| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Medical Service and Geriatric Research Education and Clinical Center Veterans Affairs Palo Alto Health Care System, and Division of Endocrinology, Gerontology, and Metabolism Department of Medicine Stanford University Palo Alto, California 94304
| ABSTRACT |
|---|
|
|
|---|
2-fold increase in the
abundance of Igf2 mRNA in liver from treated mice compared
with that of control mice. There was no significant change in
Igf2 or H19 expression in brain. In the
5-aza-C-treated mice, there was dramatic modulation of Igf2
imprinting. In some tissues, Igf2 was expressed
biallelically, while in other tissues, the paternal allele was silenced
and the normally imprinted maternal allele was expressed, an example of
allelic switching. There was no change in the normal biallelic pattern
of Igf2 expression in brain. H19, on the other
hand, remained imprinted in all tissues in mice treated with 5-aza-C.
These results provide the first example of a pharmacological
manipulation of genomic imprinting of an endogenous gene in
vivo and further implicate DNA methylation as an important factor
in maintaining the differential allelic expression of the
Igf2 gene. | INTRODUCTION |
|---|
|
|
|---|
Genomic imprinting is associated with allele-specific DNA methylation (12, 13, 14, 15). In mouse embryos that are deficient in the DNA methyltransferase (MTase) gene, the expression of H19, Igf2, and Igf2r is altered such that the normally imprinted paternal allele of H19 is activated, and the normally expressed paternal allele of Igf2 and the expressed maternal allele of Igf2r are repressed (16). These results suggest that a normal level of DNA methylation is required for the differential expression of imprinted genes. Similarly, in Wilms tumor, alterations in the allelic expression of IGF-II and H19 are usually associated with abnormal patterns of DNA methylation (17, 18).
Recent studies in our laboratory have shown that Igf2 is imprinted in all tissues except the central nervous system (CNS), where both parental alleles become transcriptionally active from all three mouse Igf2 promoters (mP1-mP3) (3). H19, however, is always monoallelically expressed in CNS. In a study using cultured primary human and mouse astrocytes, DNA demethylation induced by the demethylating agent, 5-azacytidine (5-aza-C), dramatically increased the expression of Igf2. Interestingly, the increased expression of Igf2 was primarily derived from the activation of the normally imprinted maternal allele, with the normally expressed paternal allele also remaining active (19). In this study, we have examined the effects of DNA demethylation on the expression and genomic imprinting of both Igf2 and H19 in vivo by treating newborn mice with 5-aza-C. Our results indicate that DNA demethylation affects the level of expression of both Igf2 and H19 in liver. Furthermore, 5-aza-C leads to loss of Igf2 imprinting in some tissues and allelic switching in other tissues, confirming the importance of DNA methylation in the regulation of the imprinting process and demonstrating that a pharmacological agent can alter genomic imprinting in vivo.
| RESULTS |
|---|
|
|
|---|
After treatment with sodium bisulfite, the unmethylated cytosine
residues, but not the methylated cytosine residues, in genomic DNA will
be converted into the uridine residues. After PCR amplification, the
uridine residues are visualized as thymidine residues on sequencing
gels, whereas the methylated cytosine residues remain unchanged. As
seen in the genomic sequencing gel of Igf2 mP3 (Fig. 1
), all cytosine residues that are
adjacent to adenosine, thymidine, and cytosine were converted to
thymidine (T), indicating that the sodium bisulfite reaction was
complete, changing all unmethylated cytosine residues into uridine.
Interestingly, partial or hemi-DNA methylation was observed in three
CpG sites in the mP3 region in the control mouse (Fig. 1B
). It is also
interesting to note that, in one HapII site (CCGG), the
first cytosine residue was fully converted to thymidine, whereas part
of the second cytosine adjacent to the G residue remained a C residue
in the gel, indicating that only CpG dinucleotides in genomic DNA are
methylated. However, in treated mice, all these three CpG sites in the
mP3 region were demethylated by 5-aza-C treatment. These results
indicate that treatment with 5-aza-C can completely demethylate DNA in
this mP3 region, which contains fewer CpG dinucleotides than does the
mP2 region (19).
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
In this in vivo study, we examined the importance of DNA demethylation on the expression and imprinting of Igf2 and H19 by injecting mice with the demethylating agent 5-aza-C. We observed a significant increase in the expression of both Igf2 and H19 in liver of mice treated with 5-aza-C. The increase of Igf2 expression in these tissues was confirmed using both PCR and RPA analyses. This finding is consistent with previous work done in our laboratory in cultured cells treated with 5-aza-C and 2-deoxy-5-aza-C (19). We showed that in cells treated with 5-aza-C, genomic DNA became increasingly demethylated. When the cells were treated with 5-aza-C for sequential passages, a dramatic increase in Igf2 expression was observed. In addition, Eversole-Cire et al. (24) examined Igf2 expression in cells that were cultured from a disomic mouse that possessed a duplicated maternal (and absent paternal) chromosome 7. When they treated cells with 2-deoxy-5-aza-C, they saw a 2- to 4-fold increase in Igf2 expression from the imprinted allele. Jaenisch et al. (22) also showed that 5-aza-C treatment activated silent retroviral transgenes in postnatal mice, indicating that DNA demethylation affects the expression of a previously suppressed foreign gene in vivo as well. We have shown here that, like a transgene, the expression of endogenous imprinted genes can also be affected in vivo by treatment with DNA-demethylating agents.
We then asked whether DNA demethylation increased expression of hepatic
Igf2 and H19 in the liver tissues from the
normally expressed allele, or from the silent, imprinted allele. Using
the BsaA1 polymorphism previously discovered in our laboratory (3), we
were able to determine that the maternal allele of Igf2 was
expressed in peripheral tissues of 5-aza-C-treated mice. In some
tissues, both alleles were expressed, while in others, the paternal
allele was repressed, leaving the maternal allele as the dominant
expressed allele. To ensure that the relaxation of imprinting of
Igf2 that we observed was not the result of genomic DNA
contamination, we used a primer set designed to cross the intron border
such that the genomic DNA and the cDNA would give different size bands
and could thus be distinguished. The problem of incomplete digestion by
BsaA1 was excluded in this study as we used backcross mice to check the
allelic expression of Igf2. The backcross mice carried the
undigested Mus musculus allele as the paternal allele, while
the digested M. spretus allele was maternally derived. The
observed M. spretus alleles seen in Figs. 3
and 4
represent,
therefore, the transcript from the maternal allele.
Our data suggest that the maternal Igf2 allele is normally hypermethylated and thus is transcriptionally silent. Treatment with 5-aza-C removes this restriction and allows it to be transcribed. In agreement with this hypothesis, it has been shown that the maternal allele of Igf2 is hypermethylated in Wilms tumors with normal Igf2 imprinting, whereas it is hypomethylated in tumors that display a loss of imprinting of Igf2 (25). Thus it appears that DNA demethylation could be the epigenetic change underlying the loss of imprinting, and hence, the increased expression of Igf2. Other studies, however, have shown that the upstream region of the paternal Igf2 allele is normally methylated (14).
In Wilms tumors with loss of imprinting of IGF2, there is no expression of H19. Examination of the methylation status indicated that the inactivated maternal allele of H19 became heavily methylated (17, 25). In our study, the increased expression of H19 in liver was not accompanied by a relaxation of the normally silent paternal allele. The paternal specific methylation at the 5' region of the H19 gene is a potential imprinting mark (26, 27). According to the enhancer competition model, these methyl groups suppress paternal H19 expression by inhibiting the genes interaction with enhancers (26). One would expect then, that DNA demethylation would lead to a loss of this restriction and thus result in biallelic expression of H19. This was shown in a mouse study by Li et al. (16), in which mice deficient in the DNA MTase gene showed activation of the paternal H19 allele and biallelic H19 expression. It is important to note however, that in contrast to this experiment, the MTase knock-out experiment did not allow imprinting marks via methylation ever to be established. Due to deficiency in the MTase gene, methylation during embryogenesis and thereafter was abolished. Thus, the presumed imprinting marks via methylation could never have been established in those mice. In this study, the normal imprinting process was allowed to be established and preserved during normal embryogenesis, and injection of newborn and mature mice with 5-aza-C provided a method for us to examine the modulation of imprinting by subsequent demethylation. Therefore, the effect of DNA demethylation on genomic imprinting seems to be variable, depending upon whether the intervention is set before or after the establishment of imprinting pattern.
The lack of any imprinting changes for H19 in 5-aza-C-treated mice in this study suggests that H19 imprinting is more stringent and stable relative to Igf2 imprinting. The 5-aza-C treatments may have been administered too late during development to affect what we presume is the imprinting mark for H19, and so its normal imprinting pattern was maintained. Thus it seems that Igf2 imprinting is leaky relative to that of H19, where no paternal transcripts were observed (12). A stronger, more stable imprint mark for H19 should not be surprising as it has been shown that the H19 gene, together with its allele-specific DNA methylation domain and the 3'-enhancers, is sufficient to impart imprinting on a transgene (26). Also, it has been shown that maternal inheritance of the deletion of the H19 gene leads to disruption of Igf2 imprinting (28). Thus it has been proposed that a small region surrounding the H19 structural gene contains the required elements for its allele-specific expression, and that Igf2 acquires its appropriate allele-specific expression via its linkage to H19. If this is indeed the case, then one would presume that the H19 imprint elements are relatively stable, and the inability of 5-aza-C treatment to effect a change in allelic expression should not be altogether unexpected.
There were no imprinting changes for Igf2 in brain as both parental alleles were still actively transcribed. H19 maintained its normal imprinting pattern in brain, and in all the tissues examined, with no observed relaxation of imprinting of the normally silent paternal allele. This observed monoallelic expression of H19, coexpressed with Igf2 in brain, is consistent with previous results that also showed this same expression pattern of these two genes (29). It was hypothesized that there was attachment of the Igf2-H19 intergenic region to a nuclear scaffold on the maternal chromosome, which insulates the maternal Igf2 genes promoters from interacting with the enhancers downstream of H19 (30), or a protein(s) necessary for the maternal allele scaffold attachment is absent in brain, allowing the Igf2 gene to interact freely with the downstream enhancers for the efficient expression of the imprinted maternal allele (29).
The phenomenon of allelic switching has been seen with other imprinted genes (31). If the methylation hypothesis of imprinting is correct, then it is possible that very small changes in CpG methylation can alter allelic transcription; if certain cells are at a threshold level of methylation, any further change in methylation could lead to changes in allele transcription. These cells would thus be susceptible to allelic switching. Allelic switching may depend upon the level of DNA methyltransferase activity, or it may reflect the presence of other modifying genes, which may be tissue or development specific.
The ability of a pharmacological agent to modulate the imprinting process of an endogenous gene indicates that imprinting may be a relatively plastic phenomenon. Since loss of imprinting has been linked to oncogenesis, it is intriguing to consider whether environmental toxins or diet deficient in folate or other methyl donors could alter genomic imprinting, making the organism vulnerable to a variety of neoplasms.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Treatment of Mice with 5-Aza-C
The backcross mice were used to study the imprinting changes of
Igf2 and H19 in 5-aza-C-treated mice. Mice were
injected intraperitoneally with 5-aza-C (2.5 µg/g body weight), a
dose at which no adverse effects have been reported by other
laboratories (22, 23). Control mice were injected with the same volume
of PBS. Each mouse was injected twice, at day 11 and at day 14 of life.
Mice were killed and their organs were harvested at day 25 of life.
To study the effect of DNA demethylation on the allelic expression of Igf2 in adult life, we also treated six informative 2-month-old backcross mice (3, 19). 5-aza-C was given at the same intervals and doses used for the young mice. Animals were killed 7 days after the second dose of 5-aza-C.
Because of the difficulty in breeding interspecific mice, BALB/c mice were used to examine changes in Igf2 and H19 mRNA abundance. The animal experiments were approved by the Animal Care and Use Committee of the VA Medical Center and were conducted in accord with the procedures in Guidelines for Care and Use of Experimental Animals.
RNA and DNA Extraction
Tissues were collected and frozen on dry ice until RNA and DNA
extraction. RNA and DNA (TNA, total nucleic acids) were extracted
simultaneously as previously described (9, 3, 19). Tissues (100200
mg) were homogenized in 1.0 ml solution D (4 M guanidium
thiocyanate solution containing 1% ß-mercaptoethanol, and 2.5
mM sodium citrate, pH 7.0, and 0.5% Sarcosyl), and were
extracted with an equal volume of phenol chloroform. The supernatant
was precipitated with an equal volume of isopropanol. To reduce the
background for PCR analysis, the TNA was reprecipitated by adding one
half volume of 7.5 M ammonium acetate and 2 volumes of
ethanol.
DNA Methylation Analysis
The DNA methylation status of Igf2 in selected
tissues was measured by the bisulfite genome-sequencing method (32).
Genomic DNA (1 µg), overlaid with 100 µl liquid wax (MJ Research,
Boston, MA), was denatured by 0.3 M NaOH at 37 C for 20 min
and treated with 3.5 M NaHSO3/1.0
mM hydroquinone (pH 5.0) in ice overnight. The solution was
then incubated at 50 C for 8 h, and DNA was extracted with QIAEX
II Kit (QIAGEN Inc., Chatsworth, CA) for PCR amplification. Genomic DNA
of the mouse Igf2 promoter 3 (mP3) region was amplified by
PCR for 30 cycles (95 C for 10 sec, 65 C for 40 sec, 72 C for 20 sec).
The PCR primers were MII2279 (5'-primer): AGGTTAGTTTTTGGGGGTGTAGGAG and
MII2617 (3'-primer): TACCCGTACCCTAACCACCCCACTA. PCR products were
separated on a 1.8% agarose gel. DNA bands were excised from the
agarose gel, purified with QIAEX II Kit, and sequenced by an
AmpliCycle Sequencing kit (Perkin Elmer, Foster City, CA) using
[
-32P]ATP end-labeled MII2279 according to the
manufacturers protocol.
Complementary DNA Preparation
To eliminate the DNA, TNA was treated with ribonuclease-free
deoxyribonuclease I (Stratagene, La Jolla, CA) at 37 C for 1 h and
then was reversed transcribed into cDNAs using murine leukemia reverse
transcriptase in the presence of random hexamers (GIBCO BRL,
Gaithersburg, MD), ribonuclease inhibitor (USB, Cleveland, OH),
dithiothreitol, and 4 deoxynucleoside triphosphate at 37 C for 25 min,
followed by 5 cycles (50 C, 20 sec, and 37 C, 5 min) (3, 9, 19). The
cDNA samples were diluted 10-fold with distilled water and used for PCR
amplification.
PCR Analysis
For accurate quantification of Igf2 and
H19 expression in the treated and control mice, we used PCR
to amplify Igf2 and 18S in the same PCR reaction. The 18S
PCR products were used as an internal control to adjust for the
variation among samples.
The cDNA samples were amplified in a 2.5-µl reaction mixture in the
presence of 50 µM deoxynucleoside triphosphate, 0.2
µM IGF-II primers, 0.25 µCi
-dCTP (Amersham Co.,
Arlington Heights, IL), and 0.125 U Tfl DNA polymerase (Epicentre
Technologies, Madison, WI) with a hot-start PCR (19). The cDNAs and
primers were covered with liquid wax (MJ Research) and were heated to
95 C for 2 min, then amplified for a varying number of cycles ranging
from 35 for brain to 27 for liver, at 94 C for 40 sec, 65 C for 40 sec,
72 C for 30 sec, and then followed by 3 min at 72 C. Due to the high
abundance of 18S in these tissues, we added the 18S primers so that
they would be amplified for only 10 to 12 cycles, such that comparable
PCR products of 18S and Igf2 and H19 were
amplified. After PCR, the amplified DNAs were electrophoresed on 5%
polyacrylamide-urea gel and were exposed to the screen of the
PhosphorImager Scanner (Molecular Dynamics, Sunnyvale, CA). After
PhosphorImager scanning, the image density of the Igf2 and
H19 signals were calculated against the density of the
internal 18S PCR control.
The oligonucleotide primers used for Igf2 quantification were: 1) Human/Mouse IGF2: 3038 (5'-primer): TGGCCCTCCTGGAGACG(A)TACTGTGC, 2384 (3'-primer): TTGGAAGAACTTGCCCACGGGGTATC; 2) 18S: 3967 (5'-primer): ATCCTGCCAGTAGCATATGCTTGTCT, 3968 (3'-primer): TTATCCAAGTAGGAGAGGAGCGAGC. The oligonucleotide primers used for H19 quantification were 4025 (5'-primer): TAAGTCGATTGCACTGGTTTGGAGT, and 4026 (3'-primer): TGATGGAACTGCTTCCAGACTAGG.
IGF-II RNA Quantification by RPA
Igf2 PCR-quantification was also confirmed by the RPA method in
liver and brain samples in selected mice after 5-aza-C treatment. As
previously described (19), the RPA quantification of IGF-II mRNA was
performed using RPA II kit (Ambion Inc., Austin, TX). The RPA probe for
IGF-II was prepared by MAXI script T7 kit (Ambion Inc.) from
BglII-digested plasmid DNA, which was cloned from M.
spretus mouse liver (3). The control probe of ß-actin was
in vitro transcribed from actin plasmid DNA provided by the
kit. Equal amounts (15 µg) of total RNA were used in each RPA
reaction. The protected RNA fragments of IGF-II and ß-actin were
separated on 5% polyacrylamide-urea gel and quantitated by
PhosphorImager scanning.
Determination of Igf2 and H19
Imprinting
Allelic expression of Igf2 was assessed by amplifying
the cDNA samples by PCR as described above, with a
-32P
end-labeled primer and then digesting with BsaA1 (3, 19). The products
were run on a 5% polyacrylamide-urea gel. Allelic expression of
H19 was examined in the same manner except the digestion was
performed with FokI (14). The oligonucleotide primers used for
Igf2 imprinting were: Human/Mouse IGF2: 3038
(5'-primer): TGGCCCTCCTGGAGACG(A)TACTGTGC, and 3303 (3'-primer):
CTGTCCCTGCTCAAGAGGAGGTCA. The oligonucleotide primers used for
H19 imprinting were the same as those for H19
quantification.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Supported by NIH Grant DK-36054 and the Research Service of the Department of Veterans Affairs.
1 These individuals made an equal contribution to this project. ![]()
Received for publication April 2, 1997. Revision received August 5, 1997. Accepted for publication September 11, 1997.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Li, J.-F. Hu, X. Qiu, J. Ling, H. Chen, S. Wang, A. Hou, T. H. Vu, and A. R. Hoffman CTCF Regulates Allelic Expression of Igf2 by Orchestrating a Promoter-Polycomb Repressive Complex 2 Intrachromosomal Loop Mol. Cell. Biol., October 15, 2008; 28(20): 6473 - 6482. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Waterland, J.-R. Lin, C. A. Smith, and R. L. Jirtle Post-weaning diet affects genomic imprinting at the insulin-like growth factor 2 (Igf2) locus Hum. Mol. Genet., March 1, 2006; 15(5): 705 - 716. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Fish, C. C. Matouk, A. Rachlis, S. Lin, S. C. Tai, C. D'Abreo, and P. A. Marsden The Expression of Endothelial Nitric-oxide Synthase Is Controlled by a Cell-specific Histone Code J. Biol. Chem., July 1, 2005; 280(26): 24824 - 24838. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.P. Enright, L.-Y. Sung, C.-C. Chang, X. Yang, and X.C. Tian Methylation and Acetylation Characteristics of Cloned Bovine Embryos from Donor Cells Treated with 5-aza-2'-Deoxycytidine Biol Reprod, April 1, 2005; 72(4): 944 - 948. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Han, W. Xie, S. H. Kim, L. Yue, and J. DeJong A Short Core Promoter Drives Expression of the ALF Transcription Factor in Reproductive Tissues of Male and Female Mice Biol Reprod, September 1, 2004; 71(3): 933 - 941. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.P. Enright, C. Kubota, X. Yang, and X.C. Tian Epigenetic Characteristics and Development of Embryos Cloned from Donor Cells Treated by Trichostatin A or 5-aza-2'-deoxycytidine Biol Reprod, September 1, 2003; 69(3): 896 - 901. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Viollet, M. Yaniv, and M. Pontoglio Embryonic but Not Postnatal Reexpression of Hepatocyte Nuclear Factor 1{alpha} (HNF1{alpha}) Can Reactivate the Silent Phenylalanine Hydroxylase Gene in HNF1{alpha}-Deficient Hepatocytes Mol. Cell. Biol., June 1, 2001; 21(11): 3662 - 3670. [Abstract] [Full Text] |
||||
![]() |
J.-F. Hu, J. Pham, I. Dey, T. Li, T. H. Vu, and A. R. Hoffman Allele-Specific Histone Acetylation Accompanies Genomic Imprinting of the Insulin-Like Growth Factor II Receptor Gene Endocrinology, December 1, 2000; 141(12): 4428 - 4435. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Hu, H. Oruganti, T. H. Vu, and A. R. Hoffman Tissue-Specific Imprinting of the Mouse Insulin-Like Growth Factor II Receptor Gene Correlates with Differential Allele-Specific DNA Methylation Mol. Endocrinol., February 1, 1998; 12(2): 220 - 232. [Abstract] [Full Text] |
||||
![]() |
A. El Kharroubi, G. Piras, and C. L. Stewart DNA Demethylation Reactivates a Subset of Imprinted Genes in Uniparental Mouse Embryonic Fibroblasts J. Biol. Chem., March 16, 2001; 276(12): 8674 - 8680. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |