W (wild type): 5'-AGACAC GAGTGTTCCCCCACCCCGACTGCCCGCACCCCTG-3', which corresponds to -250 to -211 bp of the NIS gene; Oligo-M: 5'-AGACACGAGTGTGACCCCACCCCGACTG CCCGCACCCCTG-3', which is the mutant type of Oligo-W; Oligo-DS: 5'-GTTCG CCTCGTGAACTCTCGGAGAGG, which contains the sequence of the downstream TTF-1 binding site of the TSH-R promoter (19, 20). EMSAs were performed as described previously (18) as follows: 1 µg nuclear extract from FRTL-5, FRT, and BRL-3A cells or 50 ng recombinant TTF-1 HD were incubated in a 30 µl reaction volume for 20 min at room temperature, with or without unlabeled competitor oligonucleotides in the following buffer: 10 mM Tris-HCl, pH 7.6, 50 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 1 mM EDTA, 12.5% glycerol, 0.1% Triton X-100, and 1 µg poly(deoxyinosinic-deoxycytidylic)acid. End-labeled probe, 50,000 cpm (0.5 ng DNA), was added and incubated for an additional 20 min at room temperature. DNA-protein complexes were separated on 5% native polyacrylamide gel.
Nuclear extracts from FRTL-5, FRT, and BRL-3A cells were prepared as described (18). Antibody to TTF-1 was produced in rabbits by using purified recombinant partial rat TTF-1 residue, corresponding to 1 to 126 amino acids, expressed in bacteria with pGEX-2T (Pharmacia Biotech, Uppsala, Sweden) as an antigen. The ability and specificity of the antibody were reported previously (35).
Transfection and Luciferase Reporter Assay
FRTL-5 cells (ATCC CRL 8305) cultured in the presence or absence
of TSH, FRT cells, and BRL-3A cells (ATCC CRL 14429) were grown to 80%
confluency. FRT cells, which are known to contain Pax-8 but not TTF-1
(15, 18, 20, 21, 22, 23), were kindly donated from Dr. L. D. Kohn (NIH,
Bethesda). These cells were transfected by an electroporation technique
(Gene Pulser, Bio-Rad Laboratories, Hercules, CA). Ten milligrams of
pNIS-Luc
-1968 or equivalent molar amount of the deletion mutant, or
pGL2-Basic, were introduced into the cells together with pCH110 ß-Gal
to correct for variability in transfection efficiency. Cells were
pulsed (300 V for FRTL-5 and FRT cells; 270 V for BRL-3A cells, 960
µFarads), plated (6 x 106 cells per dish) and
cultured for 72 h in the case of FRTL-5 cells or 48 h for FRT
and BRL-3A cells. All transfections were carried out in triplicate
batches using at least two different DNA preparations. Cells were lysed
by three to four freez-thaw cycles and centrifuged at 4 C in a
microfuge for 5 min. Luciferase assay was performed as described
previously (36). ß-Galactosidase assay was carried out according to
Sambrook et al. (34). Statistical analysis was performed by
paired t test.
| FOOTNOTES |
|---|
Received for publication May 19, 1997. Accepted for publication July 28, 1997.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Alotaibi, E. Yaman, D. Salvatore, V. Di Dato, P. Telkoparan, R. Di Lauro, and U. H. Tazebay Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription Nucleic Acids Res., January 31, 2010; (2010): gkq023v1 - gkq023. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hoshi, N. Hoshi, M. Okamoto, J. Paiz, T. Kusakabe, J. M. Ward, and S. Kimura Role of NKX2-1 in N-bis(2-hydroxypropyl)-nitrosamine-induced thyroid adenoma in mice Carcinogenesis, September 1, 2009; 30(9): 1614 - 1619. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-D. Song, J. Liang, J.-Y. Shi, S.-X. Zhao, Z. Liu, J.-J. Zhao, Y.-D. Peng, G.-Q. Gao, J. Tao, C.-M. Pan, et al. Functional SNPs in the SCGB3A2 promoter are associated with susceptibility to Graves' disease Hum. Mol. Genet., March 15, 2009; 18(6): 1156 - 1170. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kogai, S. Sajid-Crockett, L. S Newmarch, Y.-Y. Liu, and G. A Brent Phosphoinositide-3-kinase inhibition induces sodium/iodide symporter expression in rat thyroid cells and human papillary thyroid cancer cells J. Endocrinol., November 1, 2008; 199(2): 243 - 252. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Fenton, K. M. Marion, and J. M. Hershman Identification of Cyclic Adenosine 3',5'-Monophosphate Response Element Modulator as an Activator of the Human Sodium/Iodide Symporter Upstream Enhancer Endocrinology, May 1, 2008; 149(5): 2592 - 2606. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Fozzatti, M. L Velez, A. M Lucero, J. P Nicola, I. D Mascanfroni, D. R Maccio, C. G Pellizas, G. A Roth, and A. M Masini-Repiso Endogenous thyrocyte-produced nitric oxide inhibits iodide uptake and thyroid-specific gene expression in FRTL-5 thyroid cells J. Endocrinol., March 1, 2007; 192(3): 627 - 637. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Riesco-Eizaguirre and P. Santisteban A perspective view of sodium iodide symporter research and its clinical implications. Eur. J. Endocrinol., October 1, 2006; 155(4): 495 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
T Kogai, K Taki, and G A Brent Enhancement of sodium/iodide symporter expression in thyroid and breast cancer. Endocr. Relat. Cancer, September 1, 2006; 13(3): 797 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kusakabe, A. Kawaguchi, N. Hoshi, R. Kawaguchi, S. Hoshi, and S. Kimura Thyroid-Specific Enhancer-Binding Protein/NKX2.1 Is Required for the Maintenance of Ordered Architecture and Function of the Differentiated Thyroid Mol. Endocrinol., August 1, 2006; 20(8): 1796 - 1809. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Opitz, A. Trubiroha, C. Lorenz, I. Lutz, S. Hartmann, T. Blank, T. Braunbeck, and W. Kloas Expression of sodium-iodide symporter mRNA in the thyroid gland of Xenopus laevis tadpoles: developmental expression, effects of antithyroidal compounds, and regulation by TSH. J. Endocrinol., July 1, 2006; 190(1): 157 - 170. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Velez, E. Costamagna, E. T. Kimura, L. Fozzatti, C. G. Pellizas, M. M. Montesinos, A. M. Lucero, A. H. Coleoni, P. Santisteban, and A. M. Masini-Repiso Bacterial Lipopolysaccharide Stimulates the Thyrotropin-Dependent Thyroglobulin Gene Expression at the Transcriptional Level by Involving the Transcription Factors Thyroid Transcription Factor-1 and Paired Box Domain Transcription Factor 8 Endocrinology, July 1, 2006; 147(7): 3260 - 3275. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Srisodsai, R. Kurotani, Y. Chiba, F. Sheikh, H. A. Young, R. P. Donnelly, and S. Kimura Interleukin-10 Induces Uteroglobin-related Protein (UGRP) 1 Gene Expression in Lung Epithelial Cells through Homeodomain Transcription Factor T/EBP/NKX2.1 J. Biol. Chem., December 24, 2004; 279(52): 54358 - 54368. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Chun, V. Di Dato, B. D'Andrea, M. Zannini, and R. Di Lauro The CRE-Like Element Inside the 5'-Upstream Region of the Rat Sodium/Iodide Symporter Gene Interacts with Diverse Classes of b-Zip Molecules that Regulate Transcriptional Activities through Strong Synergy with Pax-8 Mol. Endocrinol., November 1, 2004; 18(11): 2817 - 2829. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Furuya, H. Shimura, A. Miyazaki, K. Taki, K. Ohta, K. Haraguchi, T. Onaya, T. Endo, and T. Kobayashi Adenovirus-Mediated Transfer of Thyroid Transcription Factor-1 Induces Radioiodide Organification and Retention in Thyroid Cancer Cells Endocrinology, November 1, 2004; 145(11): 5397 - 5405. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dentice, C. Luongo, A. Elefante, R. Romino, R. Ambrosio, M. Vitale, G. Rossi, G. Fenzi, and D. Salvatore Transcription Factor Nkx-2.5 Induces Sodium/Iodide Symporter Gene Expression and Participates in Retinoic Acid- and Lactation-Induced Transcription in Mammary Cells Mol. Cell. Biol., September 15, 2004; 24(18): 7863 - 7877. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Furuya, H. Shimura, H. Suzuki, K. Taki, K. Ohta, K. Haraguchi, T. Onaya, T. Endo, and T. Kobayashi Histone Deacetylase Inhibitors Restore Radioiodide Uptake and Retention in Poorly Differentiated and Anaplastic Thyroid Cancer Cells by Expression of the Sodium/Iodide Symporter Thyroperoxidase and Thyroglobulin Endocrinology, June 1, 2004; 145(6): 2865 - 2875. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-S. Park, J. A. Whitsett, T. Di Palma, J.-H. Hong, M. B. Yaffe, and M. Zannini TAZ Interacts with TTF-1 and Regulates Expression of Surfactant Protein-C J. Biol. Chem., April 23, 2004; 279(17): 17384 - 17390. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Costamagna, B. Garcia, and P. Santisteban The Functional Interaction between the Paired Domain Transcription Factor Pax8 and Smad3 Is Involved in Transforming Growth Factor-{beta} Repression of the Sodium/Iodide Symporter Gene J. Biol. Chem., January 30, 2004; 279(5): 3439 - 3446. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Moeller, S. Kimura, T. Kusakabe, X.-H. Liao, J. Van Sande, and S. Refetoff Hypothyroidism in Thyroid Transcription Factor 1 Haploinsufficiency Is Caused by Reduced Expression of the Thyroid-Stimulating Hormone Receptor Mol. Endocrinol., November 1, 2003; 17(11): 2295 - 2302. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Dohan, A. De la Vieja, V. Paroder, C. Riedel, M. Artani, M. Reed, C. S. Ginter, and N. Carrasco The Sodium/Iodide Symporter (NIS): Characterization, Regulation, and Medical Significance Endocr. Rev., February 1, 2003; 24(1): 48 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Taki, T. Kogai, Y. Kanamoto, J. M. Hershman, and G. A. Brent A Thyroid-Specific Far-Upstream Enhancer in the Human Sodium/Iodide Symporter Gene Requires Pax-8 Binding and Cyclic Adenosine 3',5'-Monophosphate Response Element-Like Sequence Binding Proteins for Full Activity and Is Differentially Regulated in Normal and Thyroid Cancer Cells Mol. Endocrinol., October 1, 2002; 16(10): 2266 - 2282. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-H. Wang, R. Chmelik, and M. Nirenberg Sequence-specific DNA binding by the vnd/NK-2 homeodomain of Drosophila PNAS, October 1, 2002; 99(20): 12721 - 12726. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Ramos-Vara, M. A. Miller, G. C. Johnson, and L. W. Pace Immunohistochemical Detection of Thyroid Transcription Factor-1, Thyroglobulin, and Calcitonin in Canine Normal, Hyperplastic, and Neoplastic Thyroid Gland Veterinary Pathology, July 1, 2002; 39(4): 480 - 487. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Garcia and P. Santisteban PI3K Is Involved in the IGF-I Inhibition of TSH-Induced Sodium/Iodide Symporter Gene Expression Mol. Endocrinol., February 1, 2002; 16(2): 342 - 352. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tonacchera, P. Viacava, P. Agretti, G. de Marco, A. Perri, C. di Cosmo, M. de Servi, P. Miccoli, F. Lippi, A. G. Naccarato, et al. Benign Nonfunctioning Thyroid Adenomas Are Characterized by a Defective Targeting to Cell Membrane or a Reduced Expression of the Sodium Iodide Symporter Protein J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 352 - 357. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Niimi, K. Nagashima, J. M. Ward, P. Minoo, D. B. Zimonjic, N. C. Popescu, and S. Kimura claudin-18, a Novel Downstream Target Gene for the T/EBP/NKX2.1 Homeodomain Transcription Factor, Encodes Lung- and Stomach-Specific Isoforms through Alternative Splicing Mol. Cell. Biol., November 1, 2001; 21(21): 7380 - 7390. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Niimi, C. L. Keck-Waggoner, N. C. Popescu, Y. Zhou, R. C. Levitt, and S. Kimura UGRP1, a Uteroglobin/Clara Cell Secretory Protein-Related Protein, Is a Novel Lung-Enriched Downstream Target Gene for the T/EBP/NKX2.1 Homeodomain Transcription Factor Mol. Endocrinol., November 1, 2001; 15(11): 2021 - 2036. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kogai, J. M. Hershman, K. Motomura, T. Endo, T. Onaya, and G. A. Brent Differential Regulation of the Human Sodium/Iodide Symporter Gene Promoter in Papillary Thyroid Carcinoma Cell Lines and Normal Thyroid Cells Endocrinology, August 1, 2001; 142(8): 3369 - 3379. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shimura, H. Suzuki, A. Miyazaki, F. Furuya, K. Ohta, K. Haraguchi, T. Endo, and T. Onaya Transcriptional Activation of the Thyroglobulin Promoter Directing Suicide Gene Expression by Thyroid Transcription Factor-1 in Thyroid Cancer Cells Cancer Res., May 1, 2001; 61(9): 3640 - 3646. [Abstract] [Full Text] |
||||
![]() |
B. Gereben, D. Salvatore, J. W. Harney, H. M. Tu, and P. R. Larsen The Human, but Not Rat, dio2 Gene Is Stimulated by Thyroid Transcription Factor-1 (TTF-1) Mol. Endocrinol., January 1, 2001; 15(1): 112 - 124. [Abstract] [Full Text] |
||||
![]() |
M. Nakazato, H.-K. Chung, L. Ulianich, A. Grassadonia, K. Suzuki, and L. D. Kohn Thyroglobulin Repression of Thyroid Transcription Factor 1 (TTF-1) Gene Expression Is Mediated by Decreased DNA Binding of Nuclear Factor I Proteins Which Control Constitutive TTF-1 Expression Mol. Cell. Biol., November 15, 2000; 20(22): 8499 - 8512. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. De la Vieja, O. Dohan, O. Levy, and N. Carrasco Molecular Analysis of the Sodium/Iodide Symporter: Impact on Thyroid and Extrathyroid Pathophysiology Physiol Rev, July 1, 2000; 80(3): 1083 - 1105. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Losada, J. A. Tovar, H. M. Xia, J. A. Diez-Pardo, and P. Santisteban Down-Regulation of Thyroid Transcription Factor-1 Gene Expression in Fetal Lung Hypoplasia Is Restored by Glucocorticoids Endocrinology, June 1, 2000; 141(6): 2166 - 2173. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Missero, M. T. Pirro, and R. Di Lauro Multiple Ras Downstream Pathways Mediate Functional Repression of the Homeobox Gene Product TTF-1 Mol. Cell. Biol., April 15, 2000; 20(8): 2783 - 2793. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Spitzweg, W. Joba, K. Schriever, J. R. Goellner, J. C. Morris, and A. E. Heufelder Analysis of Human Sodium Iodide Symporter Immunoreactivity in Human Exocrine Glands J. Clin. Endocrinol. Metab., November 1, 1999; 84(11): 4178 - 4184. [Abstract] [Full Text] |
||||
![]() |
K. Suzuki, A. Mori, J. Saito, E. Moriyama, L. Ullianich, and L. D. Kohn Follicular Thyroglobulin Suppresses Iodide Uptake by Suppressing Expression of the Sodium/Iodide Symporter Gene Endocrinology, November 1, 1999; 140(11): 5422 - 5430. [Abstract] [Full Text] |
||||
![]() |
M. Ohmori, N. Harii, T. Endo, and T. Onaya Tumor Necrosis Factor-{alpha} Regulation of Thyroid Transcription Factor-1 and Pax-8 in Rat Thyroid FRTL-5 Cells Endocrinology, October 1, 1999; 140(10): 4651 - 4658. [Abstract] [Full Text] |
||||
![]() |
L. Ulianich, K. Suzuki, A. Mori, M. Nakazato, M. Pietrarelli, P. Goldsmith, F. Pacifico, E. Consiglio, S. Formisano, and L. D. Kohn Follicular Thyroglobulin (TG) Suppression of Thyroid-restricted Genes Involves the Apical Membrane Asialoglycoprotein Receptor and TG Phosphorylation J. Biol. Chem., August 27, 1999; 274(35): 25099 - 25107. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Spitzweg, S. Zhang, E. R. Bergert, M. R. Castro, B. McIver, A. E. Heufelder, D. J. Tindall, C. Y. F. Young, and J. C. Morris Prostate-specific Antigen (PSA) Promoter-driven Androgen-inducible Expression of Sodium Iodide Symporter in Prostate Cancer Cell Lines Cancer Res., May 1, 1999; 59(9): 2136 - 2141. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ohno, M. Zannini, O. Levy, N. Carrasco, and R. di Lauro The Paired-Domain Transcription Factor Pax8 Binds to the Upstream Enhancer of the Rat Sodium/Iodide Symporter Gene and Participates in Both Thyroid-Specific and Cyclic-AMP-Dependent Transcription Mol. Cell. Biol., March 1, 1999; 19(3): 2051 - 2060. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Shaw-White, M. D. Bruno, and J. A. Whitsett GATA-6 Activates Transcription of Thyroid Transcription Factor-1 J. Biol. Chem., January 29, 1999; 274(5): 2658 - 2664. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Suzuki, S. Lavaroni, A. Mori, F. Okajima, S. Kimura, R. Katoh, A. Kawaoi, and L. D. Kohn Thyroid Transcription Factor 1 Is Calcium Modulated and Coordinately Regulates Genes Involved in Calcium Homeostasis in C Cells Mol. Cell. Biol., December 1, 1998; 18(12): 7410 - 7422. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-Y. Ryu, Q. Tong, and S. M. Jhiang Promoter Characterization of the Human Na+/I- Symporter J. Clin. Endocrinol. Metab., September 1, 1998; 83(9): 3247 - 3251. [Abstract] [Full Text] |
||||
![]() |
K. Suzuki, S. Lavaroni, A. Mori, M. Ohta, J. Saito, M. Pietrarelli, D. S. Singer, S. Kimura, R. Katoh, A. Kawaoi, et al. Autoregulation of thyroid-specific gene transcription by thyroglobulin PNAS, July 7, 1998; 95(14): 8251 - 8256. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Velasco, A. Acebron, M. Zannini, J. MartIn-Perez, R. Di Lauro, and P. Santisteban Ha-ras Interference with Thyroid Cell Differentiation Is Associated with a Down-Regulation of Thyroid Transcription Factor-1 Phosphorylation Endocrinology, June 1, 1998; 139(6): 2796 - 2802. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ohmori, T. Endo, N. Harii, and T. Onaya A Novel Thyroid Transcription Factor Is Essential for Thyrotropin-Induced Up-Regulation of Na+/I- Symporter Gene Expression Mol. Endocrinol., May 1, 1998; 12(5): 727 - 736. [Abstract] [Full Text] |
||||
![]() |
C. Spitzweg, W. Joba, W. Eisenmenger, and A. E. Heufelder Analysis of Human Sodium Iodide Symporter Gene Expression in Extrathyroidal Tissues and Cloning of Its Complementary Deoxyribonucleic Acids from Salivary Gland, Mammary Gland, and Gastric Mucosa J. Clin. Endocrinol. Metab., May 1, 1998; 83(5): 1746 - 1751. [Abstract] [Full Text] |
||||
![]() |
C. Missero, M. T. Pirro, S. Simeone, M. Pischetola, and R. Di Lauro The DNA Glycosylase T:G Mismatch-specific Thymine DNA Glycosylase Represses Thyroid Transcription Factor-1-activated Transcription J. Biol. Chem., August 31, 2001; 276(36): 33569 - 33575. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kogai, J. J. Schultz, L. S. Johnson, M. Huang, and G. A. Brent Retinoic acid induces sodium/iodide symporter gene expression and radioiodide uptake in the MCF-7 breast cancer cell line PNAS, July 18, 2000; 97(15): 8519 - 8524. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |