| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Cell Biology (T.N.A., J.S.R.) Baylor College of
Medicine Houston, Texas 77030
Department of Molecular and
Cell Biology (A.C.M., P.B., G.L.F.) University of California
Berkeley, California 94720
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Sgk expression was first detected in RNA prepared from rat ovary; therefore, neither the cell types in which it was expressed nor the hormones regulating its expression were known. Our preliminary data showed that sgk was expressed in the FSH-responsive ovarian granulosa cells (7). Therefore, we hypothesized that sgk was an attractive candidate for immediate-early transcriptional regulation by FSH, the physiological agonist of granulosa cell proliferation (8) and differentiation (9).
FSH coordinates the development of ovarian follicles from the small antral stage to the fully differentiated preovulatory stage (9). During this progression, FSH increases granulosa cell [3H]thymidine uptake (10) while stimulating the sequential expression of several differentiation stage-specific genes (9). For example, in undifferentiated granulosa cells FSH transiently induces cyclin D2 mRNA, itself encoding a critical regulator of granulosa cell proliferation (11). However, FSH induction of granulosa cell differentiation-specific genes, such as aromatase cytochrome P450 (12), cholesterol side-chain cleavage cytochrome P450 (13), and LH receptor (14), occurs only after 2448 h of FSH exposure. Therefore, FSH can elicit a range of cellular responses that occur in a defined temporal sequence, involving both immediate-early and delayed effects, one of which we hypothesize is the induction of sgk.
FSH exerts its effects on granulosa cells by binding to a ligand-specific G protein-coupled membrane receptor that activates adenylyl cyclase (9, 15). This leads to cAMP production and activation of cAMP-dependent protein kinases [protein kinase A (PKA)] (16). Activated PKA is known to phosphorylate specific transcription factors, thereby modulating their activity and regulating gene expression (16, 17). Indeed, PKA phosphorylates cAMP-regulatory element-binding protein (CREB) (18), enabling it to interact with other factors present in granulosa cells to induce aromatase transcription (19). Although some of the molecular mechanisms by which FSH regulates gene expression during differentiation have been defined, less is known about genes rapidly induced by FSH and the mechanisms employed to mediate this induction, particularly in undifferentiated granulosa cells. For these reasons, and because sgk is an immediate-early gene in other tissues (1, 2), we aimed to identify the pattern of sgk expression throughout FSH-stimulated granulosa cell development and to determine the molecular mechanisms regulating its expression.
For these studies we used a well characterized, primary granulosa cell culture system in which FSH is known to stimulate specific changes in granulosa cells that mimic the proliferation and differentiation occurring in vivo as small antral follicles become preovulatory follicles (9). This system allowed us to directly examine the effects of FSH on the endogenous expression of the sgk gene, as well as on the expression of transgenes derived from the sgk promoter in granulosa cells at both the undifferentiated small antral and differentiated preovulatory stages. Our results show that sgk expression in undifferentiated rat granulosa cells is induced rapidly by activators of the PKA pathway, declines, and then reaches maximal levels as cells differentiate in vitro in response to FSH. We document that a G/C-rich region in the sgk promoter is essential for Sp1 and Sp3 binding. Furthermore, we show for the first time that the binding of Sp1 and/or Sp3 is critical for basal and FSH-inducible transcription of the sgk gene in both undifferentiated and differentiated granulosa cells.
| RESULTS |
|---|
|
|
|---|
|
|
The biphasic induction of sgk mRNA and protein appears to
require the sustained activation of the PKA pathway. First, FSH alone
can induce sgk, whereas T alone does not (data not shown).
Second, FSH, a known activator of the PKA pathway, causes a rapid and
exponential increase in granulosa cell cAMP levels (69 pmol/ml) at
2 h (Fig. 2C
). Although cAMP levels decline by 48 h of FSH/T,
the cAMP concentration (15 pmol/ml) remained approximately 30-fold
higher than that in untreated cells (0.5 pmol/ml). Third, the
forskolin-induced pattern of sgk mRNA expression is
identical to that seen using FSH/T (data not shown). Therefore,
sgk transcription is inducible by activation of the PKA
pathway with an immediate early peak at 2 h and a secondary
maximal peak as granulosa cells differentiate.
Translation-Independent Induction of sgk mRNA
To determine whether the FSH induction of sgk
mRNA in granulosa cells was a transcriptionally mediated response, as
has been previously shown in other cell types (2), granulosa cells were
cultured in the presence of cycloheximide (CHX), an inhibitor of
protein synthesis, or
-amanitin, a transcriptional inhibitor. To
assay the immediate-early response, undifferentiated granulosa cells
were treated with CHX and/or FSH/T for 2 h. The FSH/T induction of
sgk mRNA was not blocked by the presence of CHX, indicating
that de novo protein synthesis is not required for
sgk transcription at 2 h (Fig. 3
). When CHX was added alone to the
cultures, sgk mRNA increased over basal levels,
demonstrating that steady-state levels of sgk mRNA are
susceptible to a CHX-sensitive step (22). Importantly, in the same time
interval,
-amanitin blocked FSH/T induction of sgk mRNA.
Together, these data show that the FSH-responsive increase in
sgk mRNA levels in undifferentiated granulosa cells is
immediate-early and transcriptionally dependent.
|
-amanitin was added to
granulosa cells that had been cultured for 41 h with FSH/T (Fig. 3
-amanitin caused a
loss of sgk mRNA, CHX had no effect. These data suggest that
transcriptional induction resulting in the secondary peak of
sgk mRNA in differentiating granulosa cells is independent
of new protein synthesis.
Seventy Eight Base Pairs of the sgk Promoter Contain
cis-Acting DNA Elements Critical for Inducible
Transcription
To identify regions of the sgk promoter that mediate
the FSH induction of sgk transcription in granulosa cells,
vectors containing -4000, -1500, -360, -78, or -35 bp of the
sgk promoter ligated to the chloramphenicol
acetyltranscriptase (CAT) reporter gene were transfected into granulosa
cells that had been cultured overnight in the absence of serum and
hormone (Fig. 4
). After a 4-h
transfection, the cells were stimulated with forskolin for 6 h or
were left untreated. Forskolin increased CAT activity of the
transfected -4000 sgk-CAT, -1500 sgk-CAT, -360 sgk-CAT, and -78
sgk-CAT vectors by 4-fold, 5-fold, 3-fold, and 7-fold, respectively,
compared with levels in untreated cells. The shortest deletion
construct containing only minimal promoter elements, -35 sgk-CAT, was
not forskolin inducible. Similar results were observed when FSH/T,
rather than forskolin, was added to the transfected cells (data not
shown). The -78 sgk-CAT construct also exhibited forskolin-responsive
transcription when examined in differentiated granulosa cells (cells
treated with 37 h FSH/T followed by transfection and 6 h
forskolin stimulation) (Fig. 8B
). Thus, the region between -78 and
-35 bp of the sgk promoter was sufficient and necessary to
confer transcriptional inducibility to the reporter gene at both the
immediate-early (2 h) and the late (48 h) phases of sgk
transcription.
|
|
|
Identification of Protein/DNA Complexes
To determine whether either AP-2 protein or Sp1 protein family
members bound the -63/-43 region of the sgk promoter, AP-2
and Sp1 consensus sequence oligonucleotides and antibodies were used in
additional EMSAs. While the labeled -63/-43 oligonucleotide formed
complexes I-IV that were competed by 100-fold excess unlabeled
self-competitor DNA, these complexes were not competed by the same
amount of an AP-2 consensus oligonucleotide. Nor did the addition of
anti-AP-2 polyclonal antibody supershift or diminish the formation of
these complexes. Based on these results, we conclude that AP-2 is not a
major factor in granulosa cell extracts binding to this region of the
sgk promoter (data not shown).
In contrast, use of the Sp1 consensus binding sites, antibodies, and
recombinant protein in EMSAs suggest that the consensus Sp1-binding
sites in the G/C box bind Sp1 present in granulosa cell extracts.
Again, complexes I-IV were formed with labeled -63/-43 bp probe and
were competed with unlabeled wild type -63/-43 oligonucleotide (Fig. 6A
, lanes 2 and 3). Sp1 competitor DNA
effectively competed for the binding of complexes I and II (lane 5)
compared with the mutant -63/-43 oligonucleotide (lane 4). Incubation
of the -63/-43 probe with recombinant Sp1 protein resulted in the
formation of a protein/DNA complex with the same mobility as complex I
(Fig. 6A
, lane 6). This Sp1 complex was competed by excess self (lane
7) but not mutant oligonucleotides (lane 8) and was competed by Sp1
competitor DNA (lane 9). This specific Sp1 complex was completely
supershifted upon incubation with a polyclonal Sp1 antibody (lane
10).
|
Similarly, to determine the identity of complex II, which was also
competed by Sp1 consensus oligonucleotides, antibodies against another
Sp1 family member, Sp3 (24), were used for supershift analysis. The Sp3
antibody specifically decreased the formation of complex II (Fig. 5B
, lane 4) while forming a supershifted band that was not observed in the
presence of probe and antibody alone (lane 1). The Sp3 antibody does
not cross-react with Sp1 as incubation of the Sp3 antibody with
recombinant Sp1 protein did not result in a supershift or depletion of
this complex (data not shown). However, incubation of Sp1 antibody and
Sp3 antibody together with granulosa cell extracts resulted in the
decrease of both complexes I and II and formation of supershifted bands
(lane 5). Therefore, in addition to binding Sp1, the consensus
Sp1-binding sites in the sgk G/C box also bind Sp3, detected
in complex II.
Sp1 Sites Mediate FSH-Stimulated Transcription
To determine whether Sp1 sites were able to mediate an
FSH-responsive induction independently of the sgk promoter
context, we transfected a construct containing six Sp1 sites upstream
of a basal promoter and luciferase reporter, pGAGC6 (25), into primary
undifferentiated granulosa cells that had been cultured overnight in
serum and hormone-free conditions. As a control, the same vector
without the Sp1 sites, pGAM (25), was transfected into identical
granulosa cell cultures. The pGAGC6 transgene exhibited much higher
levels of basal transcription (30-fold) than the pGAM construct alone
(Fig. 7
). In addition, the pGAGC6
construct showed a modest, but significant induction (2-fold) in
response to a 6-h treatment with FSH/T. The results indicate
Sp1-binding sites can confer basal and hormone-responsive transcription
in granulosa cells.
|
Regulation of Sp1 and Sp3 Levels and Binding Activity
Because Sp1 and/or Sp3 binding are required for sgk
transactivation, we examined Sp1- and Sp3-binding activity and protein
levels throughout the 48-h FSH treatment period in which granulosa cell
sgk mRNA levels are biphasically induced. Granulosa cell
whole cell extracts were isolated after 0, 2, 12, 24, or 48 h
exposure to FSH/T and were then used in EMSA and Western analysis.
Incubation of these extracts with a radiolabeled -63/-43 wild type
sgk probe revealed no change in the binding of complex I
(Sp1) or complex II (Sp3) during this time (Fig. 9A
). Likewise, repeated Western analyses
of these same extracts with antibodies against Sp1 (Fig. 9B
) and Sp3
(Fig. 9C
), revealed no significant changes in either Sp1 or Sp3 protein
levels. Although Sp1 protein levels in the granulosa cells did not
change, we show that the levels of the previously described Sp1 doublet
(105 kDa and 95 kDa) (26) are high in ovarian extracts and are
comparable to levels in extracts of lung and thymus, two tissues
previously reported to express the highest levels of Sp1 (27) (Fig. 9D
). No Sp1 protein was detectable in extracts from low Sp1-expressing
tissues, muscle, and kidney (27). These data collectively suggest a
role for a coactivating factor or posttranslational modification that
regulates the transactivating potential of Sp1 and/or Sp3 in
FSH-stimulated granulosa cells.
|
| DISCUSSION |
|---|
|
|
|---|
The secondary induction of sgk occurs as granulosa cells differentiate. Maximal levels of sgk mRNA are detected after 48 h of FSH/T in vitro or in preovulatory follicles in vivo. Not only are granulosa cells at this stage very different from those in small antral follicles, but they are also different from one another. For example, granulosa cells adjacent to the antrum of the follicle are still proliferative at this time (29). However, mural granulosa cells adjacent to the follicle basement membrane are the first to cease cell division and to express markers of terminal granulosa cell differentiation such as the LH receptor (30). Interestingly, in situ hybridization at this time reveals a gradient of sgk expression, with the highest levels seen in the most differentiated, nonproliferative mural granulosa cells. Therefore, the highly FSH-responsive transcriptional induction of sgk occurs in two phases, one of which coincides with granulosa cell proliferation and the other with granulosa cell differentiation, suggesting multiple functions of sgk in cell proliferation and differentiation.
Although the immediate-early transient induction of sgk
transcription has been well defined in both proliferating and
differentiating cell types in response to agonists such as serum,
glucocorticoids, or brain injury (1, 2, 3), this is the first report of a
biphasic pattern of gene expression in the ovary and of sgk
in particular. Interestingly, both phases of sgk induction
in granulosa cells by FSH or forskolin appear to depend upon the
activation of the protein kinase A pathway and are sensitive to
-amanitin but not to CHX, implicating transcriptional control in the
regulation of granulosa cell sgk levels.
Unlike the sgk gene, which exhibits both rapid and delayed responses to FSH, genes such as aromatase are induced by FSH only after more extended granulosa cell differentiation (21). This brings up the interesting problem of what differs between the undifferentiated granulosa cell and the differentiated preovulatory granulosa cell that enables them to respond uniquely to the same signal. We have recently shown that CREB, a PKA-activated transcription factor, is phosphorylated in a biphasic manner in response to FSH or forskolin (19). Phospho-CREB is detected at 2 h, decreases are detected at 6 h, and then maximal levels are reached between 24 and 48 h of FSH treatment (19). This pattern mimics the distinctive pattern of FSH-induced sgk transcription. Although the sgk promoter has no detectable CRE, and we have detected no role for CREB in sgk transactivation, these data suggest that the phosphorylation and regulation of other nuclear transcription factors and coactivators by PKA may also be oscillatory and obligatory for maintaining transcription.
To determine the mechanisms employed by FSH to regulate gene expression during granulosa cell differentiation, we investigated the functional promoter regions of the sgk gene at both early and late stages of granulosa cell differentiation. Deletion and mutation analyses of the sgk promoter showed that a region between -63 and -43 bp conferred FSH activation of reporter genes at 6 h and forskolin mediated activation at 48 h. Based on several approaches, our results indicate that Sp1 and Sp3 are transcription factors that contribute to the biphasic regulation of sgk by the PKA pathway in granulosa cells. First, the G/C-rich box within the transcriptionally active -63/-43 region contains overlapping consensus binding sites for Sp1 family members that bind multiple proteins present in granulosa cell extracts. Second, EMSAs showed that Sp1 consensus oligonucleotides competed for the binding of granulosa cell proteins to the -63/-43 oligonucleotide, that recombinant Sp1 bound to this same probe and formed a complex of similar mobility as complex I, and that an Sp1 antibody supershifted the Sp1/DNA complex. Complex II, also specifically competed by the Sp1 family consensus binding sites, was supershifted in the presence of Sp3 antibody. Furthermore, mutation of the Sp1-binding sites within the G/C box abolished the formation of both complexes I and II. Transfection experiments documented that a transgene containing six concatamers of Sp1-binding sites ligated to a heterologous minimal promoter conferred high basal and FSH-stimulated activity in granulosa cells. Most importantly, when the mutant -63 sgk-CAT vector lacking Sp1- and Sp3-binding activity was transfected into granulosa cells, the basal and hormone-induced expression observed with the wild type -63 sgk-CAT transgene was abolished. Although AP-2 sites were present in this region of the promoter, no evidence of binding or functional activity was observed. Based on these observations, we conclude that Sp1 and Sp3 bind to the G/C-rich cis-acting DNA element of the sgk promoter and, independently or coordinately, function as enhancers to enable FSH/PKA-mediated transcription of the sgk gene.
Sp1 has been traditionally characterized as a ubiquitous regulator of basal promoter activity, partly because of its critical role in transcription from TATA-less promoters (31). Sp3 is an Sp1 family member previously demonstrated to antagonize Sp1 activity by competing for Sp1 binding sites (24). Sp3 has also been demonstrated to activate transcription (32). The results described herein and those of others (25, 33, 34, 35, 36, 37) indicate that Sp1 and/or Sp3 can also function as enhancers, enabling hormone-inducible transcription from TATA box-containing promoters. For example, in other cell systems, putative functional Sp1-binding sites have been reported in several genes that exhibit regulated expression similar to the secondary induction of sgk in differentiated granulosa cells. Bovine cholesterol side-chain cleavage cytochrome P450 (33, 34, 35), the LH receptor (36), and the rat progesterone receptor (37) require Sp1 and/or its binding sites for PKA-mediated induction. CIP1, a cyclin-dependent kinase inhibitor that is expressed in rat luteal cells (R. L. Robker and J. S. Richards, unpublished observations) requires Sp1 for a protein kinase C-mediated induction (25). The results presented herein extend these observations and provide the first evidence that Sp1 and/or Sp3 binding to a G/C-rich cis-acting DNA element mediates the biphasic FSH induction of a specific gene, sgk, in granulosa cells.
The known mechanisms by which Sp1 family members can mediate
hormone-regulated expression of genes are complex. Regulation of Sp1
binding by phosphorylation (38), by the Sp1-Inhibitor (Sp1-I) (39, 40, 41, 42),
or by competition for binding sites with the repressor, Sp3 (43), can
also control Sp1 activity. Tissue-specific regulation of Sp1 protein
levels may also be critical. For example, the tissues that express the
highest levels of Sp1, ovary, lung, and thymus (Fig. 9C
) (27), also
express the highest levels of sgk (1). However, the lack of
significant detectable changes in Sp1 and Sp3 protein levels or binding
activity during the course of sgk induction suggests that
the functional activation of these factors depends upon a
posttranslational change in Sp1 or Sp3 or a regulated interaction with
other factors (44). Some of the factors with which Sp1 is known to
interact include SF-1, p53, Stat 1, GATA-1, AP-1, NFKB, and estrogen
receptor (35, 45, 46, 47, 48, 49, 50). The sgk promoter does contain a
functional p53 site at -1380/-1345 bp, as well as a glucocorticoid
response element at -1.0 kb, both of which have been shown to be
functional in other cells (1, 51, 52). However, to our knowledge, p53
and Sp1 interactions have thus far been reported only when the binding
sites are in close proximity (45). Furthermore, although the functional
importance of p53 and GR in transactivation has been clearly
demonstrated in other systems, deletion of these upstream regions did
not decrease or modify the expression of sgk transgenes by
FSH in granulosa cells. Although no consensus sequences for factors
known to interact with Sp1 have been identified in the -63/-43
region, the additional factor or cofactor may bind directly to Sp1 or
Sp3 instead of to the DNA. In fact, because both GR and p53 can impact
transcription in the absence of their own consensus sequence binding
sites (53, 52), these factors could potentially interact with Sp1
and/or Sp3 in trans. Based on the biphasic pattern of CREB
phosphorylation, we propose PKA mediates a biphasic change in Sp1/Sp3
activity directly or indirectly, thereby resulting in the biphasic
induction pattern of sgk transcription.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-amanitin, and
forskolin were obtained from Sigma (St. Louis, MO). Cell culture dishes
(six-well) were obtained from Corning (Corning, NY). The cAMP antibody
was a gift of Dr. Judith Vaitukaitis (NIH, Bethesda, MD).
[14C]Chloramphenicol was obtained from Amersham
(Arlington Heights, IL), and acetyl coenzyme A, coenzyme A, and
poly(deoxyinosinic-deoxycytidylic)acid [poly(dI-dC)] were purchased
from Pharmacia (Piscataway, NJ). Luciferin was from Boehringer Mannheim
Biochemicals (Indianapolis, IN), recombinant human Sp1 protein was
obtained from Promega (Madison, WI), and the Sp1, Sp3, and AP-2
antibodies and AP-2 competitor DNA were obtained from Santa Cruz (Santa
Cruz, CA). Oligonucleotides were synthesized by Genosys (Woodlands,
TX). The pGAGC6 and pGAM luciferase vectors were gifts of Dr. Jeffrey
Kudlow (University of Alabama at Birmingham, Birmingham, AL).
Methods
Primary Granulosa Cell Culture
Holtzman Sprague Dawley immature female rats (Harlan, Indianapolis, IN)
delivered on day 23 of age were injected subcutaneously with 1.5 mg
17ß-estradiol once daily on days 24, 25, and 26 of age. Animals were
treated in accordance with the principles and procedures outlined in
the "Guidelines for Care and Use of Experimental Animals." Ovaries
were isolated from rats on day 27 for the harvest of granulosa cells
exhibiting a small antral phenotype as previously described (54).
Briefly, cells were isolated from the ovaries by needle puncture (22
gauge) into media containing DMEM, F12, 30 mM
NaHCO3, 20 mM HEPES, and 100 IU/ml
penicillin-streptomycin. Granulosa cells were treated with 20 µg/ml
trypsin, 300 µg/ml soybean trypsin inhibitor, and 160 µg/ml
deoxyribonuclease I to remove dead cells. After the cells were washed
twice in DMEM-F12, they were plated on serum-coated, six-well culture
dishes in 3 ml of media. Cells were incubated in 95% air, 5%
CO2 at 37 C. To allow efficient attachment of cells before
initiation of treatments, cells were incubated overnight in hormone and
serum-free medium unless indicated otherwise. The following morning (16
h later), FSH (50 ng/ml), T (10 ng/ml), or forskolin (10
µM) were added for the preparation of RNA, protein, or
cell extracts for EMSAs. Where indicated, CHX (10 µg/ml) or
-amanitin (30 µg/ml) were added either 30 min before hormone
addition or after 41 h of culture with FSH/T to inhibit protein
and RNA synthesis, respectively. Similar granulosa cell cultures were
processed for transient transfections.
In Situ Hybridization
Ovaries isolated from adult cycling rats were fixed in 4%
paraformaldehyde in PBS (80 mM
Na2HPO4, 20 mM
NaH2PO4, 100 mM NaCl) overnight at
4 C before dehydration and paraffin embedding. Sections (6 µm) were
baked at 42 C overnight onto 3-amino propyltriethoxysilane-coated
slides. Slides were prehybridized, hybridized, washed, exposed, and
developed as previously described (55). The 35S-labeled
sense and antisense riboprobes were produced by transcription from the
T3 and T7 promoters, respectively, on the NheI-digested
pBS-sgk vector as previously described (55).
RNA Isolation and Northern Analysis
RNA was isolated as previously described (56) from granulosa cell
cultures using buffer containing 1% Nonidet P-40, followed by
phenol/chloroform extraction, ethanol precipitation, resuspension in
water previously treated with diethyl pyrocarbonate, and quantification
by absorbance at 260 nm. For Northern analysis, RNA samples (20 µg)
were denatured at 55 C for 15 min in 45% formamide-5.4% formaldehyde
and resolved by electrophoresis on formaldehyde-agarose gels at room
temperature. Acridine orange staining allowed assessment of RNA ladder
migration and confirmation of equal sample loading by the UV intensity
of 28 S and 18 S ribosomal RNA bands. After the RNA was transferred to
a nylon membrane, the blot was baked for 1 h at 80 C,
prehybridized, and hybridized with 1 x 106 cpm/ml
sgk cDNA probe (1). Blots were washed according to ICN
specifications and exposed to x-ray film at -70 C. All results were
quantified using a Betascope analyzer. The sgk cDNA probe
was labeled as previously described using a random primers and
[
-32P]dCTP (57).
Protein Preparation and Western Analysis
Granulosa cells cultured in FSH/T or forskolin were harvested at
selected times and homogenized to prepare soluble cell extracts as
previously described (58). Extracts of lung, muscle, thymus, and kidney
tissues were prepared similarly. Protein was measured using a 1:5
dilution of Bradford reagent in microtiter plates for colorimetric
detection at 590 nm (59). Cell extracts were stored at -70 C until
Western analyses were performed. Protein samples (100 µg) were
denatured for 10 min at 100 C in 5x SDS loading dye (60).
One-dimensional SDS-PAGE with 4.5% stacking and 10% separating
acrylamide gels was used to resolve proteins. Proteins were transferred
to 0.45-µm nitrocellulose membranes at 50 V for 4 h in 125
mM Tris-Base, 100 mM glycine, and then blocked
for 1 h in PBS (80 mM Na2HPO4,
20 mM NaH2PO4, 100 mM
NaCl, pH 7.5), containing 5% milk, 0.1% Tween-20. After one 20-min
incubation in wash solution (1% milk in PBS and 0.1% Tween-20),
filters were incubated 1 h with appropriate dilutions of Sgk
antibody (1:10,000), Sp1 antibody (1:1000), or Sp3 antibody (1:1000).
After three washes (10 min each), blots probed for Sgk or Sp1 proteins
were incubated with 1:10,000 anti-rabbit-horseradish peroxidase, washed
as before, and detected using the enhanced chemiluminesence assay
system. Other blots probed for Sp1 and Sp3 protein were incubated with
125I-labeled protein A (1:1000) for 3 h at room
temperature, washed, and exposed to film. Recombinant Sgk or Sp1
proteins were run as positive controls.
Production of Polyclonal anti-Sgk Antibodies
Sgk cDNA with an in-frame hemagglutinin epitope tag sequence
on the 5'-end of the gene was inserted into a T7 promoter-driven pET
vector and expressed in HMS174 Escherichia coli. Isopropyl
ß-D thiogalactopyranoside induction and activation of the
T7 promoter in a 2-liter bacterial culture produced a major protein at
55 kDa protein that was absent in a nontransformed culture. The
bacterial extract was fractionated by preparative SDS-PAGE from which
Sgk protein was excised by solidifying the Sgk-polyacrylamide slice at
200 C and grinding it into a powder. The rabbit Sgk polyclonal
antibodies were produced by Babco Berkeley Antibody Company (Richmond,
CA). Briefly, preimmune serum samples were drawn before antigen
injection. Rabbits were initially immunized with 500 µg of E.
coli-produced Sgk antigen in complete Freunds adjuvant.
Twenty-one days later, the animals were reinjected with 250 µg Sgk in
incomplete Freunds adjuvant, and booster shots of 250 µg Sgk were
given on days 42, 63, and 84. On day 94, final serum was collected and
tested by Western blots of fractionated Con8 rat mammary tumor cell
extracts, which is the cell line from which sgk was
originally cloned. A 1:10,000 dilution of the polyclonal anti-Sgk
antibody specifically recognized the 55-kDa Sgk protein.
cAMP RIA
cAMP was measured in media from granulosa cell cultures by RIA as
previously described (61). Data were analyzed using the Assay Zap
computer program (Biosoft, Cambridge, U.K.) and expressed as mean
± SEM.
Transient Transfections and CAT Assays
Plasmid DNA was purified by alkaline lysis and centrifugation on two
cesium chloride gradients as described (62). Using calcium
phosphate precipitation, a total of 20 µg of plasmid DNA were
transfected, as previously described (63), into primary granulosa cell
cultures at two distinct culture periods. To assay regulatory elements
involved in the immediate-early induction of sgk, granulosa
cells were cultured overnight (16 h) in serum and hormone-free
conditions before transfection. To assay the elements involved in
sgk induction in differentiated granulosa cells, cells were
immediately cultured in the presence of FSH/T for 37 h before the
4-h transfection. Cells were then washed and treated with forskolin for
6 h, resulting in a cumulative culture period of 48 h, at
which time granulosa cells express maximal levels of sgk.
Briefly, to make precipitates, a mixture of plasmid DNAs,
CaCl2, and water was added dropwise in 150-µl aliquots to
an equal volume of HEPES-buffered saline (283 mM NaCl, 50
mM HEPES, 1.5 mM
NaH2PO4, pH 7.05). After a 30-min incubation,
300 µl of the resulting precipitate were added to each well of cells.
Four hours later, cells were gently washed (2x) with HBSS without
calcium or magnesium before addition of fresh DMEM-F12. At this time,
FSH/T or forskolin was added to the medium for 6-h incubations. After
the incubation, cells were harvested. For CAT assays (64), cells were
lysed by repeated freeze/thaw cycles. CAT activity was measured using
15 µg of the resulting total protein, 0.05 µCi of
[14C]chloramphenicol, and 10 mM acetyl
coenzyme A and incubated for 2 h (Fig. 4
) or 7 h (Fig. 8
) at
37 C. Extracted chloramphenicol was analyzed by TLC. Data were
quantified with a Betascope analyzer. Luciferase activity was assayed
as previously described (65).
Construct Generation
Sgk-CAT reporter plasmids (-4000 sgk-CAT, -1500 sgk-CAT, and -360
sgk-CAT) contained -4 to +0.051 kb (and deletions thereof) of the rat
sgk promoter sequence linked to the coding region of
bacterial CAT gene in the vector pBLCAT3 as previously described (2, 51). The -78 sgk-CAT construct was generated from -360 sgk-CAT by
digestion with ApaI at -0.078 kb of the promoter and with
PstI in the vector multiple-cloning cassette. The
incompatible ends were filled in and then blunt-end ligated. The -35
sgk-CAT construct was created by ligating an oligonucleotide
corresponding to -35 to +40 bp of the sgk promoter into
XbaI and SalI sites of the pCAT-Basic
multiple-cloning cassette. Oligonucleotides corresponding to -63 to
-43 bp of the sgk promoter with SalI and
HindIII restriction sites (sequence detailed below) were
cloned into the -35 sgk-CAT construct to create the -63 wild type and
mutant sgk-CAT constructs. Positive clones were confirmed by
restriction mapping and DNA sequencing.
Whole Cell Extracts
Granulosa cells cultured overnight in serum-free medium were stimulated
with FSH/T for 0, 2, 12, 24, or 48 h as indicated. At each timed
endpoint, cells were washed, scraped in PBS, and collected by
centrifugation at 4 C for 5 min at 1000 x g. Cells
were resuspended in whole cell extract buffer [10 mM Tris,
1 mM EDTA, 1 mM dithiothreitol (DTT), 400
mM KCl, 10% glycerol, 1 mM
phenylmethylsulfonyl fluoride, 1 mM vanadate, 1
mM diethyldithiocarbamic acid, 0.1 mg/ml aprotinin, PIC I,
and PIC II] and then lysed by repeated freeze/thaw cycles before
centrifugation to isolate soluble protein (66). Concentrations of
soluble protein in each sample were determined by Bradford assay.
EMSAs
Whole cell extracts (1.5 µg) were incubated for 30 min with 400 pg of
probe (labeled with DNA polymerase (Klenow) and
[
-32P]dCTP) in the presence of 100 mM KCl,
5 µg poly(dI-dC), 15 mM Tris-HCl (pH 7.5), 5
mM DTT, 1 mM EDTA, 5 mM
MgCl2, and 12% glycerol in a 20 µl volume.
Sgk competitors and probes were prepared by annealing
complimentary oligonucleotides spanning -78/-35
5'AGGCCG-AGTGGCTTCCTGGTCCCGCCTGCCCCGCCCCCTGGAG-GCTC 3',
-78/-50 5'AGGCCGAGTGGCTTCCTGGTCCCGCCTGCCCC 3', -55/-35
5'AGGTGCCCCGCCCCCTGGAGGCTC 3', or -63/-43 wild type
5'TGTCCCGCCTGCCCCGCCCCCTG 3' of the sgk promoter. The
-63/43 mutant oligonucleotide contains a mutated G/C box
5'-TGTCCCGCCTGCCCCGAACCCTG-3'. Sp1 competitor DNA was
prepared by digestion of the pGAGC6 plasmid with XhoI and
XbaI to isolate a 60-bp fragment containing six Sp1 sites.
Unlabeled competitor DNA or oligonucleotides (100-fold molar excess)
were added where indicated. Sp1 and Sp3 antibodies (1 µg) were
preincubated with or without whole cell extract for 30 min at room
temperature before addition of probe. In these experiments, the amount
of poly(dI-dC) per reaction was reduced to 3.75 µg. Recombinant human
Sp1 protein was diluted 1:10 in 5 µM ZnSO4,
50 mM KCl, 1 mM DTT, 12 mM HEPES
(pH 7.0), 6 mM MgCl2, 0.05% NP-40, and 50%
glycerol. Where indicated, diluted Sp1 (1 µl) was incubated in the
presence of other reaction components with 1 µg BSA. Reactions were
resolved by electrophoresis on 5% acrylamide, 0.5x TBE, 2.5%
glycerol gels before drying and autoradiography.
Data Presentation
Representative experiments for Northern, Western, in situ
hybridization, and EMSAs are included as figures. Data from cAMP, CAT,
and luciferase assays were normalized and shown as the mean ±
SEM. Each experiment was repeated at least three times.
| FOOTNOTES |
|---|
This study was supported by NIH Grants CA-71514 (to G.L.F.) and HD-16272 (to J.S.R.).
Received for publication May 16, 1997. Revision received September 2, 1997. Accepted for publication September 18, 1997.
| REFERENCES |
|---|
|
|
|---|
and transforming growth factor-ß on
2(I) collagen gene
transcription. J Biol Chem 270:33533358
and tumor
necrosis factor-
in monocytic cells involves cooperation between
interferon regulatory factor-1, NFKB, and Sp1 transcription factors.
J Biol Chem 270:2792027931
2-macroglobulin gene in rat ovarian
granulosa cells: Stat 5 activation and binding to the interleukin-6
response element. Mol Endocrinol 10:171184This article has been cited by other articles:
![]() |
H. Alam, J. Weck, E. Maizels, Y. Park, E. J. Lee, M. Ashcroft, and M. Hunzicker-Dunn Role of the Phosphatidylinositol-3-Kinase and Extracellular Regulated Kinase Pathways in the Induction of Hypoxia-Inducible Factor (HIF)-1 Activity and the HIF-1 Target Vascular Endothelial Growth Factor in Ovarian Granulosa Cells in Response to Follicle-Stimulating Hormone Endocrinology, February 1, 2009; 150(2): 915 - 928. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Sherk, D. E. Frigo, C. G. Schnackenberg, J. D. Bray, N. J. Laping, W. Trizna, M. Hammond, J. R. Patterson, S. K. Thompson, D. Kazmin, et al. Development of a Small-Molecule Serum- and Glucocorticoid-Regulated Kinase-1 Antagonist and Its Evaluation as a Prostate Cancer Therapeutic Cancer Res., September 15, 2008; 68(18): 7475 - 7483. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Sriraman, U. Eichenlaub-Ritter, J. W. Bartsch, A. Rittger, S. M. Mulders, and J. S. Richards Regulated Expression of ADAM8 (a Disintegrin and Metalloprotease Domain 8) in the Mouse Ovary: Evidence for a Regulatory Role of Luteinizing Hormone, Progesterone Receptor, and Epidermal Growth Factor-Like Growth Factors Biol Reprod, June 1, 2008; 78(6): 1038 - 1048. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yamashita, I. Kawashima, Y. Yanai, M. Nishibori, J. S. Richards, and M. Shimada Hormone-Induced Expression of Tumor Necrosis Factor {alpha}-Converting Enzyme/A Disintegrin and Metalloprotease-17 Impacts Porcine Cumulus Cell Oocyte Complex Expansion and Meiotic Maturation via Ligand Activation of the Epidermal Growth Factor Receptor Endocrinology, December 1, 2007; 148(12): 6164 - 6175. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shimada, Y. Yanai, T. Okazaki, Y. Yamashita, V. Sriraman, M. C. Wilson, and J. S. Richards Synaptosomal-Associated Protein 25 Gene Expression Is Hormonally Regulated during Ovulation and Is Involved in Cytokine/Chemokine Exocytosis from Granulosa Cells Mol. Endocrinol., October 1, 2007; 21(10): 2487 - 2502. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Grahammer, G. Henke, C. Sandu, R. Rexhepaj, A. Hussain, B. Friedrich, T. Risler, M. Metzger, L. Just, T. Skutella, et al. Intestinal function of gene-targeted mice lacking serum- and glucocorticoid-inducible kinase 1 Am J Physiol Gastrointest Liver Physiol, June 1, 2006; 290(6): G1114 - G1123. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. MacLean II, M. K. Rao, K. M.H. Doyle, J. S. Richards, and M. F. Wilkinson Regulation of the Rhox5 Homeobox Gene in Primary Granulosa Cells: Preovulatory Expression and Dependence on SP1/SP3 and GABP Biol Reprod, December 1, 2005; 73(6): 1126 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Ongeri, M. F. Verderame, and J. M. Hammond Follicle-Stimulating Hormone Induction of Ovarian Insulin-Like Growth Factor-Binding Protein-3 Transcription Requires a TATA Box-Binding Protein and the Protein Kinase A and Phosphatidylinositol-3 Kinase Pathways Mol. Endocrinol., July 1, 2005; 19(7): 1837 - 1848. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. H. Doyle, D. L. Russell, V. Sriraman, and J. S. Richards Coordinate Transcription of the ADAMTS-1 Gene by Luteinizing Hormone and Progesterone Receptor Mol. Endocrinol., October 1, 2004; 18(10): 2463 - 2478. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Nechamen, R. M. Thomas, B. D. Cohen, G. Acevedo, P. I. Poulikakos, J. R. Testa, and J. A. Dias Human Follicle-Stimulating Hormone (FSH) Receptor Interacts with the Adaptor Protein APPL1 in HEK 293 Cells: Potential Involvement of the PI3K Pathway in FSH Signaling Biol Reprod, August 1, 2004; 71(2): 629 - 636. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Palmada, M. Dieter, A. Speil, C. Bohmer, A. F. Mack, H. J. Wagner, K. Klingel, R. Kandolf, H. Murer, J. Biber, et al. Regulation of intestinal phosphate cotransporter NaPi IIb by ubiquitin ligase Nedd4-2 and by serum- and glucocorticoid-dependent kinase 1 Am J Physiol Gastrointest Liver Physiol, July 1, 2004; 287(1): G143 - G150. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Sriraman and J. S. Richards Cathepsin L Gene Expression and Promoter Activation in Rodent Granulosa Cells Endocrinology, February 1, 2004; 145(2): 582 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. de la Rosa, T. Coric, N. Todorovic, D. Shao, T. Wang, and C. M Canessa Distribution and regulation of expression of serum- and glucocorticoid-induced kinase-1 in the rat kidney J. Physiol., September 1, 2003; 551(2): 455 - 466. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Falender, R. Lanz, D. Malenfant, L. Belanger, and J. S. Richards Differential Expression of Steroidogenic Factor-1 and FTF/LRH-1 in the Rodent Ovary Endocrinology, August 1, 2003; 144(8): 3598 - 3610. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ko, N. A. Grieshaber, I. Ji, and T. H. Ji Follicle-Stimulating Hormone Suppresses Cytosolic 3,5,3'-Triiodothyronine-Binding Protein Messenger Ribonucleic Acid Expression in Rat Granulosa Cells Endocrinology, June 1, 2003; 144(6): 2360 - 2367. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yazawa, T. Mizutani, K. Yamada, H. Kawata, T. Sekiguchi, M. Yoshino, T. Kajitani, Z. Shou, and K. Miyamoto Involvement of Cyclic Adenosine 5'-Monophosphate Response Element-Binding Protein, Steroidogenic Factor 1, and Dax-1 in the Regulation of Gonadotropin-Inducible Ovarian Transcription Factor 1 Gene Expression by Follicle-Stimulating Hormone in Ovarian Granulosa Cells Endocrinology, May 1, 2003; 144(5): 1920 - 1930. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Boehmer, V. Wilhelm, M. Palmada, S. Wallisch, G. Henke, H. Brinkmeier, P. Cohen, B. Pieske, and F. Lang Serum and glucocorticoid inducible kinases in the regulation of the cardiac sodium channel SCN5A Cardiovasc Res, March 15, 2003; 57(4): 1079 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Sriraman, S. C. Sharma, and J. S. Richards Transactivation of the Progesterone Receptor Gene in Granulosa Cells: Evidence that Sp1/Sp3 Binding Sites in the Proximal Promoter Play a Key Role in Luteinizing Hormone Inducibility Mol. Endocrinol., March 1, 2003; 17(3): 436 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Maiyar, M. L.L. Leong, and G. L. Firestone Importin-alpha Mediates the Regulated Nuclear Targeting of Serum- and Glucocorticoid-inducible Protein Kinase (Sgk) by Recognition of a Nuclear Localization Signal in the Kinase Central Domain Mol. Biol. Cell, March 1, 2003; 14(3): 1221 - 1239. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cottom, L. M. Salvador, E. T. Maizels, S. Reierstad, Y. Park, D. W. Carr, M. A. Davare, J. W. Hell, S. S. Palmer, P. Dent, et al. Follicle-stimulating Hormone Activates Extracellular Signal-regulated Kinase but Not Extracellular Signal-regulated Kinase Kinase through a 100-kDa Phosphotyrosine Phosphatase J. Biol. Chem., February 21, 2003; 278(9): 7167 - 7179. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. L. Leong, A. C. Maiyar, B. Kim, B. A. O'Keeffe, and G. L. Firestone Expression of the Serum- and Glucocorticoid-inducible Protein Kinase, Sgk, Is a Cell Survival Response to Multiple Types of Environmental Stress Stimuli in Mammary Epithelial Cells J. Biol. Chem., February 14, 2003; 278(8): 5871 - 5882. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Reisinger, R. Kaufmann, and J. Gille Increased Sp1 phosphorylation as a mechanism of hepatocyte growth factor (HGF/SF)-induced vascular endothelial growth factor (VEGF/VPF) transcription J. Cell Sci., January 15, 2003; 116(2): 225 - 238. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Grieshaber, C. Ko, S. S. Grieshaber, I. Ji, and T. H. Ji Follicle-Stimulating Hormone-Responsive Cytoskeletal Genes in Rat Granulosa Cells: Class I {beta}-Tubulin, Tropomyosin-4, and Kinesin Heavy Chain Endocrinology, January 1, 2003; 144(1): 29 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Phillips, J. Bailey, S. C. Robson, and G. N. Europe-Finner Differential Expression of the Adenylyl Cyclase-Stimulatory Guanosine Triphosphate-Binding Protein Gs{alpha} in the Human Myometrium during Pregnancy and Labor Involves Transcriptional Regulation by Cyclic Adenosine 3',5'-Monophosphate and Binding of Phosphorylated Nuclear Proteins to Multiple GC Boxes within the Promoter J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5675 - 5685. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Rao, S. Maiti, H. N. Ananthaswamy, and M. F. Wilkinson A Highly Active Homeobox Gene Promoter Regulated by Ets and Sp1 Family Members in Normal Granulosa Cells and Diverse Tumor Cell Types J. Biol. Chem., July 12, 2002; 277(29): 26036 - 26045. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chu, S. Rushdi, E.T. Zumpe, P. Mamers, D.L. Healy, T. Jobling, H.G. Burger, and P.J. Fuller FSH-regulated gene expression profiles in ovarian tumours and normal ovaries Mol. Hum. Reprod., May 1, 2002; 8(5): 426 - 433. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Richards, S. C. Sharma, A. E. Falender, and Y. H. Lo Expression of FKHR, FKHRL1, and AFX Genes in the Rodent Ovary: Evidence for Regulation by IGF-I, Estrogen, and the Gonadotropins Mol. Endocrinol., March 1, 2002; 16(3): 580 - 599. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Shelly and R. Herrera Activation of SGK1 by HGF, Rac1 and integrin-mediated cell adhesion in MDCK cells: PI-3K-dependent and -independent pathways J. Cell Sci., January 5, 2002; 115(9): 1985 - 1993. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Richards, D. L. Russell, S. Ochsner, M. Hsieh, K. H. Doyle, A. E. Falender, Y. K. Lo, and S. C. Sharma Novel Signaling Pathways That Control Ovarian Follicular Development, Ovulation, and Luteinization Recent Prog. Horm. Res., January 1, 2002; 57(1): 195 - 220. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lang and P. Cohen Regulation and Physiological Roles of Serum- and Glucocorticoid-Induced Protein Kinase Isoforms Sci. Signal., November 13, 2001; 2001(108): re17 - re17. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Salvador, Y. Park, J. Cottom, E. T. Maizels, J. C. R. Jones, R. V. Schillace, D. W. Carr, P. Cheung, C. D. Allis, J. L. Jameson, et al. Follicle-stimulating Hormone Stimulates Protein Kinase A-mediated Histone H3 Phosphorylation and Acetylation Leading to Select Gene Activation in Ovarian Granulosa Cells J. Biol. Chem., October 19, 2001; 276(43): 40146 - 40155. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. H. Burns, C. Yan, T. R. Kumar, and M. M. Matzuk Analysis of Ovarian Gene Expression in Follicle-Stimulating Hormone {beta} Knockout Mice Endocrinology, July 1, 2001; 142(7): 2742 - 2751. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brunet, J. Park, H. Tran, L. S. Hu, B. A. Hemmings, and M. E. Greenberg Protein Kinase SGK Mediates Survival Signals by Phosphorylating the Forkhead Transcription Factor FKHRL1 (FOXO3a) Mol. Cell. Biol., February 1, 2001; 21(3): 952 - 965. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Richards New Signaling Pathways for Hormones and Cyclic Adenosine 3',5'-Monophosphate Action in Endocrine Cells Mol. Endocrinol., February 1, 2001; 15(2): 209 - 218. [Abstract] [Full Text] |
||||
![]() |
J. S. Richards Graafian Follicle Function and Luteinization in Nonprimates Reproductive Sciences, January 1, 2001; 8(1_suppl): S21 - S23. [Abstract] [PDF] |
||||
![]() |
J. Y. Wu, I. J. Gonzalez-Robayna, J. S. Richards, and A. R. Means Female Fertility Is Reduced in Mice Lacking Ca2+/Calmodulin-Dependent Protein Kinase IV Endocrinology, December 1, 2000; 141(12): 4777 - 4783. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. J. Gonzalez-Robayna, A. E. Falender, S. Ochsner, G. L. Firestone, and J. S. Richards Follicle-Stimulating Hormone (FSH) Stimulates Phosphorylation and Activation of Protein Kinase B (PKB/Akt) and Serum and Glucocorticoid-Induced Kinase (Sgk): Evidence for A Kinase-Independent Signaling by FSH in Granulosa Cells Mol. Endocrinol., August 1, 2000; 14(8): 1283 - 1300. [Abstract] [Full Text] |
||||
![]() |
T. N. Alliston, I. J. Gonzalez-Robayna, P. Buse, G. L. Firestone, and J. S. Richards Expression and Localization of Serum/Glucocorticoid-Induced Kinase in the Rat Ovary: Relation to Follicular Growth and Differentiation Endocrinology, January 1, 2000; 141(1): 385 - 395. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. KUMAR, D. P. BROOKS, B. A. OLSON, and N. J. LAPING Sgk, a Putative Serine/Threonine Kinase, Is Differentially Expressed in the Kidney of Diabetic Mice and Humans J. Am. Soc. Nephrol., December 1, 1999; 10(12): 2488 - 2494. [Abstract] [Full Text] |
||||
![]() |
I. J. Gonzalez-Robayna, T. N. Alliston, P. Buse, G. L. Firestone, and J. S. Richards Functional and Subcellular Changes in the A-Kinase-Signaling Pathway: Relation to Aromatase and Sgk Expression during the Transition of Granulosa Cells to Luteal Cells Mol. Endocrinol., August 1, 1999; 13(8): 1318 - 1337. [Abstract] [Full Text] |
||||
![]() |
R. Ahlgren, G. Suske, M. R. Waterman, and J. Lund Role of Sp1 in cAMP-dependent Transcriptional Regulation of the Bovine CYP11A Gene J. Biol. Chem., July 2, 1999; 274(27): 19422 - 19428. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Naray-Fejes-Toth, C. Canessa, E. S. Cleaveland, G. Aldrich, and G. Fejes-Toth sgk Is an Aldosterone-induced Kinase in the Renal Collecting Duct. EFFECTS ON EPITHELIAL Na+ CHANNELS J. Biol. Chem., June 11, 1999; 274(24): 16973 - 16978. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chen, H. Shi, X. Liu, and D. L. Segaloff Multiple Elements and Protein Factors Coordinate the Basal and Cyclic Adenosine 3',5'-Monophosphate-Induced Transcription of the Lutropin Receptor Gene in Rat Granulosa Cells Endocrinology, May 1, 1999; 140(5): 2100 - 2109. [Abstract] [Full Text] |
||||
![]() |
P. Buse, S. H. Tran, E. Luther, P. T. Phu, G. W. Aponte, and G. L. Firestone Cell Cycle and Hormonal Control of Nuclear-Cytoplasmic Localization of the Serum- and Glucocorticoid-inducible Protein Kinase, Sgk, in Mammary Tumor Cells. A NOVEL CONVERGENCE POINT OF ANTI-PROLIFERATIVE AND PROLIFERATIVE CELL SIGNALING PATHWAYS J. Biol. Chem., March 12, 1999; 274(11): 7253 - 7263. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Black, D. Jensen, S.-Y. Lin, and J. C. Azizkhan Growth/Cell Cycle Regulation of Sp1 Phosphorylation J. Biol. Chem., January 15, 1999; 274(3): 1207 - 1215. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Clemens, R. L. Robker, W. L. Kraus, B. S. Katzenellenbogen, and J. S. Richards Hormone Induction of Progesterone Receptor (PR) Messenger Ribonucleic Acid and Activation of PR Promoter Regions in Ovarian Granulosa Cells: Evidence for a Role of Cyclic Adenosine 3',5'-Monophosphate but Not Estradiol Mol. Endocrinol., August 1, 1998; 12(8): 1201 - 1214. [Abstract] [Full Text] |
||||
![]() |
T. Mizutani, K. Yamada, T. Minegishi, and K. Miyamoto Transcriptional Regulation of Rat Scavenger Receptor Class B Type I Gene J. Biol. Chem., July 14, 2000; 275(29): 22512 - 22519. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Bell, M. L. L. Leong, B. Kim, E. Wang, J. Park, B. A. Hemmings, and G. L. Firestone Hyperosmotic Stress Stimulates Promoter Activity and Regulates Cellular Utilization of the Serum- and Glucocorticoid-inducible Protein Kinase (Sgk) by a p38 MAPK-dependent Pathway J. Biol. Chem., August 11, 2000; 275(33): 25262 - 25272. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Perrotti, R. A. He, S. A. Phillips, C. R. Haft, and S. I. Taylor Activation of Serum- and Glucocorticoid-induced Protein Kinase (Sgk) by Cyclic AMP and Insulin J. Biol. Chem., March 16, 2001; 276(12): 9406 - 9412. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Mikosz, D. R. Brickley, M. S. Sharkey, T. W. Moran, and S. D. Conzen Glucocorticoid Receptor-mediated Protection from Apoptosis Is Associated with Induction of the Serine/Threonine Survival Kinase Gene, sgk-1 J. Biol. Chem., May 11, 2001; 276(20): 16649 - 16654. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Robker, D. L. Russell, L. L. Espey, J. P. Lydon, B. W. O'Malley, and J. S. Richards Progesterone-regulated genes in the ovulation process: ADAMTS-1 and cathepsin L proteases PNAS, April 25, 2000; 97(9): 4689 - 4694. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |