help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hu, J.-F.
Right arrow Articles by Hoffman, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hu, J.-F.
Right arrow Articles by Hoffman, A. R.
Molecular Endocrinology 11 (13): 1891-1898
Copyright © 1997 by The Endocrine Society

Modulation of Igf2 Genomic Imprinting in Mice Induced by 5-Azacytidine, an Inhibitor of DNA Methylation

Ji-Fan Hu1, Pamela H. Nguyen1, Nga V. Pham, Thanh H. Vu and Andrew R. Hoffman

Medical Service and Geriatric Research Education and Clinical Center Veterans Affairs Palo Alto Health Care System, and Division of Endocrinology, Gerontology, and Metabolism Department of Medicine Stanford University Palo Alto, California 94304


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The adjacent genes, insulin-like growth factor 2 (Igf2) and H19, are imprinted in both mouse and human. While Igf2 is expressed from the paternal allele, H19 is transcribed exclusively from the maternal allele. To explore the underlying mechanism of Igf2 and H19 imprinting, we studied the effect of DNA demethylation on allelic expression by injecting mice with the demethylating agent 5-azacytidine (5-aza-C). We observed a >=2-fold increase in the abundance of Igf2 mRNA in liver from treated mice compared with that of control mice. There was no significant change in Igf2 or H19 expression in brain. In the 5-aza-C-treated mice, there was dramatic modulation of Igf2 imprinting. In some tissues, Igf2 was expressed biallelically, while in other tissues, the paternal allele was silenced and the normally imprinted maternal allele was expressed, an example of allelic switching. There was no change in the normal biallelic pattern of Igf2 expression in brain. H19, on the other hand, remained imprinted in all tissues in mice treated with 5-aza-C. These results provide the first example of a pharmacological manipulation of genomic imprinting of an endogenous gene in vivo and further implicate DNA methylation as an important factor in maintaining the differential allelic expression of the Igf2 gene.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Insulin-like growth factor II (Igf2) is a polypeptide growth factor that is essential for normal embryonic and neonatal growth and development (1). Igf2 is maternally imprinted. With the exception of the central nervous system, where the gene is biallelically expressed, only the paternal allele is normally transcribed (2, 3). H19 is an RNA of unknown function that is extensively expressed during embryonic and fetal development (4, 5). It is located directly downstream of Igf2 on mouse chromosome 7, and the transcript has been shown to suppress the tumorigenicity of one human cancer cell line and retard the growth rate of another (6), suggesting a possible tumor-suppressor potential. H19 is also imprinted, with only the maternal allele normally being expressed. Loss of IGF2 and H19 imprinting has been observed in a number of human tumors (7, 8, 9, 10). Constitutional loss of IGF2 imprinting throughout the body has been reported to cause an overgrowth syndrome in young children (11).

Genomic imprinting is associated with allele-specific DNA methylation (12, 13, 14, 15). In mouse embryos that are deficient in the DNA methyltransferase (MTase) gene, the expression of H19, Igf2, and Igf2r is altered such that the normally imprinted paternal allele of H19 is activated, and the normally expressed paternal allele of Igf2 and the expressed maternal allele of Igf2r are repressed (16). These results suggest that a normal level of DNA methylation is required for the differential expression of imprinted genes. Similarly, in Wilms’ tumor, alterations in the allelic expression of IGF-II and H19 are usually associated with abnormal patterns of DNA methylation (17, 18).

Recent studies in our laboratory have shown that Igf2 is imprinted in all tissues except the central nervous system (CNS), where both parental alleles become transcriptionally active from all three mouse Igf2 promoters (mP1-mP3) (3). H19, however, is always monoallelically expressed in CNS. In a study using cultured primary human and mouse astrocytes, DNA demethylation induced by the demethylating agent, 5-azacytidine (5-aza-C), dramatically increased the expression of Igf2. Interestingly, the increased expression of Igf2 was primarily derived from the activation of the normally imprinted maternal allele, with the normally expressed paternal allele also remaining active (19). In this study, we have examined the effects of DNA demethylation on the expression and genomic imprinting of both Igf2 and H19 in vivo by treating newborn mice with 5-aza-C. Our results indicate that DNA demethylation affects the level of expression of both Igf2 and H19 in liver. Furthermore, 5-aza-C leads to loss of Igf2 imprinting in some tissues and allelic switching in other tissues, confirming the importance of DNA methylation in the regulation of the imprinting process and demonstrating that a pharmacological agent can alter genomic imprinting in vivo.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
DNA Demethylation after 5-aza-C Treatment
To determine the extent of DNA demethylation induced by 5-aza-C, we measured the level of DNA methylation in selected tissues. Although the role of DNA methylation in the regulation of genomic imprinting has been extensively examined, no specific Igf2 methylation pattern has been found to show general agreement with the allelic expression of the gene. In a previous study in astrocytes (19), we found that three mouse Igf2 promoters (mP1-mP3) and four human IGF-II promoters (hP1-hP4) did not respond equally to treatment with 5-aza-C (20, 21). While there was a substantial increase in the expression of Igf2 from the most proximal promoter of IGF-II (mP3 and hP4), expression from the other Igf2 promoters remained unchanged. These preliminary results suggest the presence of a DNA methylation-response element near the most proximal promoter of Igf2. We thus focused our search on the DNA methylation status of promoter mP3.

After treatment with sodium bisulfite, the unmethylated cytosine residues, but not the methylated cytosine residues, in genomic DNA will be converted into the uridine residues. After PCR amplification, the uridine residues are visualized as thymidine residues on sequencing gels, whereas the methylated cytosine residues remain unchanged. As seen in the genomic sequencing gel of Igf2 mP3 (Fig. 1Go), all cytosine residues that are adjacent to adenosine, thymidine, and cytosine were converted to thymidine (T), indicating that the sodium bisulfite reaction was complete, changing all unmethylated cytosine residues into uridine. Interestingly, partial or hemi-DNA methylation was observed in three CpG sites in the mP3 region in the control mouse (Fig. 1BGo). It is also interesting to note that, in one HapII site (CCGG), the first cytosine residue was fully converted to thymidine, whereas part of the second cytosine adjacent to the G residue remained a C residue in the gel, indicating that only CpG dinucleotides in genomic DNA are methylated. However, in treated mice, all these three CpG sites in the mP3 region were demethylated by 5-aza-C treatment. These results indicate that treatment with 5-aza-C can completely demethylate DNA in this mP3 region, which contains fewer CpG dinucleotides than does the mP2 region (19).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. DNA Methylation Status in Mice with 5-aza-C or PBS Treatment

A, A portion of the mouse Igf2 promoter 3 sequence with CpG sequences in bold italics. B, Genomic sequencing gel of DNA of control and treated mice. Genomic DNA samples of muscle of control and treated mice were treated with sodium bisulfite and sequenced for comparison of methylated and unmethylated cytosine residues. Location of the three CpG dinucleotide sites is indicated by arrows. Note the partial methylation of the cytosine residues in control mouse and the unmethylated cytosine residues in 5-aza-C-treated mouse.

 
Igf2 and H19 Expression in Mice after DNA Demethylation
To examine the effect of DNA demethylation on the abundance of Igf2 and H19, we chose to measure Igf2 abundance in brain and liver because brain exhibits biallelic expression of Igf2 while liver, the major source of the circulating IGF-II, exhibits monoallelic expression of Igf2 (3). As compared with control mice, the 5-aza-C-treated mice had significantly higher Igf2 mRNA and H19 RNA abundance in liver (Fig. 2AGo), but there was no change in Igf2 or H19 abundance in brain (data not shown). The increased expression of Igf2 after 5-aza-C treatment was confirmed by ribonuclease protection assay (RPA) quantification, which also revealed an approximately 2-fold increase in the level of Igf2 expression in liver, but not in brain (Fig. 2BGo).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. Expression of Igf2 and H19 in Liver of Mice Receiving 5-aza-C Treatment

A, Gene quantification of expression by PCR. The expression of Igf2 and H19 mRNA level was standardized to a relative value by setting the ratios of the target signals to 18S of control animals at 1.0. Messenger RNA abundance was determined by quantitative RT-PCR (n = number of animals). B, Ribonuclease protection assay quantification of Igf2 in mice treated with PBS (-) and 5-aza-C (+).

 
The Effect of DNA Demethylation on Igf2 Imprinting
We then asked whether the increased amount of Igf2 seen after treatment with 5-aza-C was derived from the expressed paternal allele or from the imprinted maternal allele. Except for the CNS, Igf2 is normally maternally imprinted (Refs. 2 and 3 and Fig. 3AGo). However, after treatment with 5-aza-C, the normally silent maternal allele is activated in most tissues, leading to biallelic Igf2 expression in some tissues, such as liver and muscle (Fig. 3BGo, lanes 4 and 6; Fig. 3CGo, lanes 4 and 5). In some tissues, such as the intestine (Fig. 3BGo, lane 2 and Fig. 3CGo, lane 3), however, only the maternal allele is expressed, while the paternal allele becomes imprinted, an example of allelic switching. In brain, both parental alleles of Igf2 are normally expressed (2, 3) and, as seen in Fig. 3DGo, after DNA demethylation with 5-aza-C, both alleles are still expressed. Thus, DNA demethylation did not affect the normal biallelic expression of Igf2 in brain. The effect of 5-aza-C treatment differs among the various tissues, causing either the loss of imprinting or the reversal of the normal imprinting pattern only in peripheral tissues. Aside from the consistent biallelic expression of Igf2 in brain, the pattern of allelic expression after 5-aza-C treatment was not tissue specific among the treated animals.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Allelic Expression of Igf2 in Neonatal Mice Receiving 5-aza-C

A, Control mouse 1: lanes 1, 100-bp marker; lane 2, genomic DNA; lane 3, intestine cDNA; lane 4, kidney cDNA; lane 5, liver cDNA; lane 6, lung cDNA; lane 7, muscle cDNA; lane 8, pancreas cDNA; and lane 9, spleen cDNA. B, 5-aza-C-treated mouse 3: lane 1, 100 bp marker; lane 2, intestine cDNA; lane 3, kidney cDNA; lane 4, liver cDNA; lane 5, lung cDNA; lane 6, muscle cDNA; and lane 7, spleen cDNA. C, 5-aza-C-treated mouse 6: lane 1, 100-bp marker; lane 2, genomic DNA; lane 3, intestine cDNA; lane 4, liver cDNA; lane 5, muscle cDNA; and lane 6, pancreas cDNA; D, Cerebral cortex from control (no. 1) and 5-aza-C-treated (nos. 3 and 6) mice.

 
To address the question of whether DNA demethylation will change the allelic expression of Igf2 in mice throughout development, we gave 5-aza-C or PBS to six 2-month-old backcross mice (Fig. 4Go). As in the young mice, there is a maintenance of Igf2 imprint in tissues in control mice that received PBS (Fig. 4Go, lanes 4–8). However, in mice that received 5-aza-C, there was a change in allelic expression of Igf2 (lanes 9–19) although no consistent pattern was found. Some tissues maintained the normal imprint of Igf2 (lanes 12, 15, 16, 18, and 19), whereas others showed either loss of imprinting (lanes 9, 11, 13, 14, and 17) or a switch of expression of the parental alleles (lane 10). These results indicate that the alterations in Igf2 allelic expression by DNA demethylation can occur in mature as well as in neonatal mice.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. Allelic Expression of Igf2 in Older Mice after DNA Demethylation with 5-aza-C

Lane 1, 100-bp marker; lane 2, undigested PCR from M. spretus liver cDNA; lane 3, lane 2 PCR DNA that was digested by BsaA1 serving as digestion control. Due to the low abundance of Igf2 mRNA in older mice, a shorter PCR product was amplified with a different 5'-primer (5678): GACGTGTCTACCTCTCAGGCCGTA.

 
The Effect of DNA Demethylation on H19 Imprinting
5-aza-C had no effect upon the normal imprinting status of H19 in brain, intestine, kidney, liver, lung, muscle, pancreas, or spleen. The maternal allele continued to be the only transcribed allele (Fig. 5Go).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 5. Genomic Imprinting of H19 in Liver and Brain Tissues of Mice Receiving 5-aza-C Treatment

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The genomic imprinting of Igf2 and H19 is an epigenetic, reversible process (1, 2, 3). The mechanism for this allele-specific expression is not clearly understood, and differential DNA methylation has been proposed as the best candidate for marking the parental alleles. Studies have demonstrated a dynamic pattern of DNA methylation of several imprinted genes during embryogenesis (14) and have linked DNA demethylation to the activation of retroviral genomes (22) and altered gene expression (23). More specific evidence comes from studies that have shown that the H19, Igf2 and Igf2- receptor genes are differentially methylated depending on their parental origin (13, 14). In mice that were made deficient in DNA methyltransferase by gene targeting, there was no expression of Igf2 from the paternal allele, indicating the importance of DNA methylation in maintaining Igf2 expression and imprinting (16).

In this in vivo study, we examined the importance of DNA demethylation on the expression and imprinting of Igf2 and H19 by injecting mice with the demethylating agent 5-aza-C. We observed a significant increase in the expression of both Igf2 and H19 in liver of mice treated with 5-aza-C. The increase of Igf2 expression in these tissues was confirmed using both PCR and RPA analyses. This finding is consistent with previous work done in our laboratory in cultured cells treated with 5-aza-C and 2-deoxy-5-aza-C (19). We showed that in cells treated with 5-aza-C, genomic DNA became increasingly demethylated. When the cells were treated with 5-aza-C for sequential passages, a dramatic increase in Igf2 expression was observed. In addition, Eversole-Cire et al. (24) examined Igf2 expression in cells that were cultured from a disomic mouse that possessed a duplicated maternal (and absent paternal) chromosome 7. When they treated cells with 2-deoxy-5-aza-C, they saw a 2- to 4-fold increase in Igf2 expression from the imprinted allele. Jaenisch et al. (22) also showed that 5-aza-C treatment activated silent retroviral transgenes in postnatal mice, indicating that DNA demethylation affects the expression of a previously suppressed foreign gene in vivo as well. We have shown here that, like a transgene, the expression of endogenous imprinted genes can also be affected in vivo by treatment with DNA-demethylating agents.

We then asked whether DNA demethylation increased expression of hepatic Igf2 and H19 in the liver tissues from the normally expressed allele, or from the silent, imprinted allele. Using the BsaA1 polymorphism previously discovered in our laboratory (3), we were able to determine that the maternal allele of Igf2 was expressed in peripheral tissues of 5-aza-C-treated mice. In some tissues, both alleles were expressed, while in others, the paternal allele was repressed, leaving the maternal allele as the dominant expressed allele. To ensure that the relaxation of imprinting of Igf2 that we observed was not the result of genomic DNA contamination, we used a primer set designed to cross the intron border such that the genomic DNA and the cDNA would give different size bands and could thus be distinguished. The problem of incomplete digestion by BsaA1 was excluded in this study as we used backcross mice to check the allelic expression of Igf2. The backcross mice carried the undigested Mus musculus allele as the paternal allele, while the digested M. spretus allele was maternally derived. The observed M. spretus alleles seen in Figs. 3Go and 4Go represent, therefore, the transcript from the maternal allele.

Our data suggest that the maternal Igf2 allele is normally hypermethylated and thus is transcriptionally silent. Treatment with 5-aza-C removes this restriction and allows it to be transcribed. In agreement with this hypothesis, it has been shown that the maternal allele of Igf2 is hypermethylated in Wilms’ tumors with normal Igf2 imprinting, whereas it is hypomethylated in tumors that display a loss of imprinting of Igf2 (25). Thus it appears that DNA demethylation could be the epigenetic change underlying the loss of imprinting, and hence, the increased expression of Igf2. Other studies, however, have shown that the upstream region of the paternal Igf2 allele is normally methylated (14).

In Wilms’ tumors with loss of imprinting of IGF2, there is no expression of H19. Examination of the methylation status indicated that the inactivated maternal allele of H19 became heavily methylated (17, 25). In our study, the increased expression of H19 in liver was not accompanied by a relaxation of the normally silent paternal allele. The paternal specific methylation at the 5' region of the H19 gene is a potential imprinting mark (26, 27). According to the enhancer competition model, these methyl groups suppress paternal H19 expression by inhibiting the gene’s interaction with enhancers (26). One would expect then, that DNA demethylation would lead to a loss of this restriction and thus result in biallelic expression of H19. This was shown in a mouse study by Li et al. (16), in which mice deficient in the DNA MTase gene showed activation of the paternal H19 allele and biallelic H19 expression. It is important to note however, that in contrast to this experiment, the MTase knock-out experiment did not allow imprinting marks via methylation ever to be established. Due to deficiency in the MTase gene, methylation during embryogenesis and thereafter was abolished. Thus, the presumed imprinting marks via methylation could never have been established in those mice. In this study, the normal imprinting process was allowed to be established and preserved during normal embryogenesis, and injection of newborn and mature mice with 5-aza-C provided a method for us to examine the modulation of imprinting by subsequent demethylation. Therefore, the effect of DNA demethylation on genomic imprinting seems to be variable, depending upon whether the intervention is set before or after the establishment of imprinting pattern.

The lack of any imprinting changes for H19 in 5-aza-C-treated mice in this study suggests that H19 imprinting is more stringent and stable relative to Igf2 imprinting. The 5-aza-C treatments may have been administered too late during development to affect what we presume is the imprinting mark for H19, and so its normal imprinting pattern was maintained. Thus it seems that Igf2 imprinting is leaky relative to that of H19, where no paternal transcripts were observed (12). A stronger, more stable imprint mark for H19 should not be surprising as it has been shown that the H19 gene, together with its allele-specific DNA methylation domain and the 3'-enhancers, is sufficient to impart imprinting on a transgene (26). Also, it has been shown that maternal inheritance of the deletion of the H19 gene leads to disruption of Igf2 imprinting (28). Thus it has been proposed that a small region surrounding the H19 structural gene contains the required elements for its allele-specific expression, and that Igf2 acquires its appropriate allele-specific expression via its linkage to H19. If this is indeed the case, then one would presume that the H19 imprint elements are relatively stable, and the inability of 5-aza-C treatment to effect a change in allelic expression should not be altogether unexpected.

There were no imprinting changes for Igf2 in brain as both parental alleles were still actively transcribed. H19 maintained its normal imprinting pattern in brain, and in all the tissues examined, with no observed relaxation of imprinting of the normally silent paternal allele. This observed monoallelic expression of H19, coexpressed with Igf2 in brain, is consistent with previous results that also showed this same expression pattern of these two genes (29). It was hypothesized that there was attachment of the Igf2-H19 intergenic region to a nuclear scaffold on the maternal chromosome, which insulates the maternal Igf2 gene’s promoters from interacting with the enhancers downstream of H19 (30), or a protein(s) necessary for the maternal allele scaffold attachment is absent in brain, allowing the Igf2 gene to interact freely with the downstream enhancers for the efficient expression of the imprinted maternal allele (29).

The phenomenon of allelic switching has been seen with other imprinted genes (31). If the methylation hypothesis of imprinting is correct, then it is possible that very small changes in CpG methylation can alter allelic transcription; if certain cells are at a threshold level of methylation, any further change in methylation could lead to changes in allele transcription. These cells would thus be susceptible to allelic switching. Allelic switching may depend upon the level of DNA methyltransferase activity, or it may reflect the presence of other modifying genes, which may be tissue or development specific.

The ability of a pharmacological agent to modulate the imprinting process of an endogenous gene indicates that imprinting may be a relatively plastic phenomenon. Since loss of imprinting has been linked to oncogenesis, it is intriguing to consider whether environmental toxins or diet deficient in folate or other methyl donors could alter genomic imprinting, making the organism vulnerable to a variety of neoplasms.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animal Breeding
Male M. spretus mice (purchased from Jackson Laboratories, Bar Harbor, ME), which carry the BsaA1 polymorphism site in exon 6 of Igf2 (3), as well as the FokI polymorphism site in exon 5 of H19 (14), were mated with M. musculus (BALB/c) females, which lack these restriction sites. The female F1 mice produced from these crosses were crossed with male M. musculus mice to produce the backcross mice used for our study. Accordingly, approximately one half of the offspring were informative for Igf2 and H19 (data not shown).

Treatment of Mice with 5-Aza-C
The backcross mice were used to study the imprinting changes of Igf2 and H19 in 5-aza-C-treated mice. Mice were injected intraperitoneally with 5-aza-C (2.5 µg/g body weight), a dose at which no adverse effects have been reported by other laboratories (22, 23). Control mice were injected with the same volume of PBS. Each mouse was injected twice, at day 11 and at day 14 of life. Mice were killed and their organs were harvested at day 25 of life.

To study the effect of DNA demethylation on the allelic expression of Igf2 in adult life, we also treated six informative 2-month-old backcross mice (3, 19). 5-aza-C was given at the same intervals and doses used for the young mice. Animals were killed 7 days after the second dose of 5-aza-C.

Because of the difficulty in breeding interspecific mice, BALB/c mice were used to examine changes in Igf2 and H19 mRNA abundance. The animal experiments were approved by the Animal Care and Use Committee of the VA Medical Center and were conducted in accord with the procedures in Guidelines for Care and Use of Experimental Animals.

RNA and DNA Extraction
Tissues were collected and frozen on dry ice until RNA and DNA extraction. RNA and DNA (TNA, total nucleic acids) were extracted simultaneously as previously described (9, 3, 19). Tissues (100–200 mg) were homogenized in 1.0 ml solution D (4 M guanidium thiocyanate solution containing 1% ß-mercaptoethanol, and 2.5 mM sodium citrate, pH 7.0, and 0.5% Sarcosyl), and were extracted with an equal volume of phenol chloroform. The supernatant was precipitated with an equal volume of isopropanol. To reduce the background for PCR analysis, the TNA was reprecipitated by adding one half volume of 7.5 M ammonium acetate and 2 volumes of ethanol.

DNA Methylation Analysis
The DNA methylation status of Igf2 in selected tissues was measured by the bisulfite genome-sequencing method (32). Genomic DNA (1 µg), overlaid with 100 µl liquid wax (MJ Research, Boston, MA), was denatured by 0.3 M NaOH at 37 C for 20 min and treated with 3.5 M NaHSO3/1.0 mM hydroquinone (pH 5.0) in ice overnight. The solution was then incubated at 50 C for 8 h, and DNA was extracted with QIAEX II Kit (QIAGEN Inc., Chatsworth, CA) for PCR amplification. Genomic DNA of the mouse Igf2 promoter 3 (mP3) region was amplified by PCR for 30 cycles (95 C for 10 sec, 65 C for 40 sec, 72 C for 20 sec). The PCR primers were MII2279 (5'-primer): AGGTTAGTTTTTGGGGGTGTAGGAG and MII2617 (3'-primer): TACCCGTACCCTAACCACCCCACTA. PCR products were separated on a 1.8% agarose gel. DNA bands were excised from the agarose gel, purified with QIAEX II Kit, and sequenced by an AmpliCycle Sequencing kit (Perkin Elmer, Foster City, CA) using [{gamma}-32P]ATP end-labeled MII2279 according to the manufacturer’s protocol.

Complementary DNA Preparation
To eliminate the DNA, TNA was treated with ribonuclease-free deoxyribonuclease I (Stratagene, La Jolla, CA) at 37 C for 1 h and then was reversed transcribed into cDNAs using murine leukemia reverse transcriptase in the presence of random hexamers (GIBCO BRL, Gaithersburg, MD), ribonuclease inhibitor (USB, Cleveland, OH), dithiothreitol, and 4 deoxynucleoside triphosphate at 37 C for 25 min, followed by 5 cycles (50 C, 20 sec, and 37 C, 5 min) (3, 9, 19). The cDNA samples were diluted 10-fold with distilled water and used for PCR amplification.

PCR Analysis
For accurate quantification of Igf2 and H19 expression in the treated and control mice, we used PCR to amplify Igf2 and 18S in the same PCR reaction. The 18S PCR products were used as an internal control to adjust for the variation among samples.

The cDNA samples were amplified in a 2.5-µl reaction mixture in the presence of 50 µM deoxynucleoside triphosphate, 0.2 µM IGF-II primers, 0.25 µCi {alpha}-dCTP (Amersham Co., Arlington Heights, IL), and 0.125 U Tfl DNA polymerase (Epicentre Technologies, Madison, WI) with a hot-start PCR (19). The cDNAs and primers were covered with liquid wax (MJ Research) and were heated to 95 C for 2 min, then amplified for a varying number of cycles ranging from 35 for brain to 27 for liver, at 94 C for 40 sec, 65 C for 40 sec, 72 C for 30 sec, and then followed by 3 min at 72 C. Due to the high abundance of 18S in these tissues, we added the 18S primers so that they would be amplified for only 10 to 12 cycles, such that comparable PCR products of 18S and Igf2 and H19 were amplified. After PCR, the amplified DNAs were electrophoresed on 5% polyacrylamide-urea gel and were exposed to the screen of the PhosphorImager Scanner (Molecular Dynamics, Sunnyvale, CA). After PhosphorImager scanning, the image density of the Igf2 and H19 signals were calculated against the density of the internal 18S PCR control.

The oligonucleotide primers used for Igf2 quantification were: 1) Human/Mouse IGF2: 3038 (5'-primer): TGGCCCTCCTGGAGACG(A)TACTGTGC, 2384 (3'-primer): TTGGAAGAACTTGCCCACGGGGTATC; 2) 18S: 3967 (5'-primer): ATCCTGCCAGTAGCATATGCTTGTCT, 3968 (3'-primer): TTATCCAAGTAGGAGAGGAGCGAGC. The oligonucleotide primers used for H19 quantification were 4025 (5'-primer): TAAGTCGATTGCACTGGTTTGGAGT, and 4026 (3'-primer): TGATGGAACTGCTTCCAGACTAGG.

IGF-II RNA Quantification by RPA
Igf2 PCR-quantification was also confirmed by the RPA method in liver and brain samples in selected mice after 5-aza-C treatment. As previously described (19), the RPA quantification of IGF-II mRNA was performed using RPA II kit (Ambion Inc., Austin, TX). The RPA probe for IGF-II was prepared by MAXI script T7 kit (Ambion Inc.) from BglII-digested plasmid DNA, which was cloned from M. spretus mouse liver (3). The control probe of ß-actin was in vitro transcribed from actin plasmid DNA provided by the kit. Equal amounts (15 µg) of total RNA were used in each RPA reaction. The protected RNA fragments of IGF-II and ß-actin were separated on 5% polyacrylamide-urea gel and quantitated by PhosphorImager scanning.

Determination of Igf2 and H19 Imprinting
Allelic expression of Igf2 was assessed by amplifying the cDNA samples by PCR as described above, with a {gamma}-32P end-labeled primer and then digesting with BsaA1 (3, 19). The products were run on a 5% polyacrylamide-urea gel. Allelic expression of H19 was examined in the same manner except the digestion was performed with FokI (14). The oligonucleotide primers used for Igf2 imprinting were: Human/Mouse IGF2: 3038 (5'-primer): TGGCCCTCCTGGAGACG(A)TACTGTGC, and 3303 (3'-primer): CTGTCCCTGCTCAAGAGGAGGTCA. The oligonucleotide primers used for H19 imprinting were the same as those for H19 quantification.


    ACKNOWLEDGMENTS
 
We would like to thank Dr. Rosemary Broom and Marta Raygoza for their technical help in the animal breeding, and Drs. Haritha Oruganti and Scott Lee for their technical assistance in DNA methylation sequencing.


    FOOTNOTES
 
Address requests for reprints to: Andrew R. Hoffman, M.D., Medical Service (111), Veterans Affairs Medical Center, 3801 Miranda Avenue, Palo Alto, California 94304.

Supported by NIH Grant DK-36054 and the Research Service of the Department of Veterans Affairs.

1 These individuals made an equal contribution to this project. Back

Received for publication April 2, 1997. Revision received August 5, 1997. Accepted for publication September 11, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. DeChiara TM, Efstratiadis A, Robertson EJ 1990 A growth-deficiency phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature 345:78–80[CrossRef][Medline]
  2. DeChiara TM, Robertson EJ, Efstratiadis A 1991 Parental imprinting of the mouse insulin-like growth factor II gene. Cell 64:849–859[CrossRef][Medline]
  3. Hu J, Vu T, Hoffman A 1995 Differential biallelic activation of three insulin-like growth factor II promoters in the mouse central nervous system. Mol Endocrinol 9:628–636[Abstract/Free Full Text]
  4. Brannan CI, Dees EC, Ingram RS, Tilghman SM 1990 The product of the H19 gene may function as an RNA. Mol Cell Biol 10:28–36[Abstract/Free Full Text]
  5. Pachnis V, Brannan CI, Tilghman SM 1988 The structure and expression of a novel gene activated in early mouse embryogenesis. EMBO J 7:673–681[Medline]
  6. Hao Y, Crenshaw T, Moulton T, Newcomb E, Tycko B 1993 Tumour-suppressor activity of H19 RNA. Nature 365:764–767[CrossRef][Medline]
  7. Ogawa O, Eccles MR, Szeto J, McNoe LA, Yun K, Maw MA, Smith PJ, Reeve AE 1993 Relaxation of insulin-like growth factor II gene imprinting implicated in Wilms’ tumour. Nature 362:749–751[CrossRef][Medline]
  8. Rainier S, Johnson LA, Dobry CJ, Ping AJ, Grundy PE, Feinberg AP 1993 Relaxation of imprinted genes in human cancer. Nature 362:747–749[CrossRef][Medline]
  9. Vu TH, Yballe C, Boonyanit S, Hoffman AR 1995 Insulin-like growth factor II in uterine smooth-muscle tumors: maintenance of genomic imprinting in leiomyomata and loss of imprinting in leiomyosarcomata. J Clin Endocrinol Metab 80:1670–1676[Abstract/Free Full Text]
  10. Zhan S, Shapiro DN, Helman LJ 1994 Activation of an imprinted allele of the insulin-like growth factor II gene implicated in rhabdomyosarcoma. J Clin Invest 94:445–448
  11. Morison IM, Becroft DM, Taniguchi T, Woods CG, Reeve AE 1996 Somatic overgrowth syndrome associated with overexpression of insulin-like growth factor II. Nature Med 2:311–316[CrossRef][Medline]
  12. Sasaki H, Jones PA, Chaillet JR, Ferguson SA, Barton SC, Reik W, Surani MA 1992 Parental imprinting: potentially active chromatin of the repressed maternal allele of the mouse insulin-like growth factor II (Igf2) gene. Genes Dev 6:1843–1856[Abstract/Free Full Text]
  13. Stoger R, Kubicka P, Liu CG, Kafri T, Razin A, Cedar H, Barlow DP 1993 Maternal-specific methylation of the imprinted mouse Igf2r locus identifies the expressed locus as carrying the imprinting signal. Cell 73:61–71[CrossRef][Medline]
  14. Brandeis M, Kafri T, Ariel M, Chaillet JR, McCarrey J, Rasin A, Ceder H 1993 The ontogeny of allele-specific methylation associated with imprinted genes in the mouse. EMBO J 12:3669–3677[Medline]
  15. Tremblay KD, Saam JR, Ingram RS, Tilghman SM, Bartolomei MS 1995 A paternal-specific methylation imprint marks the alleles of the mouse H19 gene. Nat Genet 9:407–13[CrossRef][Medline]
  16. Li E, Beard C, Jaenisch R 1993 Role for DNA methyl-ation in genomic imprinting. Nature 366:362–365[CrossRef][Medline]
  17. Steenman MJC, Rainier S, Dobry CJ, Grundy P, Horon IL, Feinberg AP 1994 Loss of imprinting of IGF2 is linked to reduced expression and abnormal methylation of H19 in Wilms’ tumor. Nat Genet 7:433–439[CrossRef][Medline]
  18. Taniguchi T, Schofield AE, Scarlett JL, Morison IM, Sullivan MJ, Reeve AE 1995 Altered specificity of IGF2 promoter imprinting during fetal development and onset of Wilms’ tumour. Oncogene 11:751–756[Medline]
  19. Hu JF, Vu TH, Hoffman AR 1996 Promoter-specific modulation of insulin-like growth factor II genomic imprinting by inhibitors of DNA methylation. J Biol Chem 271:18253–18262[Abstract/Free Full Text]
  20. Jones PA, Taylor SM 1980 Cellular differentiation, cytidine analogs, and DNA methylation. Cell 20:85–93[CrossRef][Medline]
  21. Groudine M, Eisenman R, Weintraub H 1981 Chromatin structure of endogenous retroviral genes and activation by an inhibitor of DNA methylation. Nature 292:311–317[Medline]
  22. Jaenisch R, Schnieke A, Harbers K 1985 Treatment of mice with 5-azacytidine efficiently activates silent retroviral genomes in different tissues. Proc Natl Acad Sci USA 82:1451–1455[Abstract/Free Full Text]
  23. Carr BI, Reilly JG, Smith SS, Winberg C, Riggs A 1984 The tumorigenicity of 5-azacytidine in the male Fischer rat. Carcinogenesis 5:1583–1590[Abstract/Free Full Text]
  24. Eversole-Cire P, Ferguson-Smith AC, Sasaki H, Brown KD, Cattanach BM, Gonzales FA, Surani MA, Jones PA 1993 Activation of an imprinted Igf 2 gene in mouse somatic cell cultures. Mol Cell Biol 13:4928–4938[Abstract/Free Full Text]
  25. Taniguchi T, Sullivan MJ, Ogawa O, Reeve AE 1995 Epigenetic changes encompassing the IGF2/H19 locus associated with relaxation of IGF2 imprinting and silencing of H19 in Wilms’ tumor. Proc Natl Acad Sci USA 92:2159–2163[Abstract/Free Full Text]
  26. Bartolomei MS, Webber AL, Brunkow ME, Tilghman SM 1993 Epigenetic mechanisms underlying the imprinting of the mouse H19 gene. Genes Dev 7:1663–1673[Abstract/Free Full Text]
  27. Ferguson-Smith AC, Sasaki H, Cattanach BM, Surani MA 1993 Parental-origin-specific epigenetic modification of the mouse H19 gene. Nature 362:751–755[CrossRef][Medline]
  28. Leighton PA, Ingram RS, Eggenschwiler J, Efstratiadis A, Tilghman SM 1995 Disruption of imprinting caused by deletion of the H19 gene region in mice. Nature 375:34–39[CrossRef][Medline]
  29. Svensson K, Walsh C, Fundele R, Ohlsson R 1995 H19 is imprinted in the choroid plexus and leptomeninges of the mouse foetus. Mech Dev 51:31–37[CrossRef][Medline]
  30. Efstratiadis A 1994 Parental imprinting of autosomal mammalian genes. Curr Opin Genet Dev 4:265–280[CrossRef][Medline]
  31. Ohlsson R, Ekstrom T, GF, Pfeifer-Ohlsson S, Cui H, Miller S, Fisher R, Walsh C 1995 Plasticity of imprinting. In: Ohlsson R, Hall K, Ritzen M (eds) Genomic Imprinting: Causes and Consequences. Cambridge University Press, Cambridge, UK, pp 170–181
  32. Feil R, Walter J, Allen ND, Reik W 1994 Developmental control of allelic methylation in the imprinted mouse igf2 and H19 genes. Development 120:2933–2943[Abstract]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
T. Li, J.-F. Hu, X. Qiu, J. Ling, H. Chen, S. Wang, A. Hou, T. H. Vu, and A. R. Hoffman
CTCF Regulates Allelic Expression of Igf2 by Orchestrating a Promoter-Polycomb Repressive Complex 2 Intrachromosomal Loop
Mol. Cell. Biol., October 15, 2008; 28(20): 6473 - 6482.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
R. A. Waterland, J.-R. Lin, C. A. Smith, and R. L. Jirtle
Post-weaning diet affects genomic imprinting at the insulin-like growth factor 2 (Igf2) locus
Hum. Mol. Genet., March 1, 2006; 15(5): 705 - 716.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. E. Fish, C. C. Matouk, A. Rachlis, S. Lin, S. C. Tai, C. D'Abreo, and P. A. Marsden
The Expression of Endothelial Nitric-oxide Synthase Is Controlled by a Cell-specific Histone Code
J. Biol. Chem., July 1, 2005; 280(26): 24824 - 24838.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
B.P. Enright, L.-Y. Sung, C.-C. Chang, X. Yang, and X.C. Tian
Methylation and Acetylation Characteristics of Cloned Bovine Embryos from Donor Cells Treated with 5-aza-2'-Deoxycytidine
Biol Reprod, April 1, 2005; 72(4): 944 - 948.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Han, W. Xie, S. H. Kim, L. Yue, and J. DeJong
A Short Core Promoter Drives Expression of the ALF Transcription Factor in Reproductive Tissues of Male and Female Mice
Biol Reprod, September 1, 2004; 71(3): 933 - 941.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
B.P. Enright, C. Kubota, X. Yang, and X.C. Tian
Epigenetic Characteristics and Development of Embryos Cloned from Donor Cells Treated by Trichostatin A or 5-aza-2'-deoxycytidine
Biol Reprod, September 1, 2003; 69(3): 896 - 901.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. Viollet, M. Yaniv, and M. Pontoglio
Embryonic but Not Postnatal Reexpression of Hepatocyte Nuclear Factor 1{alpha} (HNF1{alpha}) Can Reactivate the Silent Phenylalanine Hydroxylase Gene in HNF1{alpha}-Deficient Hepatocytes
Mol. Cell. Biol., June 1, 2001; 21(11): 3662 - 3670.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
J.-F. Hu, J. Pham, I. Dey, T. Li, T. H. Vu, and A. R. Hoffman
Allele-Specific Histone Acetylation Accompanies Genomic Imprinting of the Insulin-Like Growth Factor II Receptor Gene
Endocrinology, December 1, 2000; 141(12): 4428 - 4435.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J.-F. Hu, H. Oruganti, T. H. Vu, and A. R. Hoffman
Tissue-Specific Imprinting of the Mouse Insulin-Like Growth Factor II Receptor Gene Correlates with Differential Allele-Specific DNA Methylation
Mol. Endocrinol., February 1, 1998; 12(2): 220 - 232.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. El Kharroubi, G. Piras, and C. L. Stewart
DNA Demethylation Reactivates a Subset of Imprinted Genes in Uniparental Mouse Embryonic Fibroblasts
J. Biol. Chem., March 16, 2001; 276(12): 8674 - 8680.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hu, J.-F.
Right arrow Articles by Hoffman, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hu, J.-F.
Right arrow Articles by Hoffman, A. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals