Molecular Endocrinology 11 (13): 1911-1923
Copyright © 1997 by The Endocrine Society
Interaction of Wild Type and Dominant-Negative p55PIK Regulatory Subunit of Phosphatidylinositol 3-Kinase with Insulin-Like Growth Factor-1 Signaling Proteins
Isabelle Mothe,
Laurent Delahaye,
Chantal Filloux,
Sebastian Pons,
Morris F. White and
Emmanuel Van Obberghen
Institut National de la Santé et de la Recherche
Médicale (INSERM) U145 (I.M., L.D., C.F., E.V.O.)
06107 Nice Cédex 2, France Joslin Diabetes Center (S.P., M.F.W.)
and Department
of Medicine Harvard Medical School Boston,
Massachusetts 02215
 |
ABSTRACT
|
|---|
In a first series of experiments done in the yeast
two-hybrid system, we investigated the nature of protein-protein
interaction between the regulatory subunit of phosphatidylinositol
3-kinase (PI 3-kinase), p55PIK, and several
of its potential signaling partners. The region between the Src
homology 2 (SH2) domains of p55PIK bound to the
NH2 terminus region of p110
, as previously
shown for p85
. Moreover, we found that the insulin-like growth
factor-1 receptor (IGF-IR) bound to p55PIK; the
interaction occurred at the receptor tyrosine 1316 and involved both
p55PIK SH2 domains. Interaction between
p55PIK and IGF-IR was seen not only in the
yeast two-hybrid system, but also using in vitro binding
and coimmunoprecipitation of lysates from IGF-1 stimulated 293 cells
overexpressing p55PIK. Further, IGF-I stimulation of these
cells led to tyrosine phosphorylation of
p55PIK. In 293 cells association of
p55PIK with insulin receptor substrate- 1 and
with IGF-IR was dependent on PI 3-kinase, since it was increased by
wortmannin, an inhibitor of PI 3-kinase. Further, by deleting amino
acids 203217 of p55PIK inter-SH2 domain, we
engineered a p55PIK mutant unable to bind to
the p110
catalytic subunit of PI 3-kinase. This mutant had a
dominant-negative action on insulin-stimulated glucose transport, since
insulins effect on Glut 4 myc translocation was inhibited in
adipocytes expressing mutant p55PIK.
Importantly, this dominant-negative mutant was more efficient than wild
type p55PIK in associating to IGF-IR and
insulin receptor substrate-1 in 293 cells. Taken together, our results
show that p55PIK interacts with key elements in
the IGF-I signaling pathway, and that these interactions are negatively
modulated by PI 3-kinase itself, providing circuitry for regulatory
feedback control.
 |
INTRODUCTION
|
|---|
Phosphatidylinositol 3-kinase (PI 3-kinase) is a heterodimeric
enzyme consisting of an 85-kDa regulatory subunit (p85) and a 110-kDa
catalytic subunit (p110) with dual specificity, i.e. lipid
kinase and serine kinase activity (1, 2). Stimulation of the p110 lipid
kinase activity leads to production of 3-phosphoinositides. While the
precise role of these lipid products is still unclear, it is believed
that they could act as second messengers that deliver specific signals
in the cell. Recently, Cantley et al. reported that
phosphatidylinositol-(3,4,5)-triphoshate is able to bind to Src
ho-mology 2 (SH2) domains of p85 PI 3-kinase and of
pp60c-src, suggesting a role in the control of SH2 domain
binding to phosphoproteins (3). In neuron-like PC12 cells, PI 3-kinase
is necessary for neurite outgrowth and prevention of apoptosis upon
nerve growth factor (NGF) stimulation (4). Moreover, PI 3-kinase
appears to be involved in insulin-induced actin rearrangement,
pp70S6k activation, and translocation of glucose
transporters Glut4 (5, 6, 7, 8, 9).
p85 carries in its C-terminal part two SH2 domains separated by an
inter-SH2 (IS) domain. These three domains are highly conserved between
the different p85 isoforms, suggesting that they are likely to play an
important role. Indeed, the IS domain is the binding site for the N
terminus of p110, and SH2 domains are high-affinity binding sites for
the phosphorylated motifs, pYXXM, occurring in tyrosine kinase
receptors and receptor substrates. This suggests that binding of p85
SH2 domains to phosphotyrosine-containing sequences leads to
conformational changes in the protein. These structural modifications
would be transmitted to p110 through its association with the IS domain
of p85, resulting in p110 activation (10, 11).
Recently, two novel regulatory subunits of PI 3-kinase have been
cloned: 1) p55
, which corresponds to an alternatively spliced form
of p85
(12, 13), and 2) p55PIK (14). These newly
identified proteins have, in common with p85, a highly conserved region
comprising the two SH2 domains separated by an IS domain and differ
from it in their NH2 terminus. Indeed, the Bcr, the SH3
domains, and one of the proline-rich motifs found in p85 isoforms are
absent in p55
and p55PIK and are replaced by a unique
sequence of 34 amino acids with a pronounced homology between the two
p55 proteins. With regard to the tissue distribution of the two newly
disclosed PI 3-kinase-regulatory subunits, they are found in most
tissues. However, p55
is more abundant in brain and muscle (13),
whereas p55PIK expression is the highest in brain and
testis (14).
Insulin-Like Growth Factor-1 (IGF-I) binding to its transmembrane
receptor (IGF-IR) leads to receptor autophosphorylation and
phosphorylation of intracellular substrates including insulin receptor
substrate-1 (IRS-1) (15). It is generally believed that, upon IGF-I
stimulation, the major pathway leading to activation of p110 PI
3-kinase is triggered by binding of p85 SH2 domains to
tyrosine-phosphorylated IRS-1 (16, 17). However, PI 3-kinase is also
able to bind directly to the IGF-IR (18, 19, 20, 21). Indeed, the
carboxy-terminal tyrosine 1316 of IGF-IR, contained in the YAHM
sequence, is a potential binding site for p85 PI 3-kinase, but the role
of this association is still unclear.
The newly identified regulatory subunits of PI 3-kinase,
p55PIK, and IGF-I receptors are both highly expressed in
brain, especially in the early stages of development (14, 22).
Therefore, we speculated that p55PIK could act as a
downstream effector in the IGF-IR-signaling pathway. In the present
study, we wished to characterize in the yeast two-hybrid system the
interaction of p55PIK with a series of potentially
associated proteins. We also investigated whether p55PIK
was associated with these molecules in intact mammalian cells and
whether PI 3-kinase modulated these associations. Finally, we
engineered a mutant of p55PIK unable to bind to p110 and
examined its effect on insulin-stimulated glucose transport and
association with IGF-IR-signaling proteins in mammalian cells.
 |
RESULTS
|
|---|
Interaction of p55PIK and its subdomains with
different proteins was first investigated using the yeast two-hybrid
system. To do so, we engineered several hybrid proteins with either the
bacterial repressor LexA, which contains a DNA-binding domain (LexA),
or the activation domain of the transcription factor GAL4 (GAD). Both
types of hybrids were coexpressed in the yeast strain L40. When these
domains fused to LexA and GAL4 are able to interact, a functional
transcription factor is reconstituted that recognizes the LexA
upstream-activating sequences contained in the reporter genes LacZ and
HIS3. The specificity of our system was evaluated by testing all our
hybrids with unrelated proteins (LexA-lamin and GAD-RAF). In these
instances, no reporter gene activity was detected (data not shown).
Taking advantage of the hemagglutinin epitope, we also verified that
p55PIK and its different subdomains in fusion with GAD were
expressed in yeast (not shown).
Mapping of the p110
and p55PIK
Domains Involved in Interaction between Both Proteins
To study the interaction of p110
with p55PIK in the
yeast two-hybrid system, the entire protein and several constructs of
p110
in fusion with LexA were cotransformed with p55PIK
fused to GAL4 activation domain (GAD-p55PIK). Figure 1
shows the ß-galactosidase activity
obtained for each cotransformation, which reflects the transcriptional
level of the reporter gene LexA-LacZ. p110
strongly interacted with
p55PIK, since their coexpression led to a high level of
ß-galactosidase activity (
5000 U). Increased deletions in the
p110
C-terminal domain from amino acids 1068 to 870 (BP), to 576
(BX), and to 127 (R1) reduced interaction with p55PIK,
since the ß-galactosidase activity was decreased by about 5-fold for
the three constructs. Moreover, when GAD-p55PIK was
coexpressed with p110
deleted from amino acids 1127
(LexA-p110
R1), no ß-galactosidase activity was measured. These
results demonstrate that the N-terminal domain of p110
is absolutely
required for interaction with p55PIK but that additional
sequences in the C terminus are also involved.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 1. Mapping of p110 Subdomains Interacting with
p55PIK
The yeast reporter strain L40 was cotransformed with cDNAs encoding
GAD-p55PIK and the indicated LexA-p110 constructs, which
were obtained as described in Materials and Methods.
Double transformants were grown in liquid culture, and transactivation
of the reporter gene LacZ was assayed by measuring ß-galactosidase
activity and using the substrate chlorophenol
red-ß-D-galactopyranoside. ß-Galactosidase units were
determined according to Miller (42). Values represent the average
± SE of three independent transformants. One
representative experiment of three is shown.
|
|
Next we mapped the region of p55PIK responsible for its
interaction with p110
. LexA-p110
was coexpressed with the
different subdomains of p55PIK fused to GAD (Table 1
). Figure 2
illustrates the ß-galactosidase
activity obtained for each cotransformant. No activity was detected
when p110
was expressed with the isolated p55PIK N
terminus, or amino-terminal SH2 (nSH2), or carboxy-terminal SH2 (cSH2)
domains. In contrast, the full-length protein as well as the constructs
containing the IS domain (IS alone, nSH2/IS, IS/cSH2, and IS flanked
with both n- and c-SH2 domains, nSH2/IS/cSH2) gave a ß-galactosidase
activity varying from 20009000 U. Note that increased
ß-galactosidase activity seen with GAD-nSH2/IS/cSH2, compared
with other constructs, was due to higher expression level of this
hybrid protein (not shown). Our data thus show that the different
hybrid proteins containing p55PIK IS domain are able to
interact with p110
. Since IS is the only domain able to bind by
itself to p110
, this region appears to be necessary and sufficient
to make possible interaction between p110
and p55PIK. We
also cotransformed the N-terminal domain of p110
(p110RI) and the IS
domain of p55PIK and found that both isolated domains are
sufficient to create an interaction (not shown).
We conclude that p55PIK binds to the amino-terminal domain
of p110
, comprising amino acids 1127. For p55PIK, this
interaction occurs through its IS domain, corresponding to amino
acid sequence 154348.
In Vitro Association of
p55PIK to the IGF-IR
Next we investigated whether p55PIK interacts with the
IGF-IR. To address this issue, we produced 35S-labeled
p55PIK by in vitro translation. We also prepared
partially purified IGF-IR fixed on wheat germ agglutinin (WGA) beads,
which were autophosphorylated or not with unlabeled ATP.
35S-labeled p55PIK was then incubated with
IGF-IR for 3 h at 4 C, and pellets were extensively washed.
Finally, the samples were submitted to SDS-PAGE and autoradiographed
(Fig. 3
). 35S-Labeled
p55PIK incubated with beads alone reflected the
experimental background, which corresponds to nonspecific binding (lane
1). In lane 9, 35S-labeled p55PIK was
immunoprecipitated with an antibody to p55PIK as a positive
control. Compared with lane 1, we observed a specific band that we
identified as p55PIK given its appropriate electrophoretic
mobility. Regardless of the quantity of receptors, when
[35S]p55PIK was incubated with
unphosphorylated IGF-IR, no labeled species was retained (lanes 35).
In contrast, even with the lowest quantity of phosphorylated IGF-IR
(0.1 pmol), we could detect a signal corresponding to
p55PIK (lane 6). This indicates that a fraction of labeled
p55PIK bound to the phosphorylated IGF-IR. Moreover,
p55PIK associated to the receptor in a dose-dependent
manner, since we could visualize more associated p55PIK
when the amount of phosphorylated IGF-IR was increased (lanes 68).
Our results demonstrate that p55PIK bound to the IGF-IR
in vitro and that this process requires receptor
autophosphorylation.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 3. In vitro Association of IGF-IR with
p55PIK
Different quantities of WGA-purified IGF-IR were adsorbed on
WGA-coupled agarose beads and autophosphorylated or not with unlabeled
ATP. 35S-labeled p55PIK protein was prepared by
performing an in vitro transcription/translation and
added to either pellets containing phosphorylated or unphosphorylated
IGF-IR or protein A-Sepharose beads preincubated with antibodies to
p55PIK. After 3 h at 4 C, samples were extensively
washed and subjected to SDS-PAGE under reducing conditions. A
representative autoradiogram of three independent experiments is
shown.
|
|
Interaction of p55PIK with the IGF-IR
in the Yeast Two-Hybrid System and Role of the Receptor Kinase and
Autophosphorylation Sites in This Interaction
Cotransformants expressing GAD-p55PIK and
LexA-IGF-IRß (wild type and mutant forms of the receptor
ß-subunit) were tested for their ability to give blue colonies on a
X-gal filter assay (Table 2
). We
previously showed that the IGF-IRß hybrid expressed in L40
corresponds to a constitutively active receptor (23). When
p55PIK was coexpressed with wild type IGF-IR,
ß-galactosidase activity was strong, indicating binding of
p55PIK to IGF-IR. This interaction was dependent on the
receptor tyrosine kinase since yeast failed to give X-gal activity with
kinase-deficient IGF-IR, in which lysine 1003 has been replaced by
threonine (LexA-IGF-IRß K1003T). These results are in agreement with
those found for in vitro binding experiments described above
(Fig. 3
).
The IGF-IR autophosphorylation sites corresponding to juxtamembrane
tyrosine 950 and C terminus tyrosine 1316 have been implicated in
binding cytosolic proteins. Indeed, tyrosine 950 binds to the
phosphotyrosine binding (PTB) domain of IRS-1, IRS-2, and Shc (23, 24),
whereas tyrosine 1316 is the binding site for p85
of PI 3-kinase
(19) and for phosphotyrosine phosphatase SHP-2 (25). Compared with wild
type receptor, the IGF-IR mutant Y950F displayed the same level of
ß-galactosidase activity, indicating that interaction with
p55PIK was not affected by the tyrosine 950 mutation.
Interestingly, interaction was dramatically decreased with the Y1316F
and with the Y950F/Y1316F mutants. Next, we examined the involvement of
the three major IGF-IR autophophosphorylation sites, tyrosines 1131,
1135, and 1136, located in the kinase domain. As shown in Table 2
, the
ß-galactosidase activity, seen with yeast expressing
p55PIK and the IGF-IR singly mutated on tyrosine 1131,
1135, and 1136, was similar to that obtained with wild type receptor.
This suggests that, taken individually, none of these three
autophosphorylation sites is involved in p55PIK binding.
However, IGF-IR mutated on two tyrosines (LexA-IGF-IRß Y1131F/Y1135F
or Y1135F/Y1136F) or on three tyrosines (LexA-IGF-IRß
Y1131F/Y1135F/Y1136F) could interact poorly, if at all, with
p55PIK. These sites have been shown to be essential for
kinase activity, since phosphorylation of the three sites is necessary
to obtain a fully active receptor (26, 27, 28). Mutation of only one site
is unlikely to be sufficient to impair receptor kinase activity, so
that interaction with p55PIK is unchanged. In contrast,
when more than one site is mutated, receptor tyrosine kinase activity
is severely decreased (two sites) or abolished (three sites). This
leads to a loss in p55PIK binding, which is very likely to
be due to a loss in phosphorylation of receptor tyrosine 1316.
Taken together, our data suggest that 1) IGF-IR tyrosine kinase
activity is required for receptor binding to p55PIK; 2)
IGF-IR C-terminal tyrosine 1316 is the major p55PIK binding
site to the receptor, and 3) the receptor kinase domain
autophosphorylation sites are probably not directly implicated as part
of a binding surface, but are necessary for the modulation of IGF-IR
autophosphorylation.
Mapping of the p55PIK Domain
Responsible for Its Interaction with the IGF-IR ß-Subunit
The p55PIK constructs depicted in Table 1
were tested
for their ability to interact with wild type IGF-IR. The
ß-galactosidase activity measured with cotransformants expressing
LexA-IGF-IRß and GAD-p55PIK constructs is shown in Fig. 4
. In contrast to the full-length
protein, the p55PIK NH2-terminus and IS domains
failed to interact with IGF-IR. Moreover, isolated nSH2 and cSH2
domains and constructs containing at least one of the two SH2 domains
in combination with the IS domain (nSH2/IS, IS/cSH2 and nSH2/IS/cSH2),
were able to associate with the receptor. As was previously observed in
Fig. 2
, GAD-nSH2/IS/cSH2 gave a stronger ß-galactosidase activity,
compared with those obtained with other fusion proteins. This can be
explained by a stronger expression in yeast of GAD-nSH2/IS/cSH2,
compared with other p55PIK fusion proteins. These results
demonstrate that both nSH2 and cSH2 domains of p55PIK are
binding sites for the IGF-IR ß-subunit. Additional experiments with
IGF-IR mutated on tyrosine 1316 coexpressed with different subdomains
of p55PIK allowed us to confirm that this tyrosine was the
target for both SH2 domains, since we were unable to detect
ß-galactosidase activity in yeast coexpressing the Y1316F IGF-IR and
isolated nSH2 or cSH2 domains (data not shown). However, a residual
interaction could be observed with full-length and nSH2/IS/cSH2
constructs, suggesting that p55PIK could associate to
another site on the IGF-IR, albeit with very low efficiency compared
with binding to tyrosine 1316.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 4. Mapping of p55PIK Subdomains
Interacting with IGF-IR
Hybrid constructs between GAD and p55PIK or its subdomains
were obtained as described in Table 1 . These fusion proteins were
coexpressed with LexA-IGF-IRß in the yeast reporter strain L40.
Activity of the reporter gene LacZ was assayed by measuring
ß-galactosidase activity as described in Materials and
Methods. Values calculated according to Miller (42) are the
mean ± SE of one representative experiment done in
triplicate, i.e. with three independent
cotransformants.
|
|
Association of p55PIK with IGF-IR in
Intact Mammalian Cells
We examined whether in intact mammalian cells p55PIK
was able to associate with IGF-IR-signaling molecules. Therefore, 239
EBNA cells expressing p55PIK were stimulated with IGF-I,
and cell extracts were subjected to immunoprecipitation with antibodies
to p55PIK. Immunoblots with antiphosphotyrosine antibodies
revealed three proteins with a molecular mass of approximately 170, 95,
and 50 kDa (Fig. 5
). No proteins
were detected when cell extracts were subjected to immunoprecipitation
with nonimmune serum, or when the experiment was performed with
nontransfected cells, suggesting that the phosphoproteins seen in
transfected cells after IGF-I stimulation were due to the presence of
p55PIK. Using blotting with specific antibodies, we
identified the molecular species of 170, 95, and 50 kDa as being IRS-1,
IGF-IR ß-subunit, and p55PIK, respectively (data not
shown). Therefore, it would appear that in 293 cells expressing
p55PIK, IGF-I induces tyrosine phosphorylation of
p55PIK and stimulates immunoprecipitation of a ternary
complex between IGF-IRs, IRS-1, and p55PIK or binary
complexes between p55PIK and IRS-1 and between
p55PIK and IGF-IR.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 5. Association of Tyrosine-Phosphorylated Proteins
with p55PIK in Mammalian Cells
p55PIK-expressing or nonexpressing 293 EBNA cells were
treated or not with 10-7 M IGF-I for 5 min.
After cell lysis, extracts were submitted to immunoprecipitation with
an antibody to p55PIK or with nonimmune serum. Then the
samples were subjected to SDS-PAGE, followed by transfer to an
Immobilon membrane. Proteins were revealed with antibodies to
phosphotyrosine and [125I]protein A. A representative
autoradiogram of three independent experiments is shown.
|
|
Inhibition of PI 3-Kinase Associated with
p55PIK Increases its
Coimmunoprecipitation with IRS-1 and IGF-IR
We looked at the wortmannin effect on association of
p55PIK with IRS-1 and with IGF-IR in intact cells. The same
experiment as the one described in Fig. 5
was performed, except that
cells were pretreated with wortmannin before being exposed to IGF-I
(Fig. 6
). In cells expressing comparable
p55PIK amounts (panel C), IGF-I stimulated association of
p55PIK with both IRS-1 and IGF-IR ß-subunit, as
visualized by blots with antibodies to phosphotyrosine (panels
A and B). Importantly, addition of wortmannin increased the amount
of IGF-I-stimulated p55PIK-associated proteins,
i.e. IRS-1 (150200% increase) and IGF-IR (300400%
increase). These results are in agreement with a recent study by Rameh
et al. (3), who observed a similar phenomenon, but related
to the association of p85 PI 3-kinase with IRS-1 and with the insulin
receptor in hormone-stimulated CHO-HIR cells. Further, we found that
wortmannin alone enhanced association of IRS-1 to p55PIK in
the absence of IGF-I. Taken together, our data suggest that PI 3-kinase
negatively regulates association of p55PIK to IGF-I
signaling molecules, such as IRS-1 and IGF-IR.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 6. Effect of PI 3-Kinase Inhibition on Association of
p55PIK with IGF-IR- Signaling Proteins in Mammalian Cells
293 EBNA cells were transfected with 8 µg pcDNA3-p55PIK.
After 24 h, the cells were pretreated or not with 100
nM wortmannin and stimulated for 5 min with
10-7 M IGF-I (1: buffer, 2: wortmannin, 3:
IGF-I, 4: wortmannin and IGF-I). Cell lysates were immunoprecipitated
with antibodies to p55PIK. Proteins in the immune complexes
were separated by SDS-PAGE and transferred to an Immobilon membrane,
which was blotted with antibodies to phosphotyrosine (panels A and B)
or p55PIK (panel C). The autoradiograms are representative
of three independent experiments.
|
|
Construction of a p55PIK Mutant
Unable to Bind PI 3-Kinase p110
and Having a Dominant-Negative
Action on Insulin-Stimulated Glucose Transport
Increased association between p55PIK, IRS-1, and
IGF-IR seen with wortmannin could be due to inhibition of p110 PI
3-kinase or of related kinases in the cells. To investigate whether the
effect of the drug was actually due to repression of PI 3-kinase
associated with p55PIK, we engineered a p55PIK
mutant expected to be unable to bind p110. In a previous study,
Waterfield and associates (29) showed that deletion of amino acids
478492 in p85
IS domain leads to a loss of p85
binding to
p110
(29). Based on sequence homology between p55PIK and
p85
, we deleted the corresponding region in p55PIK IS
domain, i.e. amino acids 203217, and produced
203217
p55PIK mutant.
First, we looked at the interaction of
203217 p55PIK
in the yeast two-hybrid system. We fused the mutant with GAD in the
pACT II vector and coexpressed it, as well as wild type
p55PIK, with Ras, IGF-IR, or p110
fused to LexA.
After growth in appropriate medium, we measured ß-galactosidase
activity for each cotransformant (Fig. 7A
). As expected, neither
p55PIK protein produced ß-galactosidase activity when
coexpressed with Ras, indicating that no interaction occurred between
the proteins. Similar to what we showed in Figs. 1
and 2
,
p55PIK interacted strongly with p110
. In contrast,
203217 p55PIK did not bind to p110
, indicating that
the deleted 15 amino acids are essential. To be sure that the loss of
interaction seen with p55PIK deletion mutant was not due to
a lack of expression, we tested its ability to bind to IGF-IR. As shown
in Fig. 7A
,
203217 p55PIK was as efficient as wild
type p55PIK in binding IGF-IR. It is concluded that amino
acids 203217 of p55PIK are necessary for its interaction
with p110
, the catalytic subunit of PI 3-kinase.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 7. Comparison of 203217 p55PIK with
Wild-Type p55PIK for Its Binding to p110 in the Yeast
Two-Hybrid System (A), and for Its Effect on Insulin-Induced Glut 4 myc
Translocation in Rat Adipocytes (B)
A, LexA fused to Ras, IGF-R cytoplasmic domain, or PI 3-kinase
p110 was coexpressed with GAD-p55PIK or GAD- 203217
p55PIK in the yeast strain L40, and ß-galactosidase
activity was measured as described in Materials and
Methods. One experiment of three is shown, and data represent
the average ± SE of three isolated colonies. B,
Isolated rat adipocytes were transfected, as previously described (9),
with 2 µg of pCIS Glut 4 myc and 8 µg of pCIS vector (mock) or 6
µg of pcDNA3-p55PIK or pcDNA3- 203217
p55PIK adjusted to 10 µg total DNA using pCIS vector.
Twenty four hours later, cells were stimulated (hatched
bars) or not (open bars) with 10-7
M insulin before the quantification of myc at the cell
surface with antibodies. Results are expressed as percentages of
insulin-stimulted Glut 4 myc translocation in mock conditions and
represent the mean ± SE of three independent
experiments done in triplicate. *, P < 0.01; **,
P < 0.0005.
|
|
Next we wished to determine whether
203217
p55PIK was able to inhibit a biological effect requiring PI
3-kinase such as glucose transport. Indeed, insulin-sensitive glucose
transport in adipocytes has been shown to be dependent on PI 3-kinase,
based on experiments with pharmacological inhibitors and with
constitutively active enzyme mutants (5, 6, 7, 8, 9). Therefore, we subcloned
wild type and
203217 p55PIK in the eukaryotic
expression vector pcDNA3 and studied their effect on translocation of
epitope-tagged Glut4 (Glut 4 myc was subcloned into pCIS vector). To do
so, isolated rat adipocytes were cotransfected with pCIS-Glut 4 myc and
pcDNA3-p55PIK or pcDNA3-
203217 p55PIK or
empty expression vector (mock conditions) (Fig. 7B
). When Glut 4 myc
was expressed alone, insulin stimulated by about 4-fold the amount of
Glut 4 myc at the cell surface, compared with the basal state.
Regardless of the nature of p55PIK protein expressed in
adipocytes, basal Glut 4 myc translocation was unchanged. A slight but
significant decrease (15%, P < 0.01) was seen when
wild type p55PIK was coexpressed with Glut 4 myc, compared
with translocation in insulin-stimulated mock adipocytes. This decrease
reached 45% with
203217 p55PIK, indicating that
p55PIK deletion mutant was able to inhibit translocation of
Glut 4 myc to the cell surface in response to insulin. Thus, our
p55PIK mutant seems to behave in a dominant-negative
fashion, since it inhibits the stimulating effect of insulin on
PI3-kinase activity and subsequent Glut 4 translocation in intact
cells.
Increased Coimmunoprecipitation of IRS-1 and IGF-IR with
203217 p55PIK Compared with
p55PIK
Since we obtained a p55PIK mutant having features
corresponding to a dominant-negative form for PI 3-kinase, we examined
its association with IGF-IR-signaling proteins. First, we checked that
PI 3-kinase activity associated with
203217 p55PIK
expressed in 293 cells was decreased compared with that seen with wild
type p55PIK (not shown). For the association experiments,
293 cells were transfected with pcDNA3-p55PIK or
pcDNA3-
203217 p55PIK and stimulated or not with IGF-I.
Cell lysates were subjected to immunoprecipitation with antibodies to
p55PIK, and Western blotting using several antibodies was
performed (Fig. 8
). In IGF-I-stimulated
cells showing the same levels of expressed proteins (panel D),
203217 p55PIK associated with more
tyrosine-phosphorylated IGF-IR proteins (panels C, 150250%
increase), compared with wild-type p55PIK. Moreover,
increased binding of p55PIK to IGF-IR was also seen in
unstimulated cells. We found similar results concerning association of
IRS-1 to
203217 p55PIK (not shown). Interestingly,
immunoblot with antibodies to IGF-IR ß-subunit (panel C) revealed
that the levels of tyrosine (panel A) and serine phosphorylation (panel
B) of IGF-IR in basal and IGF-I-stimulated conditions reflected the
amount of associated-IGF-IR to p55PIK proteins and was
independent of associated-PI 3-kinase activity. Identical results were
found concerning the phosphorylation state of IRS-1
coimmunoprecipitated with wild type or mutant p55PIK (not
shown). Thus, we showed that
203217 p55PIK was more
efficient than the wild type protein in associating IRS-1 and IGF-IR.
These results strengthen those found with the PI 3-kinase inhibitor,
wortmannin (see Fig. 6
). Our data would indicate that, when PI 3-kinase
is activated by association of p55PIK to
tyrosine-phosphorylated proteins, it exerts in return a negative
control on these associations, probably through its lipid kinase
activity.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 8. Association of 203217 p55PIK with
IGF-IR-Signaling Proteins in Mammalian Cells
293 EBNA cells expressing wild type p55PIK or 203217
p55PIK were stimulated or not with 10-7
M IGF-I for 5 min. Cell lysates were subjected to
immunoprecipitation with antibodies to p55PIK; the proteins
were separated by SDS-PAGE and transferred to membranes that were
blotted with antibodies to phosphotyrosine (A), phosphoserine (B),
IGF-IR ß-subunit (C), and p55PIK (D). The autoradiograms
are representative of three independent experiments.
|
|
 |
DISCUSSION
|
|---|
In this report, we investigated the interaction between the newly
identified regulatory subunit of PI 3-kinase, p55PIK (14),
and several proteins involved in signal transduction.
p55PIK is highly homologous to the C terminus part of p85,
especially at the level of the IS region flanked by two SH2 domains.
The most striking difference is seen in the N terminus of the protein.
Indeed, the SH3 domain, the first proline-rich motif, and the Bcr
region found in p85 are replaced in p55PIK by a unique
34-amino acid sequence. Using the yeast two-hybrid system, we have
demonstrated here a direct interaction of p55PIK with
p110
, and we have identified in both proteins the implicated
domains. We found that, like for p85
, the IS domain of
p55PIK binds to the N terminus of p110
(29, 30).
Moreover, deletion of the 200 carboxy-terminal amino acids of p110
decreases binding, suggesting that they could participate in this
interaction. It is also possible that deletion of this region induces
conformational changes in the global structure of the protein, such
that the N terminus of p110
is less able to recognize the IS domain
of p55PIK. Experiments based on further deletions in the IS
domain led us to conclude that p55PIK amino acids 203217,
corresponding to amino acids 478492 of p85
, are essential for
p110
binding. Similarly, it was shown by Waterfield and associates
(29) that this sequence participates in formation of a p110
binding
site on p85
. Further, this sequence is included in the typical
structure of IS domain forming an antiparallel coiled coil of two
70-residue long
-helices. Disruption in the 478492 sequence
profoundly alters the structure of the binding site, so that
interaction of p85
with p110
is completely abolished. The peptide
corresponding to amino acids 478492 in p85
shows 100% identity
with the one found in p55PIK, reflecting very likely the
biological importance of this region. This means that interaction of
p110 with different regulatory subunits, such as p85 and
p55PIK, involves recognition of highly conserved regions on
the two proteins.
Next we showed that both SH2 domains of p55PIK bind to the
carboxy-terminal tyrosine 1316 of the activated IGF-IR. However, with
IGF-IR mutated on tyrosine 1316 we observed a weak, but detectable,
interaction with p55PIK. We reported the same
observation in a previous work concerning interaction between p85
and insulin receptors, and IGF-IRs (20). Taken together, these results
suggest that both PI 3-kinase-regulatory subunits are able to recognize
determinants other than the receptor carboxy-terminal
autophosphorylation site. The identity of this (these) additional
site(s) is presently unknown. Despite the similarities between
p55PIK and p85
in their interaction with IGF-IR, we
revealed a difference that could contribute to generation of
specificity in IGF-I signaling. Indeed, in previous studies on p85
,
we and others showed that only the carboxy-terminal SH2 domain of
p85
was able to bind to IGF-IR, while both p85
SH2 domains bound
to the insulin receptor (20, 21). In contrast to p85
, both the
NH2- and COOH-terminal SH2 domains could link
p55PIK to the IGF-IR. Moreover, it has been shown that
binding of p85 to insulin or IGF-IRs could lead to PI 3-kinase
activation in vitro (18, 31). Studies from Cantley and
associates (32) and Gibbs and co-workers (33) have shown that doubly
phosphorylated peptides (corresponding to platelet-derived growth
factor receptor or IRS-1 sequences containing pYXXM motifs) bind with
high affinity to the two SH2 domains of p85 and are more efficient in
stimulating PI 3-kinase activity, compared with singly phosphorylated
peptides that have low binding affinity. Thus, the monovalent (one SH2
domain in case of p85
) vs. bivalent (two SH2 domains in
case of p55PIK) binding to SH2 domains would result in PI
3-kinase stimulation having variable intensity and/or duration. Hence
this is likely to modulate biological responses induced by PI 3-kinase.
Our data could also indicate that, compared with p85
,
p55PIK could be the preferential regulatory subunit for PI
3-kinase activation through the IGF-IR itself. If this were the case,
it is tempting to think that, for activation of PI-3 kinase, the IGF-IR
is using a direct pathway rather than relying on IRS-1, which appears
to be the preferred partner used by the insulin receptor to activate PI
3-kinase. One intriguing implication of such a view is that targeting
of PI 3-kinase by IRS-1 to certain intracellular compartments would
occur more easily with the insulin receptor than with the IGF-IR. This
might explain, at least in part, the specific effect of insulin on
translocation of glucose transporters, which is thought to involve
targeting of PI 3-kinase to the Glut4-containing low density microsomes
compartment (34).
Our observation in the yeast two-hybrid system, showing a direct
interaction between p55PIK and IGF-IR, was strengthened
by the demonstration of a direct association between p55PIK
synthesized by in vitro transcription/translation, and
WGA-purified autophosphorylated IGF-IR. In addition, we found that
p55PIK coimmunoprecipitated with IGF-IR in lysates from
IGF-I-stimulated 293 cells. Since IRS-1 was present in the same
immunoprecipitates, p55PIK could form either a ternary
complex with IRS-1 and IGF-IR and/or two types of binary complexes
including p55PIK/IRS-1 and p55PIK/IGF-IR. We
would expect that part of p55PIK interacts directly with
IGF-IR in intact cells, in view of our results using in
vitro binding experiments and yeast two-hybrid system. Moreover,
we showed that p55PIK expressed in 293 cells is tyrosine
phosphorylated in response to IGF-I by endogenous IGF-IRs, suggesting
that this phosphorylation could occur in a physiological set-up. White
and associates (14) showed that, in
CHOIR/p55PIK cells, insulin induced
phosphorylation of p55PIK on tyrosine 341, located in a
YFIN motif. Given the close or identical specificity of the insulin and
IGF-IR tyrosine kinase, we anticipate that the same site is
phosphorylated upon IGF-I stimulation.
We further investigated coimmunoprecipitation of p55PIK
with tyrosine-phosphorylated proteins in 293 cells and showed that PI
3-kinase negatively regulated these associations. Indeed, the inhibitor
of PI 3-kinase, wortmannin, induced increased association of both IRS-1
and IGF-IR with p55PIK. This increase was seen in basal and
IGF-I-stimulated conditions and could be explained by at least the
following two hypotheses: 1) a decreased lipid kinase activity, 2)
and/or a decreased serine kinase activity of PI 3-kinase. To further
address this phenomenon, we used
203217 p55PIK mutant.
Indeed, p55PIK deleted in these 15 amino acids in the IS
domain is unable to bind to p110
, but still associates with IGF-IR
in a yeast two-hybrid system. First, we showed that
203217
p55PIK acts as a dominant-negative mutant of PI 3-kinase,
since its overexpression in adipocytes inhibited a biological function
requiring PI 3-kinase activity, i.e. insulin-stimulated
translocation of Glut 4 glucose transporters. This inhibitory action of
203217 p55PIK could be explained by the fact that this
mutant could compete with endogenous p85 for binding to
phosphoproteins, such as IRS-1. Since
203217 p55PIK
does not bind to the p110
catalytic subunit, this would result in
less PI 3-kinase associated with and activated by IRS-1 and,
consequently, in less insulin-stimulated glucose transport. Such a
phenomenon was previously described by Quon et al., who used
a p85
mutant deleted in IS amino acids 479513. This region
comprises a sequence of amino acids 478492, which is necessary for
p110
binding (35). We also observed a slight decrease in Glut 4 myc
translocation in response to insulin, when adipocytes expressed wild
type p55PIK, compared with mock conditions. This could be
due to the presence of an excess of regulatory subunits of PI 3-kinase
in these cells, compared with the amount of endogenous p110 catalytic
subunit. Therefore, IRS-1-binding sites would be occupied not only by
functional PI 3-kinase, comprising both subunits, but also by p85 or
p55PIK alone. This will lead to decreased PI 3-kinase
associated with and activated by IRS-1, and hence to decreased Glut 4
myc translocation.
We used
203217 p55PIK for coimmunoprecipitation
experiments in 293 cells and found that, compared with wild type
p55PIK, both associations with IRS-1 and IGF-IR were
increased. These findings substantiate those seen with wortmannin and
clearly demonstrate that inhibition of PI 3-kinase associated with
p55PIK leads to stronger interaction between
p55PIK and tyrosine-phosphorylated proteins.
Since PI 3-kinase has been shown to be able to exert serine kinase
activity toward some proteins including IRS-1 (2, 36, 37), and since
serine phosphorylation has been implicated in negative regulation of
interaction between PI 3-kinase and IRS-1 (38, 39), we were interested
to determine whether increased association of IRS-1 and IGF-IR with
p55PIK could be due to a change in serine phosphorylation
of the associated protein. However, using antibodies to phosphoserine,
we found that the phosphoserine content of IGF-IR was unchanged,
suggesting that increased association was probably not due to decreased
serine phosphorylation, and hence that p110 serine kinase activity was
not involved in regulation of this phosphoprotein association. Another
mechanism, which might explain enhanced association of
p55PIK with IRS-1 and with IGF-IR, would be that PI
3-kinase causes recruitment of a tyrosine phosphatase that decreases
tyrosine phosphorylation of IRS-1 and IGF-IR. This would result in
decreased binding of PI 3-kinase to IRS-1 and IGF-IR. However, this
hypothesis can also be discarded, since blotting with antibodies to
phosphotyrosine did not reveal changes in tyrosine phosphorylation of
IRS-1 or IGF-IR. Taking these observations as a whole, we would like to
conclude that changes in interaction between SH2 domain-containing
proteins and their target can be modulated by the phospholipid products
generated by PI 3-kinase. Using a different approach, Rameh and
co-workers reached a similar conclusion in their study in which they
showed that phosphatidylinositol (3, 4, 5)-trisphosphate was able to
compete with tyrosine-phosphorylated proteins for their association
with SH2 domains of p85 PI 3-kinase. An interesting implication of our
observation is that, after its activation by binding to specific
phosphorylated tyrosines, PI 3-kinase could be able to down-regulate
itself by producing phospholipids that would act as inhibitors of PI
3-kinase binding to its activating proteins. This mechanism would
provide a negative feedback loop for PI 3-kinase. Another possible
function of lipid-mediated modulation of PI 3-kinase binding to SH2
domains could consist in the disengagement of the enzyme from its
activating structures and its subsequent relocation.
While the precise impact of p55PIK, and of PI 3-kinase
in general, on IGF-I signaling is not known, the present demonstration
of direct interaction between p55PIK and molecules involved
in IGF-I action provides the basis for such a role. Further, our
present study suggests that the activity of PI 3-kinase is likely to be
the subject of modulations through mechanisms interfering with binding
of its adapter subunits, such as p55PIK or p85
. One
mechanism would involve the lipid kinase activity of PI 3-kinase
itself, which appears to be able to reduce the interaction. Whether
this process is involved only in regulating the interaction between the
adapter subunits of PI 3-kinase and certain molecules, and consequently
the enzymatic activity, or whether they play an additional role in
releasing and therefore targeting PI 3-kinase to cellular compartments,
remains to be investigated.
 |
MATERIALS AND METHODS
|
|---|
Materials
Yeast strain L40 (MATa, trp1, leu2, his3,
LYS2::lexA-HIS3, URA3::lexA-lacZ) and yeast
two-hybrid expression vector pBTM116 were provided by A. Vojtek
(Seattle, WA), and the plasmid pACTII was provided by S. Elledge
(Houston, TX). Human IGF-IR cDNA was a gift from P. De Meyts
(Copenhagen, Denmark). Full-length, BX, R1, and
R1 constructs of
p110
, and the p85
cDNA into the pGBT9 vector were a gift from
J. E. Pessin (Iowa City, IA). Oligonucleotides were purchased from
Eurogentec (Seraing, Belgium), restriction enzymes were from New
England Biolabs (Beverly, MA), Pwo DNA polymerase was from Boehringer
Mannheim (Meylan, France), and synthetic defined dropout yeast media
lacking the appropriate amino acids were from Bio101 (La Jolla, CA).
Cell culture media and Geneticin were from Life Technologies, Inc.
(Paisley, Scotland). All chemical reagents used were from Sigma (St
Louis, MO), except protein A-Sepharose, which was from Pharmacia
Biotech Inc. (Uppsala, Sweden); 2-mercaptoethanol and (luminol)
3-aminophtalhydrazide were purchased from Fluka (Buchs, Switzerland).
IGF-I was a generous gift from Lilly Research Laboratories
(Indianapolis, IN). [35S]Methionine and
[125I]Ig against mouse Igs were from Amersham
(Buckinghamshire, UK). Antibodies to phosphotyrosine and phosphoserine
were from Upstate Biotechnology, Inc. (Lake Placid, NY) and Zymed
Laboratories, Inc. (San Francisco, CA), respectively; rabbit polyclonal
antibody to IGF-IR ß-subunit (C-20), and monoclonal antibody to myc
(9E10) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz,
CA); antiserum to p55PIK was produced by M. F. White
(Boston, MA); antibodies to IRS-1 were made by U145 and were raised to
the C-terminal (12231235) peptide of rat IRS-1.
Plasmid Constructions
Complementary DNA corresponding to the intracellular part of the
IGF-IR ß-subunit (amino acids 993-1337) was inserted into the pBTM116
yeast expression vector as previously described (23). The fusion
protein, which corresponded to the complete LexA bacterial
repressor (containing a DNA-binding domain) fused to the IGF-IR
ß-subunit was named LexA-IGF-IRß. All mutants derived from this
fusion protein were obtained by site-directed mutagenesis of
double-stranded DNA using the Transformer kit (CLONTECH, Palo Alto,
CA). The mutations were verified by DNA sequence analysis.
Complementary DNAs of full-length p55PIK and its subdomains
were amplified by PCR using pairs of primers described in Table 1
. They
were then subcloned in frame into the polylinker of pACTII, using the
NcoI (5' side) and EcoRI (3' side) restriction
sites. The fusion proteins obtained corresponded to the GAL4 activation
domain (1147) fused to different p55PIK regions and were
tagged with the hemagglutinin peptide. The junction of each fusion cDNA
was checked by sequencing with a primer corresponding to a sequence of
pACTII (5'- taccactacaatggatg-3'). Sequence analyses were performed
using the T7 sequencing kit (Pharmacia Biotech, Uppsala, Sweden).
GAD-P55PIK deleted from amino acids 203 to 217
(GAD-
203217 p55PIK) was obtained by using the
site-directed mutagenesis kit purchased from CLONTECH, and the deletion
was checked by sequence analysis. The complete p55PIK and
deletion mutant
203217 p55PIK cDNAs were also
subcloned into the pcDNA3 eukaryotic expression vector by amplifying
the cDNA using the following pair of primers: sense,
(5'-ccggaattcgaccgcgatgacgcagactg-3')/anti-sense (5'-
ctagtctagattatctgcagagcgtaggc-3'). The obtained PCR product was cut
with EcoRI and XbaI and ligated into pcDNA3
polylinker. The insertion of p55PIK cDNA was checked by
sequencing with a primer corresponding to a sequence of pcDNA3
(5'-gcgtgtacggtgggaggtc-3'). Amplification by PCR using the following
primers (5' to 3'): 1) ccccccggggatgcctccaagaccatcatcagg; 2)
ccggaattcgatatggttaaagatccag; 3) cgcggatcctcagttcaaagcatgctgc yielded
full-length p110
cDNA and p110
R1 cDNA with primer sets 1 and 3
and 2 and 3, respectively. Both cDNAs were subcloned in-frame into the
pBTM116 vector. The obtained plasmids encoded for the fusion
proteins LexA-p110
and LexA-p110
R1 (p110
lacking
amino-terminal amino acids 1127), respectively. The LexA-p110BX (LexA
fused to amino acids 1576 of p110
) and LexA-p110R1 (LexA fused to
amino acids 1127 of p110
) constructs were obtained by digestion of
pGBT9-p110BX with BamHI-PstI and pGBT9-p110R1
with EcoRI, respectively, and then in-frame religation into
the polylinker of pBTM116. The LexA-p110BP construct, corresponding to
amino acids 1870, was obtained by digestion of pBTM116-p110
by
PstI to remove C-terminal 870-1068 amino acids of p110
,
and religation of the vector. LexA-p85
was obtained by PCR
amplification of p85
cDNA using the following set of primers: sense
(5'-gccgaggggtacgaattccgggcgctg-3')/antisense
(5'-atcgcctcggatccgcgtacactgggtagg-3'), and then subcloning of the PCR
product in-frame into the pBTM116 cloning site, using the
EcoRI and BamHI restriction sites. The junction
of fusion between LexA, p110
constructs, and p85
cDNAs was
checked by sequencing with a primer corresponding to a sequence of LexA
(5'-cttcgtcagcagagcttc-3').
Yeast Transformation and Reporter Gene Activity
The yeast strain L40 was cotransformed with pBTM116 and pACTII
plasmids expressing hybrid proteins of interest, using the lithium
acetate method (40). L40 were grown for 48 h on plates containing
Trp-, Leu- synthetic complete (SC) medium to
select the clones containing both plasmids (pBTM116 and pACTII carry
the Trp+ and Leu+ selection markers,
respectively). The histidine reporter gene was tested by replicating
the clones expressing the different sets of plasmids on plates
containing SC medium without tryptophan, leucine, and histidine and
growing them at 30 C for 48 h. Double transformants were also
assayed for ß-galactosidase activity, using a color filter assay as
previously described (41) or a liquid culture assay. Briefly, three
clones of each transformation were grown for 24 h in
Trp-, Leu- SC medium, then diluted 10 times
in 2 ml of the same SC medium. After 24 h of additive growth, 1 ml
of cells was used for determination of absorbance at 600 nm; 100500
µl of cells were used for colorimetric assay at 574 nm. Cells were
pelleted, resuspended in 500 µl Z buffer/25 µl chloroform, and
vortexed for 15 sec. After 10 min incubation at 30 C, 100 µl of the
chromogenic substrate, chlorophenol
red-ß-D-galactopyranoside, at 50 mM was
added. The reaction was performed at 30 C, and ß-galactosidase
activity was measured according to Millers method (42). One unit of
ß-galactosidase activity was defined as follows: (A574 x
1,000)/[A600 x volume (ml) x time (min)].
In Vitro Association Experiment
p55PIK cDNA in pBluescript II SK under the T3
procaryotic phage RNA polymerase promoter was used to synthesize
purified and 35S-labeled p55PIK protein by
performing the coupled transcription/translation reticulocyte lysate
system from Promega (Madison, WI). This protein was incubated with
p55PIK antibody prebound to protein-A Sepharose beads or
with WGA-purified IGF-IRs preadsorbed on WGA-coupled agarose beads.
IGF-IRs were priorly phosphorylated for 20 min at 25 C, with 50
µM ATP, 4 mM MnCl2, and 8
mM MgCl2. After 3 h, protein A- or
WGA-coupled agarose beads were washed four times with 30 mM
HEPES, 30 mM NaCl, pH 7.4, containing 1% (vol/vol) Triton
X-100. Finally, the pellets were resuspended in Laemmli buffer and
subjected to SDS-PAGE under reducing conditions.
Cell Surface Epitope-Tagged Glut 4 Measurement in Isolated Rat
Adipocytes
Adipocytes from epididymal fat pads of male Wistar rats were
isolated by collagenase (Boehringer Mannheim) digestion (43). They were
transfected by electroporation, using 2 µg pCIS-Glut 4 myc and 6 µg
of pcDNA3-p55PIK or pcDNA3-
203217 p55PIK,
as previously described (9). Then, the cells were stimulated or not
with 10-7 M insulin for 30 min at 37 C, and
cell surface binding of antibodies to myc, which reflects the amount of
Glut 4 myc translocated to the plasma membrane, was measured as
described by Tanti et al. (9). Results were normalized by
measuring protein concentration in each sample, using BCA (Pierce,
Rockford, IL). Statistical analysis of the results was performed using
an unpaired Students t test.
Association Experiment in 293 Cells
Murine p55PIK and
203217 p55PIK
cDNAs, subcloned into pcDNA3 as described above, were used for
transient expression in 293 EBNA cells, using the calcium phosphate
precipitation method (44). This cell line, as well as culture
conditions, were previously described (39). Dishes (56 cm2)
of 293 EBNA cells transfected with 8 µg pcDNA3-p55PIK or
pcDNA3-
203217 p55PIK were incubated with 100
nM wortmannin for 15 min, before a 5-min stimulation with
10-7 M IGF-I. The cells were then washed once
with buffer A (50 mM HEPES, 150 mM NaCl, 10
mM EDTA, 10 mM
Na4P2O7, 2 mM sodium
orthovanadate, 100 mM NaF, pH 7.5) and lysed on ice for 20
min using buffer A supplemented with 1% (vol/vol) Nonidet-P40 and
protease inhibitors: 100 U/ml aprotinin, 1 mM
PhMeSO2F, 20 µM leupeptin, 2 µM
pepstatin, and 4 mM benzamidine. Immunoprecipitation with
antibody to p55PIK was performed for 3 h at 4 C.
Samples were then washed three times with buffer A, resuspended in
Laemmli buffer, loaded on a 7.5% polyacrylamide gel, and subjected to
SDS-PAGE under reducing conditions. Proteins were transferred to an
Immobilon membrane (polyvinylidene difluoride; Millipore Corp.,
Milford, MA). The membrane was blocked with TBS (10 mM
Tris-HCl, 140 mM NaCl, pH 7.4) containing 5% (wt/vol) BSA,
probed with antibodies to phosphotyrosine or to IGF-IR, and incubated
with [125I]protein A. Membranes were also stripped for 30
min at 50 C with stripping buffer (62.5 mM Tris-HCl, pH
6.7, 100 mM 2-mercaptoethanol, and 2% (vol/vol) SDS), and
reprobed with different antibodies followed by addition of
125I-protein A. After incubation with antibody to
phosphoserine, the membrane was incubated with a second antibody
conjugated with horseradish peroxidase and proteins were revealed using
the chemiluminescence detection system. After autoradiography,
quantification was performed by scanning the autoradiograms followed by
densitometric analysis of the obtained scans.
 |
ACKNOWLEDGMENTS
|
|---|
We thank A. Vojtek and S. Elledge for the L40 strain and yeast
plasmids, J. E. Pessin for p110
and p85
cDNAs, P. De Meyts
for the human IGF-IR cDNA. We thank Mireille Cormont and Nadine Gautier
for scientific advice and help in Glut 4 myc translocation experiments,
Véronique Baron for critical reading of the manuscript, and
Aurore Grima for illustration work.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Isabelle Mothe, INSERM U145, Faculté de Médecine, Avenue de Vallombrose, 06107 Nice Cédex 2, France.
This work was supported by INSERM, Association pour la Recherche contre
la Cancer (ARC) Grant 6432, and grants from Université de
Nice-Sophia Antipolis, Groupe Lipha (Lyon France) Contract 93123, and
Sankyo Co, Ltd. Morris F. White was supported by NIH Grants DK-43808
and DK-38712. Isabelle Mothe was supported by a fellowship from
ARC.
Received for publication January 15, 1997.
Revision received September 2, 1997.
Accepted for publication September 5, 1997.
 |
REFERENCES
|
|---|
-
Whitman M, Downes CP, Keeler M, Keller T, Cantley L 1988 Type I phosphatidylinositol kinase makes a novel inositol phospholipid,
phosphatidylinositol-3-phosphate. Nature 322:644646
-
Dhand R, Hiles I, Panayotou G, Roche S, Fry MG, Gout I, Totty
NF, Truong O, Vicendo P, Yonezawa K, Kasuga M, Courtneidge SA,
Waterfield MD 1994 PI 3-kinase is a dual specificity enzyme:
autoregulation by an intrinsic protein serine kinase activity. EMBO J 13:522533[Medline]
-
Rameh LE, Chen C-S, Cantley LC 1995 Phosphatidylinositol (3,
4, 5)P3 interacts with SH2 domains and modulates PI
3-kinase association with tyrosine-phosphorylated proteins. Cell 83:821830[CrossRef][Medline]
-
Yao R, Cooper GM 1995 Requirement for phosphatidylinositol-3
kinase in the prevention of apoptosis by nerve growth factor. Science 267:20032006[Abstract/Free Full Text]
-
Kotani K, Yonezawa K, Hara K, Ueda H, Kitamura Y, Sakaue H,
Ando A, Chavanieu A, Calas B, Grigorescu F, Nishiyama M, Waterfield MD,
Kasuga M 1994 Involvement of phosphoinositide 3-kinase in insulin- or
IGF-1-induced membrane ruffling. EMBO J 13:23132321[Medline]
-
Chung J, Grammer TC, Lemon KP, Kazlauskas JB, Blenis J 1994 PDGF-and insulin-dependent pp70S6k activation by
phosphatidylinositol-3-OH kinase. Nature 370:7175[CrossRef][Medline]
-
Martin SS, Haruta T, Morris AJ, Klippel A, Williams LT,
Olefsky JM 1996 Activated phosphatidylinositol 3-kinase is sufficient
to mediate actin rearrangement and GLUT4 translocation in 3T3L1
adipocytes. J Biol Chem 271:1760517608[Abstract/Free Full Text]
-
Katagiri H, Asano T, Ishihara H, Inukai K, Shibasaki Y,
Kikuchi M, Yazaki Y, Oka Y 1996 Overexpression of catalytic subunit
p110
of phosphatidylinositol 3-kinase increases glucose transport
activity with translocation of glucose transporters in 3T3L1
adipocytes. J Biol Chem 271:1698716990[Abstract/Free Full Text]
-
Tanti JF, Grémeaux T, Grillo S, Calleja V, Klippel A,
Williams LT, Van Obberghen E, Le Marchand-Brustel Y 1996 Overexpression of a constitutively active form of phosphatidylinositol
3-kinase is sufficient to promote Glut4 translocation in adipocytes.
J Biol Chem 271:2522725232[Abstract/Free Full Text]
-
Panayotou G, Bax B, Gout I, Federwish M, Wroblowski B, Dhand
R, Fry MJ, Blundell TL, Wollmer A, Waterfield MD 1992 Interaction of
the p85 subunit of PI-3 kinase ans its N-terminal SH2 domain with a
PDGF receptor phosphorylation site: structural features and analysis of
conformational changes. EMBO J 11:42614272[Medline]
-
Shoelson SE, Sivaraja M, Williams KP, Hu P, Schlessinger
J, Weiss MA 1993 Specific phosphopeptide binding regulates a
conformational change in the PI 3-kinase SH2 domain associated with
enzyme activation. EMBO J 12:795802[Medline]
-
Inukai K, Anai M, Van Breda E, Hosaka T, Katagiri H, Funaki M,
Fikushima Y, Ogihara T, Yazaki Y, Kikuchi M, Oka Y, Asano T 1996 A
novel 55-kDa regulatory subunit for phosphatidylinositol 3-kinase
structurally similar to p55PIK is generated by alternative
splicing of the p85
gene. J Biol Chem 271:53175320[Abstract/Free Full Text]
-
Antonetti DA, Algenstaedt P, Kahn CR 1996 Insulin receptor
substrate 1 binds two novel splice variants of the regulatory subunit
of phosphatidylinositol 3-kinase in muscle and brain. Mol Cell Biol 16:21952203[Abstract]
-
Pons S, Asano T, Glasheen E, Miralpeix M, Zhang Y, Fisher TL,
Myers MGJ, Sun XJ, White MF 1995 The structure and function of
p55PIK reveal a new regulatory subunit for
phosphatidylinositol 3-kinase. Mol Cell Biol 15:44534465[Abstract]
-
LeRoith D, Werner H, Beitner-Johnson D, Roberts CTJ 1995 Molecular and cellular aspects of the insulin-like growth factor I
receptor. Endocr Rev 16:143163[Abstract/Free Full Text]
-
Giorgetti S, Ballotti R, Kowalski-Chauvel A, Tartare S, Van
Obberghen E 1993 The insulin and insulin-like growth factor-1 receptor
substrate IRS-1 associates with and activates phosphatidylinositol
3-kinase in vitro. J Biol Chem 268:73587364[Abstract/Free Full Text]
-
Altschuler D, Yamamoto K, Lapetina EG 1994 Insulin-like growth
factor-I mediated association of p85 phosphatidylinositol 3-kinase with
pp185: requirement of SH2 domains for in vivo interaction.
Mol Endocrinol 8:11391146[Abstract/Free Full Text]
-
Yamamoto K, Altschuler D, Wood E, Horlick K, Jacobs S,
Lapetina EG 1992 Association of phosphorylated insulin-like growth
factor-I receptor with the SH2 domains of phosphatidylinositol
3-kinase p85. J Biol Chem 16:1133711343
-
Seely BL, Reichart DR, Staubs PS, Jhun BH, Hsu D, Maegawa
H, Milarski KL, Saltiel AR, Olefsky JM 1995 Localization of the
insulin-like growth factor I receptor binding sites for the SH2 domain
proteins p85, Syp, and GTPase activating protein. J Biol Chem 270:1915119157[Abstract/Free Full Text]
-
Tartare-Deckert S, Murdaca J, Sawka-Verhelle D, Holt KH,
Pessin JE, Van Obberghen E 1996 Interaction of the molecular weight 85K
regulatory subunit of the phosphatidylinositol 3-kinase with the
insulin receptor and the insulin-like growth factor-1 (IGF-1) receptor:
comparative study using the yeast two-hybrid system. Endocrinology 137:10191024[Abstract]
-
Lamothe B, Bucchini D, Jami J, Joshi RL 1995 Interaction of
p85 subunit of PI 3-kinase with insulin and IGF-1 receptors analysed by
using the two-hybrid system. FEBS Lett 373:5155[CrossRef][Medline]
-
Torres-Aleman I, Pons S, Arevalo MA 1994 The insulin-like
growth factor-1 system in the rat cerebellum: developmental regulation
and role in neuronal survival and differentiation. J Neurosci Res 39:117126[CrossRef][Medline]
-
Tartare-Deckert S, Sawka-Verhelle D, Murdaca J, Van Obberghen
E 1995 Evidence for a differential interaction of Shc and the insulin
receptor substrate 1 (IRS-1) with the insulin-like growth factor-I
(IGF-I) receptor in the yeast two-hybrid system. J Biol Chem 270:2345623460[Abstract/Free Full Text]
-
Sawka-Verhelle D, Tartare-Deckert S, White MF, Van Obberghen E 1996 Insulin receptor substrate-2 binds to the insulin receptor through
its phosphotyrosine-binding domain and through a newly identified
domain comprising amino acids 591786. J Biol Chem 271:59805983[Abstract/Free Full Text]
-
Rocchi S, Tartare-Deckert S, Sawka-Verhelle D, Gamha A, Van
Obberghen E 1996 Interaction of SH2-containing protein tyrosine
phosphatase 2 with the insulin receptor and the insulin-like growth
factor-I receptor: studies of the domains involved using the yeast
two-hybrid system. Endocrinology 137:49444952[Abstract]
-
Wilden PA, Kahn CR, Siddle K, White MF 1992 Insulin receptor
kinase domain autophosphorylation regu-lates receptor enzymatic
function. J Biol Chem 267:1666016668[Abstract/Free Full Text]
-
Gronborg M, Wulf BS, Rasmussen JS, Kjeldsen T, Gammeltoft
S 1993 Structure-function relationship of the insulin-like growth
factor-I receptor tyrosine kinase. J Biol Chem 268:2343523440[Abstract/Free Full Text]
-
Kato H, Faria TN, Stannard B, Roberts CT, LeRoith D 1994 Essential role of tyrosine residues 1131, 1135, and 1136 of the
insulin-like growth factor-I (IGF-1) receptor in IGF-1 action. Mol
Endocrinol 8:4050[Abstract/Free Full Text]
-
Dhand R, Hara K, Hiles I, Bax B, Gout I, Panayotou G, Fry MJ,
Yonozawa K, Kasuga M, Waterfield MD 1994 PI 3-kinase: structural and
functional analysis of intersubunit interactions. EMBO J 13:511521[Medline]
-
Holt KH, Olson AN, Scott Moye-Rowley W, Pessin JE 1994 Phosphatidylinositol 3-kinase activation is mediated by high-affinity
interactions between distinct domains within the p110 and p85 subunits.
Mol Cell Biol 14:4249[Abstract/Free Full Text]
-
Yonezawa K, Yokono K, Shii K, Ogawa W, Ando A, Hara K, Baba S,
Kaburagi Y, Yamamoto-Honda R, Momomura K, Kadowaki T, Kasuga M 1992 In vitro association of phosphatidylinositol 3-kinase
activity with the activated insulin receptor tyrosine kinase. J
Biol Chem 267:440446[Abstract/Free Full Text]
-
Carpenter CL, Auger KR, Chanudhuri M, Yoakim M, Schaffhausen
B, Shoelson S, Cantley LC 1993 Phosphoinositide 3-kinase is activated
by phosphopeptides that bind to the SH2 domains of the 85-kDa subunit.
J Biol Chem 268:94789483[Abstract/Free Full Text]
-
Herbst JJ, Andrews G, Contillo L, Lamphere L, Gardner J,
Lienhard GE, Gibbs EM 1994 Potent activation of phosphatidylinositol
3'-kinase by single phosphotyrosine peptides derived from insulin
receptor substrate 1 containing two YMXM motifs for binding SH2
domains. Biochemistry 33:93769381[CrossRef][Medline]
-
Heller-Harrison RA, Morin M, Guilherme A, Czech MP 1996 Insulin-mediated targeting of phosphatidylinositol 3-kinase to
GLUT4-containing vesicles. J Biol Chem 271:1020010204[Abstract/Free Full Text]
-
Quon MJ, Chen H, Ing BL, Liu M-L, Zarnowski MJ, Yonezawa
K, Kasuga M, Cushman SW, Taylor SI 1995 Roles of 1-phosphatidylinositol
3-kinase and ras in regulating translocation of GLUT4 in transfected
rat adipose cells. Mol Cell Biol 15:54035411[Abstract]
-
Lam K, Carpenter CL, Ruderman NB, Friel JC, Kelly KL 1994 The
phosphatidylinositol 3-kinase serine kinase phosphorylates IRS-1.
J Biol Chem 269:2064820652[Abstract/Free Full Text]
-
Tanti J-F, Gremeaux T, Van Obberghen E, Le Marchand-Brustel Y 1994 Insulin receptor substrate 1 is phosphorylated by the serine
kinase activity of phosphatidylinositol 3-kinase. Biochem J 304:1721
-
Tanti J-F, Grémeaux T, Van Obberghen E, Le
Marchand-Brustel Y 1994 Serine/threonine phosphorylation of insulin
receptor substrate 1 modulates insulin receptor signaling. J Biol
Chem 269:60516057[Abstract/Free Full Text]
-
Mothe I, Van Obberghen E 1996 Phosphorylation of insulin
receptor substrate-1 on multiple serine residues, 612, 632, 662, and
731, modulates insulin action. J Biol Chem 271:1122211227[Abstract/Free Full Text]
-
Gietz D, St. Jean A, Woods RA, Schiestl RH 1992 Improved
method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res 20:14251426[Free Full Text]
-
Bartel PL, Chien C, Sternglanz R, Fields S 1993 Using the two
hybrid system to detect protein-protein interactions. In: Hartley DA
(ed) Cellular Interactions in Development: A Practical Approach. Oxford
University Press, Oxford, UK, pp 153179
-
Miller JH 1972 Experiments in Molecular Genetics. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY, pp 633640
-
Cormont M, Tanti J-F, Zahraoui A, Van Obberghen E, Tavitian A,
Le Marchand-Brustel Y 1993 Insulin and okadaic acid induce Rab4
redistribution in adipocytes. J Biol Chem 268:1949119497[Abstract/Free Full Text]
-
Chen C, Okayama H 1987 High-efficiency transformation of
mammalian cells by plasmid DNA. Mol Cell Biol 7:27452752[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
J. C. Mallory, G. Crudden, A. Oliva, C. Saunders, A. Stromberg, and R. J. Craven
A Novel Group of Genes Regulates Susceptibility to Antineoplastic Drugs in Highly Tumorigenic Breast Cancer Cells
Mol. Pharmacol.,
December 1, 2005;
68(6):
1747 - 1756.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ono, H. Katagiri, M. Funaki, M. Anai, K. Inukai, Y. Fukushima, H. Sakoda, T. Ogihara, Y. Onishi, M. Fujishiro, et al.
Regulation of Phosphoinositide Metabolism, Akt Phosphorylation, and Glucose Transport by PTEN (Phosphatase and Tensin Homolog Deleted on Chromosome 10) in 3T3-L1 Adipocytes
Mol. Endocrinol.,
August 1, 2001;
15(8):
1411 - 1422.
[Abstract]
[Full Text]
[PDF]
|
 |
|