help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duval, D. L.
Right arrow Articles by Clay, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duval, D. L.
Right arrow Articles by Clay, C. M.
Molecular Endocrinology 11 (12): 1814-1821
Copyright © 1997 by The Endocrine Society

The Tripartite Basal Enhancer of the Gonadotropin-Releasing Hormone (GnRH) Receptor Gene Promoter Regulates Cell-Specific Expression Through a Novel GnRH Receptor Activating Sequence

Dawn L. Duval, Scott E. Nelson and Colin M. Clay

Animal Reproduction and Biotechnology Laboratory Department of Physiology College of Veterinary Medicine and Biomedical Sciences Colorado State University Fort Collins, Colorado 80523


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The molecular mechanisms regulating restricted expression of GnRH receptor and gonadotropin subunit genes to gonadotrope cells have been the focus of intense interest. Using deletion and mutational analysis we have identified a tripartite enhancer that regulates cell-specific expression of the GnRH receptor gene in the gonadotrope-derived {alpha}T3–1 cell line. Individual elements of this enhancer include binding sites for steroidogenic factor-1; activator protein 1 (AP-1); and a novel element referred to as the GnRH receptor activating sequence (GRAS). Mutation of each element alone results in loss of approximately 60% of promoter activity. Combinatorial mutations of any two elements decreases promoter activity by approximately 80%. Finally, mutation of all three elements reduces promoter activity to a level not different from promoterless vector. Using 2-bp mutations, we have defined the functional requirements for transcriptional activation by GRAS. The core motif of GRAS is at -391 to -380 bp relative to the start site of translation and has the sequence 5'-CTAGTCACAACA-3'. Three copies of GRAS or GRAS with a 2-bp mutation (µGRAS) were cloned into a luciferase expression vector immediately upstream of the thymidine kinase minimal promoter (TK) and tested for expression in {alpha}T3–1 cells. When compared with TK promoter alone, activity of 3xGRAS-TKLUC was increased by more than 5-fold while activity of 3xµGRAS-TKLUC was unchanged. When 3xGRAS-TKLUC was transfected into a variety of nongo-nadotrope cell lines, it did not increase activity of the TK promoter. We propose that basal activity of the GnRH receptor gene is regulated by a tripartite enhancer, and the key component of this enhancer is an element, GRAS, that activates transcription in a cell-specific fashion.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The ordered emergence of corticotropes, thyrotropes, somatotropes, mammotropes, and gonadotropes in the anterior pituitary gland and the selective secretion of their respective hormones provide an excellent opportunity to study molecular mechanisms underlying cell-specific gene regulation (1). Definition of the molecular codes that direct cell-specific gene expression of the common glycoprotein hormone {alpha}-subunit, the unique LH and FSH ß-subunits, and the GnRH receptor (GnRH-R) to gonadotropes has advanced rapidly during the past few years. Key to this progress has been use of transgenic technologies (2, 3) and availability of the gonadotrope-derived {alpha}T3–1 cell line that expresses GnRH-Rs and the {alpha}-subunit, but not the specific LH and FSH ß-subunits (4).

Analysis of {alpha}-subunit promoter activity has led to the identification of multiple cis-acting elements that interact to regulate pituitary and gonadotrope-specific expression. As might be expected, several of these elements appear to be conserved in the promoters of {alpha}-subunit genes across multiple species. These elements include a binding site for a LIM (lin-11, isl-1, mec-3)-homeodomain protein (5, 6), which cooperates with two regulatory proteins that bind to immediately adjacent elements (7); several canonical E-boxes (8); the {alpha}ACT element that binds members of the GATA binding factor family (9); and the gonadotrope-specific element or GSE that binds the nuclear orphan receptor, steroidogenic factor-1 (SF-1) (10, 11). In addition to these elements, the human glycoprotein hormone {alpha}-subunit gene also contains tandem cAMP-responsive elements (CREs) that are important for basal promoter activity not only in the pituitary but also in placenta, a normal site of expression of the {alpha}-subunit gene in primates (12, 13, 14).

While considerably less is known regarding the organization of regulatory elements in the promoters for the gonadotropin ß-subunit genes, functional homologs of the {alpha}-subunit GSE have been identified in the proximal promoter of both the rat (15) and bovine LH ß-subunit genes (16). More recently, we have identified a GSE homolog located at -245 to -237 bp in the murine GnRH-R gene promoter (17). This GSE homolog, as with those in the {alpha}- and LH ß- subunit genes, is capable of binding SF-1, and mutation of this element leads to approximately 60% loss of promoter activity in {alpha}T3–1 cells. Thus, the conserved function of the GSE in the common {alpha}, LHß, and GnRH-R genes suggests that SF-1, or a very similar protein, serves a common role in regulating expression of multiple gonadotrope-specific genes. Consistent with this regulatory role is the restricted expression of SF-1 to gonadotrope cells in the anterior pituitary gland (18). However, SF-1 is also expressed in a number of extrapituitary sites, most prominently in steroidogenic tissues including the ovaries, testes, and adrenal glands (19, 20). Consequently, while the GSE is a key element in the murine GnRH-R gene promoter, the nonpituitary expression of SF-1 suggests to us that this element alone may not be the key mediator of cell-specific expression.

In this regard, we have used a combination of deletion and mutational analyses to define multiple elements in the proximal promoter of the murine GnRH-R gene. Of particular importance to basal activity in {alpha}T3–1 cells were elements residing within the proximal 500 bp of 5'-flanking sequence and, more specifically, in the region residing between -500 and -400 bp relative to the start site of translation (21). A functional scan of this 100-bp region by block replacement mutagenesis revealed the presence of two elements that contribute to basal activity of the murine GnRH-R promoter in {alpha}T3–1 cells (17). First, mutation of the region residing between -482 and -475 bp resulted in loss of approximately 25% of promoter activity. More importantly, however, was a 58% reduction in promoter activity upon mutation of the sequence between -393 and -386 bp. We have termed this more proximal element the GnRH-R-activating sequence (GRAS). Based on these studies, we proposed a model in which cell-specific activity of the murine GnRH-R gene promoter is mediated by a complex enhancer that includes, but is not limited to, a binding site for SF-1 and an element located at approximately -393 bp (17). Remaining at issue, however, is whether these elements fully account for basal activity of the murine GnRH-R promoter in {alpha}T3–1 cells or whether additional elements contribute to activity of the GnRH-R promoter. In particular, we were interested in addressing the potential contribution of a canonical activator protein 1 (AP-1) site (TGAGTCA) (22) located at -336 to -330 bp. Accordingly, in the current studies combinatorial mutagenesis was used to assess the relative contribution of multiple cis-acting elements to GnRH-R promoter function. Herein, we report that basal activity of the proximal promoter of the murine GnRH-R gene is dependent on an SF-1-binding site, an AP-1 element, and a novel element, termed GRAS, that is capable of conferring cell-specific activity on a heterologous, minimal promoter.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Multiple Elements Contribute to Basal Activity of the Murine GnRH-R Gene Promoter
To address the relative contributions of the SF-1-binding site, GRAS, and AP-1 elements, block replacement vectors were constructed that contained either a NotI (µSF-1, µGRAS) or EcoRI (µAP-1) restriction site in place of the wild type sequence. Each mutant was constructed in the context of 600 bp of proximal promoter and tested for activity by transient expression in {alpha}T3–1 cells. Consistent with previous data (17), mutations in both the SF-1-binding site (µSF-1) and GRAS (µGRAS) resulted in a greater (P < 0.05) than 50% attenuation in transcriptional activity (Fig. 1Go). Similarly, disruption of the canonical AP-1 element (µAP-1) at position -336 bp reduced (P < 0.05) promoter activity by 64% as compared with the wild type -600 promoter. An approximate 80% reduction (P < 0.05) in promoter activity was noted in vectors containing double mutation combinations of either µGRAS, µSF-1, or µAP-1. Finally, a vector containing mutations in all three of these elements reduced promoter activity to a level not different (P > 0.05) from the promoterless control (LUC). Thus, we suggest that three elements: an SF-1-binding site, an AP-1 site, and a noncanonical site located at -393 bp serve as the major elements mediating basal activity of the proximal murine GnRH-R promoter in {alpha}T3–1 cells.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 1. Three Major Elements Regulate Activity of the Cell-Specific Basal Promoter of the GnRH-R Gene

Vectors containing mutations in a single element, two elements, or all three elements were contransfected with pRSV-LacZ using LipofectAMINE as described in Materials and Methods. At 24 h posttransfection, cells were harvested and cellular lysates were assayed for luciferase and ß-galactosidase activity. Luciferase activity was adjusted for ß-galactosidase activity, and values are expressed as the percent of pMGR-600LUC activity (1.15 ± 0.311, mean ± SD). Values reported in the figure represent the mean ± SD of triplicate samples in at least three different transfections. a, b, c, d, Bars bearing different letters are different (P < 0.05). Unadjusted luciferase activity of pMGR-600LUC averaged 1297 ± 799 (mean ± SD).

 
Functional Fine-Mapping of the Region from -393 to -376 bp Outlines a New Element
To further refine the functional domain of GRAS, we generated a series of mutant vectors in which 2-bp transversion mutations were incorporated across the region from -395 to -378 bp (µGRAS-1 to µGRAS-9; Fig. 2Go). These mutant vectors were transiently transfected into {alpha}T3–1 cells and compared with the wild type promoter (pMGR-600LUC). Analysis of this series of mutations outlined a core motif in which µGRAS-3 through µGRAS-8 each reduced promoter activity by 56%, 64%, 68%, 43%, 61%, and 53%, respectively, as compared with pMGR-600LUC (all values P < 0.01; Fig. 2Go). Thus, each of these 2-bp transversion mutations reduced promoter activity by approximately the same amount (63%) as the block replacement mutant, µGRAS. Furthermore, the element outlined by these mutations was flanked on either end by a mutation that did not significantly effect promoter activity. Based on these data, the critical core motif of the GRAS element consists of the sequence 5'-CTAGTCACAACA-3' located at -391 to -380 bp. Finally, although µGRAS-1 also had significantly lower activity than pMGR-600LUC, it was separated from the motif by a 2-bp mutation that did not effect promoter activity and consequently was not considered part of the core element.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Functional Fine-Mapping of µ11 Reveals a New Element

To define the functional limits of the GRAS element, a series of 2-bp mutations were generated across the region from -395 to -378 in the context of the wild type pMGR-600LUC vector. The wild type sequence is shown across the top of the figure with the mutations in lowercase letters below. These vectors were cotransfected with RSV-LacZ in {alpha}T3–1 cells using the lipofectamine procedure as described in Materials and Methods. At 24 h posttransfection, the cells were harvested and assayed for luciferase and ß-galactosidase activity. Luciferase values were corrected for ß-galactosidase activity, and all values are expressed as the percent of pMGR-600LUC activity. Values represent the mean ± SD of triplicate samples in at least three different transfections. *, Vectors that are significantly different from pMGR-600LUC (P < 0.01).

 
GRAS Confers {alpha}T3–1 Cell-Specific Enhancer Activity upon a Heterologous Promoter
Next we sought to determine whether GRAS was capable of acting as a stand-alone enhancer of transcriptional activity and if so, whether the activation was cell-specific. An oligonucleotide containing the core motif plus four flanking bases at both the 5'- and 3'-ends, (5' CTGTCTAGTCACAACAGTTT-3'), was used to generate a luciferase expression vector in which two or three direct repeats of the element were inserted upstream of the TK minimal promoter (3xGRAS-TKLUC). We also constructed a similar vector with three direct repeats of the element mutated as in µGRAS-5 (5' CTGTCTAGGAACAACAGTTT 3'; 3xµGRAS-TKLUC), to verify that any transcriptional activation of 3xGRAS-TKLUC was due to binding of a specific protein(s) to the GRAS elements and not an artifact of vector construction. These vectors were transiently transfected into {alpha}T3–1 cells. While two copies of GRAS 5' to TK led to a modest 1.8-fold increase over TK (data not shown), addition of three copies of GRAS led to an approximately 5-fold increase (P < 0.01; Fig. 3Go) in luciferase expression as compared with the TK vector alone (TKLUC). Consistent with the mutational analysis, the insertion of three copies of µGRAS-5 did not lead to any enhancement of luciferase expression as compared with TKLUC (P > 0.05) (Fig. 3Go).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. The GRAS Element Acts as a Stand-Alone Enhancer

3xGRAS-TKLUC and 3xµGRAS-TKLUC were cotransfected with RSV-LacZ into {alpha}T3–1 cells using the lipofectamine procedure as described in Materials and Methods. At 24 h posttransfection, the cells were harvested and assayed for luciferase and ß-galactosidase activity. Luciferase values were corrected for ß-galactosidase activity, and all values are expressed as fold over the negative control TKLUC. *, Values significantly different from TKLUC P < 0.01.

 
To test whether the enhancer activity of 3XGRAS was confined to cells of gonadotrope origin, the 3xGRAS-TKLUC vector was transiently transfected into the {alpha}T3–1 cell line, Cos-7 kidney epithelial cells, GH3 pituitary somatotrope-derived cells, HeLa cervical carcinoma cells, BeWo human choriocarcinoma cells, and MA-10 Leydig tumor cells. As in the previous experiment, 3xGRAS-TKLUC activity was 6-fold greater (P < 0.001) than TKLUC in {alpha}T3–1 cells and 1.43-fold greater (P < 0.001) than TKLUC in BeWo cells (Fig. 4Go). Although the stimulation in BeWo cells was much less than that of the {alpha}T3–1 cell line, since GnRH-Rs are expressed in the human placenta (23, 24), GRAS may represent a mechanism underlying regulation of GnRH-Rs in the placenta. In contrast, three copies of GRAS had no effect (P > 0.05) on TKLUC activity in Cos-7, HeLa, GH3, or MA-10 cells.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. GRAS Has Enhancer Activity Only in the {alpha}T3–1 Cell Line

3xGRAS-TKLUC and pRSV-LacZ were cotransfected into {alpha}T3–1, HeLa, Cos-7, MA-10, BeWo, and GH3 cells as described in Materials and Methods. At 24 h posttransfections, the cells were harvested and assayed for luciferase and ß-galactosidase activity. Luciferase values were normalized for ß-galactosidase expression. Promoter activity is expressed as fold of TKLUC expression. ***, Values significantly different from TKLUC P < 0.001.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The restricted expression of a set of genes to a specific cell type provides an opportunity to dissect the common and unique pathways directing this cell-specific expression. Gonadotrope cells of the anterior pituitary gland are characterized by their expression of the common {alpha}-subunit and specific ß-subunits of the LH and FSH glycoprotein hormones, and the GnRH-R. The emerging model for gonadotrope expression of the {alpha}-subunit establishes that, as in placenta, tandem cAMP response elements (CREs) are critical for basal promoter activity (10, 25, 26), although different members of the CRE-binding protein/activating transcription factor family may bind these elements in trophoblasts and gonadotropes (14). In addition, four other elements contribute to gonadotrope expression. These elements are the GSE, the pituitary glycoprotein hormone basal element, and the {alpha}-basal elements 1 and 2 (5, 6, 7, 10, 11). These elements interact both additively and synergistically to create a complex combinatorial code that is responsible for expression of the common {alpha}-subunit in gonadotropes (7). Such an arrangement of multiple elements into complex enhancers that act to confer tissue/cell-specific expression has emerged as a hallmark of multiple genes (27, 28, 29). Thus, it seems likely that a complex enhancer may also mediate gonadotrope-specific expression of the LH ß-subunit and the GnRH-R. Although much less is known about the specific elements, there has been progress in recent years toward defining functional regions in the promoters of the LHß and GnRH-R genes. Of particular interest is the presence of functional SF-1-binding sites in both the LHß (15, 16) and the GnRH-R (17) genes. Therefore, among these genes expressed in gonadotropes, there appear to be both common and unique elements regulating gene expression. Such a combinatorial code allows both coordinated stimulation of the gene group as well as differential regulation of individual genes.

In the current study, we employed the gonadotrope-derived {alpha}T3–1 cell line as a model to further dissect the elements responsible for cell-specific basal activity of the GnRH-R gene promoter. We propose a model in which cell-specific basal activity is regulated by a tripartite enhancer composed of, but not limited to, binding sites for SF-1, AP-1, and a novel element we have termed GRAS. This model is based on several lines of evidence. First, the 250-bp region from -492 to -235 bp is capable of conferring full, cell-specific basal activity upon a heterologous minimal promoter (17). Second, within that 250-bp region we used block replacement mutagenesis to functionally define both the SF-1-binding site and the element located between -393 and -376 bp (GRAS) (17). Finally, in the present study, we have also identified a functional role for a canonical AP-1 element located at -336 to -330 bp. The individual mutation of each of these three elements results in a loss of approximately 60% of promoter activity, while the mutation of all three elements reduces luciferase expression to a level not significantly different from the promoterless luciferase vector. Although these data do not obviate the existence of other elements that may contribute to activity of the wild type promoter, it does suggest that these three elements are major contributors to basal promoter activity. Furthermore, since each of the three combinations of double mutations results in a nearly identical decrease in promoter activity, each individual element may contribute equally to promoter function and act independently of the other elements. This is in marked contrast to the {alpha}-subunit promoter, in which mutation of a single element, the tandem CREs, abrogates placental expression (30) and accounts for a greater than 80% reduction of promoter activity in pituitary cell lines (7).

A question arises in regard to the tripartite cell-specific enhancer of the GnRH-R gene. Specifically, is full, basal cell-specific activity due to a unique combination of elements or a single cell-specific element? In regard to the former, we have shown that mutation of any of the three elements that comprise the cell-specific enhancer significantly decreases promoter activity. Thus, full activity of the GnRH-R gene promoter is undoubtedly due to the unique combination of the AP-1 element, SF-1-binding site, and GRAS element. The question regarding a single cell-specific element is more complicated. At first glance it would be easy to dismiss both SF-1 and AP-1 as elements regulating cell-specific GnRH-R promoter activity because of the expression of SF-1 in cells other than gonadotropes and the ubiquitous expression of members of the Jun/Fos family of transcription factors. However, upon further consideration, these elements can not be excluded from a role as cell-specific regulators. For example, while SF-1 is expressed in tissues outside of the pituitary gland (19, 20), it must be noted that among the cells of the pituitary gland, SF-1 expression is restricted to gonadotropes (18). Similarly, AP-1 elements are bound by a family of factors whose relative expression may differ among tissues and that may interact with other non-Jun/Fos proteins that are potentially cell-specific (31, 32, 33, 34, 35). In fact, the tandem CREs of the {alpha}-subunit gene promoter provide an excellent example of a situation in which a common element serves as a cell-specific regulator by binding to different members of the CRE-binding protein/activating transcription factor family in trophoblast and gonadotrope cell lines (14).

Regardless of how we view SF-1 and AP-1, the evidence for GRAS as a cell-specific enhancer is clear. Three copies of the wild type GRAS element (5'-CTAGTCACAACA-3') led to a 5- to 6-fold stimulation in transcriptional activity of the TK minimal promoter in {alpha}T3–1 cells, whereas three copies of the µGRAS-5 mutant element had no effect. Furthermore, this enhancer activity of GRAS is not specific to the TK promoter as 3xGRAS leads to a 22-fold stimulation of the rat PRL minimal promoter in transient transfections of {alpha}T3–1 cells (data not shown). The larger relative stimulation apparent with the PRL minimal promoter (positions -33 to +13) is probably due to significantly lower basal activity of the PRL promoter as compared with the TK promoter (36). Finally, transcriptional activity of the 3xGRAS-TKLUC vector was virtually unchanged when transiently transfected in a variety of other cell types, including cells from both reproductive and nonreproductive tissues. Since these cell types included the GH3 pituitary somatotrope cell line, the factor(s) binding to the GRAS element are apparently not common to all pituitary cell types. Hence, these data establish the ability of GRAS to function as a stand-alone enhancer that stimulates promoter activity specifically in a gonadotrope-derived cell line. As such, the protein(s) binding to the GRAS element may be unique to gonadotropes. In fact, we have previously shown sequence-specific binding of protein(s) in {alpha}T3–1 cell nuclear extracts to the region from -410 to -363, which contains the GRAS element. In contrast, no binding activity to this region was detected using nuclear extracts from Cos-7 cells (21).

In summary, we have identified a tripartite enhancer comprised of an AP-1 element, a binding site for SF-1, and a novel element (GRAS) that regulates basal activity of the GnRH-R gene promoter in the gonadotrope-derived {alpha}T3–1 cell line. Finally, we propose that GRAS may be the key component regulating this cell-specific basal enhancer. Given the ability of the proximal promoter of the GnRH-R gene to direct pituitary-specific expression of luciferase in transgenic mice (37), perhaps the ultimate test of this hypothesis will be to test the activity of a promoter containing a mutation of the GRAS element in transgenic mice.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Vector Construction
The construction of pMGR-600LUC, µGRAS, and µSF-1 has been described (17, 21). The block replacement mutation of the AP-1 site located at -336 was generated by PCR amplification using a pair of sense and antisense primers that replaced the AP-1 site with a restriction site for EcoRI (GAATTC). These primers included sufficient 5'- and 3'-flanking sequence (~18 bp) to assure specific annealing. Overlapping fragments were generated from pMGR-600LUC template DNA in separate PCR reactions using a sense primer from the luciferase vector (RV3, Promega, Madison, WI) and the antisense mutant primer or an antisense primer from the luciferase vector (GL2, Promega) and the sense mutated primer. These products were combined and amplified in a second round of PCR using the RV3 and GL2 primers. The PCR product was digested with KpnI and XhoI and inserted into the basic luciferase vector (pGL3-basic, Promega) digested with the same enzymes.

The series of 2-bp transversion mutations of PMGR-600LUC were generated using the same protocol. Sense and antisense mutant primers were designed with 2-bp transversion mutations spanning the region from -395 to -378 (5'-CTGTCTAGTCACAACAGT-3'; Fig. 2Go). The correct size of the resulting PCR products was determined by gel electrophoresis, and the products were digested with KpnI and XhoI and ligated into the vector fragment of pGL3-basic cut with the same enzymes.

Multiple copies of the GRAS element were concatamerized by phosphorylating one strand of a synthesized oligonucleotide containing the element using polynucleotide kinase, annealing the two synthesized strands, and ligating the mixture. Concatamers were subsequently ligated into pBluescript SK (pBSK) digested with SmaI. The construction of triple directionally inserted elements was verified by sequencing. The 3XGRAS construct was subsequently digested out of the pBluescript vector using XbaI and XhoI restriction endonucleases and ligated into TKLUC digested with the NheI and XhoI restriction endonucleases. Insertion of the TK minimal promoter (positions -105 to +51 bp) in the luciferase expression vector was described previously (17). The identity of all plasmids was verified by restriction enzyme digestion and sequencing.

Cell Culture and Transient Transfections
All cell cultures were maintained in a humidified atmosphere of 5% CO2 at 37 C. {alpha}T3–1 cells were cultured in high-glucose DMEM containing 2 mM glutamine, 5% FBS, 5% horse serum, 100 U/ml penicillin, and 100 µg/ml streptomycin sulfate. Cos-7, GH3, and HeLa cells were maintained in high-glucose DMEM containing 2 mM glutamine, 10% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin sulfate. BeWo cells were cultured in Waymouth’s media containing 15% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin sulfate. MA-10 cells were cultured in RPMI 1640 media containing 2 mM glutamine, 15% horse serum, and 50 µg/ml gentamicin. GH3 cells were transfected using a calcium phosphate/DNA coprecipitation method as previously described (30) followed at 12 h after transfection by a 4-min exposure to 15% dimethyl sulfoxide and 10% FCS in DMEM. After the dimethyl sulfoxide shock, cells were washed twice with PBS, fresh media were added, and the cells were incubated for 48 h before harvest. {alpha}T3–1, Cos-7, BeWo, MA-10, and HeLa cell cultures were transfected using the LipofectAMINE procedure (GIBCO/BRL Life Technologies, Gaithersburg, MD) as previously described (21). Briefly, on the day before transfection, 0.5–1.5 x 106 cells were seeded into 35-mm wells of a six-well tissue culture plate. Transfections included 1.4 µg test vector and 0.25 µg pRSV-LacZ with 5 µl lipofectAMINE reagent (0.5 µg in 10 µl for BeWo and MA-10 cultures) in 200 µl high-glucose DMEM containing 2 mM glutamine. This mixture was incubated at room temperature for 30 min, then diluted to 1 ml with the same media and applied to cell cultures previously washed with high-glucose DMEM containing 2 mM glutamine. The cell cultures were incubated with the transfection mixture for approximately 16 h at 37 C in a humidified atmosphere of 5% CO2. After incubation, {alpha}T3–1, Cos-7, and HeLa cells were supplemented with 1 ml high-glucose DMEM containing 2 mM glutamine, 10% FBS, 10% horse serum, and antibiotics. In cultures of BeWo or MA-10 cells, the transfection medium was aspirated and 2 ml of their respective culture medias were added. After 5–6 h, media were aspirated, and cells were washed twice with ice-cold PBS (pH 7.4). Cells were lysed in the wells by the addition of 200 µl lysis buffer (0.025 M glycylglycine, pH 7.8, 1 mM dithiothreitol, 15 mM MgSO4, and 1.0% Triton X-100). Cellular debris was removed from lysate by microcentrifugation at 16,000 x g for 2 min. Lysates were immediately assayed for luciferase activity by adding 20 µl lysate to 100 µl luciferin substrate (Promega) and measuring luminescence with a Turner model TD-20E luminometer set for a 5-sec delay and 10-sec integration. ß-Galactosidase activity was measured in 50 µl lysate using the luminescent assay system and substrate (Tropix, Bedford, MA) with the same luminometer set for 10-sec delay and 5-sec integration following manufacturer’s instructions. Luciferase activity was normalized for transfection efficiency by dividing the luciferase activity by ß-galactosidase activity. Each vector was transfected in triplicate for each transfection, and transfections were repeated at least three times using two to three different plasmid preparations.

Statistical Analysis
The transfection data were analyzed by one-way ANOVA with vector as the independent variable. If the F test was significant (P < 0.05), means were separated using Tukey’s (Fig. 1Go) or Dunnett’s (Figs. 2Go, 3Go, and 4Go) methods of multiple comparisons (38).


    FOOTNOTES
 
Address requests for reprints to: Colin M. Clay, Animal Reproduction and Biotechnology Laboratory-Foothills Campus, Colorado State University, Fort Collins, Colorado 80523.

This work was supported by NIH Grant R29HD-32416. D.L.D. was supported by NIH Postdoctoral Fellowship NRSA 1F32HD08169.

Received for publication June 10, 1997. Revision received August 1, 1997. Accepted for publication August 15, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Simmons DM, Voss JW, Ingraham HA, Holloway JM, Broide RS, Rosenfeld MG, Swanson LW 1990 Pituitary cell phenotypes involve cell-specific Pit-1 mRNA translation and synergistic interactions with other classes of transcription factors. Genes Dev 4:695–711[Abstract/Free Full Text]
  2. Hamernik DL, Keri RA, Clay CM, Clay JN, Sherman GB, Sawyer Jr HR, Nett TM, Nilson JH 1992 Gonadotrope- and thyrotrope-specific expression of the human and bovine glycoprotein hormone {alpha}-subunit genes is regulated by distinct cis-acting elements. Mol Endocrinol 6:1745–1755[Abstract/Free Full Text]
  3. Kendall SK, Saunders TL, Jin L, Lloyd RV, Glode LM, Nett TM, Keri RA, Nilson JH, Camper SA 1991 Targeted ablation of pituitary gonadotropes in transgenic mice. Mol Endocrinol 5:2025–2036[Abstract/Free Full Text]
  4. Windle JJ, Weiner RI, Mellon PL 1990 Cell lines of the pituitary gonadotrope lineage derived by target oncogenesis in transgenic mice. Mol Endocrinol 4:597–603[Abstract/Free Full Text]
  5. Schoderbek WE, Kim KE, Ridgway EC, Mellon PL, Maurer RA 1992 Analysis of DNA sequences required for pituitary-specific expression of the glycoprotein hormone {alpha}-subunit gene. Mol Endocrinol 6:893–903[Abstract/Free Full Text]
  6. Roberson MS, Schoderbek WE, Tremml G, Maurer RA 1994 Activation of the glycoprotein hormone alpha subunit promoter by a LIM-homeodomain transcription factor. Mol Cell Biol 14:2985–2993[Abstract/Free Full Text]
  7. Heckert LL, Schultz K, Nilson JH 1995 Different composite regulatory elements direct expression of the human {alpha} subunit gene to pituitary and placenta. J Biol Chem 270:26497–26504[Abstract/Free Full Text]
  8. Jackson SM, Gutierrez-Hartmann A, Hoeffler JP 1995 Upstream stimulatory factor, a basic-helix-loop-helix-zipper protein, regulates the activity of the {alpha}-glycoprotein hormone subunit gene in pituitary cells. Mol Endocrinol 9:278–291[Abstract/Free Full Text]
  9. Steger DJ, Hecht JH, Mellon PL 1994 GATA-binding proteins regulate the human gonadotropin {alpha}-subunit gene in the placenta and pituitary gland. Mol Cell Biol 14:5592–5602[Abstract/Free Full Text]
  10. Horn F, Windle JJ, Barnhart KM, Mellon PM 1992 Tissue-specific gene expression in the pituitary: the glycoprotein hormone {alpha}-subunit gene is regulated by a gonadotrope-specific protein. Mol Cell Biol 12:2143–2153[Abstract/Free Full Text]
  11. Barnhart KM, Mellon PL 1994 The orphan nuclear receptor steroidogenic factor-1, regulates the glycoprotein hormone {alpha}-subunit gene in pituitary gonadotropes. Mol Endocrinol 8:878–885[Abstract/Free Full Text]
  12. Deutsch PJ, Jameson JL, Habener JF 1987 Cyclic AMP responsiveness of human gonadotropin-{alpha} gene transcription is directed by a repeated 18-base pair enhancer: {alpha}-promoter receptivity to the enhancer confers cell-preferential expression. J Biol Chem 262:12169–12174[Abstract/Free Full Text]
  13. Delegeane AM, Ferland LH, Mellon PL 1987 Tissue-specific enhancer of the human glycoprotein hormone alpha-subunit gene: dependence on cyclic AMP-inducible elements. Mol Cell Biol 7:3994–4002[Abstract/Free Full Text]
  14. Heckert LL, Schultz K, Nilson JH 1996 The cAMP response elements of the {alpha} subunit gene bind similar proteins in trophoblasts and gonadotropes but have distinct functional sequence requirements. J Biol Chem 271:31650–31656[Abstract/Free Full Text]
  15. Halvorson LM, Kaiser UB, Chin WW 1996 Stimulation of luteinizing hormone ß gene promoter activity by the orphan nuclear receptor, steroidogenic factor-1. J Biol Chem 271:6645–6650[Abstract/Free Full Text]
  16. Keri RA, Nilson JH 1996 A steroidogenic factor-1 binding site is required for activity of the luteinizing hormone ß subunit promoter in gonadotropes of transgenic mice. J Biol Chem 271:10782–10788[Abstract/Free Full Text]
  17. Duval DL, Nelson SE, Clay CM 1997 A binding site for steroidogenic factor-1 is part of a complex enhancer that mediates expression of the murine GnRH receptor gene. Biol Reprod 56:160–168[Abstract]
  18. Ingraham HA, Lala DS, Ikeda Y, Luo X, Shen W, Nachtigal MW, Abbud R, Nilson JH, Parker KL 1994 The nuclear receptor steroidogenic factor 1 acts at multiple levels of the reproductive axis. Genes Dev 8:2302–2312[Abstract/Free Full Text]
  19. Ikeda Y, Shen W, Ingraham HA, Parker KL 1994 Developmental expression of mouse steroidogenic factor-1, and essential regulator of the steroid hydroxylases. Mol Endocrinol 8:654–662[Abstract/Free Full Text]
  20. Ikeda Y, Lala DS, Luo X, Kim E, Moisan M-P, Parker KL 1993 Characterization of the mouse FTZ-F1 gene, which encodes a key regulator of steroid hydroxylase gene expression. Mol Endocrinol 7:852–860[Abstract/Free Full Text]
  21. Clay CM, Nelson SE, DiGregorio GB, Campion CE, Wiedemann AL, Nett RJ 1995 Cell-specific expression of the mouse gonadotropin-releasing hormone (GnRH) receptor gene is conferred by elements residing within 500 bp of proximal 5' flanking region. Endocrine 3:615–622[CrossRef]
  22. Albarracin CT, Kaiser UB, Chin WW 1994 Isolation and characterization of the 5'-flanking region of the mouse gonadotropin-releasing hormone receptor gene. Endocrinology 135:2300–2306[Abstract]
  23. Currie AJ, Fraser HM, Sharpe RM 1981 Human placental receptors for luteinizing hormone releasing hormone. Biochem Biophys Res Commun 99:332–338[CrossRef][Medline]
  24. Kakar SS, Jennes L 1995 Expression of gonadotropin-releasing hormone and gonadotropin releasing hormone receptor mRNAs in various non-reproductive human tissues. Cancer Lett 98:57–62[Medline]
  25. Jameson JL, Powers AC, Gallagher GD, Habener JF 1989 Enhancer and promoter element interactions dictate cyclic adenosine monophosphate mediated and cell-specific expression of the glycoprotein hormone {alpha}-gene. Mol Endocrinol 3:763–772[Abstract/Free Full Text]
  26. Bokar JA, Keri RA, Farmerie TA, Fenstermaker RA, Andersen B, Hamernik DL, Yun J, Wagner T, Nilson JH 1989 Expression of the glycoprotein hormone alpha-subunit gene in the placenta requires a functional cyclic AMP response element, whereas a different cis-acting element mediates pituitary-specific expression. Mol Cell Biol 9:5113–5122[Abstract/Free Full Text]
  27. Jones BK, Monks BR, Liebhaber SA, Cooke NE 1995 The human growth hormone gene is regulated by a multicomponent locus control region. Mol Cell Biol 15:7010–7021[Abstract]
  28. Kruse F, Rose SD, Swift GH, Hammer RE, MacDonald RJ 1995 Cooperation between elements of an organ-specific transcriptional enhancer in animals. Mol Cell Biol 15:4385–4394[Abstract]
  29. Mitchell J, Noisin E, Hall R, O’Brien R, Imai E, Granner D 1994 Integration of multiple signals through a complex hormone response unit in the phosphoenolpyruvate carboxykinase gene promoter. Mol Endocrinol 8:585–594[Abstract/Free Full Text]
  30. Silver BJ, Bokar JA, Virgin JB, Vallen ER, Milsted A, Nilson JA 1987 Cyclic AMP regulation of the human glycoprotein hormone alpha-subunit gene is mediated by an 18-base-pair element. Proc Natl Acad Sci USA 84:2198–2202[Abstract/Free Full Text]
  31. Kawana M, Lee M, Quertermous EE 1995 Cooperative interaction of GATA-2 and AP1 regulates transcription of the endothelin-1 gene. Mol Cell Biol 15:4225–4231[Abstract]
  32. Li L, Chambard JC, Karin M, Olson EN 1992 Fos and Jun repress transcriptional activation by myogenin and MyoD: the amino terminus of Jun can mediate repression. Genes Dev 6:676–689[Abstract/Free Full Text]
  33. Zhang X, Wills KN, Husmann M, Hermann T, Pfahl M 1991 Novel pathway for thyroid hormone receptor action through interaction with jun and fos oncogene activities. Mol Cell Biol 11:6016–6025[Abstract/Free Full Text]
  34. Savouret J, Rauch M, Redeuilh G, Sar S, Chauchereau A, Woodruff K, Parker MG, Milgrom E 1994 Interplay between estrogens, progestins, retinoid acid and AP-1 on a single regulatory site in the progesterone receptor gene. J Biol Chem 269:28955–28962[Abstract/Free Full Text]
  35. Claret F-X, Hibi M, Dhut S, Toda T, Karin M 1996 A new group of conserved coactivators that increase the specificity of AP-1 transcription factors. Nature 383:453–457[CrossRef][Medline]
  36. Howard PW, Maurer RA 1997 A composite Ets/Pit-1 binding site in the prolactin gene can mediate transcriptional responses to multiple signal transduction pathways. J Biol Chem 270:20930–20936[Abstract/Free Full Text]
  37. McCue JM, Quirk CC, Nelson SE, Bowen RA, Clay CM 1997 Expression of a murine gonadotropin-releasing hormone receptor-luciferase fusion gene in transgenic mice is diminished by immunoneutralization of gonadotropin-releasing hormone. Endocrinology 138:3154–3160[Abstract/Free Full Text]
  38. SAS/STAT 1989 User’s Guide. Version 6, ed. 4. SAS Institute Inc., Cary, NC, vol 1



This article has been cited by other articles:


Home page
EndocrinologyHome page
K.-H. Jeong, J. C. Gill, V. Nose, A. F. Parlow, R. S. Carroll, and U. B. Kaiser
Expression of a Gonadotropin-Releasing Hormone Receptor-Simian Virus 40 T-Antigen Transgene Has Sex-Specific Effects on the Reproductive Axis
Endocrinology, July 1, 2009; 150(7): 3383 - 3391.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Xie, K. H. Allen, A. Marguet, K. A. Berghorn, S. P. Bliss, A. M. Navratil, J. L. Guan, and M. S. Roberson
Analysis of the Calcium-Dependent Regulation of Proline-Rich Tyrosine Kinase 2 by Gonadotropin-Releasing Hormone
Mol. Endocrinol., October 1, 2008; 22(10): 2322 - 2335.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. G. Thackray and P. L. Mellon
Synergistic Induction of Follicle-Stimulating Hormone {beta}-Subunit Gene Expression by Gonadal Steroid Hormone Receptors and Smad Proteins
Endocrinology, March 1, 2008; 149(3): 1091 - 1102.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
A. L. Chand, G. T. Ooi, C. A. Harrison, A. N. Shelling, and D. M. Robertson
Functional analysis of the human inhibin {alpha} subunit variant A257T and its potential role in premature ovarian failure
Hum. Reprod., December 1, 2007; 22(12): 3241 - 3248.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. J. Westphal and A. F. Seasholtz
Gonadotropin-Releasing Hormone (GnRH) Positively Regulates Corticotropin-Releasing Hormone-Binding Protein Expression via Multiple Intracellular Signaling Pathways and a Multipartite GnRH Response Element in {alpha}T3-1 Cells
Mol. Endocrinol., November 1, 2005; 19(11): 2780 - 2797.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. S. Roberson, S. P. Bliss, J. Xie, A. M. Navratil, T. A. Farmerie, M. W. Wolfe, and C. M. Clay
Gonadotropin-Releasing Hormone Induction of Extracellular-Signal Regulated Kinase Is Blocked by Inhibition of Calmodulin
Mol. Endocrinol., September 1, 2005; 19(9): 2412 - 2423.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. M. McGillivray, J. S. Bailey, R. Ramezani, B. J. Kirkwood, and P. L. Mellon
Mouse GnRH Receptor Gene Expression Is Mediated by the LHX3 Homeodomain Protein
Endocrinology, May 1, 2005; 146(5): 2180 - 2185.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. D. Cherrington, T. A. Farmerie, C. A. Lents, J. D. Cantlon, M. S. Roberson, and C. M. Clay
Activin Responsiveness of the Murine Gonadotropin-Releasing Hormone Receptor Gene Is Mediated by a Composite Enhancer Containing Spatially Distinct Regulatory Elements
Mol. Endocrinol., April 1, 2005; 19(4): 898 - 912.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. K. Cheng and P. C. K. Leung
Molecular Biology of Gonadotropin-Releasing Hormone (GnRH)-I, GnRH-II, and Their Receptors in Humans
Endocr. Rev., April 1, 2005; 26(2): 283 - 306.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B.-S. An, J.-H. Choi, K.-C. Choi, and P. C. K. Leung
Differential Role of Progesterone Receptor Isoforms in the Transcriptional Regulation of Human Gonadotropin-Releasing Hormone I (GnRH I) Receptor, GnRH I, and GnRH II
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1106 - 1113.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K.-Y. Kam, K.-H. Jeong, E. R. Norwitz, E. M. Jorgensen, and U. B. Kaiser
Oct-1 and Nuclear Factor Y Bind to the SURG-1 Element to Direct Basal and Gonadotropin-Releasing Hormone (GnRH)-Stimulated Mouse GnRH Receptor Gene Transcription
Mol. Endocrinol., January 1, 2005; 19(1): 148 - 162.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K.-H. Jeong, W. W. Chin, and U. B. Kaiser
Essential Role of the Homeodomain for Pituitary Homeobox 1 Activation of Mouse Gonadotropin-Releasing Hormone Receptor Gene Expression through Interactions with c-Jun and DNA
Mol. Cell. Biol., July 15, 2004; 24(14): 6127 - 6139.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. J. Spady, R. Shayya, V. G. Thackray, L. Ehrensberger, J. S. Bailey, and P. L. Mellon
Androgen Regulates Follicle-Stimulating Hormone {beta} Gene Expression in an Activin-Dependent Manner in Immortalized Gonadotropes
Mol. Endocrinol., April 1, 2004; 18(4): 925 - 940.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Granger, V. Ngo-Muller, C. Bleux, C. Guigon, H. Pincas, S. Magre, D. Daegelen, A. Tixier-Vidal, R. Counis, and J.-N. Laverriere
The Promoter of the Rat Gonadotropin-Releasing Hormone Receptor Gene Directs the Expression of the Human Placental Alkaline Phosphatase Reporter Gene in Gonadotrope Cells in the Anterior Pituitary Gland as well as in Multiple Extrapituitary Tissues
Endocrinology, February 1, 2004; 145(2): 983 - 993.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. S. Ellsworth, B. R. White, A. T. Burns, B. D. Cherrington, A. M. Otis, and C. M. Clay
c-Jun N-Terminal Kinase Activation of Activator Protein-1 Underlies Homologous Regulation of the Gonadotropin-Releasing Hormone Receptor Gene in {alpha}T3-1 Cells
Endocrinology, March 1, 2003; 144(3): 839 - 849.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. R. Norwitz, S. Xu, J. Xu, L. B. Spiryda, J. S. Park, K.-H. Jeong, E. A. McGee, and U. B. Kaiser
Direct Binding of AP-1 (Fos/Jun) Proteins to a SMAD Binding Element Facilitates Both Gonadotropin-releasing Hormone (GnRH)- and Activin-mediated Transcriptional Activation of the Mouse GnRH Receptor Gene
J. Biol. Chem., September 27, 2002; 277(40): 37469 - 37478.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
W. Xing, N. Danilovich, and M. R. Sairam
Orphan Receptor Chicken Ovalbumin Upstream Promoter Transcription Factors Inhibit Steroid Factor-1, Upstream Stimulatory Factor, and Activator Protein-1 Activation of Ovine Follicle-Stimulating Hormone Receptor Expression via Composite cis-Elements
Biol Reprod, June 1, 2002; 66(6): 1656 - 1666.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. R. Norwitz, S. Xu, K.-H. Jeong, G. Y. Bedecarrats, L. D. Winebrenner, W. W. Chin, and U. B. Kaiser
Activin A Augments GnRH-Mediated Transcriptional Activation of the Mouse GnRH Receptor Gene
Endocrinology, March 1, 2002; 143(3): 985 - 997.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
K. W. Cheng, C.-K. Cheng, and P. C. K. Leung
Differential Role of PR-A and -B Isoforms in Transcription Regulation of Human GnRH Receptor Gene
Mol. Endocrinol., December 1, 2001; 15(12): 2078 - 2092.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
G. Maya-Nunez and P. Michael Conn
Cyclic Adenosine 3',5'-Monophosphate (cAMP) and cAMP Responsive Element-Binding Protein Are Involved in the Transcriptional Regulation of Gonadotropin-Releasing Hormone (GnRH) Receptor by GnRH and Mitogen-Activated Protein Kinase Signal Transduction Pathway in GGH3 Cells
Biol Reprod, August 1, 2001; 65(2): 561 - 567.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. C. Quirk, K. L. Lozada, R. A. Keri, and J. H. Nilson
A Single Pitx1 Binding Site Is Essential for Activity of the LH{beta} Promoter in Transgenic Mice
Mol. Endocrinol., May 1, 2001; 15(5): 734 - 746.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
K. W. Cheng, B. K. C. Chow, and P. C. K. Leung
Functional Mapping of a Placenta-Specific Upstream Promoter for Human Gonadotropin-Releasing Hormone Receptor Gene
Endocrinology, April 1, 2001; 142(4): 1506 - 1516.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
D. Boerboom, N. Pilon, R. Behdjani, D. W. Silversides, and J. Sirois
Expression and Regulation of Transcripts Encoding Two Members of the NR5A Nuclear Receptor Subfamily of Orphan Nuclear Receptors, Steroidogenic Factor-1 and NR5A2, in Equine Ovarian Cells during the Ovulatory Process
Endocrinology, December 1, 2000; 141(12): 4647 - 4656.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. Sekar, H. A. LaVoie, and J. D. Veldhuis
Concerted Regulation of Steroidogenic Acute Regulatory Gene Expression by Luteinizing Hormone and Insulin (or Insulin-Like Growth Factor I) in Primary Cultures of Porcine Granulosa-Luteal Cells
Endocrinology, November 1, 2000; 141(11): 3983 - 3992.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. W. Cheng, E. S. W. Ngan, S. K. Kang, B. K. C. Chow, and P. C. K. Leung
Transcriptional Down-Regulation of Human Gonadotropin-Releasing Hormone (GnRH) Receptor Gene by GnRH: Role of Protein Kinase C and Activating Protein 1
Endocrinology, October 1, 2000; 141(10): 3611 - 3622.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. W. Cheng, P. S. Nathwani, and P. C. K. Leung
Regulation of Human Gonadotropin-Releasing Hormone Receptor Gene Expression in Placental Cells
Endocrinology, July 1, 2000; 141(7): 2340 - 2349.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. L. Duval, A. R. Farris, C. C. Quirk, T. M. Nett, D. L. Hamernik, and C. M. Clay
Responsiveness of the Ovine Gonadotropin-Releasing Hormone Receptor Gene to Estradiol and Gonadotropin-Releasing Hormone Is Not Detectable in Vitro But Is Revealed in Transgenic Mice
Endocrinology, March 1, 2000; 141(3): 1001 - 1010.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Maya-Núñez and P. M. Conn
Transcriptional Regulation of the Gonadotropin-Releasing Hormone Receptor Gene Is Mediated in Part by a Putative Repressor Element and by the Cyclic Adenosine 3',5'-Monophosphate Response Element
Endocrinology, August 1, 1999; 140(8): 3452 - 3458.
[Abstract] [Full Text]


Home page
Reproductive SciencesHome page
E. R. Norwitz, K.-H. Jeong, and W. W. Chin
Molecular Mechanisms of Gonadotropin-Releasing Hormone Receptor Gene Regulation
Reproductive Sciences, July 1, 1999; 6(4): 169 - 178.
[Abstract] [PDF]


Home page
EndocrinologyHome page
E. S. W. Ngan, P. K. W. Cheng, P. C. K. Leung, and B. K. C. Chow
Steroidogenic Factor-1 Interacts with a Gonadotrope-Specific Element within the First Exon of the Human Gonadotropin-Releasing Hormone Receptor Gene to Mediate Gonadotrope-Specific Expression
Endocrinology, June 1, 1999; 140(6): 2452 - 2462.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
B. R. White, D. L. Duval, J. M. Mulvaney, M. S. Roberson, and C. M. Clay
Homologous Regulation of the Gonadotropin-Releasing Hormone Receptor Gene Is Partially Mediated by Protein Kinase C Activation of an Activator Protein-1 Element
Mol. Endocrinol., April 1, 1999; 13(4): 566 - 577.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
S. Nelson, R. D. Horvat, J. Malvey, D. A. Roess, B. G. Barisas, and C. M. Clay
Characterization of an Intrinsically Fluorescent Gonadotropin-Releasing Hormone Receptor and Effects of Ligand Binding on Receptor Lateral Diffusion
Endocrinology, February 1, 1999; 140(2): 950 - 957.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
E. R. Norwitz, G. R. Cardona, K.-H. Jeong, and W. W. Chin
Identification and Characterization of the Gonadotropin-releasing Hormone Response Elements in the Mouse Gonadotropin-releasing Hormone Receptor Gene
J. Biol. Chem., January 8, 1999; 274(2): 867 - 880.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Lin and P. M. Conn
Transcriptional Activation of Gonadotropin-Releasing Hormone (GnRH) Receptor Gene by GnRH and Cyclic Adenosine Monophosphate
Endocrinology, September 1, 1998; 139(9): 3896 - 3902.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Pincas, J.-N. Laverriere, and R. Counis
Pituitary Adenylate Cyclase-activating Polypeptide and Cyclic Adenosine 3',5'-Monophosphate Stimulate the Promoter Activity of the Rat Gonadotropin-releasing Hormone Receptor Gene via a Bipartite Response Element in Gonadotrope-derived Cells
J. Biol. Chem., June 22, 2001; 276(26): 23562 - 23571.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duval, D. L.
Right arrow Articles by Clay, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duval, D. L.
Right arrow Articles by Clay, C. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals