| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Anesthesiology (H.S., G.I., M.B.) University of
California Los Angeles School of Medicine Los Angeles, California
90095
Department of Medicine (D.G.B.) Université de
Montréal Centre de Recherche et Unité de Recherches
Cliniques Hôpital du Sacré-Coeur de Montréal
Montréal, Québec, H4J 1C5 Canada
Center for
Endocrinology, Metabolism, and Nutrition (G.L.R.) Northwestern
University Medical School Chicago, Illinois 60611-3008
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
We have previously characterized the biochemical defect that alters the activity of two mutant forms of V2R in individuals affected with NDI. Missense mutations in codons 113 and 137 (R113W and R137H) were found to significantly reduce receptor expression in transfected cells, possibly due to misfolding of the protein. Additionally, the R137H mutation abolished coupling to G proteins, and the R113W mutation reduced receptor ligand-binding affinity and Gs coupling to such an extent that the kidney challenged either by dehydration or infusions of DDAVP was unable to produce concentrated urine, thus displaying a complete phenotype (7, 8, 9). Experiments examining the traffic of proteins in transfected cells have shown that many of the missense mutations impair severely the processing of the receptor protein and result in trapping of the misfolded receptor protein in the endoplasmic reticulum (10, 11).
Recently, four families with individuals exhibiting a partial NDI phenotype were identified. While subjected to dehydration (a condition that increases the circulating levels of AVP), the kidneys of these patients were able to produce concentrated urine. They responded in a similar manner to infusions of high doses of DDAVP (Ref. 6 and G. Robertson, and D. G. Bichet, manuscript in preparation). Analysis of the V2R gene in these families revealed two new mutations: one at Asp85, the other at Gly201. To characterize their activity, the mutant receptors were expressed in HEK 293 cells. Both mutant receptors were transported to the cell surface and exhibited alterations in their ligand-binding affinity. The Gly201Asp mutation reduced the number of receptor sites per cell, while the Asp85Asn mutant was expressed at the same level as wild type receptor. The coupling efficiency and the level of expression of the mutant receptors were examined and compared with the wild type.
| RESULTS |
|---|
|
|
|---|
|
2-adrenergic
receptor, Limbird and collaborators (13, 14) found the Asp in the
equivalent position to be required for the receptor to display agonist
binding sensitivity to Na+ and for regulation of ion
fluxes. In previous studies, we examined whether we could detect an
effect of Na+ on the V2R-mediated stimulation of cAMP
accumulation in intact cells. To this end we determined dose-response
curves to AVP in the presence of either 140 mM NaCl or 140
mM Glucamine·HCl, and found them identical, indicating
that this amino acid does not confer sodium sensitivity to the V2R
(15). Thus, we did not expect to detect alterations in receptor
function related to sodium ions in this mutant receptor.
The binding characteristics of the D85N mutant receptor were determined
in HEK 293 cells expressing the transfected receptor. All assays were
performed in parallel with cells transfected with the wild type V2R. As
shown in Fig. 2
and Table 1
, the mutation reduced the binding
affinity of the receptor approximately 6-fold, but did not seem to
interfere with the maturation and transport of the protein to the cell
surface since the receptor abundance was virtually identical for cells
that expressed either receptor: 1.7 ± 0.13 x 106vs. 1.9 ± 0.19 x 106 sites
per cell for the wild type and the D85N mutant, respectively. After
metabolic labeling of transfected COS cells and immunoprecipitation of
the receptor, the radioactive band corresponding to the mature D85N
mutant receptor protein detected by SDS-PAGE was of equivalent
intensity to the band obtained from expression of the wild type
receptor as shown in Fig. 3B
. The bands
of the glycosylated receptor protein were characterized as mature by
their resistance to Endoglycosidase H and sensitivity to PNGase F
treatments (16). The data on protein expression were in agreement with
the receptor abundance determined by the saturation binding
experiments.
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
-2 adrenergic
receptor required for coupling to ion flux and responsible for the
modulation of agonist binding by sodium ions (13). A similar role has
been described for this amino acid in the opioid and somatostatin
receptors (18, 19). Mutagenesis of this amino acid did not alter the
ligand-binding affinity of these receptors. Chung et al. had
observed that mutating the equivalent Asp of the ß-adrenergic
receptor to Asn reduced agonist-binding affinity approximately 50-fold
and shifted the EC50 for cAMP accumulation more than
100-fold (12).
Results obtained in vitro with the D85N mutant V2R, and in
affected individuals by DDAVP infusion (G. Robertson and D. G.
Bichet, in preparation), revealed that for this receptor the
consequences of the Asp to Asn change are somewhere between the very
dramatic loss of function seen with the ß-adrenergic receptor and the
subtle alterations in coupling seen with the
2A-adrenergic receptors. Based on the in
vitro data, carriers of the D85N mutation are expected to express
normal levels of receptor in their kidneys, which have reduced coupling
due to a diminished binding affinity for AVP and reduced coupling with
Gs. This situation could reduce the response to normal
levels of endogenous AVP sufficiently to produce NDI. This deficiency
can be overcome by the high AVP levels induced by dehydration.
Likewise, these patients are expected to respond to DDAVP infusions, as
they do (G. Robertson and D. G. Bichet, manuscript in
preparation).
For the G201D mutation, although the functional impairment of the receptor to stimulate cAMP production in transfected cells is similar to the one found with the Arg113Trp mutation (15) detected in patients that exhibit the full NDI phenotype, the reduction in receptor abundance to 30% of wild type levels and the preservation of better ligand-binding affinity, as compared with the R113W mutant, leave sufficient receptor on the cell surface to allow the principal cell to respond to elevated levels of AVP or DDAVP. The change in coupling efficiency for this mutant receptor was not considered significant because, according to Whaley et al. (20), a 2-fold variation of this parameter was found when the coupling efficiency of different cells expressing the ß2-adrenergic receptor were compared.
Other NDI mutations have been found in this second extracellular loop, and three have been expressed and characterized. Coincidentally the three result in the appearance of extra cysteines in the loop. Pan et al. (21) described that the R181C mutant V2R was expressed at similar levels as the wild type receptor, but its ligand-binding affinity has been reduced 20-fold. No phenotype information was provided. The other two mutations, R202C and Y205C, had different effects on receptor funtion (22, 23). The R202C mutation interfered with the traffic of the V2 receptor to the cell surface, and reduced the level of expression by 10-fold or more. Nevertheless a KD similar to the wild type value was reported for the receptor expressed in COS cells. This is reminiscent of the impact of the R137H mutation on these parameters (8). The ability of this mutant receptor to mediate AVP stimulation of adenylyl cyclase activity was not reported.
On the other hand, the Y205C mutation did not change the level of receptor expression, an indication of normal traffic to the plasma membrane, but reduced the ligand-binding affinity for AVP about 10-fold. Similar to what was observed for the G201D mutant receptor, the Y205C receptor stimulated cAMP accumulation with an EC50 for AVP 100-fold higher than the wild type. The similar findings in coupling between mutations affecting G201 and Y205 are not surprising, since both occur in the same region of the receptor. However, the difference in ligand-binding affinity indicates a greater impact of the Y205C mutation on AVP binding. There is no mention in Ref. 21 as to whether the patient carrying this mutation had a full or partial phenotype, but the report mentions that the patient was diagnosed at age 46, and the urinary osmolality was 293 mosmol/kg under normal hydration conditions, a value of urinary osmolality unusually high for an NDI patient. Considering the age of the patient and the absence of mental retardation, a common sequel of severe episodes of hypernatremia triggered by dehydration, the possibility that the Y205C mutation is associated with a partial NDI phenotype must be considered. This becomes more likely when the functional characteristics and level of expression of the Y205C and G201D mutant receptors are examined.
In conclusion, the functional characteristics and level of expression of these receptor mutants correlate well with the phenotypes observed and demonstrate different mechanisms that lead to a reduction in the normal response of the kidney to AVP. For the D85N mutant V2R the combination of reduced ligand-binding affinity and efficient coupling to Gs has similar consequences as the decrease in cell surface expression with minimal changes in functional parameters for the G201D V2R. The second situation reinforces our previous conclusions as to the importance of the number of receptors per cell in determining the ability to respond to normal levels of circulating AVP.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-32P]ATP, specific
activity 3000 Ci/mmol, and EXPRE35S35S Protein
Labeling Mix, specific activity >1000 Ci/mmol were purchased from
Dupont-New England Nuclear (Boston, MA) [3H]cAMP was from
ICN Biochemicals (Irvine, CA).
Construction of Mutant V2Rs
Genomic DNA from the white blood cells of patients with X-linked
recessive NDI was used as template for the PCR. For the D85N mutation,
primers 23 (5'CCCAGCCTGCCCAGCAAC-3' sense) and 65
(5'CGCTGGGCGAAGATGAAGAGCT3' antisense) were used to amplify the regions
containing the mutation. The PCR product was digested with
NheI and EagI and purified by electrophoresis
through GTG-agarose. The cDNA encoding the wild type human V2R (2),
cloned into the EcoRI site of pGEM-3, was digested with
NheI and EagI, dephosphorylated, and purified by
electrophoresis through GTG-agarose gel. The linearized plasmid was
ligated to the PCR fragments containing the D85N mutation. A similar
procedure was applied to introduce the G201D mutation into the cDNA of
the human V2R. For the latter, primers 13 (5'-TGACGCTGGACCGCCACCGTG-3'
sense) and 60 (5'AGCACAGCACATAGACGACCA-3' antisense) were used to
generate the PCR product. This product was digested with
EagI and Bsa A1, gel purified, and ligated into the
dephosphorylated and purified wtV2R cDNA in pGEM3 that had been
digested with EagI and Bsa A1. The resulting constructs were
sequenced fully by the dideoxy chain termination method of Sanger
et al. (24). For expression in eukaryotic cells the cDNAs
bearing the D85N and the G201D mutations were excised from their
vectors with EcoRI and ligated into the dephosphorylated
expression vector pcDNA3 (In-vitrogen, Boston, MA).
Cell Culture
HEK 293 cells were grown in DMEM-high glucose, supplemented with
10% heat-inactivated FBS, penicillin (50 U/ml), and streptomycin (50
µg/ml).
Transient Expression in Cells
Subconfluent HEK 293 cells were plated at a density of 2.8
x 106 cells per 100-mm dish and transfected the following
day by a modification of the method of Luthman and Magnusson (25).
Briefly, cells were transfected by replacing the growth medium with 6.7
ml of a mixture of 100 µM chloroquine and 0.25 mg/ml
diethylaminoethyl-dextran in DMEM with 10% FBS containing 3 µg DNA.
After 2 h at 37 C, the solution was removed and the cells were
treated for 1 min at room temperature with 10% DMSO in PBS. The cells
were rinsed twice with PBS and incubated overnight in growth
medium.
Stable Expression in HEK 293 Cells
HEK 293 cells, kept subconfluent, were transfected by the
calcium phosphate precipitation technique of Graham and van der Eb
(26). Briefly, cells were grown in DMEM containing 10% FBS, penicillin
(50 U/ml), and streptomycin (50 µg/ml). The day before transfection
12 x 106 cells were plated into each of two 100-mm
plates. The DNA-calcium phosphate coprecipitate containing 10 µg
pcDNA3 was prepared in a sterile hood immediately before use with all
reagents at 37 C. The reagents were mixed in a 15-ml sterile
polystyrene tube in this order: 10 µg plasmid DNA in 10
mM Tris-HCl, pH 7.5, 1 mM EDTA, sterile
H2O to bring the volume to 900 µl, 1 ml of 250
mM CaCl2 followed by 100 µl of 15
mM Na2HPO4, 50 mM
HEPES, 150 mM NaCl, and 5 mM KCl, adjusted to
pH 7.05 with NaOH. All reagents were added dropwise and slowly with
gentle mixing after each addition. After 10 min at room temperature, 1
ml of the whitish suspension was added dropwise to each plate and mixed
by gentle swirling. After 18 h in the incubator, the medium was
removed and cells were treated with 2 ml of 25% glycerol in HBSS at 37
C. After 1 min the glycerol/HBSS mixture was diluted with 10 ml HBSS
added slowly with continuous mixing. The solutions were then aspirated,
and the rinse with HBSS was repeated. After fresh medium was added, the
plates were returned to the incubator. The next day, the cells were
trypsinized and diluted with the selection medium containing G-418 400
µg/ml. Cells were then distributed into the wells of two 96-well
microtitration plates (2000 to 4000 cells per well) using a COSTAR
transplate device. G418-resistant clones were picked (after 1618
days) and expanded in six-well plates to assay for stimulation of
adenylyl cyclase activity as described.
Hormone Binding to Intact Cells
Cells were plated in 12-well plates at a density of
0.51.0 x 105 cells per well. Binding assays were
performed the following day. Cells were washed twice with ice-cold
D-PBS, after which each well received 0.5 ml of ice-cold D-PBS with 2%
BSA and the appropriate dilution of [3H]AVP. Plates were
incubated for 2 h on top of crushed ice in the cold room before
removal of the binding mixture by aspiration. After quickly rinsing
twice with ice-cold D-PBS, 0.5 ml of 0.1 N NaOH was added
to each well to extract bound radioactivity. After 30 min at 37 C, the
fluid from the wells was transferred to scintillation vials containing
3.5 ml of ULTIMA-FLO M (Packard, Meriden, CT) scintillation fluid for
radioassay. Nonspecific binding was determined under the same
conditions in the presence of 10 µM unlabeled AVP (9).
Replicate plated wells were trypsinized and their cell content
determined to normalize the results as binding sites per cell. Binding
experiments were performed five times.
Adenylyl Cyclase Activity in Cell Homogenates
Adenylyl cyclase activity was determined as previously described
(9). The medium contained, in a final volume of 50 µl, 0.1
mM [32P]ATP (15 x 106
cpm), 1.6 mM MgCl2, 10 µM GTP, 1
mM EDTA, 1 mM [3H]cAMP (
10,000
cpm), 2 mM isobutylmethylxanthine, a nucleoside
triphosphate-regenerating system composed of 20 mM creatine
phosphate, 0.2 mg/ml (2000 U/mg) creatine phosphokinase, 0.02 mg/ml
myokinase (448 U/mg), and 25 mM Tris-HCl, pH 7.4. The
incubations were at 32 C for 20 min. Hormones (diluted in 1% BSA) were
present at the concentrations indicated on the figures. Reactions were
stopped by the addition of 100 µl of a solution containing 40
mM ATP, 10 mM cAMP, and 1% SDS. The cAMP
formed was isolated by a modification (27) of the standard double
chromatography over Dowex-50 and alumina columns (28).
Under these assay conditions, cAMP accumulations were linear with time of incubation for up to 40 min and proportional to the amounts of homogenate. The activities were expressed as picomoles of cAMP formed per min per mg of homogenate protein and normalized by the maximal value of adenylyl cyclase activity obtained with the addition of 100 nM VIP. Protein content was determined by the method of Lowry et al. (29) using BSA as standard.
Genomic Analysis
Analysis of the Xq28 haplotypes and the amplification and
sequencing of the gene encoding the V2R was performed as described in
Ref. 7. The entire gene encoding the V2R was sequenced for at least one
affected male from each family. From the four families tested, the
entire genes of six affected males, seven female carriers, and four
nonaffected males were sequenced. The presence or absence of mutations
was also confirmed by restriction enzyme analysis.
Metabolic Labeling with
[35S]Methionine/Cysteine and
Immunoprecipitation
Proteins were labeled in 100-mm dishes by a modification of the
method published by Keefer and Limbird (30). Forty eight hours after
transfection, cells were starved for 1 h in
methionine/cysteine-free DMEM and then labeled for 1 or 2 h with 2
ml of the same medium containing 100 µCi of
EXPRE35S35S Protein Labeling Mix/plate. Cells
were then rinsed, washed twice with ice-cold D-PBS, scraped from the
plate, and collected by centrifugation. The cell pellet from each plate
was disrupted in 500 µl RIPA buffer (150 mM NaCl, 50
mM Tris·HCl, pH 8.0, 5 mM EDTA, 1% Nonidet
P-40, 0.5% deoxycholic acid, 0.1% SDS containing protease inhibitors:
0.1 mM PMSF, 1 µg/ml soybean trypsin inhibitor, 0.5
µg/ml leupeptin). Homogenization was achieved by drawing the cells
through needles of decreasing gauge (20G, 25G) fitted into a 3-ml
plastic syringe. Cell extracts were then clarified by mixing them with
50 µl of a 50% slurry of prewashed Protein A-Sepharose in the same
buffer. Prewashed Protein A-Sepharose was prepared by addition of 1.0
ml of 25 mg/ml BSA in RIPA buffer, mixed for 1 h, and then washed
twice with RIPA buffer alone. For immunoprecipitation, an antibody
raised against a portion of third intracellular loop of human V2R
(AntiV2 2, peptide VPGPSERPGGRRRGR) was added to the clarified
extracts at a concentration of 10 µg/ml and incubated overnight at 4
C. The antigen/antibody complexes were then separated by incubating the
mixture with prewashed Protein A-Sepharose for 2 h at the same
temperature. The beads were centrifuged and washed three times for 4
min on ice with RIPA buffer. The samples were then eluted with 80 µl
of 100 µM peptide 2 in RIPA buffer for 30 min at room
temperature and, after addition of 1 mU of Endoglycosidase H or 100 mU
of PNGase F, the eluates were incubated at room temperature for 1
h. After mixing with an equal volume of 2x sample buffer containing
10% ß-mercaptoethanol, the samples were electrophoresed in 10%
SDS-polyacrylamide gels. Radioactive bands were visualized by treating
the gel with Amplify®, and the dried gels were exposed to Kodak-Xomat
film at -70 C for the indicated times. For determination of the
relative intensity of the obtained band, densitometric measurements
were performed using the Bio-Rad Imaging Densitometer Model GS-670
(Bio-Rad, Hercules, CA).
Calculation of Coupling Efficiency
Calculations of coupling efficiency for the V2R were performed
as described by Whaley et al. (17) for the ß2-adrenergic
receptor in an attempt to quantify the relationship between stimulation
of adenylyl cyclase activity and the level of receptor expression in
transfected cells. The formulas applied for the wild type receptor
were:
![]() |
![]() |
For mutant receptors Whaley et al. developed a formula based
on formula (10) of reference 17:
![]() |
![]() |
![]() |
![]() |
| FOOTNOTES |
|---|
This work was supported in part by Grants NIH DK 41244 (to M.B.), 2M01 RR00048 to the General Clinical Research Center at Northwestern University, and Medical Research Council of Canada (MT-8126). D.G.B. is a Career Investigator of the Fonds de la Recherche en Santé du Québec.
Received for publication February 14, 1997.
Revision received August 4, 1997.
| REFERENCES |
|---|
|
|
|---|
2-adrenergic
receptors by sodium. J Biol Chem 265:2159021595
-adrenoceptor that blocks coupling to potassium
but not calcium currents. Science 257:977980This article has been cited by other articles:
![]() |
K. Tan, I. D. Pogozheva, G. S. H. Yeo, D. Hadaschik, J. M. Keogh, C. Haskell-Leuvano, S. O'Rahilly, H. I. Mosberg, and I. S. Farooqi Functional Characterization and Structural Modeling of Obesity Associated Mutations in the Melanocortin 4 Receptor Endocrinology, January 1, 2009; 150(1): 114 - 125. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Robben, N. V. A. M. Knoers, and P. M. T. Deen Cell biological aspects of the vasopressin type-2 receptor and aquaporin 2 water channel in nephrogenic diabetes insipidus. Am J Physiol Renal Physiol, August 1, 2006; 291(2): F257 - F270. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bernier, J.-P. Morello, A. Zarruk, N. Debrand, A. Salahpour, M. Lonergan, M.-F. Arthus, A. Laperriere, R. Brouard, M. Bouvier, et al. Pharmacologic Chaperones as a Potential Treatment for X-Linked Nephrogenic Diabetes Insipidus J. Am. Soc. Nephrol., January 1, 2006; 17(1): 232 - 243. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Robben, N. V. A. M. Knoers, and P. M. T. Deen Characterization of vasopressin V2 receptor mutants in nephrogenic diabetes insipidus in a polarized cell model Am J Physiol Renal Physiol, August 1, 2005; 289(2): F265 - F272. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Thomas, R. W. Loftus, and K. Z. Liu AVP-induced VIT32 gene expression in collecting duct cells occurs via trans-activation of a CRE in the 5'-flanking region of the VIT32 gene Am J Physiol Renal Physiol, September 1, 2004; 287(3): F460 - F468. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-X. Tao and D. L. Segaloff Functional Characterization of Melanocortin-3 Receptor Variants Identify a Loss-of-Function Mutation Involving an Amino Acid Critical for G Protein-Coupled Receptor Activation J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 3936 - 3942. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Boccalandro, F. de Mattia, D.-C. Guo, L. Xue, P. Orlander, T. M. King, P. Gupta, P. M.T. Deen, V. R Lavis, and D. M. Milewicz Characterization of an Aquaporin-2 Water Channel Gene Mutation Causing Partial Nephrogenic Diabetes Insipidus in a Mexican Family: Evidence of Increased Frequency of the Mutation in the Town of Origin J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1223 - 1231. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Birnbaumer The V2 vasopressin receptor mutations and fluid homeostasis Cardiovasc Res, August 15, 2001; 51(3): 409 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Inaba, H. Hatakeyama, N. Taniguchi, and I. Miyamori The Property of a Novel V2 Receptor Mutant in a Patient with Nephrogenic Diabetes Insipidus J. Clin. Endocrinol. Metab., January 1, 2001; 86(1): 381 - 385. [Abstract] [Full Text] |
||||
![]() |
L. S. Barak, R. H. Oakley, S. A. Laporte, and M. G. Caron Constitutive arrestin-mediated desensitization of a human vasopressin receptor mutant associated with nephrogenic diabetes insipidus PNAS, December 22, 2000; (2000) 11303698. [Abstract] [Full Text] |
||||
![]() |
E. ALBERTAZZI, D. ZANCHETTA, P. BARBIER, S. FARANDA, A. FRATTINI, P. VEZZONI, M. PROCACCIO, A. BETTINELLI, F. GUZZI, M. PARENTI, et al. Nephrogenic Diabetes Insipidus: Functional Analysis of New AVPR2Mutations Identified in Italian Families J. Am. Soc. Nephrol., June 1, 2000; 11(6): 1033 - 1043. [Abstract] [Full Text] |
||||
![]() |
M.-F. ARTHUS, M. LONERGAN, M. J. CRUMLEY, A. K. NAUMOVA, D. MORIN, L. A. DE MARCO, B. S. KAPLAN, G. L. ROBERTSON, S. SASAKI, K. MORGAN, et al. Report of 33 Novel AVPR2 Mutations and Analysis of 117 Families with X-Linked Nephrogenic Diabetes Insipidus J. Am. Soc. Nephrol., June 1, 2000; 11(6): 1044 - 1054. [Abstract] [Full Text] |
||||
![]() |
K. Pasel, A. Schulz, K. Timmermann, K. Linnemann, M. Hoeltzenbein, J. Jääskeläinen, A. Grüters, G. Filler, and T. Schöneberg Functional Characterization of the Molecular Defects Causing Nephrogenic Diabetes Insipidus in Eight Families J. Clin. Endocrinol. Metab., April 1, 2000; 85(4): 1703 - 1710. [Abstract] [Full Text] |
||||
![]() |
B. D. Gaylinn, V. I. DeAlmeida, C. E. Lyons Jr., K. C. Wu, K. E. Mayo, and M. O. Thorner The Mutant Growth Hormone-Releasing Hormone (GHRH) Receptor of the Little Mouse Does Not Bind GHRH Endocrinology, November 1, 1999; 140(11): 5066 - 5074. [Abstract] [Full Text] |
||||
![]() |
K. Nakamura, J. G. Krupnick, J. L. Benovic, and M. Ascoli Signaling and Phosphorylation-impaired Mutants of the Rat Follitropin Receptor Reveal an Activation- and Phosphorylation-independent but Arrestin-dependent Pathway for Internalization J. Biol. Chem., September 18, 1998; 273(38): 24346 - 24354. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Barak, R. H. Oakley, S. A. Laporte, and M. G. Caron Constitutive arrestin-mediated desensitization of a human vasopressin receptor mutant associated with nephrogenic diabetes insipidus PNAS, January 2, 2001; 98(1): 93 - 98. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |