help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sadeghi, H.
Right arrow Articles by Birnbaumer, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sadeghi, H.
Right arrow Articles by Birnbaumer, M.
Molecular Endocrinology 11 (12): 1806-1813
Copyright © 1997 by The Endocrine Society

Biochemical Basis of Partial Nephrogenic Diabetes Insipidus Phenotypes

Hamid Sadeghi, Gary L. Robertson, Daniel G. Bichet, Giulio Innamorati and Mariel Birnbaumer

Department of Anesthesiology (H.S., G.I., M.B.) University of California Los Angeles School of Medicine Los Angeles, California 90095
Department of Medicine (D.G.B.) Université de Montréal Centre de Recherche et Unité de Recherches Cliniques Hôpital du Sacré-Coeur de Montréal Montréal, Québec, H4J 1C5 Canada
Center for Endocrinology, Metabolism, and Nutrition (G.L.R.) Northwestern University Medical School Chicago, Illinois 60611-3008


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Biochemical properties of mutant type 2 vasopressin receptors (V2Rs) causing a partial phenotype of nephrogenic diabetes insipidus were investigated in transiently transfected HEK 293 cells. Cell surface expression of the V2R was not altered by substituting Asp85 in the second transmembrane region by Asn as determined by saturation binding assays. Although the affinity of the mutant V2R for arginine vasopressin (AVP) was reduced only 6-fold, the response of adenylyl cyclase activity to AVP revealed a 50-fold right shift in EC50 and a decreased maximum response for the mutant V2R. These data indicated that replacement of Asp85 by Asn affected coupling of the receptor to Gs, a conclusion substantiated by a 20-fold decrease in the calculated coupling efficiency of this receptor. The Gly201Asp mutation in the second extracellular loop, also found associated with an NDI partial phenotype, decreased cell surface expression of the V2R with minor reduction in ligand-binding affinity and coupling efficiency to Gs. A pronounced difference was observed for this mutant V2R between the stimulation of adenylyl cyclase activity promoted by AVP and the V2 vasopressin receptor agonist deamino[Cys1,D-Arg8]-vasopressin, suggesting an involvement of Gly201 in the selectivity of the receptor for different ligands. These data demonstrated that while decreased ligand-binding affinity and decreased coupling to Gs are responsible for the attenuation of response to ligand in the Asp85Asn mutant V2R, cell surface expression of the V2R is the major factor reducing cellular responses to ligand for the Gly201Asp mutant V2R.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Arginine vasopressin (AVP) regulates diuresis by promoting the recovery of water in the kidney collecting duct. Interaction between this peptide hormone and vasopressin type 2 receptors (V2Rs) of the principal cells stimulates cAMP production and protein kinase A. Activation of the kinase starts a phosphorylation cascade that promotes the recruitment of the aquaporin 2 water channel to the apical membrane of the cell with concomitant increase in water permeability (1). Cloning of the cDNAs encoding the vasopressin receptor and aquaporin 2 defined the composition of the initiator and the ultimate effector of this path (2, 3). The discovery that genetic defects in either the receptor or the aquaporin 2 proteins can block the vasopressin-induced increases in tubular permeability and cause diabetes insipidus confirmed the physiological role assigned to these molecules (4, 5, 6). Most males afflicted with X-linked recessive nephrogenic diabetes insipidus (X-NDI) display a full phenotype; their kidneys fail to produce concentrated urine even when perfused with high doses of the V2 vasopressin receptor agonist desmopressin [also known as DDAVP (deamino[Cys1,D-Arg8]-vasopressin) (6).

We have previously characterized the biochemical defect that alters the activity of two mutant forms of V2R in individuals affected with NDI. Missense mutations in codons 113 and 137 (R113W and R137H) were found to significantly reduce receptor expression in transfected cells, possibly due to misfolding of the protein. Additionally, the R137H mutation abolished coupling to G proteins, and the R113W mutation reduced receptor ligand-binding affinity and Gs coupling to such an extent that the kidney challenged either by dehydration or infusions of DDAVP was unable to produce concentrated urine, thus displaying a complete phenotype (7, 8, 9). Experiments examining the traffic of proteins in transfected cells have shown that many of the missense mutations impair severely the processing of the receptor protein and result in trapping of the misfolded receptor protein in the endoplasmic reticulum (10, 11).

Recently, four families with individuals exhibiting a partial NDI phenotype were identified. While subjected to dehydration (a condition that increases the circulating levels of AVP), the kidneys of these patients were able to produce concentrated urine. They responded in a similar manner to infusions of high doses of DDAVP (Ref. 6 and G. Robertson, and D. G. Bichet, manuscript in preparation). Analysis of the V2R gene in these families revealed two new mutations: one at Asp85, the other at Gly201. To characterize their activity, the mutant receptors were expressed in HEK 293 cells. Both mutant receptors were transported to the cell surface and exhibited alterations in their ligand-binding affinity. The Gly201Asp mutation reduced the number of receptor sites per cell, while the Asp85Asn mutant was expressed at the same level as wild type receptor. The coupling efficiency and the level of expression of the mutant receptors were examined and compared with the wild type.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Identification of the Mutations
Amplification and sequencing of the V2R gene of the four families featuring the partial phenotype revealed that three of them carried the missense mutation G324A, which results in the Asp85Asn amino acid change (D85N), while the fourth family carried the G673A missense mutation, which changed amino acid 201 from a glycine to an aspartic acid G201D (7). Figure 1Go illustrates the predicted location of these mutations in the V2R protein. Because the three families bearing the D85N mutation originated in the same area, the haplotype of the X chromosome of the patients was examined to determine whether a common ancestor could be identified for the mutation. Hybridization with the Xq28 markers flanking the V2R gene established that they differed on both sides, verifying the independent origin of the mutation (G. Robertson, and D. G. Bichet, manuscript in preparation).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Some of the Characterized Mutations in the Human V2 Vasopressin Receptor

The diamonds indicate the location of the missense mutations mentioned in the text.

 
Biochemical Characterization of the Mutant Receptors
The mutation in Asp85 of the second transmembrane region affects a very highly conserved amino acid in the rhodopsin receptor family. This aspartic acid has been extensively mutagenized in the adrenergic receptors (12). In the case of the {alpha}2-adrenergic receptor, Limbird and collaborators (13, 14) found the Asp in the equivalent position to be required for the receptor to display agonist binding sensitivity to Na+ and for regulation of ion fluxes. In previous studies, we examined whether we could detect an effect of Na+ on the V2R-mediated stimulation of cAMP accumulation in intact cells. To this end we determined dose-response curves to AVP in the presence of either 140 mM NaCl or 140 mM Glucamine·HCl, and found them identical, indicating that this amino acid does not confer sodium sensitivity to the V2R (15). Thus, we did not expect to detect alterations in receptor function related to sodium ions in this mutant receptor.

The binding characteristics of the D85N mutant receptor were determined in HEK 293 cells expressing the transfected receptor. All assays were performed in parallel with cells transfected with the wild type V2R. As shown in Fig. 2Go and Table 1Go, the mutation reduced the binding affinity of the receptor approximately 6-fold, but did not seem to interfere with the maturation and transport of the protein to the cell surface since the receptor abundance was virtually identical for cells that expressed either receptor: 1.7 ± 0.13 x 106vs. 1.9 ± 0.19 x 106 sites per cell for the wild type and the D85N mutant, respectively. After metabolic labeling of transfected COS cells and immunoprecipitation of the receptor, the radioactive band corresponding to the mature D85N mutant receptor protein detected by SDS-PAGE was of equivalent intensity to the band obtained from expression of the wild type receptor as shown in Fig. 3BGo. The bands of the glycosylated receptor protein were characterized as mature by their resistance to Endoglycosidase H and sensitivity to PNGase F treatments (16). The data on protein expression were in agreement with the receptor abundance determined by the saturation binding experiments.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Saturation Binding Assays for Wild Type and Mutant V2Rs

Intact cell assays were performed with transfected HEK 293 cells expressing the wild type ({blacksquare}), the D85N ({triangleup}), or the G201D({circ}) V2R. The assay was carried out at 4 C in D-PBS in the absence and presence of 10 µm unlabeled AVP to determine nonspecific binding. A representative experiment is shown in the top panel. The bottom panel illustrates the Scatchard analysis of the data.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Vasopressin Binding and Stimulation of Adenylyl Cyclase Activity and Calculation of Gs Coupling Efficiency for the Wild Type and Mutant V2Rs Expressed in the HEK 293T Cells

 


View larger version (65K):
[in this window]
[in a new window]
 
Figure 3. Analysis of Expression of Mutant V2 Vasopressin Receptor Proteins by Metabolic Labeling and Immunoprecipitation

After pulse labeling with the transfected COS cells with [35S]methionine/cysteine, detergent extraction, and immunoprecipitation, the receptor proteins were analyzed by SDS-PAGE before and after the enzymatic treatments as described in Materials and Methods. Panel A, The left picture illustrates the migration of the D85N receptor: as a broad band of glycosylated protein that is resistant to endoglycosidase H treatment, as indicated by the bracket, and as a sharper band of deglycosylated protein identified by the arrowhead. The right picture illustrates the same for the G201D mutant receptor protein. Panel B, Migration of the deglycosylated receptor proteins after peptide N-glycosydase F (PNGase F) treatment. The mature receptor of the wild type and both mutant receptor proteins are shown. Note the reduced intensity of the G201D band.

 
The coupling characteristics of the mutant receptors were examined in homogenates obtained from transiently transfected cells. The D85N mutant receptor stimulated the Gs/adenylyl cyclase system with less efficacy than the wild type receptor. As shown on Fig. 4Go and Table 1Go, the EC50 for AVP was 17.1 ± 2.1 nM for the mutant compared with 0.33 ± 0.1 nM for the wild type receptor. The significant reduction in maximal response suggested an alteration in the coupling between this receptor and Gs. To assess the effect of the mutation in coupling in quantitative terms, the coupling efficiency was appraised and compared with that of the wild type V2R using the coupling efficiency formula developed by Whaley et al. (17). The ratio of 20.1 ± 4.4 between both values indicated that there was a significant alteration of coupling efficiency as a result of the mutation, suggesting that the protein distortion affected ligand-binding affinity and the interactions with Gs. Dose-response curves with desmopressin (DDAVP), showed a right shift in the EC50 for stimulation of adenylyl cyclase activity similar to the quantitative alteration observed for AVP stimulation (data not shown).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Adenylyl Cyclase Activity of Cells Expressing the Wild Type or Mutant V2R

Homogenates were prepared from transiently transfected HEK 293 cells expressing the wild type ({blacksquare}), the D85N ({triangleup}), or the G201D({circ}) V2R. The results were normalized based on the maximal adenylyl cyclase activity obtained in the presence of 100 nM VIP. A representative experiment of those reported in Table 1Go is shown.

 
In contrast with the D85N, the G201D mutation reduced the receptor abundance on the cell surface. The abundance of the mutant receptor, as determined by binding assays, was approximately 25% of that observed for the wild type receptor. This reduced level of mutant receptor coincided with the presence of a significantly weaker band of mature receptor in the protein expression analysis, as seen in Fig. 3BGo and Table 1Go. Ligand-binding affinity was slightly altered resulting in KD values of 1.53 ± 0.15 and 2.90 ± 0.42 nM for the wild type and the G201D receptors, respectively. These data are illustrated in Fig. 2Go and Table 1Go. The dose response for AVP stimulation of adenylyl cyclase activity determined in transiently transfected cells was right shifted about 50-fold in reference to the wild type as shown in Fig. 4Go and Table 1Go. These results were similar in transient or stably transfected cells. The increase in the EC50 seem to be mostly a consequence of reduced receptor density. Calculation of coupling efficiencies revealed a 3.32 ± 0.60 ratio between the wild type and the mutant receptor activities, demonstrating an insignificant alteration in coupling efficiency to Gs. As for other mutant receptors, the ability of the G201D mutant V2R to respond to DDAVP was assessed. At variance with the other mutations characterized in our laboratory (8, 9), the response to the agonist had been impaired by this mutation to a greater extent than the response to AVP. To reduce experimental variability, the EC50 for DDAVP and for AVP was determined in stably transfected HEK 293 cells as seen in Fig. 5Go. The ratio of the EC50 for DDAVP over that for AVP was approximately 3 for the wild type, while it was 15 for the mutant receptor. These results suggest that Gly201 plays a significant role in agonist-binding selectivity, a different selectivity profile than the one detected with the mutation affecting Arg-113 (9).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 5. Adenylyl Cyclase Activity of Stably Transfected HEK 293 Cell Clones

Effect of increasing concentrations of AVP and DDAVP on the adenylyl cyclase activity of homogenates obtained from cell clones expressing the wild type and the G201D mutant receptor, respectively. Basal and maximally stimulated adenylyl cyclase activities, expressed as picomoles of cAMP formed per min/mg of protein, were: 31.0 and 590.0 for AVP, 34.0 and 603.0 for DDAVP for cells expressing wild type receptor; 10.7 and 197.0 for AVP, 11.3 and 195.3 for DDAVP for cells expressing the G201D mutant receptor. Results are expressed as the mean ± SEM, n = 3.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The two V2R mutations characterized here result in an NDI phenotype in which the kidneys of the affected patients are able to concentrate urine during dehydration or upon DDAVP infusion. The mutation in aspartic85 affects one of the most conserved residues among the rhodopsin subfamily of serpentine receptors. As mentioned before, Limbird and collaborators found this residue in the {alpha}-2 adrenergic receptor required for coupling to ion flux and responsible for the modulation of agonist binding by sodium ions (13). A similar role has been described for this amino acid in the opioid and somatostatin receptors (18, 19). Mutagenesis of this amino acid did not alter the ligand-binding affinity of these receptors. Chung et al. had observed that mutating the equivalent Asp of the ß-adrenergic receptor to Asn reduced agonist-binding affinity approximately 50-fold and shifted the EC50 for cAMP accumulation more than 100-fold (12).

Results obtained in vitro with the D85N mutant V2R, and in affected individuals by DDAVP infusion (G. Robertson and D. G. Bichet, in preparation), revealed that for this receptor the consequences of the Asp to Asn change are somewhere between the very dramatic loss of function seen with the ß-adrenergic receptor and the subtle alterations in coupling seen with the {alpha}2A-adrenergic receptors. Based on the in vitro data, carriers of the D85N mutation are expected to express normal levels of receptor in their kidneys, which have reduced coupling due to a diminished binding affinity for AVP and reduced coupling with Gs. This situation could reduce the response to normal levels of endogenous AVP sufficiently to produce NDI. This deficiency can be overcome by the high AVP levels induced by dehydration. Likewise, these patients are expected to respond to DDAVP infusions, as they do (G. Robertson and D. G. Bichet, manuscript in preparation).

For the G201D mutation, although the functional impairment of the receptor to stimulate cAMP production in transfected cells is similar to the one found with the Arg113Trp mutation (15) detected in patients that exhibit the full NDI phenotype, the reduction in receptor abundance to 30% of wild type levels and the preservation of better ligand-binding affinity, as compared with the R113W mutant, leave sufficient receptor on the cell surface to allow the principal cell to respond to elevated levels of AVP or DDAVP. The change in coupling efficiency for this mutant receptor was not considered significant because, according to Whaley et al. (20), a 2-fold variation of this parameter was found when the coupling efficiency of different cells expressing the ß2-adrenergic receptor were compared.

Other NDI mutations have been found in this second extracellular loop, and three have been expressed and characterized. Coincidentally the three result in the appearance of extra cysteines in the loop. Pan et al. (21) described that the R181C mutant V2R was expressed at similar levels as the wild type receptor, but its ligand-binding affinity has been reduced 20-fold. No phenotype information was provided. The other two mutations, R202C and Y205C, had different effects on receptor funtion (22, 23). The R202C mutation interfered with the traffic of the V2 receptor to the cell surface, and reduced the level of expression by 10-fold or more. Nevertheless a KD similar to the wild type value was reported for the receptor expressed in COS cells. This is reminiscent of the impact of the R137H mutation on these parameters (8). The ability of this mutant receptor to mediate AVP stimulation of adenylyl cyclase activity was not reported.

On the other hand, the Y205C mutation did not change the level of receptor expression, an indication of normal traffic to the plasma membrane, but reduced the ligand-binding affinity for AVP about 10-fold. Similar to what was observed for the G201D mutant receptor, the Y205C receptor stimulated cAMP accumulation with an EC50 for AVP 100-fold higher than the wild type. The similar findings in coupling between mutations affecting G201 and Y205 are not surprising, since both occur in the same region of the receptor. However, the difference in ligand-binding affinity indicates a greater impact of the Y205C mutation on AVP binding. There is no mention in Ref. 21 as to whether the patient carrying this mutation had a full or partial phenotype, but the report mentions that the patient was diagnosed at age 46, and the urinary osmolality was 293 mosmol/kg under normal hydration conditions, a value of urinary osmolality unusually high for an NDI patient. Considering the age of the patient and the absence of mental retardation, a common sequel of severe episodes of hypernatremia triggered by dehydration, the possibility that the Y205C mutation is associated with a partial NDI phenotype must be considered. This becomes more likely when the functional characteristics and level of expression of the Y205C and G201D mutant receptors are examined.

In conclusion, the functional characteristics and level of expression of these receptor mutants correlate well with the phenotypes observed and demonstrate different mechanisms that lead to a reduction in the normal response of the kidney to AVP. For the D85N mutant V2R the combination of reduced ligand-binding affinity and efficient coupling to Gs has similar consequences as the decrease in cell surface expression with minimal changes in functional parameters for the G201D V2R. The second situation reinforces our previous conclusions as to the importance of the number of receptors per cell in determining the ability to respond to normal levels of circulating AVP.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
DMEM, Hanks-buffered salt solution (HBSS), Dulbecco’s PBS (D-PBS), penicillin/streptomycin, 0.5% trypsin/5 mM EDTA, geneticin (G-418), and FBS were from GIBCO (Grand Island, NY); cell culture plasticware was from COSTAR (Cambridge, MA); AVP and DDAVP were from Peninsula Laboratories (Belmont, CA); vasoactive intestinal peptide (VIP), (-)isoproterenol (Iso), and isobutylmethylxanthine were from Sigma (St.Louis, MO); forskolin was from Calbiochem (San Diego, CA). All other reagents were from Sigma. [3H]AVP, specific activity 60–80 Ci/mmol, [{alpha}-32P]ATP, specific activity 3000 Ci/mmol, and EXPRE35S35S Protein Labeling Mix, specific activity >1000 Ci/mmol were purchased from Dupont-New England Nuclear (Boston, MA) [3H]cAMP was from ICN Biochemicals (Irvine, CA).

Construction of Mutant V2Rs
Genomic DNA from the white blood cells of patients with X-linked recessive NDI was used as template for the PCR. For the D85N mutation, primers 23 (5'CCCAGCCTGCCCAGCAAC-3' sense) and 65 (5'CGCTGGGCGAAGATGAAGAGCT3' antisense) were used to amplify the regions containing the mutation. The PCR product was digested with NheI and EagI and purified by electrophoresis through GTG-agarose. The cDNA encoding the wild type human V2R (2), cloned into the EcoRI site of pGEM-3, was digested with NheI and EagI, dephosphorylated, and purified by electrophoresis through GTG-agarose gel. The linearized plasmid was ligated to the PCR fragments containing the D85N mutation. A similar procedure was applied to introduce the G201D mutation into the cDNA of the human V2R. For the latter, primers 13 (5'-TGACGCTGGACCGCCACCGTG-3' sense) and 60 (5'AGCACAGCACATAGACGACCA-3' antisense) were used to generate the PCR product. This product was digested with EagI and Bsa A1, gel purified, and ligated into the dephosphorylated and purified wtV2R cDNA in pGEM3 that had been digested with EagI and Bsa A1. The resulting constructs were sequenced fully by the dideoxy chain termination method of Sanger et al. (24). For expression in eukaryotic cells the cDNAs bearing the D85N and the G201D mutations were excised from their vectors with EcoRI and ligated into the dephosphorylated expression vector pcDNA3 (In-vitrogen, Boston, MA).

Cell Culture
HEK 293 cells were grown in DMEM-high glucose, supplemented with 10% heat-inactivated FBS, penicillin (50 U/ml), and streptomycin (50 µg/ml).

Transient Expression in Cells
Subconfluent HEK 293 cells were plated at a density of 2.8 x 106 cells per 100-mm dish and transfected the following day by a modification of the method of Luthman and Magnusson (25). Briefly, cells were transfected by replacing the growth medium with 6.7 ml of a mixture of 100 µM chloroquine and 0.25 mg/ml diethylaminoethyl-dextran in DMEM with 10% FBS containing 3 µg DNA. After 2 h at 37 C, the solution was removed and the cells were treated for 1 min at room temperature with 10% DMSO in PBS. The cells were rinsed twice with PBS and incubated overnight in growth medium.

Stable Expression in HEK 293 Cells
HEK 293 cells, kept subconfluent, were transfected by the calcium phosphate precipitation technique of Graham and van der Eb (26). Briefly, cells were grown in DMEM containing 10% FBS, penicillin (50 U/ml), and streptomycin (50 µg/ml). The day before transfection 1–2 x 106 cells were plated into each of two 100-mm plates. The DNA-calcium phosphate coprecipitate containing 10 µg pcDNA3 was prepared in a sterile hood immediately before use with all reagents at 37 C. The reagents were mixed in a 15-ml sterile polystyrene tube in this order: 10 µg plasmid DNA in 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, sterile H2O to bring the volume to 900 µl, 1 ml of 250 mM CaCl2 followed by 100 µl of 15 mM Na2HPO4, 50 mM HEPES, 150 mM NaCl, and 5 mM KCl, adjusted to pH 7.05 with NaOH. All reagents were added dropwise and slowly with gentle mixing after each addition. After 10 min at room temperature, 1 ml of the whitish suspension was added dropwise to each plate and mixed by gentle swirling. After 18 h in the incubator, the medium was removed and cells were treated with 2 ml of 25% glycerol in HBSS at 37 C. After 1 min the glycerol/HBSS mixture was diluted with 10 ml HBSS added slowly with continuous mixing. The solutions were then aspirated, and the rinse with HBSS was repeated. After fresh medium was added, the plates were returned to the incubator. The next day, the cells were trypsinized and diluted with the selection medium containing G-418 400 µg/ml. Cells were then distributed into the wells of two 96-well microtitration plates (2000 to 4000 cells per well) using a COSTAR transplate device. G418-resistant clones were picked (after 16–18 days) and expanded in six-well plates to assay for stimulation of adenylyl cyclase activity as described.

Hormone Binding to Intact Cells
Cells were plated in 12-well plates at a density of 0.5–1.0 x 105 cells per well. Binding assays were performed the following day. Cells were washed twice with ice-cold D-PBS, after which each well received 0.5 ml of ice-cold D-PBS with 2% BSA and the appropriate dilution of [3H]AVP. Plates were incubated for 2 h on top of crushed ice in the cold room before removal of the binding mixture by aspiration. After quickly rinsing twice with ice-cold D-PBS, 0.5 ml of 0.1 N NaOH was added to each well to extract bound radioactivity. After 30 min at 37 C, the fluid from the wells was transferred to scintillation vials containing 3.5 ml of ULTIMA-FLO M (Packard, Meriden, CT) scintillation fluid for radioassay. Nonspecific binding was determined under the same conditions in the presence of 10 µM unlabeled AVP (9). Replicate plated wells were trypsinized and their cell content determined to normalize the results as binding sites per cell. Binding experiments were performed five times.

Adenylyl Cyclase Activity in Cell Homogenates
Adenylyl cyclase activity was determined as previously described (9). The medium contained, in a final volume of 50 µl, 0.1 mM [32P]ATP (1–5 x 106 cpm), 1.6 mM MgCl2, 10 µM GTP, 1 mM EDTA, 1 mM [3H]cAMP (~10,000 cpm), 2 mM isobutylmethylxanthine, a nucleoside triphosphate-regenerating system composed of 20 mM creatine phosphate, 0.2 mg/ml (2000 U/mg) creatine phosphokinase, 0.02 mg/ml myokinase (448 U/mg), and 25 mM Tris-HCl, pH 7.4. The incubations were at 32 C for 20 min. Hormones (diluted in 1% BSA) were present at the concentrations indicated on the figures. Reactions were stopped by the addition of 100 µl of a solution containing 40 mM ATP, 10 mM cAMP, and 1% SDS. The cAMP formed was isolated by a modification (27) of the standard double chromatography over Dowex-50 and alumina columns (28).

Under these assay conditions, cAMP accumulations were linear with time of incubation for up to 40 min and proportional to the amounts of homogenate. The activities were expressed as picomoles of cAMP formed per min per mg of homogenate protein and normalized by the maximal value of adenylyl cyclase activity obtained with the addition of 100 nM VIP. Protein content was determined by the method of Lowry et al. (29) using BSA as standard.

Genomic Analysis
Analysis of the Xq28 haplotypes and the amplification and sequencing of the gene encoding the V2R was performed as described in Ref. 7. The entire gene encoding the V2R was sequenced for at least one affected male from each family. From the four families tested, the entire genes of six affected males, seven female carriers, and four nonaffected males were sequenced. The presence or absence of mutations was also confirmed by restriction enzyme analysis.

Metabolic Labeling with [35S]Methionine/Cysteine and Immunoprecipitation
Proteins were labeled in 100-mm dishes by a modification of the method published by Keefer and Limbird (30). Forty eight hours after transfection, cells were starved for 1 h in methionine/cysteine-free DMEM and then labeled for 1 or 2 h with 2 ml of the same medium containing 100 µCi of EXPRE35S35S Protein Labeling Mix/plate. Cells were then rinsed, washed twice with ice-cold D-PBS, scraped from the plate, and collected by centrifugation. The cell pellet from each plate was disrupted in 500 µl RIPA buffer (150 mM NaCl, 50 mM Tris·HCl, pH 8.0, 5 mM EDTA, 1% Nonidet P-40, 0.5% deoxycholic acid, 0.1% SDS containing protease inhibitors: 0.1 mM PMSF, 1 µg/ml soybean trypsin inhibitor, 0.5 µg/ml leupeptin). Homogenization was achieved by drawing the cells through needles of decreasing gauge (20G, 25G) fitted into a 3-ml plastic syringe. Cell extracts were then clarified by mixing them with 50 µl of a 50% slurry of prewashed Protein A-Sepharose in the same buffer. Prewashed Protein A-Sepharose was prepared by addition of 1.0 ml of 25 mg/ml BSA in RIPA buffer, mixed for 1 h, and then washed twice with RIPA buffer alone. For immunoprecipitation, an antibody raised against a portion of third intracellular loop of human V2R (AntiV2 2, peptide VPGPSERPGGRRRGR) was added to the clarified extracts at a concentration of 10 µg/ml and incubated overnight at 4 C. The antigen/antibody complexes were then separated by incubating the mixture with prewashed Protein A-Sepharose for 2 h at the same temperature. The beads were centrifuged and washed three times for 4 min on ice with RIPA buffer. The samples were then eluted with 80 µl of 100 µM peptide 2 in RIPA buffer for 30 min at room temperature and, after addition of 1 mU of Endoglycosidase H or 100 mU of PNGase F, the eluates were incubated at room temperature for 1 h. After mixing with an equal volume of 2x sample buffer containing 10% ß-mercaptoethanol, the samples were electrophoresed in 10% SDS-polyacrylamide gels. Radioactive bands were visualized by treating the gel with Amplify®, and the dried gels were exposed to Kodak-Xomat film at -70 C for the indicated times. For determination of the relative intensity of the obtained band, densitometric measurements were performed using the Bio-Rad Imaging Densitometer Model GS-670 (Bio-Rad, Hercules, CA).

Calculation of Coupling Efficiency
Calculations of coupling efficiency for the V2R were performed as described by Whaley et al. (17) for the ß2-adrenergic receptor in an attempt to quantify the relationship between stimulation of adenylyl cyclase activity and the level of receptor expression in transfected cells. The formulas applied for the wild type receptor were:

in which the terms are: Vmax, the maximal stimulated adenylyl cyclase activity measured; V100, the stimulated adenylyl cyclase activity when the rate of activation (k1r) approaches infinity; EC50, the concentration of agonist producing half-maximal stimulated activity; KD, the dissociation constant; r, the number of receptors per cell (expressed as femtomoles/103 cells); k1, the rate constant for activation and k-1, the rate constant for inactivation of the GTPase activity of Gs. From these formulas the relative coupling efficiencies k1/k-1 can be calculated:

This ratio provides an assessment of coupling efficiency independent of the number of receptors expressed per cell. The ratio of receptor coupling efficiencies estimates the changes in interactions with Gs independent of KD and receptor abundance.

For mutant receptors Whaley et al. developed a formula based on formula (10) of reference 17:

that makes

The ratio between k1W and k1 determined in the same cellular background can be calculate by the following equation that was applied by Whaley et al. to analyze coupling efficiency for mutants of the ß2-adrenergic receptor in Ref. 20:

V100 and k-1 are the same in the HEK cell; thus the equation yields a numerical ratio between k1 of wild type and the mutant receptors analyzed in parallel. To obtain the coupling efficiency value for the mutant, (k1 m/k-1), the ratio obtained from the last equation is multiplied by the k1WT/k-1. Since the k-1 value depends on the GTPase activity on the cell, it is the same for both ratios, and


    FOOTNOTES
 
Address requests for reprints to: Mariel Birnbaumer, Department of Anesthesiology, UCLA Medical Center, BH-612 CHS, 10833 Leconte Avenue, Los Angeles, California 90024-1778.

This work was supported in part by Grants NIH DK 41–244 (to M.B.), 2M01 RR00048 to the General Clinical Research Center at Northwestern University, and Medical Research Council of Canada (MT-8126). D.G.B. is a Career Investigator of the Fonds de la Recherche en Santé du Québec.

Received for publication February 14, 1997. Revision received August 4, 1997.
    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Orloff J, Handler JS 1967 The role of adenosine 3',5'-phosphate in the action of antidiuretic hormone. Am J Med 42:757–768[CrossRef][Medline]
  2. Birnbaumer M, Seibold A, Gilbert S, Ishido M, Barberis C, Antaramian A, Brabet P, Rosenthal W 1992 Molecular cloning of the human antidiuretic hormone receptor. Nature 357:333–335[CrossRef][Medline]
  3. Sasaki S, Fushimi K, Saito H, Saito F, Uchida S, Ishibashi K, Kuwahara M, Ikeuchi T, Inui K, Nakajima K, Watanabe T, Marumo F 1994 Cloning, characterization, chromosomal mapping of human aquaporin of collecting duct. J Clin Invest 93:1250–1256
  4. Rosenthal W, Antaramian A, Arthus M-F, Lonergan M, Hendy GN, Birnbaumer M, Bichet DG 1992 Molecular identification of the gene responsible for congenital nephrogenic diabetes insipidus. Nature 359:233–235[CrossRef][Medline]
  5. Deen PM, Verdijk MA, Knoers NV, Wieringa B, Monnens LA, van Os CH, van Oost A 1994 Requirement of human renal water channel aquaporin- 2 for vasopressin-dependent concentration of urine. Science 264:92–95[Abstract/Free Full Text]
  6. Bichet DG 1992 Nephrogenic diabetes insipidus. In: Cameron JS, Davison AM, Gruenfeld JP, Kerr DNS, Ritz E (eds) Oxford Textbook of Clinical Nephrology. Oxford University Press, New York, pp 789–800
  7. Bichet DG, Birnbaumer M, Lonergan M, Arthus M-F, Rosenthal W, Goodyer P, Nivet H, Benoit S, Giampietro P, Simonetti S, Fish A, Whitley CB, Jaeger P, Gertner J, New M, DiBona F, Kaplan BS, Robertson GL, Hendy GN, Fujiwara TM, Morgan K 1994 Nature, recurrence of AVPR 2 mutations in X-linked nephrogenic diabetes insipidus. Am J Hum Genet 55:278–286[Medline]
  8. Rosenthal W, Antaramian A, Gilbert S, Birnbaumer M 1993 Nephrogenic diabetes insipidus: AV2 vasopressin receptor unable to stimulate adenylyl cyclase. J Biol Chem 268:13030–13033[Abstract/Free Full Text]
  9. Birnbaumer M, Gilbert S, Rosenthal W 1994 An extracellular CNDI mutation of the vasopressin receptor reduces cell surface expression, affinity for ligand, coupling to the Gs/adenylyl cyclase system. Mol Endocrinol 8:886–894[Abstract]
  10. Tsukaguchi H, Matsubara H, Taketani S, Mori Y, Seido T, Inada M 1995 Binding-, intracellular transport-, biosynthesis-defective mutants of vasopressin type 2 receptor in patients with X-linked nephrogenic diabetes insipidus. J Clin Invest 96:2043–2050
  11. Oksche A, Schuelein RA, Rutz C, Liebenhhoff U, Dickson J, Mueller H, Birnbaumer M, Rosenthal W 1996 Vasopressin V2 receptor mutants that cause X-linked nephrogenic diabetes insipidus: analysis of expression, processing, function. Mol Pharmacol 50:820–828[Abstract]
  12. Chung FZ, Wang CD, Potter PC, Venter JC, Fraser CM 1988 Site-directed mutagenesis, continuous expression of human ß-adrenergic receptors. J Biol Chem 263:4052–4055[Abstract/Free Full Text]
  13. Horstman D, Brandon S, Wilson AL, Guyer CA, Cragoe Jr EJ, Limbird LE 1990 An aspartate conserved among G-protein receptors confers allosteric regulation of {alpha}2-adrenergic receptors by sodium. J Biol Chem 265:21590–21595[Abstract/Free Full Text]
  14. Surprenant A, Horstman D, Akbarali H, Limbird LE 1992 A point mutation of cloned {alpha}-adrenoceptor that blocks coupling to potassium but not calcium currents. Science 257:977–980[Abstract/Free Full Text]
  15. Birnbaumer M 1995 ADH receptors: molecular biology, signal transduction. In: Bonventre JV, Schlondorff D (eds) Molecular Nephrology. Marcel Dekker, Inc, New York, pp 517–524
  16. Innamorati G, Sadeghi H, Birnbaumer M 1996 A fully active non-glycosylated V2 vasopressin receptor. Mol Pharmacol 50:467–473[Abstract]
  17. Whaley BS, Yuan N, Birnbaumer L, Clark RB, Barber R 1994 Differential expression of the ß-adrenergic receptor modifies agonist stimulation of adenylyl cyclase: a quantitative evaluation. Mol Pharmacol 45:481–489[Abstract]
  18. Lawrence DMP, Bidlack JM 1992 Kappa opioid binding sites on the R1. 1 murine lymphoma cell line sensitiv-ity to cations, guanine nucleotides. J Neuroimmunol 41:223–230[CrossRef][Medline]
  19. Kong H, Raynor K, Yasuda K, Bell GI, Reisine T 1993 Mutation of an aspartate at residue 89 in somatostatin receptor subtype 2 prevents Na+ regulation of agonist binding but does not alter receptor-G protein association. Mol Pharmacol 44:380–384[Abstract]
  20. Whaley BS, Yuan N, Barber R, Clark RB 1995 ß-adrenergic regulation of adenylyl cyclase: effect of receptor number. Pharmacol Commun 6:203–210
  21. Pan Y, Wilson P, Gitschier J 1994 The effect of eight V2 vasopressin receptor mutations on stimulation of adenylyl cyclase, binding to vasopressin. J Biol Chem 269:31933–31937[Abstract/Free Full Text]
  22. Yokoyama K, Yamauchi A, Izumi M, Itoh T, Ando A, Imai E, Kamada T, Ueda N 1996 A low-affinity vasopressin V2-receptor gene in a kindred with X-linked nephrogenic diabetes insipidus. J Am Soc Nephrol 7:410–414[Abstract]
  23. Tsukaguchi H, Matsubara H, Inada M 1995 Expression studies of two vasopressin V2 receptor gene mutations, R202C, 804insG, in nephrogenic diabetes insipidus. Kidney Int 48:554–562[Medline]
  24. Sanger F, Nicklen S, Coulson AB 1977 DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467[Abstract/Free Full Text]
  25. Luthman H, Magnusson G 1983 High efficiency polyoma DNA transfection of chloroquine treated cells. Nucleic Acid Res 11:1295–1308[Abstract/Free Full Text]
  26. Graham FL, Van der Eb AJ 1973 A new technique for the assay of infectivity of human adenovirus SDN A. Virology 52:456–467[CrossRef][Medline]
  27. Bockaert J, Hunzicker-Dunn M, Birnbaumer L 1976 Hormone-stimulated desensitization of hormone-dependent adenylyl cyclase. Dual action of luteinizing hormone on pig graafian follicle membranes. J Biol Chem 251:2653–2663[Abstract/Free Full Text]
  28. Salomon Y, Londos C, Rodbell M 1974 A highly sensitive adenylate cyclase assay. Anal Biochem 58:541–548[CrossRef][Medline]
  29. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ 1951 Protein measurement with the Folin phenol reagent. J Biol Chem 193:265–275[Free Full Text]
  30. Keefer JR, Limbird LE 1993 The alpha 2A-adrenergic receptor is targeted directly to the basolateral membrane domain of Madin-Darby canine kidney cells independent of coupling to pertussis toxin GTP-binding proteins. J Biol Chem 268:11340–11347, 1993[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
J. H. Robben, N. V. A. M. Knoers, and P. M. T. Deen
Cell biological aspects of the vasopressin type-2 receptor and aquaporin 2 water channel in nephrogenic diabetes insipidus.
Am J Physiol Renal Physiol, August 1, 2006; 291(2): F257 - F270.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
V. Bernier, J.-P. Morello, A. Zarruk, N. Debrand, A. Salahpour, M. Lonergan, M.-F. Arthus, A. Laperriere, R. Brouard, M. Bouvier, et al.
Pharmacologic Chaperones as a Potential Treatment for X-Linked Nephrogenic Diabetes Insipidus
J. Am. Soc. Nephrol., January 1, 2006; 17(1): 232 - 243.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. H. Robben, N. V. A. M. Knoers, and P. M. T. Deen
Characterization of vasopressin V2 receptor mutants in nephrogenic diabetes insipidus in a polarized cell model
Am J Physiol Renal Physiol, August 1, 2005; 289(2): F265 - F272.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. P. Thomas, R. W. Loftus, and K. Z. Liu
AVP-induced VIT32 gene expression in collecting duct cells occurs via trans-activation of a CRE in the 5'-flanking region of the VIT32 gene
Am J Physiol Renal Physiol, September 1, 2004; 287(3): F460 - F468.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y.-X. Tao and D. L. Segaloff
Functional Characterization of Melanocortin-3 Receptor Variants Identify a Loss-of-Function Mutation Involving an Amino Acid Critical for G Protein-Coupled Receptor Activation
J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 3936 - 3942.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
C. Boccalandro, F. de Mattia, D.-C. Guo, L. Xue, P. Orlander, T. M. King, P. Gupta, P. M.T. Deen, V. R Lavis, and D. M. Milewicz
Characterization of an Aquaporin-2 Water Channel Gene Mutation Causing Partial Nephrogenic Diabetes Insipidus in a Mexican Family: Evidence of Increased Frequency of the Mutation in the Town of Origin
J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1223 - 1231.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Birnbaumer
The V2 vasopressin receptor mutations and fluid homeostasis
Cardiovasc Res, August 15, 2001; 51(3): 409 - 415.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Inaba, H. Hatakeyama, N. Taniguchi, and I. Miyamori
The Property of a Novel V2 Receptor Mutant in a Patient with Nephrogenic Diabetes Insipidus
J. Clin. Endocrinol. Metab., January 1, 2001; 86(1): 381 - 385.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. S. Barak, R. H. Oakley, S. A. Laporte, and M. G. Caron
Constitutive arrestin-mediated desensitization of a human vasopressin receptor mutant associated with nephrogenic diabetes insipidus
PNAS, December 22, 2000; (2000) 11303698.
[Abstract] [Full Text]


Home page
J. Am. Soc. Nephrol.Home page
E. ALBERTAZZI, D. ZANCHETTA, P. BARBIER, S. FARANDA, A. FRATTINI, P. VEZZONI, M. PROCACCIO, A. BETTINELLI, F. GUZZI, M. PARENTI, et al.
Nephrogenic Diabetes Insipidus: Functional Analysis of New AVPR2Mutations Identified in Italian Families
J. Am. Soc. Nephrol., June 1, 2000; 11(6): 1033 - 1043.
[Abstract] [Full Text]


Home page
J. Am. Soc. Nephrol.Home page
M.-F. ARTHUS, M. LONERGAN, M. J. CRUMLEY, A. K. NAUMOVA, D. MORIN, L. A. DE MARCO, B. S. KAPLAN, G. L. ROBERTSON, S. SASAKI, K. MORGAN, et al.
Report of 33 Novel AVPR2 Mutations and Analysis of 117 Families with X-Linked Nephrogenic Diabetes Insipidus
J. Am. Soc. Nephrol., June 1, 2000; 11(6): 1044 - 1054.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Pasel, A. Schulz, K. Timmermann, K. Linnemann, M. Hoeltzenbein, J. Jääskeläinen, A. Grüters, G. Filler, and T. Schöneberg
Functional Characterization of the Molecular Defects Causing Nephrogenic Diabetes Insipidus in Eight Families
J. Clin. Endocrinol. Metab., April 1, 2000; 85(4): 1703 - 1710.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
B. D. Gaylinn, V. I. DeAlmeida, C. E. Lyons Jr., K. C. Wu, K. E. Mayo, and M. O. Thorner
The Mutant Growth Hormone-Releasing Hormone (GHRH) Receptor of the Little Mouse Does Not Bind GHRH
Endocrinology, November 1, 1999; 140(11): 5066 - 5074.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. Nakamura, J. G. Krupnick, J. L. Benovic, and M. Ascoli
Signaling and Phosphorylation-impaired Mutants of the Rat Follitropin Receptor Reveal an Activation- and Phosphorylation-independent but Arrestin-dependent Pathway for Internalization
J. Biol. Chem., September 18, 1998; 273(38): 24346 - 24354.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. S. Barak, R. H. Oakley, S. A. Laporte, and M. G. Caron
Constitutive arrestin-mediated desensitization of a human vasopressin receptor mutant associated with nephrogenic diabetes insipidus
PNAS, January 2, 2001; 98(1): 93 - 98.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sadeghi, H.
Right arrow Articles by Birnbaumer, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sadeghi, H.
Right arrow Articles by Birnbaumer, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals