help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alliston, T. N.
Right arrow Articles by Richards, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alliston, T. N.
Right arrow Articles by Richards, J. S.
Molecular Endocrinology 11 (13): 1934-1949
Copyright © 1997 by The Endocrine Society

Follicle Stimulating Hormone-Regulated Expression of Serum/Glucocorticoid-Inducible Kinase in Rat Ovarian Granulosa Cells: A Functional Role for the Sp1 Family in Promoter Activity

Tamara N. Alliston, Anita C. Maiyar, Patricia Buse, Gary L. Firestone and JoAnne S. Richards

Department of Cell Biology (T.N.A., J.S.R.) Baylor College of Medicine Houston, Texas 77030
Department of Molecular and Cell Biology (A.C.M., P.B., G.L.F.) University of California Berkeley, California 94720


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Recently, a family of novel, serine/threonine protein kinases has been identified. One of these transcriptionally inducible, immediate-early genes encodes serum/glucocorticoid inducible-protein kinase, sgk. By in situ hybridization, we show that sgk expression in the rat ovary is selectively localized to granulosa cells. In culture, FSH or forskolin, activators of the protein kinase A (PKA) pathway, rapidly (2 h) and transiently increased sgk mRNA levels in undifferentiated granulosa cells. Sgk mRNA exhibited a biphasic expression pattern, with maximal levels observed at 48 h of FSH/forskolin as granulosa cells differentiate to the preovulatory phenotype. Deletion analyses using sgk promoter-reporter constructs (-4.0 kb to -35 bp) identified a region between -63 and -43 bp that mediated FSH and forskolin-responsive transcription in undifferentiated and differentiated granulosa cells. This G/C-rich region 1) conferred both basal and inducible transcription to the minimal -35 sgk promoter chloramphenicol acetyltransferase reporter construct, 2) specifically bound Sp1 and Sp3 present in granulosa cell extracts, and 3) bound recombinant Sp1. Mutation of 2 bp in this region not only prevented Sp1 and Sp3 binding, but also abolished the PKA-mediated transactivation observed when using the wild type construct. Sp1 and Sp3 DNA-binding activity and protein levels did not change significantly during sgk induction. Collectively, these data indicate that Sp1/Sp3 transactivation of the sgk promoter likely involves regulated, phosphorylation-dependent interaction with other factors. Thus the novel, biphasic induction of sgk that correlates with granulosa cell progression from proliferation to differentiation appears to involve sequential, coordinated actions of FSH, PKA, and transcription factors, including Sp1 and Sp3.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cells respond to their environment by activating cellular signaling pathways, many of which converge upon the nucleus to coordinate gene expression. A novel family of serine/threonine kinases, distinguished by their immediate-early transcriptional induciblity, has added a new dimension to our understanding of the regulation of kinase activity. Serum/glucocorticoid inducible protein kinase, sgk, a member of this family, was initially identified as a gene whose transcription was rapidly induced by glucocorticoids in rat mammary tumor cells (1). Sgk transcription is also inducible by serum (2) and by cortical injury to the rat brain (3). Therefore, unlike other kinases that are constitutively present in cells and are activated by post-translational mechanisms such as phosphorylation or ligand binding, sgk and its family members, serum inducible kinase, snk (4), fibroblast growth factor inducible kinase, fnk (5), and proliferation related kinase, prk (6), are rapidly transactivated in response to specific hormonal and environmental stimuli. The induction of these kinases requires new transcription, is independent of new protein synthesis, and is often associated with increased cellular proliferation (1, 2, 4, 5, 6). In fact, snk was identified as a gene up-regulated in dividing cells (4), whereas sgk is induced by serum as quiescent fibroblasts begin to proliferate (2). Interestingly, sgk is also transactivated during differentiation, as shown by the induction of sgk transcription in mammary tumor cells as they differentiate in response to glucocorticoids (1). Furthermore, the highest levels of sgk transcripts have been detected in differentiated adult tissues, such as the lung, thymus, and ovary (1). Collectively, these previously described results set sgk apart as a kinase that can be rapidly induced in cells during both proliferation and differentiation.

Sgk expression was first detected in RNA prepared from rat ovary; therefore, neither the cell types in which it was expressed nor the hormones regulating its expression were known. Our preliminary data showed that sgk was expressed in the FSH-responsive ovarian granulosa cells (7). Therefore, we hypothesized that sgk was an attractive candidate for immediate-early transcriptional regulation by FSH, the physiological agonist of granulosa cell proliferation (8) and differentiation (9).

FSH coordinates the development of ovarian follicles from the small antral stage to the fully differentiated preovulatory stage (9). During this progression, FSH increases granulosa cell [3H]thymidine uptake (10) while stimulating the sequential expression of several differentiation stage-specific genes (9). For example, in undifferentiated granulosa cells FSH transiently induces cyclin D2 mRNA, itself encoding a critical regulator of granulosa cell proliferation (11). However, FSH induction of granulosa cell differentiation-specific genes, such as aromatase cytochrome P450 (12), cholesterol side-chain cleavage cytochrome P450 (13), and LH receptor (14), occurs only after 24–48 h of FSH exposure. Therefore, FSH can elicit a range of cellular responses that occur in a defined temporal sequence, involving both immediate-early and delayed effects, one of which we hypothesize is the induction of sgk.

FSH exerts its effects on granulosa cells by binding to a ligand-specific G protein-coupled membrane receptor that activates adenylyl cyclase (9, 15). This leads to cAMP production and activation of cAMP-dependent protein kinases [protein kinase A (PKA)] (16). Activated PKA is known to phosphorylate specific transcription factors, thereby modulating their activity and regulating gene expression (16, 17). Indeed, PKA phosphorylates cAMP-regulatory element-binding protein (CREB) (18), enabling it to interact with other factors present in granulosa cells to induce aromatase transcription (19). Although some of the molecular mechanisms by which FSH regulates gene expression during differentiation have been defined, less is known about genes rapidly induced by FSH and the mechanisms employed to mediate this induction, particularly in undifferentiated granulosa cells. For these reasons, and because sgk is an immediate-early gene in other tissues (1, 2), we aimed to identify the pattern of sgk expression throughout FSH-stimulated granulosa cell development and to determine the molecular mechanisms regulating its expression.

For these studies we used a well characterized, primary granulosa cell culture system in which FSH is known to stimulate specific changes in granulosa cells that mimic the proliferation and differentiation occurring in vivo as small antral follicles become preovulatory follicles (9). This system allowed us to directly examine the effects of FSH on the endogenous expression of the sgk gene, as well as on the expression of transgenes derived from the sgk promoter in granulosa cells at both the undifferentiated small antral and differentiated preovulatory stages. Our results show that sgk expression in undifferentiated rat granulosa cells is induced rapidly by activators of the PKA pathway, declines, and then reaches maximal levels as cells differentiate in vitro in response to FSH. We document that a G/C-rich region in the sgk promoter is essential for Sp1 and Sp3 binding. Furthermore, we show for the first time that the binding of Sp1 and/or Sp3 is critical for basal and FSH-inducible transcription of the sgk gene in both undifferentiated and differentiated granulosa cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Localization of sgk mRNA Expression in the Ovary
Although sgk mRNA was detected in the adult rat ovary (1), the localization of sgk expression within this tissue was unknown. Therefore, ovaries from adult cycling rats were prepared for in situ hybridization to identify the ovarian cell types expressing sgk. Using a radiolabeled antisense sgk riboprobe, sgk mRNA expression was detected at highest levels in preovulatory follicles rather than in interstitial tissue (Fig. 1Go). In these follicles, sgk mRNA was localized preferentially to the mural granulosa cells. Low amounts of sgk mRNA were detected in the interstitial tissue and in outer thecal cells, but no sgk mRNA was detected in the oocyte or in the cumulus granulosa cells surrounding the oocyte. Use of a radiolabeled sense sgk riboprobe as a negative control confirmed the specificity of the sgk signal. The expression of sgk in the FSH-responsive preovulatory granulosa cells led us to investigate the ability of FSH to directly regulate sgk transcription in cultured granulosa cells.



View larger version (122K):
[in this window]
[in a new window]
 
Figure 1. Localization of sgk mRNA Expression

The top two panels are bright-field photographs of hematoxylin- and eosin-stained ovarian tissue sections acquired from adult cycling rats. Dark-field photographs of the same region reveal staining resulting from in situ hybridization using antisense sgk riboprobe (lower left) or sense sgk riboprobe (lower right). Dark-field photos were exposed using identical conditions. The majority of the specific staining localizes to the granulosa cells in the preovulatory follicle.

 
Regulation of sgk mRNA and Protein Expression in Cultured Small Antral Granulosa Cells
To investigate the ability of FSH to regulate sgk expression, we analyzed FSH-responsive changes in sgk mRNA and protein levels. Total RNA was isolated from primary granulosa cell cultures after 0, 1, 2, 4, 6, 12, or 48 h of treatment with FSH and testosterone (T) and was examined by Northern analysis. T was used to maintain optimal FSH responsiveness of granulosa cell cultures (20). In granulosa cells cultured overnight in the absence of hormone, sgk mRNA levels were very low (Fig. 2AGo). Addition of FSH/T stimulated a rapid increase in sgk mRNA that reached a peak at 2 h and then declined by 6 h. Although all time points examined are not shown in this representative Northern blot, sgk mRNA levels gradually increased between 12 and 48 h of FSH/T. The maximal expression of sgk at 48 h of FSH/T coincides with granulosa cell differentiation to the preovulatory phenotype in vitro; as is demonstrated by the concurrent expression of another preovulatory granulosa cell-specific gene, aromatase (21). Forskolin, a PKA agonist that directly activates adenylyl cyclase, yields an identical, although more robust, pattern of sgk mRNA induction (data not shown).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Expression of sgk mRNA and Protein in Response to FSH/T in Cultured Granulosa Cells

Granulosa cells plated on serum-coated dishes were cultured overnight in hormone-free medium. At that time (t = 0), FSH/T or forskolin was added and RNA (A), protein (B), or media (C) was harvested at the indicated times. A, Twenty micrograms of RNA were examined by Northern blot analysis using an sgk cDNA as the labeled probe (upper panel). Acridine orange staining was used to visualize 28S and 18S RNA (lower panel). B, Soluble cell protein (100 µg) isolated from cultured granulosa cells was examined by Western blot analysis with an Sgk antibody. Recombinant Sgk protein in bacterial extracts (Sgk extract, 55 kDa) was used as a positive control. C, cAMP concentrations in media of FSH/T-stimulated granulosa cells were analyzed by RIA.

 
To determine whether the induction of sgk mRNA by FSH or forskolin resulted in a corresponding increase in cellular Sgk protein content, soluble cell extracts were examined by Western blot analysis using a polyclonal Sgk antibody. Recombinant Sgk protein (Mr = 55,000) was used as a positive control (Fig. 2BGo). Low amounts of immunoreactive Sgk protein were present in granulosa cells cultured overnight in the absence of serum and hormones. Addition of forskolin caused an increase in two immunoreactive bands by 6 h. The large protein corresponds to full-length Sgk protein, whereas the other may represent a partially degraded form of the kinase or a closely related Sgk-like protein. The highest amounts of Sgk protein were observed at 48 h after the addition of forskolin. FSH/T caused a pattern of Sgk induction similar to that seen with forskolin, but with lower levels at earlier time points. However, after 48 h of FSH/T, Sgk protein levels were high and equivalent to those detected with 48 h of forskolin. Thus, the time course and magnitude of Sgk protein expression paralleled the biphasic induction of sgk mRNA by FSH or forskolin.

The biphasic induction of sgk mRNA and protein appears to require the sustained activation of the PKA pathway. First, FSH alone can induce sgk, whereas T alone does not (data not shown). Second, FSH, a known activator of the PKA pathway, causes a rapid and exponential increase in granulosa cell cAMP levels (69 pmol/ml) at 2 h (Fig. 2CGo). Although cAMP levels decline by 48 h of FSH/T, the cAMP concentration (15 pmol/ml) remained approximately 30-fold higher than that in untreated cells (0.5 pmol/ml). Third, the forskolin-induced pattern of sgk mRNA expression is identical to that seen using FSH/T (data not shown). Therefore, sgk transcription is inducible by activation of the PKA pathway with an immediate early peak at 2 h and a secondary maximal peak as granulosa cells differentiate.

Translation-Independent Induction of sgk mRNA
To determine whether the FSH induction of sgk mRNA in granulosa cells was a transcriptionally mediated response, as has been previously shown in other cell types (2), granulosa cells were cultured in the presence of cycloheximide (CHX), an inhibitor of protein synthesis, or {alpha}-amanitin, a transcriptional inhibitor. To assay the immediate-early response, undifferentiated granulosa cells were treated with CHX and/or FSH/T for 2 h. The FSH/T induction of sgk mRNA was not blocked by the presence of CHX, indicating that de novo protein synthesis is not required for sgk transcription at 2 h (Fig. 3Go). When CHX was added alone to the cultures, sgk mRNA increased over basal levels, demonstrating that steady-state levels of sgk mRNA are susceptible to a CHX-sensitive step (22). Importantly, in the same time interval, {alpha}-amanitin blocked FSH/T induction of sgk mRNA. Together, these data show that the FSH-responsive increase in sgk mRNA levels in undifferentiated granulosa cells is immediate-early and transcriptionally dependent.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 3. Transcriptional Inducibility of the sgk Promoter

Left panel, Undifferentiated granulosa cells were left untreated or were pretreated with CHX (10 µg/ml) or {alpha}-amanitin ({alpha}-A, 30 µg/ml) for 30 min before hormone treatment. After a 2-h exposure in the presence or absence of FSH, cells were harvested for RNA isolation and Northern analysis. Right panel, Immediately upon isolation, granulosa cells were cultured in the presence of FSH/T. After 41 h of FSH/T exposure, CHX or {alpha}-A were added to differentiated granulosa cell cultures for the remainder of the 48-h culture period, at which time cells were harvested for RNA isolation and Northern analysis.

 
To assess the transcriptional inducibility of sgk mRNA in differentiated granulosa cells, CHX or {alpha}-amanitin was added to granulosa cells that had been cultured for 41 h with FSH/T (Fig. 3Go). RNA was harvested after 41 or 48 h of treatment and examined by Northern analysis. Although a 7-h exposure to {alpha}-amanitin caused a loss of sgk mRNA, CHX had no effect. These data suggest that transcriptional induction resulting in the secondary peak of sgk mRNA in differentiating granulosa cells is independent of new protein synthesis.

Seventy Eight Base Pairs of the sgk Promoter Contain cis-Acting DNA Elements Critical for Inducible Transcription
To identify regions of the sgk promoter that mediate the FSH induction of sgk transcription in granulosa cells, vectors containing -4000, -1500, -360, -78, or -35 bp of the sgk promoter ligated to the chloramphenicol acetyltranscriptase (CAT) reporter gene were transfected into granulosa cells that had been cultured overnight in the absence of serum and hormone (Fig. 4Go). After a 4-h transfection, the cells were stimulated with forskolin for 6 h or were left untreated. Forskolin increased CAT activity of the transfected -4000 sgk-CAT, -1500 sgk-CAT, -360 sgk-CAT, and -78 sgk-CAT vectors by 4-fold, 5-fold, 3-fold, and 7-fold, respectively, compared with levels in untreated cells. The shortest deletion construct containing only minimal promoter elements, -35 sgk-CAT, was not forskolin inducible. Similar results were observed when FSH/T, rather than forskolin, was added to the transfected cells (data not shown). The -78 sgk-CAT construct also exhibited forskolin-responsive transcription when examined in differentiated granulosa cells (cells treated with 37 h FSH/T followed by transfection and 6 h forskolin stimulation) (Fig. 8BGo). Thus, the region between -78 and -35 bp of the sgk promoter was sufficient and necessary to confer transcriptional inducibility to the reporter gene at both the immediate-early (2 h) and the late (48 h) phases of sgk transcription.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. Forskolin Inducibility of the sgk Promoter

Granulosa cells were cultured overnight in serum and hormone-free media and then transfected with constructs containing 4000 bp, 1500 bp, 360 bp, 78 bp, or 35 bp of the sgk promoter linked to a CAT reporter gene. Cells were incubated 4 h for transfection of calcium phosphate DNA precipitate and then 6 h in the presence or absence of forskolin. pCAT control and pCAT basic plasmids were used as positive and negative controls, respectively, for all CAT assays (data not shown). Cell extracts were assayed for CAT activity for 2 h. Results are shown as percent conversion of [14C]chloramphenicol.

 


View larger version (34K):
[in this window]
[in a new window]
 
Figure 8. Role of the G/C Box in the Hormone Induction of the sgk Promoter

As detailed in the previous figure, undifferentiated granulosa cells (A) were transfected with constructs containing portions of the sgk promoter linked to the CAT reporter gene. The -63 mut sgk-CAT construct contains a mutation in the G/C box (CC to AA) as indicated. After transfection, cells were incubated for 6 h in the presence or absence of FSH/T. B, Other granulosa cells were cultured with FSH/T for 37 h to allow differentiation before the 4-h transfection with the same constructs. Then cells were washed and incubated for 6 h in the presence or absence (0) of forskolin. This regimen mimicked the 48-h culture period of FSH/T alone when sgk mRNA levels were maximal. CAT activity of all cell extracts was assayed for 7 h. Results are shown as percent conversion of [14C]chloramphenicol.

 
Specific Binding of Protein Complexes to -78/-35 of the sgk Promoter
The transcriptionally active region from -78 to -35 bp of the sgk promoter contains several transcription factor consensus-binding sites. An Sp1 site and an AP-2 site are upstream of another G/C-rich region, referred to here as the G/C box. The G/C box itself contains three overlapping Sp1 sites and an additional AP-2 site (Fig. 5AGo). Because these consensus sequences potentially bind AP-2 and multiple members of the Sp1 family, several proteins are candidate enhancers of sgk transcription. To determine whether the -78/-35 region of the sgk promoter did, indeed, bind specific proteins, oligonucleotides corresponding to various fragments of this region were constructed for use in electrophoretic mobility shift assays (EMSAs). When the -78/-35 bp oligonucleotide spanning the entire functional region was used as a radiolabeled probe, four major protein/DNA complexes were formed in the presence of granulosa whole cell extracts (Fig. 5BGo). These complexes (I, II, III, IV) were specifically competed by 100-fold excess of unlabeled -78/-35 self-competitor DNA. When unlabeled oligonucleotides spanning a 3'-region (-55/-35 bp), a 5'-region (-78/-50 bp), or the central region (-63/-43 bp) of the -78/-35 oligonucleotide were used as competitors, only the central (-63/-43 bp) oligonucleotide effectively competed for all complexes. Although oligonucleotides corresponding to the 3'-region (-55/-35 bp) and 5'-region (-78/-50 bp) of the sgk promoter could partially compete for binding of complex III and completely compete for binding of complex IV, we focused on the central region (-63/-43 bp) as it was the only oligonucleotide that formed all four specific protein/DNA complexes with granulosa whole cell extracts when it was used as a labeled probe (Fig. 5CGo).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. Specific Binding of Granulosa Cell Proteins to -78/-35 bp of the sgk Promoter

Whole cell extracts (WCE) used in all EMSAs were prepared from granulosa cells cultured overnight in hormone-free media before 1 h exposure to FSH unless otherwise indicated. A, A schematic of oligonucleotides spanning the sgk promoter identifies the consensus transcription factor-binding sites within the transcriptionally active region and the oligonucleotides used in EMSA analysis that span each region. B, Complexes (I-IV) formed with WCE incubated with the -78/-35 bp sgk oligonucleotide probe. Oligonucleotides corresponding to -78/-35, -78/-50, -55/-35, and -63/-43 bp of the sgk promoter were used as competitor DNA. C, Wild type or mutant -63/-43 bp sgk oligonucleotides were used as probes or unlabeled competitor DNA with WCE to assess the role of the G/C box.

 
To assess the role of the G/C box in protein/DNA complex formation, another -63/-43 oligonucleotide was synthesized with the CC at position 48/-47 bp mutated to AA. When EMSAs were performed using the wild type -63/-43 oligonucleotide as the labeled probe with granulosa cell extracts, complexes I-IV were formed and were competed by excess self-competitor DNA (Fig. 5CGo). The mutated -63/-43 oligonucleotide failed to compete for the binding of protein in the major complexes I and II. However, the mutant oligonucleotide did compete partially for complex III or completely for complex IV. When this mutated -63/-43 oligonucleotide was used as a labeled probe, complexes I and II were not formed. Complexes III and IV were detected, but at levels lower than those detected using the wild type probe. These results showed that the formation of two major, specific protein/DNA complexes (I and II) critically depend upon an intact G/C box with its overlapping Sp1 and AP-2 sites for binding.

Identification of Protein/DNA Complexes
To determine whether either AP-2 protein or Sp1 protein family members bound the -63/-43 region of the sgk promoter, AP-2 and Sp1 consensus sequence oligonucleotides and antibodies were used in additional EMSAs. While the labeled -63/-43 oligonucleotide formed complexes I-IV that were competed by 100-fold excess unlabeled self-competitor DNA, these complexes were not competed by the same amount of an AP-2 consensus oligonucleotide. Nor did the addition of anti-AP-2 polyclonal antibody supershift or diminish the formation of these complexes. Based on these results, we conclude that AP-2 is not a major factor in granulosa cell extracts binding to this region of the sgk promoter (data not shown).

In contrast, use of the Sp1 consensus binding sites, antibodies, and recombinant protein in EMSAs suggest that the consensus Sp1-binding sites in the G/C box bind Sp1 present in granulosa cell extracts. Again, complexes I-IV were formed with labeled -63/-43 bp probe and were competed with unlabeled wild type -63/-43 oligonucleotide (Fig. 6AGo, lanes 2 and 3). Sp1 competitor DNA effectively competed for the binding of complexes I and II (lane 5) compared with the mutant -63/-43 oligonucleotide (lane 4). Incubation of the -63/-43 probe with recombinant Sp1 protein resulted in the formation of a protein/DNA complex with the same mobility as complex I (Fig. 6AGo, lane 6). This Sp1 complex was competed by excess self (lane 7) but not mutant oligonucleotides (lane 8) and was competed by Sp1 competitor DNA (lane 9). This specific Sp1 complex was completely supershifted upon incubation with a polyclonal Sp1 antibody (lane 10).



View larger version (57K):
[in this window]
[in a new window]
 
Figure 6. Identification of the Protein/DNA Complexes

A, Unlabeled -63/-43 wt (self) and mutant sgk oligonucleotides and Sp1 consensus site DNA (six copies) were used to compete the formation of the protein/DNA complexes formed between a -63/-43 sgk oligonucleotide probe and granulosa cell WCE or recombinant human Sp1 protein. Incubation of recombinant Sp1 protein with Sp1 antibody caused the formation of a supershifted complex (*) that was not detected upon incubation of antibody with the probe alone (lane 11). B, When the same probe was incubated with granulosa cell WCE in the presence of Sp1 and/or Sp3 antibody, the formation of complexes I and II, respectively, were decreased in association with the formation of supershifted bands (*). These supershifted bands were not detected upon incubation of Sp3 antibody with probe alone (lane 1).

 
With the specificity of the Sp1 antibody confirmed, the antibody was then used in EMSAs with granulosa cell extracts to more specifically determine the identity of complex I. When incubated with the -63/-43 sgk probe in the presence of granulosa cell extracts, the Sp1 antibody decreased the formation of complex I and formed a supershifted band (Fig. 5BGo, lane 3) that was not detected upon incubation of the probe with antibody alone (Fig. 5AGo, lane 11). As has been shown previously, this antibody causes a partial supershift with cell extracts, most likely because the peptide region used to generate the antibody can be posttranslationally modified in vivo (23). Therefore, protein/DNA complex I formed between the G/C box of the sgk promoter and granulosa cell whole cell extracts contains Sp1.

Similarly, to determine the identity of complex II, which was also competed by Sp1 consensus oligonucleotides, antibodies against another Sp1 family member, Sp3 (24), were used for supershift analysis. The Sp3 antibody specifically decreased the formation of complex II (Fig. 5BGo, lane 4) while forming a supershifted band that was not observed in the presence of probe and antibody alone (lane 1). The Sp3 antibody does not cross-react with Sp1 as incubation of the Sp3 antibody with recombinant Sp1 protein did not result in a supershift or depletion of this complex (data not shown). However, incubation of Sp1 antibody and Sp3 antibody together with granulosa cell extracts resulted in the decrease of both complexes I and II and formation of supershifted bands (lane 5). Therefore, in addition to binding Sp1, the consensus Sp1-binding sites in the sgk G/C box also bind Sp3, detected in complex II.

Sp1 Sites Mediate FSH-Stimulated Transcription
To determine whether Sp1 sites were able to mediate an FSH-responsive induction independently of the sgk promoter context, we transfected a construct containing six Sp1 sites upstream of a basal promoter and luciferase reporter, pGAGC6 (25), into primary undifferentiated granulosa cells that had been cultured overnight in serum and hormone-free conditions. As a control, the same vector without the Sp1 sites, pGAM (25), was transfected into identical granulosa cell cultures. The pGAGC6 transgene exhibited much higher levels of basal transcription (30-fold) than the pGAM construct alone (Fig. 7Go). In addition, the pGAGC6 construct showed a modest, but significant induction (2-fold) in response to a 6-h treatment with FSH/T. The results indicate Sp1-binding sites can confer basal and hormone-responsive transcription in granulosa cells.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 7. Role of Sp1-Binding Sites in Hormone-Responsive Granulosa Cell Transcription

After overnight incubation in serum- and hormone-free conditions, undifferentiated granulosa cells were transfected with pGAM or pGAGC6 vectors before 6 h of exposure to no hormone (0) or FSH/T. Luciferase activity was assayed in protein extracts from these cultures and is expressed as luciferase units per microgram of protein.

 
The G/C Box Regulates Transcription of the sgk Promoter
To determine whether the Sp1 sites within the G/C box of the sgk promoter could also mediate basal and hormone-induced transactivation, both -63/-43 wild type and mutant oligonucleotides were cloned into the minimal -35 sgk-CAT construct (Fig. 8AGo). Basal and inducible activities of these constructs were compared with the -78 sgk-CAT and -35 sgk-CAT constructs. As shown above, the -35 sgk-CAT has minimal basal activity and no FSH-inducible transcription when transfected into primary undifferentiated granu-losa cell cultures. Basal transcription from the -78 sgk-CAT and -63 sgk-CAT constructs was greater than basal transcription seen with -35 sgk-CAT. Furthermore, FSH induced transactivation from -78 sgk-CAT and -63 sgk-CAT by 3-fold or 2-fold, respectively, over basal levels. When the G/C box was mutated in the -63 sgk-CAT construct, basal levels were low and did not differ from those seen with the minimal promoter -35 sgk-CAT construct. Additionally, FSH induction was lost in the mutated construct. These results were identical, but even more dramatic, when differentiated granulosa cells were transfected after 37 h of FSH/T exposure, before a 6-h stimulation with forskolin (Fig. 8BGo). Therefore, the presence of an intact G/C box with its overlapping Sp1-binding sites is sufficient for basal transcription of the sgk promoter and can mediate an FSH-responsive induction at both early and late stages of granulosa cell differentiation.

Regulation of Sp1 and Sp3 Levels and Binding Activity
Because Sp1 and/or Sp3 binding are required for sgk transactivation, we examined Sp1- and Sp3-binding activity and protein levels throughout the 48-h FSH treatment period in which granulosa cell sgk mRNA levels are biphasically induced. Granulosa cell whole cell extracts were isolated after 0, 2, 12, 24, or 48 h exposure to FSH/T and were then used in EMSA and Western analysis. Incubation of these extracts with a radiolabeled -63/-43 wild type sgk probe revealed no change in the binding of complex I (Sp1) or complex II (Sp3) during this time (Fig. 9AGo). Likewise, repeated Western analyses of these same extracts with antibodies against Sp1 (Fig. 9BGo) and Sp3 (Fig. 9CGo), revealed no significant changes in either Sp1 or Sp3 protein levels. Although Sp1 protein levels in the granulosa cells did not change, we show that the levels of the previously described Sp1 doublet (105 kDa and 95 kDa) (26) are high in ovarian extracts and are comparable to levels in extracts of lung and thymus, two tissues previously reported to express the highest levels of Sp1 (27) (Fig. 9DGo). No Sp1 protein was detectable in extracts from low Sp1-expressing tissues, muscle, and kidney (27). These data collectively suggest a role for a coactivating factor or posttranslational modification that regulates the transactivating potential of Sp1 and/or Sp3 in FSH-stimulated granulosa cells.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 9. Analysis of Sp1 and Sp3 Protein Levels and Binding Activity in Response to FSH

Whole cell extracts isolated from granulosa cells cultured in FSH/T for 0, 2, 12, 24, or 48 h were isolated and examined by EMSA with the radiolabeled -63/-43 sgk oligonucleotide probe (A) or by Western analysis using antibodies against Sp1 (B) or Sp3 (C). D, Similar extracts prepared from the ovary, lung, thymus, kidney, and muscle were analyzed along with recombinant human Sp1 protein by Western analysis with an Sp1 antibody.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
This report provides the first evidence that sgk, a member of a class of novel, transcriptionally inducible kinases, is expressed in granulosa cells of the rat ovary, in vivo and in vitro. Furthermore, we have shown that sgk transcription is regulated in these cells by FSH in a biphasic pattern. The two phases of sgk mRNA and protein induction correlate with distinct FSH-regulated events in granulosa cell maturation, proliferation, and differentiation. The rapid (2 h) and transient induction of sgk by FSH is coincident with the FSH stimulation of events regulating granulosa cell proliferation as is detected by intense labeling of cells with [3H]thymidine (10), BrDU staining (28), and FSH induction of cyclin D2 mRNA (11). Cyclin D2 is a cell cycle regulator that has recently been shown to be obligatory for granulosa cell proliferation as mice null for cyclin D2 have a dramatically reduced number of granulosa cells (11). Sgk is also rapidly induced by serum in fibroblasts as they enter the cell cycle from quiescence (2). Collectively, these data suggest that the FSH-induced immediate-early expression of sgk mRNA in granulosa cells is coincident with important cell cycle events.

The secondary induction of sgk occurs as granulosa cells differentiate. Maximal levels of sgk mRNA are detected after 48 h of FSH/T in vitro or in preovulatory follicles in vivo. Not only are granulosa cells at this stage very different from those in small antral follicles, but they are also different from one another. For example, granulosa cells adjacent to the antrum of the follicle are still proliferative at this time (29). However, mural granulosa cells adjacent to the follicle basement membrane are the first to cease cell division and to express markers of terminal granulosa cell differentiation such as the LH receptor (30). Interestingly, in situ hybridization at this time reveals a gradient of sgk expression, with the highest levels seen in the most differentiated, nonproliferative mural granulosa cells. Therefore, the highly FSH-responsive transcriptional induction of sgk occurs in two phases, one of which coincides with granulosa cell proliferation and the other with granulosa cell differentiation, suggesting multiple functions of sgk in cell proliferation and differentiation.

Although the immediate-early transient induction of sgk transcription has been well defined in both proliferating and differentiating cell types in response to agonists such as serum, glucocorticoids, or brain injury (1, 2, 3), this is the first report of a biphasic pattern of gene expression in the ovary and of sgk in particular. Interestingly, both phases of sgk induction in granulosa cells by FSH or forskolin appear to depend upon the activation of the protein kinase A pathway and are sensitive to {alpha}-amanitin but not to CHX, implicating transcriptional control in the regulation of granulosa cell sgk levels.

Unlike the sgk gene, which exhibits both rapid and delayed responses to FSH, genes such as aromatase are induced by FSH only after more extended granulosa cell differentiation (21). This brings up the interesting problem of what differs between the undifferentiated granulosa cell and the differentiated preovulatory granulosa cell that enables them to respond uniquely to the same signal. We have recently shown that CREB, a PKA-activated transcription factor, is phosphorylated in a biphasic manner in response to FSH or forskolin (19). Phospho-CREB is detected at 2 h, decreases are detected at 6 h, and then maximal levels are reached between 24 and 48 h of FSH treatment (19). This pattern mimics the distinctive pattern of FSH-induced sgk transcription. Although the sgk promoter has no detectable CRE, and we have detected no role for CREB in sgk transactivation, these data suggest that the phosphorylation and regulation of other nuclear transcription factors and coactivators by PKA may also be oscillatory and obligatory for maintaining transcription.

To determine the mechanisms employed by FSH to regulate gene expression during granulosa cell differentiation, we investigated the functional promoter regions of the sgk gene at both early and late stages of granulosa cell differentiation. Deletion and mutation analyses of the sgk promoter showed that a region between -63 and -43 bp conferred FSH activation of reporter genes at 6 h and forskolin mediated activation at 48 h. Based on several approaches, our results indicate that Sp1 and Sp3 are transcription factors that contribute to the biphasic regulation of sgk by the PKA pathway in granulosa cells. First, the G/C-rich box within the transcriptionally active -63/-43 region contains overlapping consensus binding sites for Sp1 family members that bind multiple proteins present in granulosa cell extracts. Second, EMSAs showed that Sp1 consensus oligonucleotides competed for the binding of granulosa cell proteins to the -63/-43 oligonucleotide, that recombinant Sp1 bound to this same probe and formed a complex of similar mobility as complex I, and that an Sp1 antibody supershifted the Sp1/DNA complex. Complex II, also specifically competed by the Sp1 family consensus binding sites, was supershifted in the presence of Sp3 antibody. Furthermore, mutation of the Sp1-binding sites within the G/C box abolished the formation of both complexes I and II. Transfection experiments documented that a transgene containing six concatamers of Sp1-binding sites ligated to a heterologous minimal promoter conferred high basal and FSH-stimulated activity in granulosa cells. Most importantly, when the mutant -63 sgk-CAT vector lacking Sp1- and Sp3-binding activity was transfected into granulosa cells, the basal and hormone-induced expression observed with the wild type -63 sgk-CAT transgene was abolished. Although AP-2 sites were present in this region of the promoter, no evidence of binding or functional activity was observed. Based on these observations, we conclude that Sp1 and Sp3 bind to the G/C-rich cis-acting DNA element of the sgk promoter and, independently or coordinately, function as enhancers to enable FSH/PKA-mediated transcription of the sgk gene.

Sp1 has been traditionally characterized as a ubiquitous regulator of basal promoter activity, partly because of its critical role in transcription from TATA-less promoters (31). Sp3 is an Sp1 family member previously demonstrated to antagonize Sp1 activity by competing for Sp1 binding sites (24). Sp3 has also been demonstrated to activate transcription (32). The results described herein and those of others (25, 33, 34, 35, 36, 37) indicate that Sp1 and/or Sp3 can also function as enhancers, enabling hormone-inducible transcription from TATA box-containing promoters. For example, in other cell systems, putative functional Sp1-binding sites have been reported in several genes that exhibit regulated expression similar to the secondary induction of sgk in differentiated granulosa cells. Bovine cholesterol side-chain cleavage cytochrome P450 (33, 34, 35), the LH receptor (36), and the rat progesterone receptor (37) require Sp1 and/or its binding sites for PKA-mediated induction. CIP1, a cyclin-dependent kinase inhibitor that is expressed in rat luteal cells (R. L. Robker and J. S. Richards, unpublished observations) requires Sp1 for a protein kinase C-mediated induction (25). The results presented herein extend these observations and provide the first evidence that Sp1 and/or Sp3 binding to a G/C-rich cis-acting DNA element mediates the biphasic FSH induction of a specific gene, sgk, in granulosa cells.

The known mechanisms by which Sp1 family members can mediate hormone-regulated expression of genes are complex. Regulation of Sp1 binding by phosphorylation (38), by the Sp1-Inhibitor (Sp1-I) (39, 40, 41, 42), or by competition for binding sites with the repressor, Sp3 (43), can also control Sp1 activity. Tissue-specific regulation of Sp1 protein levels may also be critical. For example, the tissues that express the highest levels of Sp1, ovary, lung, and thymus (Fig. 9CGo) (27), also express the highest levels of sgk (1). However, the lack of significant detectable changes in Sp1 and Sp3 protein levels or binding activity during the course of sgk induction suggests that the functional activation of these factors depends upon a posttranslational change in Sp1 or Sp3 or a regulated interaction with other factors (44). Some of the factors with which Sp1 is known to interact include SF-1, p53, Stat 1, GATA-1, AP-1, NFKB, and estrogen receptor (35, 45, 46, 47, 48, 49, 50). The sgk promoter does contain a functional p53 site at -1380/-1345 bp, as well as a glucocorticoid response element at -1.0 kb, both of which have been shown to be functional in other cells (1, 51, 52). However, to our knowledge, p53 and Sp1 interactions have thus far been reported only when the binding sites are in close proximity (45). Furthermore, although the functional importance of p53 and GR in transactivation has been clearly demonstrated in other systems, deletion of these upstream regions did not decrease or modify the expression of sgk transgenes by FSH in granulosa cells. Although no consensus sequences for factors known to interact with Sp1 have been identified in the -63/-43 region, the additional factor or cofactor may bind directly to Sp1 or Sp3 instead of to the DNA. In fact, because both GR and p53 can impact transcription in the absence of their own consensus sequence binding sites (53, 52), these factors could potentially interact with Sp1 and/or Sp3 in trans. Based on the biphasic pattern of CREB phosphorylation, we propose PKA mediates a biphasic change in Sp1/Sp3 activity directly or indirectly, thereby resulting in the biphasic induction pattern of sgk transcription.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Ovine FSH was provided by the National Hormone and Pituitary Program (Baltimore, MD). T was obtained from Steraloids (Keene, NH). Cell culture reagents were purchased from GIBCO (Grand Island, NY). Biotrans nylon membrane (0.2 mm) was purchased from ICN Biochemicals (Cleveland, OH) and [32P]dCTP, [125I]Protein A, and [125I]cAMP were obtained from ICN Radiochemical (Costa Mesa, CA). 17ß-Estradiol, deoxyribonuclease I, soybean trypsin inhibitor, CHX, {alpha}-amanitin, and forskolin were obtained from Sigma (St. Louis, MO). Cell culture dishes (six-well) were obtained from Corning (Corning, NY). The cAMP antibody was a gift of Dr. Judith Vaitukaitis (NIH, Bethesda, MD). [14C]Chloramphenicol was obtained from Amersham (Arlington Heights, IL), and acetyl coenzyme A, coenzyme A, and poly(deoxyinosinic-deoxycytidylic)acid [poly(dI-dC)] were purchased from Pharmacia (Piscataway, NJ). Luciferin was from Boehringer Mannheim Biochemicals (Indianapolis, IN), recombinant human Sp1 protein was obtained from Promega (Madison, WI), and the Sp1, Sp3, and AP-2 antibodies and AP-2 competitor DNA were obtained from Santa Cruz (Santa Cruz, CA). Oligonucleotides were synthesized by Genosys (Woodlands, TX). The pGAGC6 and pGAM luciferase vectors were gifts of Dr. Jeffrey Kudlow (University of Alabama at Birmingham, Birmingham, AL).

Methods
Primary Granulosa Cell Culture
Holtzman Sprague Dawley immature female rats (Harlan, Indianapolis, IN) delivered on day 23 of age were injected subcutaneously with 1.5 mg 17ß-estradiol once daily on days 24, 25, and 26 of age. Animals were treated in accordance with the principles and procedures outlined in the "Guidelines for Care and Use of Experimental Animals." Ovaries were isolated from rats on day 27 for the harvest of granulosa cells exhibiting a small antral phenotype as previously described (54). Briefly, cells were isolated from the ovaries by needle puncture (22 gauge) into media containing DMEM, F12, 30 mM NaHCO3, 20 mM HEPES, and 100 IU/ml penicillin-streptomycin. Granulosa cells were treated with 20 µg/ml trypsin, 300 µg/ml soybean trypsin inhibitor, and 160 µg/ml deoxyribonuclease I to remove dead cells. After the cells were washed twice in DMEM-F12, they were plated on serum-coated, six-well culture dishes in 3 ml of media. Cells were incubated in 95% air, 5% CO2 at 37 C. To allow efficient attachment of cells before initiation of treatments, cells were incubated overnight in hormone and serum-free medium unless indicated otherwise. The following morning (16 h later), FSH (50 ng/ml), T (10 ng/ml), or forskolin (10 µM) were added for the preparation of RNA, protein, or cell extracts for EMSAs. Where indicated, CHX (10 µg/ml) or {alpha}-amanitin (30 µg/ml) were added either 30 min before hormone addition or after 41 h of culture with FSH/T to inhibit protein and RNA synthesis, respectively. Similar granulosa cell cultures were processed for transient transfections.

In Situ Hybridization
Ovaries isolated from adult cycling rats were fixed in 4% paraformaldehyde in PBS (80 mM Na2HPO4, 20 mM NaH2PO4, 100 mM NaCl) overnight at 4 C before dehydration and paraffin embedding. Sections (6 µm) were baked at 42 C overnight onto 3-amino propyltriethoxysilane-coated slides. Slides were prehybridized, hybridized, washed, exposed, and developed as previously described (55). The 35S-labeled sense and antisense riboprobes were produced by transcription from the T3 and T7 promoters, respectively, on the NheI-digested pBS-sgk vector as previously described (55).

RNA Isolation and Northern Analysis
RNA was isolated as previously described (56) from granulosa cell cultures using buffer containing 1% Nonidet P-40, followed by phenol/chloroform extraction, ethanol precipitation, resuspension in water previously treated with diethyl pyrocarbonate, and quantification by absorbance at 260 nm. For Northern analysis, RNA samples (20 µg) were denatured at 55 C for 15 min in 45% formamide-5.4% formaldehyde and resolved by electrophoresis on formaldehyde-agarose gels at room temperature. Acridine orange staining allowed assessment of RNA ladder migration and confirmation of equal sample loading by the UV intensity of 28 S and 18 S ribosomal RNA bands. After the RNA was transferred to a nylon membrane, the blot was baked for 1 h at 80 C, prehybridized, and hybridized with 1 x 106 cpm/ml sgk cDNA probe (1). Blots were washed according to ICN specifications and exposed to x-ray film at -70 C. All results were quantified using a Betascope analyzer. The sgk cDNA probe was labeled as previously described using a random primers and [{alpha}-32P]dCTP (57).

Protein Preparation and Western Analysis
Granulosa cells cultured in FSH/T or forskolin were harvested at selected times and homogenized to prepare soluble cell extracts as previously described (58). Extracts of lung, muscle, thymus, and kidney tissues were prepared similarly. Protein was measured using a 1:5 dilution of Bradford reagent in microtiter plates for colorimetric detection at 590 nm (59). Cell extracts were stored at -70 C until Western analyses were performed. Protein samples (100 µg) were denatured for 10 min at 100 C in 5x SDS loading dye (60). One-dimensional SDS-PAGE with 4.5% stacking and 10% separating acrylamide gels was used to resolve proteins. Proteins were transferred to 0.45-µm nitrocellulose membranes at 50 V for 4 h in 125 mM Tris-Base, 100 mM glycine, and then blocked for 1 h in PBS (80 mM Na2HPO4, 20 mM NaH2PO4, 100 mM NaCl, pH 7.5), containing 5% milk, 0.1% Tween-20. After one 20-min incubation in wash solution (1% milk in PBS and 0.1% Tween-20), filters were incubated 1 h with appropriate dilutions of Sgk antibody (1:10,000), Sp1 antibody (1:1000), or Sp3 antibody (1:1000). After three washes (10 min each), blots probed for Sgk or Sp1 proteins were incubated with 1:10,000 anti-rabbit-horseradish peroxidase, washed as before, and detected using the enhanced chemiluminesence assay system. Other blots probed for Sp1 and Sp3 protein were incubated with 125I-labeled protein A (1:1000) for 3 h at room temperature, washed, and exposed to film. Recombinant Sgk or Sp1 proteins were run as positive controls.

Production of Polyclonal anti-Sgk Antibodies
Sgk cDNA with an in-frame hemagglutinin epitope tag sequence on the 5'-end of the gene was inserted into a T7 promoter-driven pET vector and expressed in HMS174 Escherichia coli. Isopropyl ß-D thiogalactopyranoside induction and activation of the T7 promoter in a 2-liter bacterial culture produced a major protein at 55 kDa protein that was absent in a nontransformed culture. The bacterial extract was fractionated by preparative SDS-PAGE from which Sgk protein was excised by solidifying the Sgk-polyacrylamide slice at 200 C and grinding it into a powder. The rabbit Sgk polyclonal antibodies were produced by Babco Berkeley Antibody Company (Richmond, CA). Briefly, preimmune serum samples were drawn before antigen injection. Rabbits were initially immunized with 500 µg of E. coli-produced Sgk antigen in complete Freund’s adjuvant. Twenty-one days later, the animals were reinjected with 250 µg Sgk in incomplete Freund’s adjuvant, and booster shots of 250 µg Sgk were given on days 42, 63, and 84. On day 94, final serum was collected and tested by Western blots of fractionated Con8 rat mammary tumor cell extracts, which is the cell line from which sgk was originally cloned. A 1:10,000 dilution of the polyclonal anti-Sgk antibody specifically recognized the 55-kDa Sgk protein.

cAMP RIA
cAMP was measured in media from granulosa cell cultures by RIA as previously described (61). Data were analyzed using the Assay Zap computer program (Biosoft, Cambridge, U.K.) and expressed as mean ± SEM.

Transient Transfections and CAT Assays
Plasmid DNA was purified by alkaline lysis and centrifugation on two cesium chloride gradients as described (62). Using calcium phosphate precipitation, a total of 20 µg of plasmid DNA were transfected, as previously described (63), into primary granulosa cell cultures at two distinct culture periods. To assay regulatory elements involved in the immediate-early induction of sgk, granulosa cells were cultured overnight (16 h) in serum and hormone-free conditions before transfection. To assay the elements involved in sgk induction in differentiated granulosa cells, cells were immediately cultured in the presence of FSH/T for 37 h before the 4-h transfection. Cells were then washed and treated with forskolin for 6 h, resulting in a cumulative culture period of 48 h, at which time granulosa cells express maximal levels of sgk. Briefly, to make precipitates, a mixture of plasmid DNAs, CaCl2, and water was added dropwise in 150-µl aliquots to an equal volume of HEPES-buffered saline (283 mM NaCl, 50 mM HEPES, 1.5 mM NaH2PO4, pH 7.05). After a 30-min incubation, 300 µl of the resulting precipitate were added to each well of cells. Four hours later, cells were gently washed (2x) with HBSS without calcium or magnesium before addition of fresh DMEM-F12. At this time, FSH/T or forskolin was added to the medium for 6-h incubations. After the incubation, cells were harvested. For CAT assays (64), cells were lysed by repeated freeze/thaw cycles. CAT activity was measured using 15 µg of the resulting total protein, 0.05 µCi of [14C]chloramphenicol, and 10 mM acetyl coenzyme A and incubated for 2 h (Fig. 4Go) or 7 h (Fig. 8Go) at 37 C. Extracted chloramphenicol was analyzed by TLC. Data were quantified with a Betascope analyzer. Luciferase activity was assayed as previously described (65).

Construct Generation
Sgk-CAT reporter plasmids (-4000 sgk-CAT, -1500 sgk-CAT, and -360 sgk-CAT) contained -4 to +0.051 kb (and deletions thereof) of the rat sgk promoter sequence linked to the coding region of bacterial CAT gene in the vector pBLCAT3 as previously described (2, 51). The -78 sgk-CAT construct was generated from -360 sgk-CAT by digestion with ApaI at -0.078 kb of the promoter and with PstI in the vector multiple-cloning cassette. The incompatible ends were filled in and then blunt-end ligated. The -35 sgk-CAT construct was created by ligating an oligonucleotide corresponding to -35 to +40 bp of the sgk promoter into XbaI and SalI sites of the pCAT-Basic multiple-cloning cassette. Oligonucleotides corresponding to -63 to -43 bp of the sgk promoter with SalI and HindIII restriction sites (sequence detailed below) were cloned into the -35 sgk-CAT construct to create the -63 wild type and mutant sgk-CAT constructs. Positive clones were confirmed by restriction mapping and DNA sequencing.

Whole Cell Extracts
Granulosa cells cultured overnight in serum-free medium were stimulated with FSH/T for 0, 2, 12, 24, or 48 h as indicated. At each timed endpoint, cells were washed, scraped in PBS, and collected by centrifugation at 4 C for 5 min at 1000 x g. Cells were resuspended in whole cell extract buffer [10 mM Tris, 1 mM EDTA, 1 mM dithiothreitol (DTT), 400 mM KCl, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, 1 mM vanadate, 1 mM diethyldithiocarbamic acid, 0.1 mg/ml aprotinin, PIC I, and PIC II] and then lysed by repeated freeze/thaw cycles before centrifugation to isolate soluble protein (66). Concentrations of soluble protein in each sample were determined by Bradford assay.

EMSAs
Whole cell extracts (1.5 µg) were incubated for 30 min with 400 pg of probe (labeled with DNA polymerase (Klenow) and [{alpha}-32P]dCTP) in the presence of 100 mM KCl, 5 µg poly(dI-dC), 15 mM Tris-HCl (pH 7.5), 5 mM DTT, 1 mM EDTA, 5 mM MgCl2, and 12% glycerol in a 20 µl volume. Sgk competitors and probes were prepared by annealing complimentary oligonucleotides spanning -78/-35 5'AGGCCG-AGTGGCTTCCTGGTCCCGCCTGCCCCGCCCCCTGGAG-GCTC 3', -78/-50 5'AGGCCGAGTGGCTTCCTGGTCCCGCCTGCCCC 3', -55/-35 5'AGGTGCCCCGCCCCCTGGAGGCTC 3', or -63/-43 wild type 5'TGTCCCGCCTGCCCCGCCCCCTG 3' of the sgk promoter. The -63/43 mutant oligonucleotide contains a mutated G/C box 5'-TGTCCCGCCTGCCCCGAACCCTG-3'. Sp1 competitor DNA was prepared by digestion of the pGAGC6 plasmid with XhoI and XbaI to isolate a 60-bp fragment containing six Sp1 sites. Unlabeled competitor DNA or oligonucleotides (100-fold molar excess) were added where indicated. Sp1 and Sp3 antibodies (1 µg) were preincubated with or without whole cell extract for 30 min at room temperature before addition of probe. In these experiments, the amount of poly(dI-dC) per reaction was reduced to 3.75 µg. Recombinant human Sp1 protein was diluted 1:10 in 5 µM ZnSO4, 50 mM KCl, 1 mM DTT, 12 mM HEPES (pH 7.0), 6 mM MgCl2, 0.05% NP-40, and 50% glycerol. Where indicated, diluted Sp1 (1 µl) was incubated in the presence of other reaction components with 1 µg BSA. Reactions were resolved by electrophoresis on 5% acrylamide, 0.5x TBE, 2.5% glycerol gels before drying and autoradiography.

Data Presentation
Representative experiments for Northern, Western, in situ hybridization, and EMSAs are included as figures. Data from cAMP, CAT, and luciferase assays were normalized and shown as the mean ± SEM. Each experiment was repeated at least three times.


    FOOTNOTES
 
Address requests for reprints to: JoAnne S. Richards, Department of Cell Biology, Baylor College of Medicine, Houston, Texas 77030.

This study was supported by NIH Grants CA-71514 (to G.L.F.) and HD-16272 (to J.S.R.).

Received for publication May 16, 1997. Revision received September 2, 1997. Accepted for publication September 18, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Webster MK, Goya L, Ge Y, Maiyar AC, Firestone GL 1993 Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13:2031–2040[Abstract/Free Full Text]
  2. Webster MK, Goya L, Firestone GL 1993 Immediate-early transcriptional regulation and rapid mRNA turnover of a putative serine/threonine kinase. J Biol Chem 268:11482–11485[Abstract/Free Full Text]
  3. Imaizumi K, Tsuda M, Wanaka A, Tohyama M, Takagi T 1994 Differential expression of sgk mRNA, a member of the ser/thr protein kinase gene family, in rat brain after CNS injury. Mol Brain Res 26:189–196[Medline]
  4. Simmons DL, Neel BG, Stevens R, Evett G, Erikson RL 1992 Identification of an early-growth-response gene encoding a novel putative protein kinase. Mol Cell Biol 12:4163–4169
  5. Donahue PJ, Alberts GF, Guo Y, Winkles JA 1995 Identification by targeted differential display of an immediate-early gene encoding a putative serine/threonine kinase. J Biol Chem 270:10351–10357[Abstract/Free Full Text]
  6. Li B, Ouyang B, Pan H, Reissmann PT, Slamon DJ, Arceci R, Lu L, Dai W 1996 prk, a cytokine-inducible human protein serine/threonine kinase whose expression appears to be down-regulated in lung carcinomas. J Biol Chem 271:19402–19408[Abstract/Free Full Text]
  7. Alliston TN, Richards JS Hormonal regulation of serum, glucocorticoid regulated kinase, sgk, in rat granulosa cells. Program of the 29th meeting of The Society for the Study of Reproduction, London, Ontario, Canada, 1996, p 98 (Abstract 166)
  8. Rao MC, Midgley Jr AR, Richards JS 1978 Hormonal regulation of ovarian cellular proliferation. Cell 14:71–78[CrossRef][Medline]
  9. Richards JS 1994 Hormonal control of gene expression in the ovary. Endocr Rev 15:725–751[Abstract/Free Full Text]
  10. Hirshfield AN 1985 Comparison of granulosa cell proliferation in small follicles of hypophysectomized, prepubertal and immature rats. Biol Reprod 32:979–987[Abstract]
  11. Sicinski P, Donaher JL, Geng Y, Parker SB, Gardner H, Park MY, Robker RL, Richards JS, McGinnis LK, Biggers JD, Eppig JJ, Bronson RT, Elledge SJ, Weinberg RA 1996 Cyclin D2 is an FSH-responsive gene involved in gonadal cell proliferation and oncogenesis. Nature 384:470–474[CrossRef][Medline]
  12. Hickey GJ, Chen S, Besman MJ, Shively JE, Hall PF, Gaddy-Kurten D, Richards JS 1988 Hormonal regulation, tissue distribution, and content of aromatase cytochrome P450 messenger ribonucleic acid and enzyme in rat ovarian follicles and corpora lutea. Endocrinology 122:1426–1436[Abstract/Free Full Text]
  13. Goldring NB, Durica JM, Lifka J, Hedin L, Ratoosh SL, Miller WL, Orly J 1987 Cholesterol side-chain cleavage P450 messenger ribonucleic acid: evidence for hormonal regulation in rat ovarian follicles and constitutive expression in corpora lutea. Endocrinology 120:1942–1950[Abstract/Free Full Text]
  14. Segaloff DL, Wang H, Richards JS 1990 Hormonal regulation of luteinizing hormone/chorionic gonadotropin receptor mRNA in rat ovarian cells during follicular development and luteinization. Mol Endocrinol 4:1856–1865[Abstract/Free Full Text]
  15. Leung PCK, Steele GL 1992 Intracellular signaling in the gonads. Endocr Rev 13:476–498[Abstract/Free Full Text]
  16. Habener JF, Miller CP, Vallejo M 1995 cAMP-dependent regulation of gene transcription by cAMP response element-binding protein and cAMP response element modulator. Vitam Horm 51:1–57[Medline]
  17. Hunter T, Karin M 1992 The regulation of transcription by phosphorylation. Cell 70:375–387[CrossRef][Medline]
  18. Gonzalez GA, Montminy MR 1989 Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59:675–680[CrossRef][Medline]
  19. Carlone DL, Richards JS 1996 Functional interaction, phosphorylation and levels of 3',5'-cyclic adenosine monophosphate-regulatory element binding protein and steroidogenic factor-1 mediate hormone-regulated and constitutive expression of aromatase in gonadal cells. Mol Endocrinol 11:292–304[Abstract/Free Full Text]
  20. Richards JS 1981 Maturation of ovarian follicles: actions and interactions of pituitary and ovarian hormones on follicular cell differentiation. Physiol Rev 90:51–89
  21. Fitzpatrick SL, Richards JS 1991 Regulation of cytochrome P450 aromatase messenger ribonucleic acid and activity by steroids and gonadotropins in rat granulosa cells. Endocrinology 129:1452–1462[Abstract/Free Full Text]
  22. Beelman CA, Parker R 1994 Differential effects of translational inhibition in cis and in trans on the decay of the unstable yeast MFA2 mRNA. J Biol Chem 269:9687–9692[Abstract/Free Full Text]
  23. Neish AS, Khachigian LM, Park A, Baichwal VR, Collins T 1995 Sp1 is a component of the cytokine-inducible enhancer in the promoter of vascular cell adhesion molecule-1. J Biol Chem 270:28903–28909[Abstract/Free Full Text]
  24. Kingsley C, Winoto A 1992 Cloning of GT box-binding proteins: a novel Sp1 multigene family regulating T-cell receptor gene expression. Mol Cell Biol 12:4251–4261[Abstract/Free Full Text]
  25. Biggs JR, Kudlow JE, Kraft AS 1996 The role of the transcription factor Sp1 in regulating the expression of the WAF1/CIP1 gene in U937 leukemic cells. J Biol Chem 271:901–906[Abstract/Free Full Text]
  26. Briggs MR, Kadonaga JT, Bell SP, Tjian R 1986 Purification and biochemical characterization of the promoter-specific transcription factor, Sp1. Science 234:47–52[Abstract/Free Full Text]
  27. Saffer JD, Jackson SP, Annarella MB 1991 Developmental expression of Sp1 in the mouse. Mol Cell Biol 11:2189–2199[Abstract/Free Full Text]
  28. Gaytan F, Morales C, Bellido C, Aguilar E, Sanchez-Criado JE 1996 Proliferative activity in the different compartments in cycling rats estimated by the 5-bromodeoxyuridine technique. Biol Reprod 54:1356–1365[Abstract]
  29. Hirshfield AN 1986 Patterns of (3H) thymidine incorporation differ in immature rats and mature, cycling rats. Biol Reprod 34:229–235[Abstract]
  30. Bortolussi M, Marini G, Reolon ML 1979 A histochem-ical study of the binding of 125I-labeled hCG to the rat ovary throughout the estrus cycle. Cell Tissue Res 197:213–226[Medline]
  31. Jones NC, Rigby PWJ, Ziff EB 1988 Trans-acting protein factors and the regulation of eukaryotic transcription: lessons from studies on DNA tumor viruses. Genes Dev 2:267–281[Free Full Text]
  32. Prowse DM, Bolgan L, Molnar A, Dotto GP 1997 Involvement of the Sp3 transcription factor in induction of p21Cip1/WAF1 in keratinocyte differentiation. J Biol Chem 272:1308–1314[Abstract/Free Full Text]
  33. Venepally P, Waterman MR 1995 Two Sp1-binding sites mediate cAMP-induced transcription of the bovine CYP11A gene through the protein kinase A signaling pathway. J Biol Chem 270:25402–25410[Abstract/Free Full Text]
  34. Chou S-J, Lai K-N, Chung B-C 1996 Characteri-zation of the upstream sequence of the human CYP11A1 gene for cell type-specific expression. J Biol Chem 271:22125–22129[Abstract/Free Full Text]
  35. Liu Z, Simpson ER 1997 Steroidogenic factor-1 and Sp1 are required for regulation of bovine CYP11A gene expression in bovine luteal cells and adrenal Y1 cells. Mol Endocrinol 11:127–137[Abstract/Free Full Text]
  36. Hu YL, Lei ZM, Rao ChV 1996 cis-acting elements and trans-acting proteins in the transcription of chorionic gonadotropin/luteinizing hormone receptor gene in human choriocarcinoma cells and placenta. Endocrinology 137:3897–3905[Abstract]
  37. Park-Sarge O-K, Sarge KD 1995 Cis-regulatory elements conferring cyclic 3', 5'-adenosine monophosphate responsiveness of the progesterone receptor gene in transfected rat granulosa cells. Endocrinology 136:5430–5437[Abstract]
  38. Leggett RW, Armstrong SA, Barry D, Mueller CR 1995 Sp1 is phosphorylated and its DNA binding activity down-regulated upon terminal differentiation of the liver. J Biol Chem 270:25879–25884[Abstract/Free Full Text]
  39. Chen LI, Nishinaka T, Kwan K, Kitabayashi I, Yokoyama K, Florence FY-H, Grünwald S, Chiu R 1994 The retinoblastoma gene product RB stimulates Sp1-mediated transcription by liberating Sp1 from a negative regulator. Mol Cell Biol 14:4380–4389[Abstract/Free Full Text]
  40. Shen WK, Kim HS, Tsai SY 1995 Stimulation of human insulin receptor gene expression by retinoblastoma gene product. J Biol Chem 270:20525–20529[Abstract/Free Full Text]
  41. Inagaki Y, Truter S, Tanaka S, Di Liberto M, Ramirez F 1995 Overlapping pathways mediate the opposing actions of tumor necrosis factor-{alpha} and transforming growth factor-ß on {alpha}2(I) collagen gene transcription. J Biol Chem 270:3353–3358[Abstract/Free Full Text]
  42. Sancéau J, Kaisho T, Hirano T, Weitzerbin J 1995 Triggering of the human interleukin-6 gene by interferon-{gamma} and tumor necrosis factor-{alpha} in monocytic cells involves cooperation between interferon regulatory factor-1, NFKB, and Sp1 transcription factors. J Biol Chem 270:27920–27931[Abstract/Free Full Text]
  43. Hagen G, Dennig J, Preib A, Beato M, Suske G 1995 Functional analyses of the transcription factor Sp4 reveal properties distinct from Sp1 and Sp3. J Biol Chem 270:24989–24994[Abstract/Free Full Text]
  44. Blau J, Xiao H, McCracken S, O’Hare P, Greenblatt J, Bentley D 1996 Three functional classes of transcriptional activation domain. Mol Cell Biol 16:2044–2055[Abstract]
  45. Gualberto A, Baldwin Jr AS 1995 p53 and Sp1 interact and cooperate in the tumor necrosis factor-induced transcriptional activation of the HIV-1 long terminal repeat. J Biol Chem 270:19680–19683[Abstract/Free Full Text]
  46. Look DC, Pelletier MR, Tidwell RM, Roswit WT, Holtzman MJ 1995 Stat1 depends on transcriptional synergy with Sp1. J Biol Chem 270:30264–30267[Abstract/Free Full Text]
  47. Merika M, Orkin SH 1995 Functional synergy and physical interactions of the erythroid transcription factor GATA-1 with the Krüppel family proteins Sp1 and EKLF. Mol Cell Biol 15:2437–2447[Abstract]
  48. Noti JD, Reinemann BC, Petrus MN 1996 Sp1 binds two sites in the CD11c promoter in vivo specifically in myeloid cells and cooperates with AP1 to activate transcription. Mol Cell Biol 16:2940–2950[Abstract]
  49. Perkins ND, Agranoff AB, Pascal E, Nabel GJ 1994 An interaction between the DNA-binding domains of RelA (p65) and Sp1 mediates human immunodeficiency virus gene activation. Mol Cell Biol 14:6570–6583[Abstract/Free Full Text]
  50. Porter W, Wang F, Wang W, Duan R, Safe S 1996 Role of estrogen receptor/Sp1 complexes in estrogen-induced heat shock protein 27 gene expression. Mol Endocrinol 10:1371–1378[Abstract/Free Full Text]
  51. Maiyar AC, Huang AJ, Phu PT, Cha HH, Firestone GL 1996 p53 stimulates promoter activity of the sgk serum/glucocorticoid inducible serine/threonine protein kinase gene in rodent mammary epithelial cells. J Biol Chem 271:12414–12422[Abstract/Free Full Text]
  52. Maiyar AC, Phu PT, Huang AJ, Firestone GL 1997 Repression of glucocorticoid receptor transactivation and DNA binding of a glucocorticoid response element within the serum/glucocorticoid-inducible protein kinase gene promoter by the p53 tumor suppressor protein. Mol Endocrinol 11:312–329[Abstract/Free Full Text]
  53. Stocklin E, Wissler M, Gouilleux F, Groner B 1996 Functional interactions between Stat5 and the glucocorticoid receptor. Nature 383:726–728[CrossRef][Medline]
  54. Ratoosh SL, Richards JS 1985 Regulation of the content and phosphorylation of RII by adenosine 3', 5'-monophosphate, follicle stimulating hormone, and estradiol in cultured granulosa cells. Endocrinology 117:917–927[Abstract/Free Full Text]
  55. Wilkensen DG 1993 In Situ Hybridization. In: Stern CD, Holland PWH (eds) Essential Developmental Biology, A Practical Approach. Oxford University Press, New York, pp 258–263
  56. Pelham HRB 1982 A regulatory upstream promoter element in the Drosophila Hsp70 heat shock gene. Cell 30:517–528[CrossRef][Medline]
  57. Feinberg A, Vogelstein B 1984 Technique for radiolabeling DNA restriction nuclease fragments to high specific activity. Anal Biochem 137:266–267[CrossRef][Medline]
  58. Sirois J, Richards JS 1992 Purification and characterization of a novel, distinct isoform of prostaglandin endoperoxide synthase induced by human chorionic gonadotropin in granulosa cells of rat preovulatory follicles. J Biol Chem 267:6382–6388[Abstract/Free Full Text]
  59. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  60. Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685[CrossRef][Medline]
  61. Richards JS, Bogovich K 1987 Effects of human chorionic gonadotropin and progesterone on follicular development in the immature rat. Endocrinology 111:1429–1438[Abstract/Free Full Text]
  62. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory Manual, ed. 2. Cold Spring Harbor Laboratory, Cold Spring, NY, pp 1.34–1.48
  63. Sirois J, Richards JS 1993 Transcriptional regulation of the rat prostaglandin endoperoxide synthase-2 gene in granulosa cells. J Biol Chem 268:21931–21938[Abstract/Free Full Text]
  64. Gorman CM, Moffat LF, Howard BH 1982 Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044–1051[Abstract/Free Full Text]
  65. Dajee M, Kazansky AV, Raught B, Hocke GM, Fey GH, Richards JS 1996 Prolactin induction of the {alpha}2-macroglobulin gene in rat ovarian granulosa cells: Stat 5 activation and binding to the interleukin-6 response element. Mol Endocrinol 10:171–184[Abstract/Free Full Text]
  66. Welte T, Garimorth K, Philipp S, Doppler W 1994 Prolactin-dependent activation of a tyrosine phosphorylated DNA binding factor in mouse mammary epithelial cells. Mol Endocrinol 8:1091–1102[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
H. Alam, J. Weck, E. Maizels, Y. Park, E. J. Lee, M. Ashcroft, and M. Hunzicker-Dunn
Role of the Phosphatidylinositol-3-Kinase and Extracellular Regulated Kinase Pathways in the Induction of Hypoxia-Inducible Factor (HIF)-1 Activity and the HIF-1 Target Vascular Endothelial Growth Factor in Ovarian Granulosa Cells in Response to Follicle-Stimulating Hormone
Endocrinology, February 1, 2009; 150(2): 915 - 928.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. B. Sherk, D. E. Frigo, C. G. Schnackenberg, J. D. Bray, N. J. Laping, W. Trizna, M. Hammond, J. R. Patterson, S. K. Thompson, D. Kazmin, et al.
Development of a Small-Molecule Serum- and Glucocorticoid-Regulated Kinase-1 Antagonist and Its Evaluation as a Prostate Cancer Therapeutic
Cancer Res., September 15, 2008; 68(18): 7475 - 7483.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
V. Sriraman, U. Eichenlaub-Ritter, J. W. Bartsch, A. Rittger, S. M. Mulders, and J. S. Richards
Regulated Expression of ADAM8 (a Disintegrin and Metalloprotease Domain 8) in the Mouse Ovary: Evidence for a Regulatory Role of Luteinizing Hormone, Progesterone Receptor, and Epidermal Growth Factor-Like Growth Factors
Biol Reprod, June 1, 2008; 78(6): 1038 - 1048.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Yamashita, I. Kawashima, Y. Yanai, M. Nishibori, J. S. Richards, and M. Shimada
Hormone-Induced Expression of Tumor Necrosis Factor {alpha}-Converting Enzyme/A Disintegrin and Metalloprotease-17 Impacts Porcine Cumulus Cell Oocyte Complex Expansion and Meiotic Maturation via Ligand Activation of the Epidermal Growth Factor Receptor
Endocrinology, December 1, 2007; 148(12): 6164 - 6175.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Shimada, Y. Yanai, T. Okazaki, Y. Yamashita, V. Sriraman, M. C. Wilson, and J. S. Richards
Synaptosomal-Associated Protein 25 Gene Expression Is Hormonally Regulated during Ovulation and Is Involved in Cytokine/Chemokine Exocytosis from Granulosa Cells
Mol. Endocrinol., October 1, 2007; 21(10): 2487 - 2502.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
F. Grahammer, G. Henke, C. Sandu, R. Rexhepaj, A. Hussain, B. Friedrich, T. Risler, M. Metzger, L. Just, T. Skutella, et al.
Intestinal function of gene-targeted mice lacking serum- and glucocorticoid-inducible kinase 1
Am J Physiol Gastrointest Liver Physiol, June 1, 2006; 290(6): G1114 - G1123.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. A. MacLean II, M. K. Rao, K. M.H. Doyle, J. S. Richards, and M. F. Wilkinson
Regulation of the Rhox5 Homeobox Gene in Primary Granulosa Cells: Preovulatory Expression and Dependence on SP1/SP3 and GABP
Biol Reprod, December 1, 2005; 73(6): 1126 - 1134.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. M. Ongeri, M. F. Verderame, and J. M. Hammond
Follicle-Stimulating Hormone Induction of Ovarian Insulin-Like Growth Factor-Binding Protein-3 Transcription Requires a TATA Box-Binding Protein and the Protein Kinase A and Phosphatidylinositol-3 Kinase Pathways
Mol. Endocrinol., July 1, 2005; 19(7): 1837 - 1848.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. M. H. Doyle, D. L. Russell, V. Sriraman, and J. S. Richards
Coordinate Transcription of the ADAMTS-1 Gene by Luteinizing Hormone and Progesterone Receptor
Mol. Endocrinol., October 1, 2004; 18(10): 2463 - 2478.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. A. Nechamen, R. M. Thomas, B. D. Cohen, G. Acevedo, P. I. Poulikakos, J. R. Testa, and J. A. Dias
Human Follicle-Stimulating Hormone (FSH) Receptor Interacts with the Adaptor Protein APPL1 in HEK 293 Cells: Potential Involvement of the PI3K Pathway in FSH Signaling
Biol Reprod, August 1, 2004; 71(2): 629 - 636.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Palmada, M. Dieter, A. Speil, C. Bohmer, A. F. Mack, H. J. Wagner, K. Klingel, R. Kandolf, H. Murer, J. Biber, et al.
Regulation of intestinal phosphate cotransporter NaPi IIb by ubiquitin ligase Nedd4-2 and by serum- and glucocorticoid-dependent kinase 1
Am J Physiol Gastrointest Liver Physiol, July 1, 2004; 287(1): G143 - G150.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. Sriraman and J. S. Richards
Cathepsin L Gene Expression and Promoter Activation in Rodent Granulosa Cells
Endocrinology, February 1, 2004; 145(2): 582 - 591.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
D. A. de la Rosa, T. Coric, N. Todorovic, D. Shao, T. Wang, and C. M Canessa
Distribution and regulation of expression of serum- and glucocorticoid-induced kinase-1 in the rat kidney
J. Physiol., September 1, 2003; 551(2): 455 - 466.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. E. Falender, R. Lanz, D. Malenfant, L. Belanger, and J. S. Richards
Differential Expression of Steroidogenic Factor-1 and FTF/LRH-1 in the Rodent Ovary
Endocrinology, August 1, 2003; 144(8): 3598 - 3610.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Ko, N. A. Grieshaber, I. Ji, and T. H. Ji
Follicle-Stimulating Hormone Suppresses Cytosolic 3,5,3'-Triiodothyronine-Binding Protein Messenger Ribonucleic Acid Expression in Rat Granulosa Cells
Endocrinology, June 1, 2003; 144(6): 2360 - 2367.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Yazawa, T. Mizutani, K. Yamada, H. Kawata, T. Sekiguchi, M. Yoshino, T. Kajitani, Z. Shou, and K. Miyamoto
Involvement of Cyclic Adenosine 5'-Monophosphate Response Element-Binding Protein, Steroidogenic Factor 1, and Dax-1 in the Regulation of Gonadotropin-Inducible Ovarian Transcription Factor 1 Gene Expression by Follicle-Stimulating Hormone in Ovarian Granulosa Cells
Endocrinology, May 1, 2003; 144(5): 1920 - 1930.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
C. Boehmer, V. Wilhelm, M. Palmada, S. Wallisch, G. Henke, H. Brinkmeier, P. Cohen, B. Pieske, and F. Lang
Serum and glucocorticoid inducible kinases in the regulation of the cardiac sodium channel SCN5A
Cardiovasc Res, March 15, 2003; 57(4): 1079 - 1084.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
V. Sriraman, S. C. Sharma, and J. S. Richards
Transactivation of the Progesterone Receptor Gene in Granulosa Cells: Evidence that Sp1/Sp3 Binding Sites in the Proximal Promoter Play a Key Role in Luteinizing Hormone Inducibility
Mol. Endocrinol., March 1, 2003; 17(3): 436 - 449.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. C. Maiyar, M. L.L. Leong, and G. L. Firestone
Importin-alpha Mediates the Regulated Nuclear Targeting of Serum- and Glucocorticoid-inducible Protein Kinase (Sgk) by Recognition of a Nuclear Localization Signal in the Kinase Central Domain
Mol. Biol. Cell, March 1, 2003; 14(3): 1221 - 1239.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Cottom, L. M. Salvador, E. T. Maizels, S. Reierstad, Y. Park, D. W. Carr, M. A. Davare, J. W. Hell, S. S. Palmer, P. Dent, et al.
Follicle-stimulating Hormone Activates Extracellular Signal-regulated Kinase but Not Extracellular Signal-regulated Kinase Kinase through a 100-kDa Phosphotyrosine Phosphatase
J. Biol. Chem., February 21, 2003; 278(9): 7167 - 7179.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. L. L. Leong, A. C. Maiyar, B. Kim, B. A. O'Keeffe, and G. L. Firestone
Expression of the Serum- and Glucocorticoid-inducible Protein Kinase, Sgk, Is a Cell Survival Response to Multiple Types of Environmental Stress Stimuli in Mammary Epithelial Cells
J. Biol. Chem., February 14, 2003; 278(8): 5871 - 5882.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. Reisinger, R. Kaufmann, and J. Gille
Increased Sp1 phosphorylation as a mechanism of hepatocyte growth factor (HGF/SF)-induced vascular endothelial growth factor (VEGF/VPF) transcription
J. Cell Sci., January 15, 2003; 116(2): 225 - 238.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. A. Grieshaber, C. Ko, S. S. Grieshaber, I. Ji, and T. H. Ji
Follicle-Stimulating Hormone-Responsive Cytoskeletal Genes in Rat Granulosa Cells: Class I {beta}-Tubulin, Tropomyosin-4, and Kinesin Heavy Chain
Endocrinology, January 1, 2003; 144(1): 29 - 39.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. J. Phillips, J. Bailey, S. C. Robson, and G. N. Europe-Finner
Differential Expression of the Adenylyl Cyclase-Stimulatory Guanosine Triphosphate-Binding Protein Gs{alpha} in the Human Myometrium during Pregnancy and Labor Involves Transcriptional Regulation by Cyclic Adenosine 3',5'-Monophosphate and Binding of Phosphorylated Nuclear Proteins to Multiple GC Boxes within the Promoter
J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5675 - 5685.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. K. Rao, S. Maiti, H. N. Ananthaswamy, and M. F. Wilkinson
A Highly Active Homeobox Gene Promoter Regulated by Ets and Sp1 Family Members in Normal Granulosa Cells and Diverse Tumor Cell Types
J. Biol. Chem., July 12, 2002; 277(29): 26036 - 26045.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S. Chu, S. Rushdi, E.T. Zumpe, P. Mamers, D.L. Healy, T. Jobling, H.G. Burger, and P.J. Fuller
FSH-regulated gene expression profiles in ovarian tumours and normal ovaries
Mol. Hum. Reprod., May 1, 2002; 8(5): 426 - 433.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. S. Richards, S. C. Sharma, A. E. Falender, and Y. H. Lo
Expression of FKHR, FKHRL1, and AFX Genes in the Rodent Ovary: Evidence for Regulation by IGF-I, Estrogen, and the Gonadotropins
Mol. Endocrinol., March 1, 2002; 16(3): 580 - 599.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. Shelly and R. Herrera
Activation of SGK1 by HGF, Rac1 and integrin-mediated cell adhesion in MDCK cells: PI-3K-dependent and -independent pathways
J. Cell Sci., January 5, 2002; 115(9): 1985 - 1993.
[Abstract] [Full Text] [PDF]


Home page
Recent Prog Horm ResHome page
J. S. Richards, D. L. Russell, S. Ochsner, M. Hsieh, K. H. Doyle, A. E. Falender, Y. K. Lo, and S. C. Sharma
Novel Signaling Pathways That Control Ovarian Follicular Development, Ovulation, and Luteinization
Recent Prog. Horm. Res., January 1, 2002; 57(1): 195 - 220.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
F. Lang and P. Cohen
Regulation and Physiological Roles of Serum- and Glucocorticoid-Induced Protein Kinase Isoforms
Sci. Signal., November 13, 2001; 2001(108): re17 - re17.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. M. Salvador, Y. Park, J. Cottom, E. T. Maizels, J. C. R. Jones, R. V. Schillace, D. W. Carr, P. Cheung, C. D. Allis, J. L. Jameson, et al.
Follicle-stimulating Hormone Stimulates Protein Kinase A-mediated Histone H3 Phosphorylation and Acetylation Leading to Select Gene Activation in Ovarian Granulosa Cells
J. Biol. Chem., October 19, 2001; 276(43): 40146 - 40155.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. H. Burns, C. Yan, T. R. Kumar, and M. M. Matzuk
Analysis of Ovarian Gene Expression in Follicle-Stimulating Hormone {beta} Knockout Mice
Endocrinology, July 1, 2001; 142(7): 2742 - 2751.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Brunet, J. Park, H. Tran, L. S. Hu, B. A. Hemmings, and M. E. Greenberg
Protein Kinase SGK Mediates Survival Signals by Phosphorylating the Forkhead Transcription Factor FKHRL1 (FOXO3a)
Mol. Cell. Biol., February 1, 2001; 21(3): 952 - 965.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
J. S. Richards
New Signaling Pathways for Hormones and Cyclic Adenosine 3',5'-Monophosphate Action in Endocrine Cells
Mol. Endocrinol., February 1, 2001; 15(2): 209 - 218.
[Abstract] [Full Text]


Home page
Reproductive SciencesHome page
J. S. Richards
Graafian Follicle Function and Luteinization in Nonprimates
Reproductive Sciences, January 1, 2001; 8(1_suppl): S21 - S23.
[Abstract] [PDF]


Home page
EndocrinologyHome page
J. Y. Wu, I. J. Gonzalez-Robayna, J. S. Richards, and A. R. Means
Female Fertility Is Reduced in Mice Lacking Ca2+/Calmodulin-Dependent Protein Kinase IV
Endocrinology, December 1, 2000; 141(12): 4777 - 4783.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
I. J. Gonzalez-Robayna, A. E. Falender, S. Ochsner, G. L. Firestone, and J. S. Richards
Follicle-Stimulating Hormone (FSH) Stimulates Phosphorylation and Activation of Protein Kinase B (PKB/Akt) and Serum and Glucocorticoid-Induced Kinase (Sgk): Evidence for A Kinase-Independent Signaling by FSH in Granulosa Cells
Mol. Endocrinol., August 1, 2000; 14(8): 1283 - 1300.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
T. N. Alliston, I. J. Gonzalez-Robayna, P. Buse, G. L. Firestone, and J. S. Richards
Expression and Localization of Serum/Glucocorticoid-Induced Kinase in the Rat Ovary: Relation to Follicular Growth and Differentiation
Endocrinology, January 1, 2000; 141(1): 385 - 395.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. M. KUMAR, D. P. BROOKS, B. A. OLSON, and N. J. LAPING
Sgk, a Putative Serine/Threonine Kinase, Is Differentially Expressed in the Kidney of Diabetic Mice and Humans
J. Am. Soc. Nephrol., December 1, 1999; 10(12): 2488 - 2494.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
I. J. Gonzalez-Robayna, T. N. Alliston, P. Buse, G. L. Firestone, and J. S. Richards
Functional and Subcellular Changes in the A-Kinase-Signaling Pathway: Relation to Aromatase and Sgk Expression during the Transition of Granulosa Cells to Luteal Cells
Mol. Endocrinol., August 1, 1999; 13(8): 1318 - 1337.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
R. Ahlgren, G. Suske, M. R. Waterman, and J. Lund
Role of Sp1 in cAMP-dependent Transcriptional Regulation of the Bovine CYP11A Gene
J. Biol. Chem., July 2, 1999; 274(27): 19422 - 19428.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Naray-Fejes-Toth, C. Canessa, E. S. Cleaveland, G. Aldrich, and G. Fejes-Toth
sgk Is an Aldosterone-induced Kinase in the Renal Collecting Duct. EFFECTS ON EPITHELIAL Na+ CHANNELS
J. Biol. Chem., June 11, 1999; 274(24): 16973 - 16978.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Chen, H. Shi, X. Liu, and D. L. Segaloff
Multiple Elements and Protein Factors Coordinate the Basal and Cyclic Adenosine 3',5'-Monophosphate-Induced Transcription of the Lutropin Receptor Gene in Rat Granulosa Cells
Endocrinology, May 1, 1999; 140(5): 2100 - 2109.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
P. Buse, S. H. Tran, E. Luther, P. T. Phu, G. W. Aponte, and G. L. Firestone
Cell Cycle and Hormonal Control of Nuclear-Cytoplasmic Localization of the Serum- and Glucocorticoid-inducible Protein Kinase, Sgk, in Mammary Tumor Cells. A NOVEL CONVERGENCE POINT OF ANTI-PROLIFERATIVE AND PROLIFERATIVE CELL SIGNALING PATHWAYS
J. Biol. Chem., March 12, 1999; 274(11): 7253 - 7263.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. R. Black, D. Jensen, S.-Y. Lin, and J. C. Azizkhan
Growth/Cell Cycle Regulation of Sp1 Phosphorylation
J. Biol. Chem., January 15, 1999; 274(3): 1207 - 1215.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. W. Clemens, R. L. Robker, W. L. Kraus, B. S. Katzenellenbogen, and J. S. Richards
Hormone Induction of Progesterone Receptor (PR) Messenger Ribonucleic Acid and Activation of PR Promoter Regions in Ovarian Granulosa Cells: Evidence for a Role of Cyclic Adenosine 3',5'-Monophosphate but Not Estradiol
Mol. Endocrinol., August 1, 1998; 12(8): 1201 - 1214.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
T. Mizutani, K. Yamada, T. Minegishi, and K. Miyamoto
Transcriptional Regulation of Rat Scavenger Receptor Class B Type I Gene
J. Biol. Chem., July 14, 2000; 275(29): 22512 - 22519.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. M. Bell, M. L. L. Leong, B. Kim, E. Wang, J. Park, B. A. Hemmings, and G. L. Firestone
Hyperosmotic Stress Stimulates Promoter Activity and Regulates Cellular Utilization of the Serum- and Glucocorticoid-inducible Protein Kinase (Sgk) by a p38 MAPK-dependent Pathway
J. Biol. Chem., August 11, 2000; 275(33): 25262 - 25272.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Perrotti, R. A. He, S. A. Phillips, C. R. Haft, and S. I. Taylor
Activation of Serum- and Glucocorticoid-induced Protein Kinase (Sgk) by Cyclic AMP and Insulin
J. Biol. Chem., March 16, 2001; 276(12): 9406 - 9412.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. A. Mikosz, D. R. Brickley, M. S. Sharkey, T. W. Moran, and S. D. Conzen
Glucocorticoid Receptor-mediated Protection from Apoptosis Is Associated with Induction of the Serine/Threonine Survival Kinase Gene, sgk-1
J. Biol. Chem., May 11, 2001; 276(20): 16649 - 16654.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. L. Robker, D. L. Russell, L. L. Espey, J. P. Lydon, B. W. O'Malley, and J. S. Richards
Progesterone-regulated genes in the ovulation process: ADAMTS-1 and cathepsin L proteases
PNAS, April 25, 2000; 97(9): 4689 - 4694.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alliston, T. N.
Right arrow Articles by Richards, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alliston, T. N.
Right arrow Articles by Richards, J. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals