help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, Z.
Right arrow Articles by Simpson, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, Z.
Right arrow Articles by Simpson, E. R.
Molecular Endocrinology 11 (2): 127-137
Copyright © 1997 by The Endocrine Society

Steroidogenic Factor 1 (SF-1) and SP1 Are Required for Regulation of Bovine CYP11A Gene Expression in Bovine Luteal Cells and Adrenal Y1 Cells

Zheng Liu and Evan R. Simpson

Cecil H. and Ida Green Center for Reproductive Biology Sciences, and the Departments of Obstetrics/Gynecology and Biochemistry The University of Texas Southwestern Medical Center Dallas, Texas 75235-9051


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cholesterol side-chain cleavage cytochrome P450 (CYP11A; P450scc) gene expression is regulated by gonadotropins via cAMP in the ovary and by ACTH via cAMP in adrenal cortical cells. Previously, we have characterized a response element located at -118 to -101 bp in the 5'-flanking region of the bovine P450scc gene required for cAMP-stimulated transcription in both mouse adrenocortical Y1 cells and bovine ovarian cells in primary culture. It was shown that this region contains a binding site for the transcription factor Sp1. Deletion of this sequence abolished cAMP-stimulated transcription in both Y1 cells and bovine ovarian luteal cells. Another sequence element located at -57 to -32 bp upstream from the transcription initiation site, which is highly conserved in CYP11A of other species, contains the motif TAGCCTTG, similar to the consensus binding site of steroidogenic factor-1, SF-1 (or Ad4-BP), but in the inverted orientation. In the present study, gel shift analysis using nuclear extracts of either Y1 cells or bovine luteal cells demonstrated that the sequence between -57 and -32 bp bound SF-1. A mutation of the SF-1-binding site that abolished binding of the nuclear protein to DNA reduced markedly the basal transcription of the reporter gene as well as the responsiveness to cAMP, when the mutated fragments containing the region from -186 to +12 bp were cloned into a luciferase construct and transfected into mouse adrenal Y1 cells and bovine luteal cells. The role of SF-1 in P450scc transcription was further confirmed by transactivation of the -186/+12Luc construct employing an SF-1 expression vector after transfection into nonsteroidogenic COS-1 cells. In addition, results obtained employing a double mutation of the Sp1- and SF-1-binding sites, and from a construct containing both Sp1 and SF-1 elements upstream of the CYP11A TATA box, indicated that Sp1 and SF-1 function cooperatively in the transactivation of the bovine CYP11A promoter in both bovine luteal cells and Y1 cells. Finally, a mammalian two-hybrid system was employed to demonstrate that Sp1 and SF-1 can associate in vivo. These results establish that basal and cAMP-stimulated activity of the bovine P450scc promoter in both Y1 cells and bovine luteal cells requires the combined action of at least two transcription factors, Sp1 and SF-1.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The biosynthesis of steroid hormones in the gonads and the adrenal cortex involves at least five distinct steroid hydroxylases that are members of the cytochrome P450 gene superfamily (1). In all steroidogenic pathways the initial and the rate-limiting reaction is the cleavage of the side chain of cholesterol leading to the production of pregnenolone, a mitochondrial reaction catalyzed by cholesterol side-chain cleavage cytochrome P450 (P450scc, the product of the CYP11A gene) (2). During the bovine ovarian cycle, P450scc activity is regulated in a highly coordinated fashion by the gonadotropin, LH, which appears to exert its hormonal effects via cAMP, an activator of protein kinase A (3). In the bovine adrenal cortex, the transcription of this gene is regulated by the peptide hormone ACTH via cAMP (4). Therefore, cAMP is the principal mediator of the hormonal induction of P450scc expression in gonadal and adrenocortical cells.

Studies of the 5'-flanking sequence of CYP11A genes from different species have identified several putative cis-acting elements required for cAMP-dependent transcription, including Sp1, AP-2, cAMP/AP-1, and SF-1 response elements (5, 6, 7, 8, 9, 10, 11). However, no common cis-acting DNA element(s) has been implicated to mediate the cAMP-responsive activity of the P450scc promoter among different species. In previous studies (5, 6, 12), we have reported that a region between -183 and -83 bp of the 5'-flanking sequence of the bovine CYP11A gene is capable of conferring cAMP-dependent regulation of a reporter gene, upon transfection into mouse adrenal Y1 tumor cells, bovine adrenocortical cells, and bovine luteal cells. Further characterization of this region (7, 12) has indicated that a cAMP-response sequence is located within -118 and -100 bp, using transiently transfected mouse Y1 cells and bovine ovarian luteal cells. This element is highly conserved among different species and is similar to the consensus Sp1-binding sequence, except that an ‘A’ replaces the core ‘C’. Later, it was shown that a second sequence element located at -70 to -50 bp is similar to the consensus Sp1-binding site, and that the transcription factor Sp1 mediates cAMP-dependent transcription of a reporter gene through binding to these sequences in Y1 cells (13). However, the mechanism by which Sp1 mediates responsiveness to cAMP is still unknown.

When sequences in the proximal promoter regions of CYP11A from different species are compared, another region between -57 and -32 bp is highly conserved among the bovine, rat, mouse, and human CYP11A genes (13, 14). This region contains the motif TAGCCTTG, similar to the consensus binding site of steroidogenic factor-1, SF-1 (or Ad4-BP), but in the inverted orientation. It was shown that the corresponding region in the rat P450scc gene was required for cAMP-dependent transcription of a reporter gene in rat granulosa cells (9). In the present study, we have investigated the role of this SF-1-like sequence in basal and cAMP-stimulated transcription of the bovine CYP11A gene. We have found that SF-1 binds specifically to the sequence within -57 and -32 bp in the bovine P450scc promoter. Mutations in the TAGCCTTG region abolished binding of SF-1 and markedly reduced both basal and cAMP-dependent transcription in mouse Y1 cells and bovine ovarian luteal cells. The role of this element appears to be mediated by SF-1, as shown by cotransfection experiments in nonsteroidogenic COS-1 cells. In addition, double mutation of both Sp1 and SF-1-like sequences eliminates both basal and cAMP-stimulated transcription. Furthermore, a construct containing both the Sp1 and SF-1 elements shows simultaneous binding of both transcription factors and also exhibits an increase in luciferase activity in response to protein kinase A (PKA). Finally, we provide evidence that Sp1 and SF-1 proteins associate in vivo. These results suggest that the combined action of Sp1 and SF-1 is required for both basal and cAMP-dependent transcription of the bovine CYP11A gene.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Oligonucleotide -57/-32 bp Binding Protein
Examination of the proximal promoter region of the bovine CYP11A gene (Fig. 1Go) showed potential binding sites for the general transcription factor Sp1 (5, 6, 12, 13, 23) and steroidogenic factor-1, SF-1. The region between -57 and -32 bp, which is highly conserved among different species, contains the motif TAGCCTTG, similar to the consensus SF-1-binding sequence, but in the inverted orientation. In the present study, we examined the role of the SF-1-like element in the regulation of the bovine CYP11A promoter activity.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. The Bovine CYP11A Proximal Promoter and 5'-Untranslated Region

The GA box is encircled by a rectangle, the hexameric AGGTCA motif is in bold type, the TATA box is underlined, and the transcriptional start site is indicated by an arrow. The asterisks indicate base changes in the wild type sequence that were introduced in the mutated sequences.

 
The protein that binds to the -57/-32 bp sequence was investigated by gel mobility shift assays. As shown in Fig. 2Go, the -57/-32 bp probe formed a single protein-DNA complex in the presence of either bovine luteal cell nuclear extracts (Fig. 2AGo), or Y1 nuclear extracts (Fig. 2CGo). Formation of this complex was efficiently competed by the unlabeled -57/-32 bp sequence and by an oligonucleotide containing the consensus SF-1 sequence. It also appeared that the same protein-DNA complex was formed from cells whether unstimulated or stimulated by treatment with forskolin, an activator of adenylate cyclase. As shown in Fig. 2BGo, the mutant oligonucleotide -57/-32M, with mutations of GG (CAAGGCTA to CAAtaCTA) within the putative SF-1-binding sequence, lost competition with the wild type oligonucleotides for the formation of the complex. Consistent with this result, no complex was formed in the presence of Y1 nuclear extracts when the -57/-32M oligonucleotide was used as a probe in gel shift assays (Fig. 2CGo). These data indicate that these two bases are important for nuclear protein binding.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. Mobility Shift Analysis Employing Nuclear Extracts from Bovine Luteal Cells or Y1 Cells

A, DNA-protein complexes, formed by the labeled wild type -57/-32 bp fragment in the presence of bovine luteal cell nuclear proteins (10 µg) or COS-1 cell nuclear proteins (10 µg) were analyzed by gel mobility shift assay, as described in Materials and Methods; 500-fold molar excess of unlabeled -57/-32 bp fragment and consensus SF-1 sequence were used as competitors. Nuclear extracts were derived from bovine luteal cells maintained in the absence (-) or presence (+) of 25 µM forskolin for 12 h. B, Labeled -57/-32 bp fragment was bound to 20 µg of bovine luteal cell nuclear proteins, with a 50-fold (lanes 2 and 4) or 100-fold (lanes 3 and 5) molar excess of unlabeled -57/-32 bp (lanes 2 and 3) or mutant oligonucleotide -57/-32M bp (lanes 4 and 5). C, Labeled wild type -57/-32 bp fragment and mutant -57/-32M bp fragment were used as probes in the presence of 2 µg of Y1 nuclear extracts. The nonradiolabeled probes and the consensus SF-1 oligonucleotides were used as competitors. Nuclear extracts were derived from cells maintained in the absence (-) or presence (+) of 25 µM forskolin for 24 h. D, Labeled -57/-32 bp oligonucleotide were incubated with 5 µg of Y1 nuclear proteins or 20 µg of bovine luteal cell nuclear proteins. Before incubation with labeled probe, some of the reactions were first incubated with 1 µg of either bovine SF-1 polyclonal antibody or preimmune serum. The arrowhead indicates the DNA-protein complex formed.

 
The nature of this binding protein was further investigated by antibody supershift experiments. As shown in Fig. 2DGo, the single complex formed between the -57/-32 bp oligonucleotide and Y1 cell nuclear extract protein(s) was displaced, when the extract was incubated with a specific antibody against bovine SF-1, but not with the preimmune serum. This antibody likewise displaced the binding of the bovine luteal cell nuclear protein(s) from the -57/-32 bp oligonucleotide instead of forming an antibody-protein-DNA complex. Thus, the protein from either Y1 or bovine luteal cells that specifically binds to the -57/-32 bp sequence was SF-1 or shared similar binding specificity and antigenicity with SF-1. However, when nuclear extracts from nonsteroidogenic COS-1 cells were incubated with the -57/-32 bp fragment, the binding pattern was different from that observed in the presence of either bovine luteal cell or Y1 cell nuclear extracts (Fig. 2AGo). The formation of these complexes was not competed by excess of unlabeled -57/-32 bp, indicating that they are nonspecific. Since SF-1 mRNA was only detected in steroidogenic tissues, such as testis, adipose tissue, brain, adrenal cortex, and ovary (24, 25), the difference was presumably due to the absence of SF-1 in COS-1 cells, which was confirmed by Western blot analysis (data not shown).

Activation of the Promoter Function of the CYP11A Gene by SF-1
To investigate the role of SF-1 in the activation of the bovine CYP11A promoter, we carried out a transient transfection experiment by expressing SF-1 in nonsteroidogenic COS-1 cells, which lack SF-1 as shown in Fig. 2AGo. The expression vector for SF-1 was cotransfected into COS-1 cells together with the P450scc promoter constructs containing the 5'-flanking sequence of the bovine CYP11A gene fused upstream of the luciferase reporter gene. As illustrated in Fig. 3Go, transcriptional activity of the -186/+12Luc and -101/+12Luc reporter plasmids is about 3- and 2-fold higher, respectively, in the cells cotransfected with SF-1 than in those cotransfected with only vector plasmid DNA. To examine directly whether SF-1 activates the bovine P450scc promoter via the -57/-32 bp sequence, a mutant -186/+12 bp fragment containing the mutation (GG to TA) within the sequence between -57 bp and -32 bp, similar to that used in the gel mobility shift analysis shown in Fig. 2Go, was inserted into the pGL3basic vector and transfected together with the SF-1 expression vector into the COS-1 cells. As shown in Fig. 3Go, expression of SF-1 had no effect on the transcription of the mutant -186/+12SF1mLuc construct. These data indicate that SF-1 is necessary for optimal promoter activity of the bovine CYP11A gene via binding to the -57/-32 bp sequence.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Transcriptional Activation of Bovine CYP11A Gene Constructs by SF-1

COS-1 cells were cotransfected with 0.5 µg of CYP11A promoter constructs, 0.1 µg of internal reference plasmid pCMVLac, and 0.5 µg of RSV/SF-1 (closed bars) or 0.5 µg of pRC/RSV (open bars) using the lipofectamine method. After transfection for 48 h, the cell lysates were subjected to the luciferase assay. Values for absolute light units range from 10,000 to 100,000. The values of luciferase activity were normalized to ß-galactosidase activity. The results are shown as ± SEM for four independent experiments.

 
Transient Transfection Analysis of the Wild Type and Mutant CYP11A Reporter Gene Plasmids
The initial deletion analysis of the 5'-flanking region of bovine CYP11A showed that the -186/+12 bp chloramphenicol acetyltransferase (CAT) constructs containing the homologous CYP11A promoter exhibited the highest fold induction of promoter activity upon forskolin treatment in both bovine luteal cells (5) and Y1 cells (6). The CAT construct containing -101 bp to +12 bp of the P450scc 5'-flanking region was not expressed at levels higher than the empty CAT construct alone in either bovine luteal cells or Y1 cells, but the -101/+12 bp fragment still exhibited the ability to promote an increase in cAMP-dependent transcription in Y1 cells and bovine luteal cells. This suggested that more than one sequence, in addition to the element at -118 to -101 bp, might be required for optimal bovine P450scc promoter activity.

To test whether the -57/-32 bp sequence contains another element involved in both basal and cAMP-stimulated expression, luciferase reporter plasmids containing the wild type and mutant -186/+12 bp sequences were transfected into bovine luteal cells in primary culture. As illustrated in Fig. 4AGo, forskolin treatment resulted in a 4-fold increase over control levels of luciferase activity with the -186/+12Luc wild type plasmid. A promoter construct containing the mutation between -57 and -32 bp, namely -186/+12SF1mLuc, showed markedly decreased basal and forskolin-induced luciferase activity compared with -186/+12Luc. Similar results were also obtained when the wild type and mutant -186/-32 bp sequences were inserted into the OVEC-ß-globin reporter gene vector containing the heterologous minimal promoter of ß-globin gene and transfected into bovine luteal cells (Fig. 4BGo).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Analysis of Wild Type and Mutant Bovine CYP11A Promoter Activity in Bovine Luteal Cells

A, Cells were transfected with 75 µg of various CYP11A promoter constructs and 4 µg of internal reference plasmid pCMVLac. Thereafter, the cells were starved for 12 h and treated with (hatched bars) or without (open bars) 25 µM forskolin for 12 h. B, One hundred micrograms of the OVEC constructs as indicated and 2 µg of internal reference vector OVEC-REF were cotransfected into bovine luteal cells. Thereafter the cells were treated with (+) or without (-) 25 µM forskolin for 9 h. RNA was prepared and each sample (10 µg) was analyzed by S1 nuclease protection assay after hybridization using a 32P-labeled 93 bp ß-globin probe (6) followed by electrophoresis and autoradiography. The bands due to the reference OVEC-REF construct indicate the transfection efficiencies of each experiment. C.I., Correctly initiated transcripts; REF., transcripts of OVEC-REF. The data shown are from one of two independent experiments.

 
These results were further corroborated by cotransfection of the PKA catalytic subunit into Y1 cells (Fig. 5Go). The -186/+12Luc construct showed a 4-fold increase in luciferase activity when the free catalytic subunit of PKA was overexpressed in these cells. However, expression of the construct -186/+12SF1mLuc, which has mutations in the -57/-32 bp sequence and cannot bind SF-1, resulted in a marked diminution of basal transcriptional activity as well as activity in response to exogenously supplied PKA catalytic subunit. Thus, the mutation in the -57/-32 bp sequence that eliminated the formation of DNA-protein complexes also markedly reduced basal and cAMP-induced transcription in both bovine luteal cells and Y1 cells.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 5. Analysis of Wild Type and Mutant Bovine CYP11A Promoter Activity in Y1 Mouse Adrenal Tumor Cells

Y1 cells were cotransfected with 1 µg of CYP11A promoter constructs, 0.25 µg of pCMVLac, and 0.5 µg of the wild type (hatched bars) or mutated (open bars) catalytic subunit of PKA expression vectors. The results are shown as ± SEM for three independent experiments.

 
Previous studies (7, 12) have shown that the sequence located at -118/-101 bp binds the transcription factor Sp1 and supports both basal and cAMP-dependent transcription upon transfection of reporter gene constructs containing the 5'-flanking region of the bovine CYP11A gene linked to the heterologous minimal promoter of the ß-globin gene into bovine luteal cells and Y1 cells. To further confirm the role of this -118/-101 bp sequence in basal and cAMP-dependent transcription, we used the native CYP11A promoter in the transfection experiments employing the luciferase reporter gene. As illustrated in Fig. 4AGo, in bovine luteal cells, the -186/+12Sp1 mLuc construct containing the mutation (GG to CC) between -118 and -101 bp of the Sp1-binding site showed a marked decrease in both basal and forskolin-induced luciferase activity compared with the wild type -186/+12Luc plasmid. In Y1 cells (Fig. 5Go), this mutation also decreased both basal and cAMP-dependent luciferase activity, but to a lesser extent than in luteal cells.

The effect of this mutation (GG to CC) within the -118/-101 bp sequence was further examined employing gel mobility shift assay (Fig. 6Go). Use of the wild type -118/-101 bp sequence as a probe resulted in complexes A and B in the presence of bovine luteal cell (Fig. 6AGo) or Y1 cell nuclear extracts (Fig. 6BGo), typical of Sp1 binding in those cells (12). A supershift complex was also formed when nuclear extracts from either bovine luteal cells or Y1 cells were incubated with the wild type -118/-101 bp sequence in the presence of Sp1 antibody. Formation of two complexes was efficiently competed by the unlabeled -118/-101 bp sequence, the -111/-101 bp sequence, and the consensus Sp1 oligonucleotide, but not by the mutant oligonucleotide, -118/-95M (TGGGAGGAGCT to TGccAGGAGCT). Consistent with the gel competition results, when the -111/-101 bp sequence was used as a probe, a binding pattern similar to that observed with the -118/-101 bp was observed (Fig. 6BGo). Upon employing the -118/-95M sequence as a probe, no DNA-protein complex was formed, indicating that the mutation abolished nuclear protein binding. Thus, these results confirm that Sp1 binds to the region from -111 bp to -101 bp and that the mutation within this region eliminated the formation of DNA-protein complexes and markedly reduced the response to cAMP and PKA in bovine luteal cells and Y1 cells, employing the homologous promoter.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 6. Gel Mobility Analysis of Binding of Bovine Luteal Cell (A) or Y1 Cell (B) Nuclear Proteins to the Different Bovine CYP11A (Wild Type or Mutated) -118/-101 bp Sequences

A, The bovine luteal cell nuclear extracts were incubated with the labeled -118/-101 bp fragment as described in the legend of Fig. 2Go. The unlabeled -118/-101 bp, -111/-101 bp, the consensus Sp1 oligonucleotide, and CYP11A mutant oligonucleotides (-118/-95M) were used as competitors, respectively. After incubation with labeled probe, some of the reactions were incubated with 1 µg of anti-Sp1 antibody. Nuclear extracts were derived from cells maintained in the absence (-) or presence (+) of 25 µM forskolin for 12 h. B, The nuclear extracts from Y1 cells were incubated with the labeled -118/-101 bp, -111/-101 bp, or mutant -118/-95M sequence, respectively. The nonradiolabeled sequences and the consensus Sp1 oligonucleotide were used as competitors. Supershift assays were conducted as described above. P, Probe; E, extract. The arrows indicate the positions of two DNA-protein complexes A and B.

 
As anticipated from these findings, when the -186/+12 bp fragment containing mutations within both the -111/-101 bp and the -57/-32 bp sequence was inserted into the luciferase vector and transfected into either bovine luteal cells or Y1 cells (Figs. 4Go and 5Go), the double mutation decreased significantly both basal and cAMP-dependent transcription compared with either -186/+12SF1mLuc or -186/+12Sp1mLuc alone. Although the decrease of luciferase activity in bovine luteal cells is less than in Y1 cells, the luciferase activity of the double mutation was comparable to that of the empty vector (pGL3basic) in both cell types. Therefore, optimal bovine CYP11A promoter activity requires both the Sp1- and SF-1-binding sites.

To further characterize the functional relationship between SF-1 and Sp1 elements, a -118/+12{Delta}52Luc construct, which contains the Sp1 element adjacent to the SF-1 site upstream of the endogenous CYP11A TATA box, was created and transfected into Y1 cells. As shown in Fig. 7AGo, this construct exhibited about 4-fold induction in luciferase activity in the presence of overexpressed free catalytic subunit of PKA. Its fold-induction is comparable to that of the -118/+12Luc construct with the native P450scc promoter region from -118 to +12 bp (5-fold). It is known that the region from -118 to +12 bp of the P450scc promoter is required for cAMP responsiveness (7, 12, 13), and the results from Fig. 7AGo suggest that Sp1 and SF-1 are both necessary for this response to cAMP. To investigate whether Sp1 could interact with SF-1, gel mobility shift assay was performed with the probes derived from the -118/+12{Delta}52Luc plasmid. When incubated with Y1 cell nuclear extracts (Fig. 7BGo), in addition to two complexes due to Sp1 and one complex due to SF-1, a new complex was detected. This slower mobility complex was competed by an excess of the -118/-101 bp sequence, the consensus Sp1 element, the -57/-32 bp sequence, and the consensus SF-1 sequence. It was also displaced partially by incubation with anti-Sp1 antibody or totally by the presence of SF-1 antibody. These data suggest that the complex contains both transcription factors. Consistent with this, previous results from DNase I footprint analysis of the bovine CYP11A 5'-flanking sequence have shown that a broad region from -114 to -91 bp and a short sequence at -49 to -33 bp within the fragment from -186 to +12 bp are protected by increasing amounts of Y1 nuclear proteins (7).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 7. Analysis of the Functional Interaction between Sp1 and SF-1 in Y1 Mouse Adrenal Tumor Cells

A, Y1 cells were cotransfected with 1 µg of CYP11A promoter constructs, 0.25 µg of pCMVLac, and 0.5 µg of the wild type (hatched bars) or mutated (open bars) catalytic subunit of PKA expression vectors. Transfections were conducted in duplicate. Values for absolute light units range from 10,000 to 100,000. The results are shown as ± SEM for five independent experiments. B, The Y1 cell nuclear extracts (25 µg) were incubated with the labeled -114/-35{Delta}52 bp fragment as described in the legend of Fig. 2Go. The unlabeled -114/-35{Delta}52 bp, -118/-101 bp, -57/-32 bp, the consensus Sp1 and SF-1 oligonucleotides were used as competitors, respectively. One microgram of either anti-Sp1 antibody or bovine SF-1 polyclonal antibody was added for the supershift assays. DNA-protein complexes were analyzed by electrophoresis on a native 5% polyacrylamide gel. The relevant Sp1 and SF-1 complexes are indicated. The position of the free probe is also indicated.

 
Two-Hybrid Analysis of Sp1 and SF-1 Interactions in Y1 and COS-1 Cells
To determine whether the functional synergism between Sp1 and SF-1 observed above involves direct protein-protein interaction, we applied the mammalian two-hybrid system, a method to detect in vivo protein-protein interactions, based on the functional reconstitution of the chimeric transcription factor GAL4-VP16 (26, 27). This fusion protein, which contains both the DNA-binding domain of the yeast GAL4 and the transactivation domain of the herpesvirus VP16 protein, strongly activates transcription of reporter genes downstream of the GAL4 sites in mammalian cells (28, 29). Expression vectors were constructed that encode the C-terminal 696 amino acids of Sp1 or the full-length sequence of SF-1 fused to either the GAL4 DNA-binding domain or the VP16 transactivation domain. These hybrid polypeptides should not activate the reporter gene on their own, because they lack either a transactivation domain (GAL4-X) or a proper DNA-binding domain (VP16-Y). However, if Sp1 and SF-1 interact stably in vivo, the protein-protein interaction will reconstitute a functional transcription factor, and expression of the reporter gene regulated by GAL4 would be detected.

The GAL4-Sp1 and VP16-SF-1 expression vectors were transfected singly or pairwise into Y1 cells along with G5Luc, a GAL4-responsive reporter plasmid that contains five GAL4-binding sites upstream of the luciferase gene (19). It has been shown that the GAL-Sp1 fusion protein can activate transcription in a GAL4 binding site-dependent manner (30). While optimal GAL4-Sp1 activation is achieved in Y1 and CV-1 cells with microgram quantities of the activator gene (Ref. 30 and data not shown), we used smaller quantities to optimize for activation by VP16-SF-1. As illustrated in Fig. 8AGo, expression of the VP16-SF-1 polypeptide alone had limited effect on luciferase activity. However, coexpression of both GAL4-Sp1 and VP16-SF-1 polypeptides generated a dramatic increase in luciferase activity to levels 6- or 28-fold higher, respectively, than those observed with GAL4-Sp1 or VP16-SF-1 alone. We also applied this two-hybrid assay in nonsteroidogenic COS-1 cells. As shown in Fig. 8BGo, coexpression of the GAL4-Sp1 and VP16-SF-1 polypeptides generated a marked increase in luciferase activity, to levels 4- or 82-fold higher than those observed with either GAL4-Sp1 or VP16-SF-1 alone, respectively. These data suggest that Sp1 and SF-1 are either capable of a direct association or interact via a common adapter protein in vivo.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 8. Two-Hybrid Analysis of Interactions between Sp1 and SF-1 in Y1 Cells (A) and in COS-1 Cells (B)

A, Y1 cells were transiently transfected with 1.5 µg of the G5LUC reporter plasmid, 25 ng of a GAL4-hybrid expression vector, 1.5 µg of a VP16-hybrid expression plasmid, and 250 ng of internal reference plasmid pCMVLac. Transfections were conducted in duplicate for each combination of expression plasmids. The values of luciferase activity are normalized to ß-galactosidase activity. The results are shown as ± SEM for four independent experiments. B, COS-1 cells were transiently cotransfected with 150 ng of the G5LUC reporter plasmid, 10 ng of a GAL4-hybrid expression vector, 500 ng of a VP16-hybrid expression plasmid, and 25 ng of pCMVLac. Transfections were conducted in duplicate for each combination of expression plasmids. The values of luciferase activity are normalized to ß-galactosidase activity. The results are shown as ± SEM for three independent experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Although stimulation by cAMP is a pathway of regulation of expression common to all steroidogenic genes, different mechanisms are involved in the regulation of expression of each of the genes. A consensus, however, is emerging, which suggests that a factor common to these pathways is SF-1. However, a role for this component had not previously been determined in the case of bovine CYP11A, because an SF-1-binding site was not apparent in the sequence flanking the transcription start site. Rather, in previous studies (5, 6, 12, 13) the sequence -111/-101 bp, containing a binding site for the transcription factor Sp1, was shown to be involved in basal and cAMP-induced transcription of a heterologous promoter in bovine luteal cells and Y1 cells. The present study confirms that the same sequence can bind to Sp1 or an Sp1-like protein from bovine luteal cells and that the element is required for both basal and cAMP-dependent transcription in bovine luteal cells employing the endogenous CYP11A promoter. However, as a ubiquitous transcription factor, Sp1 protein is detected in steroidogenic bovine luteal cells, Y1 cells, and nonsteroidogenic COS-1 cells (data not shown). Employing the -111/-101 bp sequence as a probe, similar gel mobility shifts were obtained with bovine luteal cell, Y1, or nonsteroidogenic COS-1 cell nuclear extracts (data not shown). Since P450scc is only expressed in steroidogenic tissues, the protein binding to the -111/-101 bp sequence is not sufficient to completely define the regulation of P450scc expression.

In the present study, we have identified another sequence in the region between -57 and -32 bp that is required for basal and cAMP-stimulated expression. This sequence contains an SF-1-binding site in the inverted orientation, which, as a consequence, had previously escaped detection. Gel shift analysis indicates that the -57/-32 bp region is specifically bound by one nuclear protein from bovine luteal cells and Y1 cells, but not from nonsteroidogenic COS-1 cells. Forskolin treatment does not affect the DNA-binding activity of this nuclear protein. The bound nuclear protein is identified by antibody supershift analysis to be the orphan nuclear receptor, SF-1, which is expressed in a tissue-specific fashion (24, 25). Mutations within the SF-1 binding region, which abolished nuclear protein binding, decreased both basal and cAMP-dependent transcription (Figs. 5Go and 6Go), and eliminated activation of the bovine P450scc promoter resulting from expression of SF-1 in COS-1 cells (Fig. 3Go).

From the results of the present study, it is apparent that SF-1 alone is necessary, but not sufficient, for cAMP responsiveness, because mutations within the -57/-32 bp sequence reduced, but did not eliminate, basal and cAMP-stimulated luciferase activity compared with the wild type construct (Figs. 5Go and 6Go). Additionally, the -101/+12Luc construct that contains only the SF-1-binding site was expressed at levels lower than the -186/+12Luc construct including both Sp1- and SF-1-binding sites (Fig. 3Go). To explore the functional synergism between SF-1 and Sp1 in the regulation of bovine CYP11A gene expression, the -186/+12Sp1mSF1mLuc construct that contains double mutations of both the Sp1- and the SF-1-binding sequences was employed in transient transfection assays. The double mutation abolished promoter activity in either unstimulated or stimulated bovine luteal cells, as well as in Y1 cells. In addition, the -118/+12{Delta}52Luc construct containing only Sp1 and SF-1 elements upstream of CYP11A TATA box showed a similar fold increase in the promoter activity, compared with the construct with the native -118 to +12 bp region, although basal activity was less. Furthermore, a complex composed of both Sp1 and SF-1 was detected by gel mobility shift assay (Fig. 7Go). These results suggest that a cooperative relationship exists between SF-1 and Sp1 to mediate basal and cAMP-stimulated expression of the bovine CYP11A gene. To our knowledge, this is the first report to show the cooperative involvement of both Sp1 and SF-1 in the regulation of bovine CYP11A expression.

Recent studies (13) have demonstrated the presence of a second sequence element located at -70 to -50 bp of the bovine CYP11A gene, which also binds Sp1 and supports cAMP-induced transcription when subcloned into the OVEC vector and transfected into Y1 cells. However, the OVEC vector has a potential SF-1-binding site in the reverse orientation adjacent to its TATA box. This SF-1 site was shown to bind the SF-1 protein by gel mobility shift assay (data not shown). These data suggest that the -70/-50 bp sequence may also mediate cAMP responsiveness in cooperation with SF-1. They may explain also why constructs containing mutations within the -111/-101 bp sequence still show modest responsiveness to cAMP in Y1 cells (Fig. 5Go). However, the -118/+12{Delta}15Luc construct with an internal deletion of the -70/-50 bp element exhibited similar level of transcriptional activity to the wild type -118/+12Luc construct (data not shown), and the -118/+12{Delta}52Luc construct showed a similar fold increase in luciferase activity to the -118/+12Luc construct, although basal activity was less. These results indicate that the promoter region lacking the -70/-50-bp sequence is sufficient for basal and cAMP-dependent transcription of bovine CYP11A gene, although the -70/-50 bp sequence might play a complementary role in modulating cAMP responsiveness.

SF-1 is known as a regulator for many steroidogenic genes, such as human (11, 31) and rat (9) CYP11A, human CYP19 (32), bovine CYP11B (31), and rat CYP17 (33). All those studies showed that SF-1 could mediate cAMP responsiveness, but the mechanism for the functional role of SF-1 in the cAMP-PKA signal transduction pathway was not clear. While the role of SF-1 may not be mediated by increased DNA-binding activity, but in part mediated by induced SF-1 expression (32) and/or phosphorylation by PKA, SF-1 was suspected to interact with other nuclear factor(s) that bound to specific DNA sequences in mediating the cAMP-induced transcription of bovine CYP11B (31), human (11, 31), and rat (9) CYP11A. The two-hybrid analysis (Fig. 8Go) further suggests that interaction between Sp1 and SF-1 may be involved in this regulation of the bovine CYP11A promoter activity. Thus, our present study provides evidence for the first time which suggests that the transcription factor Sp1 is able to interact with SF-1 to regulate bovine CYP11A promoter activity.

It has been shown that Sp1 can interact with several other transcription factors, such as p53, bovine papillomavirus type 1 (BPV-1) protein E2, retinoblastoma (RB) protein, and CCAAT/enhancer binding protein ß (C/EBPß), to regulate gene transcription (30, 34, 35, 36). Since Sp1 does not have a PKA phosphorylation site, it was suspected that an unidentified coactivator might be a target for PKA in execution of its role in coupling the ubiquitous transcription factor Sp1 with cAMP-dependent transcription (13). From our studies, it appears that cAMP and PKA might stimulate bovine CYP11A gene expression through an Sp1-SF-1 interaction. However, an attempt to show direct interaction between Sp1 and SF-1 by coimmunoprecipitation was unsuccessful. Furthermore, no significant induction of luciferase activity was produced in the reciprocal two-hybrid experiment involving coexpression of GAL4-SF-1 and VP16-Sp1 (data not shown). It is possible that Sp1 interacts with SF-1 through unidentified adapter protein(s). Perhaps the adapter protein(s) functions like CREB-binding protein (CBP), which serves as a common coactivator required for the function of nuclear receptors such as cAMP response element-binding protein (CREB) and AP-1 (37). Thus, it is not clear, at this point, whether PKA stimulates CYP11A gene expression by stabilizing an SF-1-Sp1 interaction, by potentiating SF-1 activity, or by regulation of the activity of an unknown adapter protein.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Restriction endonucleases were purchased from Bethesda Research Laboratories (Gaithersburg, MD) and used according to the directions supplied by the manufacturer. Forskolin was purchased from Calbiochem (San Diego, CA).

Cell Culture
Bovine ovaries were obtained at a local slaughterhouse, and corpora lutea corresponding to early or midstages of the luteal phase were selected. Luteal cells were prepared as described previously (5, 15), cultured in McCoy’s 5A medium supplemented as described previously (5), and allowed to grow to confluency (5–6 days) before transfection. The Y1 and COS-1 cells were routinely maintained in DMEM supplemented with 10% bovine calf serum at 37 C in a 5% CO2 incubator.

Oligonucleotides
Complementary single-stranded oligonucleotides were synthesized and annealed to generate the following double-stranded oligonucleotides representing both wild type and mutant bovine P450scc promoter elements. The sequences containing consensus GC-rich double-strand oligonucleotide, which binds transcription factor Sp1, and a consensus SF-1 binding site are also shown. a) -118/-101

ACTGAGTCTGGGAGGAGCG

tcgagTGACTCAGACCCTCCTCGCagct b) -111/-101

TGGGAGGAGCG

tcgagACCCTCCTCGCagct c) -118/-95 M

ACTGAGTCTGccAGGAGCTGTGTG

TGACTCAGACggTCCTCGACACAC d) -57/-32

GCTTCTCACTTAGCCTTGAGCTGGTG

CGAAGAGTGAATCGGAACTCGACCAC e) -57/-32 M

GCTTCTCACTTAGtaTTGAGCTGGTG

CGAAGAGTGAATCatAACTCGACCAC f) consensus Sp1

GCGATCGGGGCGGGGCG

tcgaCGCTAGCCCCGCCCCGCagct g) consensus SF-1 motif

CACTCTACCAAGGTCAGAAATG

tcgaGTGAGATGGTTCCAGTCTTTACagct h) -114/-35{Delta}52

AGTCTGGGAGGAGCTTTAGCCTTGAGCTG

TCAGACCCTCCTCGAAATCGGAACTCGAC

DNA Reporter Gene Constructs
The expression systems used are the luciferase reporter gene plasmid, pGL3basic, which is a promoterless vector, purchased from Promega (Madison, WI), and the OVEC vector containing a minimal ß-globin promoter as described previously (6) and generously provided by Dr. W. Schaffner.

Luciferase reporter gene constructs containing -186/+12 bp, -118/+12 bp, and -101/+12 bp of the bovine CYP11A gene were made in the following way: the -186/-9 bp fragment was amplified by PCR using the -896/-32 bp fragment as a template and a primer containing the sequence from -32 to -9 bp. The second PCR reaction was conducted to amplify the -186/+12 bp fragment, using the -186/-9 bp fragment as a template and a primer including the region from -9 to +12 bp. A SalI site and a SacI site were introduced in the 3' and 5'-primer, respectively, to facilitate cloning into the pGL3basic vector. The resultant fragment was cloned into the SacI-SalI sites of the pGL3basic vector, just upstream of the coding region of the luciferase reporter gene. From this plasmid a series of CYP11A gene fragments were deleted by PCR. The construction of plasmids containing the mutated -186/+12 bp fragment was conducted as follows: the -186/+12 bp fragment was mutagenized by overlap extension using PCR (16) and then subcloned into the SacI-SalI sites of the pGL3basic vector. The -118/+12{Delta}52Luc construct was also made by a similar method. All plasmid constructions were confirmed by restriction digestion and dideoxy sequencing. The expression vectors for the wild type and the mutated catalytic subunit of PKA were kindly provided by Dr. R. Maurer.

The OVEC reporter gene constructs containing the wild type -186/-32 bp fragment and mutants thereof inserted upstream of the rabbit ß-globin TATA box were made as described by Ahlgren et al. (6).

Plasmids encoding the GAL4-Sp1 and VP16-Sp1 hybrid polypeptides were constructed by inserting the XhoI fragment from pPacSp1, kindly provided by Dr. R. Tjian, into the SalI site of the pM and pVP16 expression vectors (17), respectively. To produce plasmids encoding GAL4-SF-1 and VP16-SF-1, the fragment including the entire SF-1-coding region was amplified by PCR from the pRc/RSV-SF-1 expression vector, kindly provided by Dr. K. Morohashi. A HindIII site was introduced in both 5'- and 3'-primers. The amplified fragment was cloned into the HindIII site of pM and pVP16 vectors, respectively.

Transient Cell Transfections
Mouse Y1 adrenocortical tumor cells were maintained in DMEM supplemented with 10% bovine calf serum and antibiotics. On the day before transfection, about 2 x 106 cells were seeded in each 60-mm dish. The next morning the medium was changed, and 2 h later the DNA was added to the cells by the calcium-phosphate method (18) using 5 µg of plasmid/60-mm dish. After 4 h of exposure to the DNA precipitates, the cells were shocked with 15% glycerol for 1 min at room temperature. The medium was changed the morning after transfection, and the cells were maintained in the presence of 10% serum.

Confluent bovine luteal cells were removed from the culture dishes using trypsin/EDTA solution and resuspended in McCoy’s 5A medium. Transfection was achieved by electroporation using a cell porator (Bethesda Research Laboratories). Two consecutive discharges (750 V/cm and 1180 µFarads) were applied to 3 x 106 cells in 1 ml of McCoy’s 5A medium containing 75 µg of test plasmid and 4 µg of internal reference plasmid pCMVLac, as reported previously by Lauber et al. (5). After an overnight plating of the transfected cells in McCoy’s 5A medium containing 2.5% bovine calf serum, the treatments were started the day after transfection in McCoy’s 5A medium without serum for 12 h and continued in the presence of 25 µM forskolin for 12 h. For OVEC reporter gene constructs, the transfection procedure was the same as described except 100 µg of test plasmid and 2 µg of internal reference vector OVEC-REF were used, and the cells were exposed to forskolin for 9 h the day after transfection.

COS-1 cells were maintained in DMEM supplemented with 10% bovine calf serum and antibiotics. Plasmid DNA (1 µg) was transfected into COS-1 cells using the lipofectamine method (Bethesda Research Laboratories). After 48 h, the cells were lysed and the cell lysates were used for luciferase assay.

The Two-Hybrid Assay
Approximately 2 x 106 Y1 cells were seeded onto each 60-mm plate and cultured in 5 ml of growth medium. After 1 day, each 60-mm culture was transfected with 1.5 µg of the G5LUC reporter plasmid (19), 25 ng of a GAL4-hybrid expression plasmid, and/or 1.5 µg of a VP16-hybrid expression plasmid, and 0.25 µg of internal reference plasmid pCMVLac. After 48 h of culture the cells were lysed and used for luciferase assay.

Gel Retardation Assay
Nuclear extracts were prepared from mouse Y1 adrenocortical tumor cells and bovine luteal cells in primary culture as described by Dignam et al. (20). The double-stranded oligonucleotides were labeled by T4 polynucleotide kinase using [{gamma}-32P]dATP or by Klenow labeling using [{alpha}-32P]dCTP, and then incubated (10,000 cpm) with nuclear extracts (10 µg of protein) on ice for 10 min (21). For the competition assays, 500-fold molar excess of unlabeled oligonucleotide used as a competitor was added simultaneously with the labeled fragment. The resulting DNA-protein complexes were analyzed by electrophoresis using an 8% polyacrylamide gel with 0.5 x Tris-borate-EDTA as the running buffer (22). Supershift assays were also conducted as described above except 1 µg of anti-Sp1 antibody (Santa Cruz Biotech., Santa Cruz, CA) was added to the DNA-protein complexes after 10 min incubation on ice. Incubation of the DNA-protein complexes with the antibody continued for an additional 30 min at room temperature before electrophoresis. In some experiments, nuclear extract proteins were preincubated with anti-SF-1 polyclonal antibody, provided by Dr. K. Morohashi, or preimmune serum at room temperature for 30 min before addition to the binding reaction.

Luciferase and ß-Galactosidase Assays
Forty-eight hours after the transfection, the cells were lysed with 300 µl of 1% Triton X-100, 0.1 M phosphate buffer, pH 7.8, 2 mM EDTA, and 1 mM dithiothreitol. The luciferase assays were conducted essentially after the protocol provided by Analytical Luminescence Laboratory (San Diego, CA). Fifty microliters of lysate were added to 100 µl of substrate A, and the luciferase reaction was initiated by the injection of 100 µl of substrate B. Light output was measured for 10 sec at room temperature using a monolight luminometer (Analytical Luminescence Laboratory, San Diego, CA). ß-Galactosidase activity was measured using a chemiluminescent reporter assay kit (TROPIX, Bedford, MA). Twenty microliters of lysate were added to 200 µl of reaction buffer and incubated at room temperature for 60 min. After the addition of 300 µl of light emission accelerator, light output was measured for 5 sec using a monolight luminometer.

S1 Nuclease Protection Assay
Total RNA was isolated using a RNAzol B method (Biotecx Laboratories, Inc. Houston, TX). ß-Globin transcripts were detected and quantitated using a single-stranded rabbit ß-globin-specific oligonucleotide (93 mer) (6). After hybridization of the 32P-labeled probe with RNA (10 µg), it was digested with S1 nuclease, and correctly initiated protected fragments (75 nucleotides) were separated from free probe (93 nucleotides) by electrophoresis. Specific bands were visualized by autoradiography.


    ACKNOWLEDGMENTS
 
We thank Carolyn Fisher and Christy Ahsanullah for their technique assistance.


    FOOTNOTES
 
Address requests for reprints to: Evan R. Simpson, Ph.D., Cecil H. and Ida Green Center for Reproductive Biology Sciences, The University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75235-9051.

This work was supported, in part, by USPHS Grant 5-ROI-HD13234 and by Grant I-1228 from the Robert A. Welch Foundation.

Received for publication September 3, 1996. Revision received November 18, 1996. Accepted for publication November 20, 1996.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Nebert DW, Nelson DR, Adesnik M, Coon MJ, Estabrook RW, Gonzalez FJ, Guengerich FP, Gunsalus IC, Johnson EF, Kemper B, Levin W, Philps FR, Sato R, Waterman MR 1989 The P450 gene superfamily: recommended nomenclature. DNA 8:1–13[Medline]
  2. Nelson DR, Kamataki T, Waxman DJ, Guengerich FP, Estabrook RW, Feyereisen R, Gonzalez FJ, Coon MJ, Gunsalus IC, Gotoh O, Okuda K, Nebert DW 1993 The P450 superfamily: update on new sequences, gene mapping, accession numbers, early trivial names of enzymes, and nomenclature. DNA Cell Biol 12:1–51[Medline]
  3. Marsh JM 1976 The role of cyclic AMP in gonadal steroidogenesis. Biol Reprod 14:30–53[CrossRef][Medline]
  4. John ME, John MC, Boggaram V, Simpson ER, Waterman MR 1986 Transcriptional regulation of steroid hydroxylase genes by ACTH. Proc Natl Acad Sci USA 83:4715–4719[Abstract/Free Full Text]
  5. Lauber ME, Bengston T, Waterman MR, Simpson ER 1991 Regulation of CYP11A (P450scc) and CYP17 (P45017{alpha}) gene expression in bovine luteal cells in primary culture. J Biol Chem 266:11170–11175[Abstract/Free Full Text]
  6. Ahlgren R, Simpson ER, Waterman MR, Lund J 1990 Characterization of the promoter-regulatory region of the bovine CYP11A (P450scc) expression. J Biol Chem 265:3313–3319[Abstract/Free Full Text]
  7. Momoi K, Waterman MR, Simpson ER, Zanger UM 1992 Cyclic AMP-dependent transcription of the CYP11A (cholesterol side-chain cleavage cytochrome P450) involves a DNA response element containing a putative binding site for transcription factor Sp1. Mol Endocrinol 6:1682–1690[Abstract/Free Full Text]
  8. Waterman MR, Kagawa N, Zanger UM, Momoi K, Lund J, Simpson ER 1992 Comparison of cAMP-responsive DNA sequences and their binding proteins associated with expression of the bovine CYP17 and CYP11A and human CYP21B genes. J Steroid Biochem Mol Biol 43:931–935[CrossRef]
  9. Clemens JW, Lala DS, Parker KL, Richards JS 1994 Steroidogenic factor-1 binding and transcriptional activity of the cholesterol side-chain cleavage promoter in rat granulosa cells. Endocrinology 134:1499–1508[Abstract/Free Full Text]
  10. Hum DW, Staels B, Black SM, Miller WL 1993 Basal transcriptional activity and cyclic adenosine 3',5'-monophosphate responsiveness of the human cytochrome P450scc promoter transfected into MA-10 Leydig cells. Endocrinology 132:546–552[Abstract/Free Full Text]
  11. Guo I-C, Tsai H-M, Chung B-C 1994 Actions of two different cAMP-responsive sequences and an enhancer of the human CYP11A1 (P450scc) gene in adrenal Y1 and placental JEG-3 Cells. J Biol Chem 269:6362–6369[Abstract/Free Full Text]
  12. Begeot M, Shetty U, Kilgore M, Waterman MR, Simpson ER 1993 Regulation of expression of the CYP11A (P450scc) gene in bovine ovarian luteal cells by forskolin and phorbol esters. J Biol Chem 268:17317–17325[Abstract/Free Full Text]
  13. Venepally P, Waterman MR 1995 Two Sp1-binding site mediate cAMP-induced transcription of the bCYP11A gene through the protein kinase A signaling pathway. J Biol Chem 270:1–9[Free Full Text]
  14. Oonk RB, Parker KL, Gibson JL, Richards JS 1990 Rat cholesterol side-chain cleavage cytochrome P450 (P450scc) gene: Structure and regulation by cAMP in vitro. J Biol Chem 265:22392–22401[Abstract/Free Full Text]
  15. Stirling D, Magness RR, Stone R, Waterman MR, Simpson ER 1990 Angiotensin II inhibits LH-stimulated cholesterol side-chain cleavage expression and stimulates basic fibroblast growth factor expression in bovine luteal cells in primary culture. J Biol Chem 265:5–8[Abstract/Free Full Text]
  16. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR 1989 Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59[CrossRef][Medline]
  17. Sadowski I, Bell B, Broad P, Hollis M 1992 GAL4 fusion vectors for expression in yeast or mammalian cells. Gene 118:137–141[CrossRef][Medline]
  18. Graham FL, van der Eb AJ 1973 A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52:456–457[CrossRef][Medline]
  19. Hsu H-L, Wadman I, Baer R 1994 Formation of in vivo complexes between the TAL1 and E2A polypeptides of leukemic T cells. Proc Natl Acad Sci USA 91:3181–3185[Abstract/Free Full Text]
  20. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  21. Kagawa N, Waterman MR 1990 cAMP-dependent transcription of the human CYP21B (P450c21) gene requires a cis-regulatory element distinct from the consensus cAMP- regulatory element. J Biol Chem 265:11299–11305[Abstract/Free Full Text]
  22. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  23. Kadonaga JT, Jones KA, Tjian R 1986 Promoter-specific activation of RNA polymerase II transcription by Sp1. Trends Biochem 11:20–23
  24. Honda S, Morohashi K, Nomura M, Takeya M, Kitajima M, Omura T 1993 Ad4BP regulating steroidogenic P450 gene is a member of steroid hormone receptor superfamily. J Biol Chem 268:7479–7502
  25. Lala DS, Rice DA, Parker KL 1992 Steroidogenic factor I, a key regulator of steroidogenic enzyme expression, is the mouse homolog of fushi tarazu-factor I. Mol Endocrinol 6:1249–1258[Abstract/Free Full Text]
  26. Dang C-V, Barrett JB, Villa-Garcia M, Resar LMS, Kato GJ, Fearon ER 1991 Intracellular leucine zipper interactions suggest c-Myc hetero-oligomerization. Mol Cell Biol 11:954–962[Abstract/Free Full Text]
  27. Fields S, Song O-K 1989 A novel genetic system to detect protein-protein interactions. Nature 340:245–246[CrossRef][Medline]
  28. Lillie JW, Green MR 1989 Transcription activation by the adenovirus E1a protein. Nature 338:39–44[CrossRef][Medline]
  29. Sadowski I, Ma J, Treizenberg S, Ptshne M 1988 GAL4-VP16 is an unusually potent transcriptional activator. Nature 335:559–560[CrossRef][Medline]
  30. Li R, Knight JD, Jackson SP, Tjian R, Botchan MR 1991 Direct interaction between Sp1 and the BPV enhancer E2 protein mediates synergistic activation of transcription. Cell 65:493–505[CrossRef][Medline]
  31. Morohashi K, Zanger UM, Honda S, Hara M, Waterman MR, Omura T 1993 Activation of CYP11A and CYP11B gene promoters by the steroidogenic cell-specific transcription factor, Ad4BP. Mol Endocrinol 7:1196–1204[Abstract/Free Full Text]
  32. Michael MD, Kilgore MW, Morohashi K, Simpson ER 1995 Ad4BP/SF-1 regulates cyclic AMP-induced transcription from the proximal promoter (PII) of the human aromatase P450 (CYP19) gene in the ovary. J Biol Chem 270:13561–13566[Abstract/Free Full Text]
  33. Zhang P, Mellon SH 1996 The orphan nuclear receptor steroidogenic factor-1 regulates the cyclic adenosine 3',5'-monophosphate-mediated transcriptional activation of rat cytochrome P450c17 (17{alpha}-hydroxylase/c17–20 lyase). Mol Endocrinol 10:147–158[Abstract/Free Full Text]
  34. Borellini F, Glazer RI 1993 Induction of Sp1–p53 DNA-binding heterocomplexes during granulocyte/macrophage colony-stimulating factor-dependent proliferation in human erythroleukemia cell line TF-1. J Biol Chem 268:7923–7928[Abstract/Free Full Text]
  35. Udvadia A, Rogers KT, Higgins PDR, Murata Y, Martin KH, Humphrey PA, Horowitz JM 1993 Sp-1 binds promoter elements regulated by the RB protein and Sp-1-mediated transcription is stimulated by RB coexpression. Proc Natl Acad Sci USA 90:3265–3269[Abstract/Free Full Text]
  36. Lee Y-H, Yano M, Liu S-Y, Matsunaga E, Johnson PF, Gonzalez FJ 1994 A novel cis- acting element controlling the rat CYP2D5 gene and requiring cooperativity between C/EBPß and an Sp1 factor. Mol Cell Biol 14:1383–1394[Abstract/Free Full Text]
  37. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa, R, Gloss B, Lin S-C, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Cell Sci.Home page
M. Hajduskova, M. Jindra, M. A. Herman, and M. Asahina
The nuclear receptor NHR-25 cooperates with the Wnt/{beta}-catenin asymmetry pathway to control differentiation of the T seam cell in C. elegans
J. Cell Sci., September 1, 2009; 122(17): 3051 - 3060.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
H. A. LaVoie and S. R. King
Transcriptional Regulation of Steroidogenic Genes: STARD1, CYP11A1 and HSD3B
Experimental Biology and Medicine, August 1, 2009; 234(8): 880 - 907.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. C. Kim, F. M. Barlaskar, J. H. Heaton, T. Else, V. R. Kelly, K. T. Krill, J. O. Scheys, D. P. Simon, A. Trovato, W.-H. Yang, et al.
In Search of Adrenocortical Stem and Progenitor Cells
Endocr. Rev., May 1, 2009; 30(3): 241 - 263.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W.-H. Yang, J. H. Heaton, H. Brevig, S. Mukherjee, J. A. Iniguez-Lluhi, and G. D. Hammer
SUMOylation Inhibits SF-1 Activity by Reducing CDK7-Mediated Serine 203 Phosphorylation
Mol. Cell. Biol., February 1, 2009; 29(3): 613 - 625.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Fukami, Y. Wada, M. Okada, F. Kato, N. Katsumata, T. Baba, K.-i. Morohashi, J. Laporte, M. Kitagawa, and T. Ogata
Mastermind-like Domain-containing 1 (MAMLD1 or CXorf6) Transactivates the Hes3 Promoter, Augments Testosterone Production, and Contains the SF1 Target Sequence
J. Biol. Chem., February 29, 2008; 283(9): 5525 - 5532.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. J. Kuhl, S. M. Ross, and K. W. Gaido
CCAAT/Enhancer Binding Protein {beta}, But Not Steroidogenic Factor-1, Modulates the Phthalate-Induced Dysregulation of Rat Fetal Testicular Steroidogenesis
Endocrinology, December 1, 2007; 148(12): 5851 - 5864.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. L. Yaspan, J. P. Breyer, Q. Cai, Q. Dai, J. B. Elmore, I. Amundson, K. M. Bradley, X.-O. Shu, Y.-T. Gao, W. D. Dupont, et al.
Haplotype Analysis of CYP11A1 Identifies Promoter Variants Associated with Breast Cancer Risk
Cancer Res., June 15, 2007; 67(12): 5673 - 5682.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Sher, N. Yivgi-Ohana, and J. Orly
Transcriptional Regulation of the Cholesterol Side Chain Cleavage Cytochrome P450 Gene (CYP11A1) Revisited: Binding of GATA, Cyclic Adenosine 3',5'-Monophosphate Response Element-Binding Protein and Activating Protein (AP)-1 Proteins to a Distal Novel Cluster of cis-Regulatory Elements Potentiates AP-2 and Steroidogenic Factor-1-Dependent Gene Expression in the Rodent Placenta and Ovary
Mol. Endocrinol., April 1, 2007; 21(4): 948 - 962.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
K. A Brown, K. Sayasith, N. Bouchard, J. G Lussier, and J. Sirois
Molecular cloning of equine 17{beta}-hydroxysteroid dehydrogenase type 1 and its downregulation during follicular luteinization in vivo
J. Mol. Endocrinol., January 1, 2007; 38(1): 67 - 78.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. N. Winnay, J. Xu, B. W. O'Malley, and G. D. Hammer
Steroid Receptor Coactivator-1-Deficient Mice Exhibit Altered Hypothalamic-Pituitary-Adrenal Axis Function
Endocrinology, March 1, 2006; 147(3): 1322 - 1332.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. H. Bassett, B. Mayhew, K. Rehman, P. C. White, F. Mantero, G. Arnaldi, P. M. Stewart, I. Bujalska, and W. E. Rainey
Expression Profiles for Steroidogenic Enzymes in Adrenocortical Disease
J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5446 - 5455.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Huang, A. Dardis, and W. L. Miller
Regulation of Cytochrome b5 Gene Transcription by Sp3, GATA-6, and Steroidogenic Factor 1 in Human Adrenal NCI-H295A Cells
Mol. Endocrinol., August 1, 2005; 19(8): 2020 - 2034.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Seenundun and B. Robaire
Cloning and Characterization of the 5{alpha}-Reductase Type 2 Promoter in the Rat Epididymis
Biol Reprod, April 1, 2005; 72(4): 851 - 861.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
A Pierre, C Pisselet, J Dupont, B Mandon-Pepin, D Monniaux, P Monget, and S Fabre
Molecular basis of bone morphogenetic protein-4 inhibitory action on progesterone secretion by ovine granulosa cells
J. Mol. Endocrinol., December 1, 2004; 33(3): 805 - 817.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Curtin, H. A. Ferris, M. Hakli, M. Gibson, O. A. Janne, J. J. Palvimo, and M. A. Shupnik
Small Nuclear RING Finger Protein Stimulates the Rat Luteinizing Hormone-{beta} Promoter by Interacting with Sp1 and Steroidogenic Factor-1 and Protects from Androgen Suppression
Mol. Endocrinol., May 1, 2004; 18(5): 1263 - 1276.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
P. R. Manna, D. W. Eubank, and D. M. Stocco
Assessment of the Role of Activator Protein-1 on Transcription of the Mouse Steroidogenic Acute Regulatory Protein Gene
Mol. Endocrinol., March 1, 2004; 18(3): 558 - 573.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. Sriraman and J. S. Richards
Cathepsin L Gene Expression and Promoter Activation in Rodent Granulosa Cells
Endocrinology, February 1, 2004; 145(2): 582 - 591.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Hammer, N. A. Compagnone, J.-L. Vigne, S. R. Bair, and S. H. Mellon
Transcriptional Regulation of P450scc Gene Expression in the Embryonic Rodent Nervous System
Endocrinology, February 1, 2004; 145(2): 901 - 912.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Val, C. Aigueperse, B. Ragazzon, G. Veyssiere, A.-M. Lefrancois-Martinez, and A. Martinez
Adrenocorticotropin/3',5'-Cyclic AMP-Mediated Transcription of the Scavenger akr1-b7 Gene in Adrenocortical Cells Is Dependent on Three Functionally Distinct Steroidogenic Factor-1-Responsive Elements
Endocrinology, February 1, 2004; 145(2): 508 - 518.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. Borud, G. Mellgren, J. Lund, and M. Bakke
Cloning and Characterization of a Novel Zinc Finger Protein that Modulates the Transcriptional Activity of Nuclear Receptors
Mol. Endocrinol., November 1, 2003; 17(11): 2303 - 2319.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L. J. Whale, D. C. Eckery, and J. L. Juengel
Determination of Steroidogenic Potential of Ovarian Cells of the Brushtail Possum (Trichosurus vulpecula)
Biol Reprod, September 1, 2003; 69(3): 947 - 958.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Sadie, G. Styger, and J. Hapgood
Expression of the Mouse Gonadotropin-Releasing Hormone Receptor Gene in {alpha}T3-1 Gonadotrope Cells Is Stimulated by Cyclic 3',5'-Adenosine Monophosphate and Protein Kinase A, and Is Modulated by Steroidogenic Factor-1 and Nur77
Endocrinology, May 1, 2003; 144(5): 1958 - 1971.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Martinez, P. Val, I. Sahut-Barnola, C. Aigueperse, G. Veyssiere, and A.-M. Lefrancois-Martinez
Steroidogenic Factor-1 Controls the Aldose Reductase akr1b7 Gene Promoter in Transgenic Mice through an Atypical Binding Site
Endocrinology, May 1, 2003; 144(5): 2111 - 2120.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
V. Sriraman, S. C. Sharma, and J. S. Richards
Transactivation of the Progesterone Receptor Gene in Granulosa Cells: Evidence that Sp1/Sp3 Binding Sites in the Proximal Promoter Play a Key Role in Luteinizing Hormone Inducibility
Mol. Endocrinol., March 1, 2003; 17(3): 436 - 449.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Sekiguchi, T. Mizutani, K. Yamada, T. Yazawa, H. Kawata, M. Yoshino, T. Kajitani, T. Kameda, T. Minegishi, and K. Miyamoto
Transcriptional Regulation of the Epiregulin Gene in the Rat Ovary
Endocrinology, December 1, 2002; 143(12): 4718 - 4729.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
X. Wei, M. Sasaki, H. Huang, V. L. Dawson, and T. M. Dawson
The Orphan Nuclear Receptor, Steroidogenic Factor 1, Regulates Neuronal Nitric Oxide Synthase Gene Expression in Pituitary Gonadotropes
Mol. Endocrinol., December 1, 2002; 16(12): 2828 - 2839.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Desclozeaux, I. N. Krylova, F. Horn, R. J. Fletterick, and H. A. Ingraham
Phosphorylation and Intramolecular Stabilization of the Ligand Binding Domain in the Nuclear Receptor Steroidogenic Factor 1
Mol. Cell. Biol., October 15, 2002; 22(20): 7193 - 7203.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Val, A. Martinez, I. Sahut-Barnola, C. Jean, G. Veyssiere, and A.-M. Lefrancois-Martinez
A 77-Base Pair LINE-Like Sequence Elicits Androgen-Dependent mvdp/akr1-b7 Expression in Mouse Vas Deferens, But Is Dispensable for Adrenal Expression in Rats
Endocrinology, September 1, 2002; 143(9): 3435 - 3448.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. M. Salvador, Y. Park, J. Cottom, E. T. Maizels, J. C. R. Jones, R. V. Schillace, D. W. Carr, P. Cheung, C. D. Allis, J. L. Jameson, et al.
Follicle-stimulating Hormone Stimulates Protein Kinase A-mediated Histone H3 Phosphorylation and Acetylation Leading to Select Gene Activation in Ovarian Granulosa Cells
J. Biol. Chem., October 19, 2001; 276(43): 40146 - 40155.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. J. Lin, J. W. M. Martens, and W. L. Miller
NF-1C, Sp1, and Sp3 Are Essential for Transcription of the Human Gene for P450c17 (Steroid 17{alpha}-hydroxylase/17,20 lyase) in Human Adrenal NCI-H295A Cells
Mol. Endocrinol., August 1, 2001; 15(8): 1277 - 1293.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
P. de Santa Barbara, C. Méjean, B. Moniot, M.-H. Malclès, P. Berta, and B. Boizet-Bonhoure
Steroidogenic Factor-1 Contributes to the Cyclic-Adenosine Monophosphate Down-Regulation of Human SRY Gene Expression
Biol Reprod, March 1, 2001; 64(3): 775 - 783.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
H. Pincas, K. Amoyel, R. Counis, and J.-N. Laverrière
Proximal cis-Acting Elements, Including Steroidogenic Factor 1, Mediate the Efficiency of a Distal Enhancer in the Promoter of the Rat Gonadotropin-Releasing Hormone Receptor Gene
Mol. Endocrinol., February 1, 2001; 15(2): 319 - 337.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
C. Aigueperse, P. Val, C. Pacot, C. Darne, E. Lalli, P. Sassone-Corsi, G. Veyssiere, C. Jean, and A. Martinez
SF-1 (Steroidogenic Factor-1), C/EBP{beta} (CCAAT/Enhancer Binding Protein), and Ubiquitous Transcription Factors NF1 (Nuclear Factor 1) and Sp1 (Selective Promoter Factor 1) Are Required for Regulation of the Mouse Aldose Reductase-Like Gene (AKR1B7) Expression in Adrenocortical Cells
Mol. Endocrinol., January 1, 2001; 15(1): 93 - 111.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
D. Boerboom and J. Sirois
Equine P450 Cholesterol Side-Chain Cleavage and 3{beta}-Hydroxysteroid Dehydrogenase/{{Delta}}5-{{Delta}}4 Isomerase: Molecular Cloning and Regulation of Their Messenger Ribonucleic Acids in Equine Follicles During the Ovulatory Process
Biol Reprod, January 1, 2001; 64(1): 206 - 215.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
S. Chen, X. Liu, and D. L. Segaloff
A Novel Cyclic Adenosine 3',5'-Monophosphate-Responsive Element Involved In the Transcriptional Regulation of the Lutropin Receptor Gene in Granulosa Cells
Mol. Endocrinol., September 1, 2000; 14(9): 1498 - 1508.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
U. B. Kaiser, L. M. Halvorson, and M. T. Chen
Sp1, Steroidogenic Factor 1 (SF-1), and Early Growth Response Protein 1 (Egr-1) Binding Sites Form a Tripartite Gonadotropin-Releasing Hormone Response Element in the Rat Luteinizing Hormone-{beta} Gene Promoter: an Integral Role for SF-1
Mol. Endocrinol., August 1, 2000; 14(8): 1235 - 1245.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
T. Sugawara, M. Saito, and S. Fujimoto
Sp1 and SF-1 Interact and Cooperate in the Regulation of Human Steroidogenic Acute Regulatory Protein Gene Expression
Endocrinology, August 1, 2000; 141(8): 2895 - 2903.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. Xie, R. Duan, I. Chen, I. Samudio, and S. Safe
Transcriptional Activation of Thymidylate Synthase by 17{beta}-Estradiol in MCF-7 Human Breast Cancer Cells
Endocrinology, July 1, 2000; 141(7): 2439 - 2449.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. R. Vines and D. A. Weigent
Identification of SP3 as a Negative Regulatory Transcription Factor in the Monocyte Expression of Growth Hormone
Endocrinology, March 1, 2000; 141(3): 938 - 946.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Barnea and Y. Bergman
Synergy of SF1 and RAR in Activation of Oct-3/4 Promoter
J. Biol. Chem., February 25, 2000; 275(9): 6608 - 6619.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Ito, Y. Park, J. Weck, K. E. Mayo, and J. L. Jameson
Synergistic Activation of the Inhibin {alpha}-Promoter by Steroidogenic Factor-1 and Cyclic Adenosine 3',5'-Monophosphate
Mol. Endocrinol., January 1, 2000; 14(1): 66 - 81.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
D. Lopez and M. P. McLean
Sterol Regulatory Element-Binding Protein-1a Binds to cis Elements in the Promoter of the Rat High Density Lipoprotein Receptor SR-BI Gene
Endocrinology, December 1, 1999; 140(12): 5669 - 5681.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
K. Kawabe, T. Shikayama, H. Tsuboi, S. Oka, K. Oba, T. Yanase, H. Nawata, and K.-i. Morohashi
Dax-1 as One of the Target Genes of Ad4BP/SF-1
Mol. Endocrinol., August 1, 1999; 13(8): 1267 - 1284.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
P. Pena, A. T. Reutens, C. Albanese, M. D’Amico, G. Watanabe, A. Donner, I-W. Shu, T. Williams, and R. G. Pestell
Activator Protein-2 Mediates Transcriptional Activation of the CYP11A1 Gene by Interaction with Sp1 Rather than Binding to DNA
Mol. Endocrinol., August 1, 1999; 13(8): 1402 - 1416.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Y.-K. Lee, K. L. Parker, H.-S. Choi, and D. D. Moore
Activation of the Promoter of the Orphan Receptor SHP by Orphan Receptors That Bind DNA as Monomers
J. Biol. Chem., July 23, 1999; 274(30): 20869 - 20873.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Ahlgren, G. Suske, M. R. Waterman, and J. Lund
Role of Sp1 in cAMP-dependent Transcriptional Regulation of the Bovine CYP11A Gene
J. Biol. Chem., July 2, 1999; 274(27): 19422 - 19428.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. Lopez, T. W. Sandhoff, and M. P. McLean
Steroidogenic Factor-1 Mediates Cyclic 3',5'-Adenosine Monophosphate Regulation of the High Density Lipoprotein Receptor
Endocrinology, July 1, 1999; 140(7): 3034 - 3044.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
E. Silverman, S. Eimerl, and J. Orly
CCAAT Enhancer-binding Protein beta  and GATA-4 Binding Regions within the Promoter of the Steroidogenic Acute Regulatory Protein (StAR) Gene Are Required for Transcription in Rat Ovarian Cells
J. Biol. Chem., June 18, 1999; 274(25): 17987 - 17996.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Chen, H. Shi, X. Liu, and D. L. Segaloff
Multiple Elements and Protein Factors Coordinate the Basal and Cyclic Adenosine 3',5'-Monophosphate-Induced Transcription of the Lutropin Receptor Gene in Rat Granulosa Cells
Endocrinology, May 1, 1999; 140(5): 2100 - 2109.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
T. W. Sandhoff, D. B. Hales, K. H. Hales, and M. P. McLean
Transcriptional Regulation of the Rat Steroidogenic Acute Regulatory Protein Gene by Steroidogenic Factor 1
Endocrinology, December 1, 1998; 139(12): 4820 - 4831.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Young and M. J. McPhaul
A Steroidogenic Factor-1-Binding Site and Cyclic Adenosine 3',5'-Monophosphate Response Element-Like Elements Are Required for the Activity of the Rat Aromatase Promoter in Rat Leydig Tumor Cell Lines
Endocrinology, December 1, 1998; 139(12): 5082 - 5093.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Dajee, G. H. Fey, and J. S. Richards
Stat 5b and the Orphan Nuclear Receptors Regulate Expression of the {alpha}2-Macroglobulin ({alpha}2M) Gene in Rat Ovarian Granulosa Cells
Mol. Endocrinol., September 1, 1998; 12(9): 1393 - 1409.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
J. W. Clemens, R. L. Robker, W. L. Kraus, B. S. Katzenellenbogen, and J. S. Richards
Hormone Induction of Progesterone Receptor (PR) Messenger Ribonucleic Acid and Activation of PR Promoter Regions in Ovarian Granulosa Cells: Evidence for a Role of Cyclic Adenosine 3',5'-Monophosphate but Not Estradiol
Mol. Endocrinol., August 1, 1998; 12(8): 1201 - 1214.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
L. M. Halvorson, M. Ito, J. L. Jameson, and W. W. Chin
Steroidogenic Factor-1 and Early Growth Response Protein 1 Act through Two Composite DNA Binding Sites to Regulate Luteinizing Hormone beta -Subunit Gene Expression
J. Biol. Chem., June 12, 1998; 273(24): 14712 - 14720.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
U. B. Kaiser, E. Sabbagh, M. T. Chen, W. W. Chin, and B. D. Saunders
Sp1 Binds to the Rat Luteinizing Hormone beta  (LHbeta ) Gene Promoter and Mediates Gonadotropin-releasing Hormone-stimulated Expression of the LHbeta Subunit Gene
J. Biol. Chem., May 22, 1998; 273(21): 12943 - 12951.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. N. Harris and P. L. Mellon
The Basic Helix-Loop-Helix, Leucine Zipper Transcription Factor, USF (Upstream Stimulatory Factor), Is a Key Regulator of SF-1 (Steroidogenic Factor-1) Gene Expression in Pituitary Gonadotrope and Steroidogenic Cells
Mol. Endocrinol., May 1, 1998; 12(5): 714 - 726.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
J. M. Burrin, S. J. B. Aylwin, J. G. Holdstock, and U. Sahye
Mechanism of Action of Pituitary Adenylate Cyclase-Activating Polypeptide on Human Glycoprotein Hormone {alpha}-Subunit Transcription in {alpha}T3-1 Gonadotropes
Endocrinology, April 1, 1998; 139(4): 1731 - 1737.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Monte, F. DeWitte, and D. W. Hum
Regulation of the Human P450scc Gene by Steroidogenic Factor 1 Is Mediated by CBP/p300
J. Biol. Chem., February 20, 1998; 273(8): 4585 - 4591.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Ito, R. N. Yu, and J. L. Jameson
Steroidogenic Factor-1 Contains a Carboxy-Terminal Transcriptional Activation Domain That Interacts with Steroid Receptor Coactivator-1
Mol. Endocrinol., February 1, 1998; 12(2): 290 - 301.
[Abstract] [Full Text]


Home page
Reproductive SciencesHome page
Y. Sadovsky and P. A. Crawford
Developmental and Physiologic Roles of the Nuclear Receptor Steroidogenic Factor-I in the Reproductive System
Reproductive Sciences, January 1, 1998; 5(1): 6 - 12.
[Abstract] [PDF]


Home page
Mol. Endocrinol.Home page
T. N. Alliston, A. C. Maiyar, P. Buse, G. L. Firestone, and J. S. Richards
Follicle Stimulating Hormone-Regulated Expression of Serum/Glucocorticoid-Inducible Kinase in Rat Ovarian Granulosa Cells: A Functional Role for the Sp1 Family in Promoter Activity
Mol. Endocrinol., December 1, 1997; 11(13): 1934 - 1949.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Mizutani, K. Yamada, T. Minegishi, and K. Miyamoto
Transcriptional Regulation of Rat Scavenger Receptor Class B Type I Gene
J. Biol. Chem., July 14, 2000; 275(29): 22512 - 22519.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Stoner, F. Wang, M. Wormke, T. Nguyen, I. Samudio, C. Vyhlidal, D. Marme, G. Finkenzeller, and S. Safe
Inhibition of Vascular Endothelial Growth Factor Expression in HEC1A Endometrial Cancer Cells through Interactions of Estrogen Receptor alpha and Sp3 Proteins
J. Biol. Chem., July 21, 2000; 275(30): 22769 - 22779.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Gizard, B. Lavallee, F. DeWitte, and D. W. Hum
A Novel Zinc Finger Protein TReP-132 Interacts with CBP/p300 to Regulate Human CYP11A1 Gene Expression
J. Biol. Chem., August 31, 2001; 276(36): 33881 - 33892.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. L. Jacob, J. Lund, P. Martinez, and L. Hedin
Acetylation of Steroidogenic Factor 1 Protein Regulates Its Transcriptional Activity and Recruits the Coactivator GCN5
J. Biol. Chem., September 28, 2001; 276(40): 37659 - 37664.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, Z.
Right arrow Articles by Simpson, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, Z.
Right arrow Articles by Simpson, E. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals