| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cecil H. and Ida Green Center for Reproductive Biology Sciences, and the Departments of Obstetrics/Gynecology and Biochemistry The University of Texas Southwestern Medical Center Dallas, Texas 75235-9051
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Studies of the 5'-flanking sequence of CYP11A genes from different species have identified several putative cis-acting elements required for cAMP-dependent transcription, including Sp1, AP-2, cAMP/AP-1, and SF-1 response elements (5, 6, 7, 8, 9, 10, 11). However, no common cis-acting DNA element(s) has been implicated to mediate the cAMP-responsive activity of the P450scc promoter among different species. In previous studies (5, 6, 12), we have reported that a region between -183 and -83 bp of the 5'-flanking sequence of the bovine CYP11A gene is capable of conferring cAMP-dependent regulation of a reporter gene, upon transfection into mouse adrenal Y1 tumor cells, bovine adrenocortical cells, and bovine luteal cells. Further characterization of this region (7, 12) has indicated that a cAMP-response sequence is located within -118 and -100 bp, using transiently transfected mouse Y1 cells and bovine ovarian luteal cells. This element is highly conserved among different species and is similar to the consensus Sp1-binding sequence, except that an A replaces the core C. Later, it was shown that a second sequence element located at -70 to -50 bp is similar to the consensus Sp1-binding site, and that the transcription factor Sp1 mediates cAMP-dependent transcription of a reporter gene through binding to these sequences in Y1 cells (13). However, the mechanism by which Sp1 mediates responsiveness to cAMP is still unknown.
When sequences in the proximal promoter regions of CYP11A from different species are compared, another region between -57 and -32 bp is highly conserved among the bovine, rat, mouse, and human CYP11A genes (13, 14). This region contains the motif TAGCCTTG, similar to the consensus binding site of steroidogenic factor-1, SF-1 (or Ad4-BP), but in the inverted orientation. It was shown that the corresponding region in the rat P450scc gene was required for cAMP-dependent transcription of a reporter gene in rat granulosa cells (9). In the present study, we have investigated the role of this SF-1-like sequence in basal and cAMP-stimulated transcription of the bovine CYP11A gene. We have found that SF-1 binds specifically to the sequence within -57 and -32 bp in the bovine P450scc promoter. Mutations in the TAGCCTTG region abolished binding of SF-1 and markedly reduced both basal and cAMP-dependent transcription in mouse Y1 cells and bovine ovarian luteal cells. The role of this element appears to be mediated by SF-1, as shown by cotransfection experiments in nonsteroidogenic COS-1 cells. In addition, double mutation of both Sp1 and SF-1-like sequences eliminates both basal and cAMP-stimulated transcription. Furthermore, a construct containing both the Sp1 and SF-1 elements shows simultaneous binding of both transcription factors and also exhibits an increase in luciferase activity in response to protein kinase A (PKA). Finally, we provide evidence that Sp1 and SF-1 proteins associate in vivo. These results suggest that the combined action of Sp1 and SF-1 is required for both basal and cAMP-dependent transcription of the bovine CYP11A gene.
| RESULTS |
|---|
|
|
|---|
|
|
Activation of the Promoter Function of the CYP11A Gene by SF-1
To investigate the role of SF-1 in the activation of the bovine
CYP11A promoter, we carried out a transient transfection experiment by
expressing SF-1 in nonsteroidogenic COS-1 cells, which lack SF-1 as
shown in Fig. 2A
. The expression vector for SF-1 was cotransfected into
COS-1 cells together with the P450scc promoter constructs containing
the 5'-flanking sequence of the bovine CYP11A gene fused upstream of
the luciferase reporter gene. As illustrated in Fig. 3
, transcriptional activity of the -186/+12Luc and -101/+12Luc reporter
plasmids is about 3- and 2-fold higher, respectively, in the cells
cotransfected with SF-1 than in those cotransfected with only vector
plasmid DNA. To examine directly whether SF-1 activates the bovine
P450scc promoter via the -57/-32 bp sequence, a mutant -186/+12 bp
fragment containing the mutation (GG to TA) within the sequence between
-57 bp and -32 bp, similar to that used in the gel mobility shift
analysis shown in Fig. 2
, was inserted into the pGL3basic vector and
transfected together with the SF-1 expression vector into the COS-1
cells. As shown in Fig. 3
, expression of SF-1 had no effect on the
transcription of the mutant -186/+12SF1mLuc construct. These data
indicate that SF-1 is necessary for optimal promoter activity of the
bovine CYP11A gene via binding to the -57/-32 bp sequence.
|
To test whether the -57/-32 bp sequence contains another element
involved in both basal and cAMP-stimulated expression, luciferase
reporter plasmids containing the wild type and mutant -186/+12 bp
sequences were transfected into bovine luteal cells in primary culture.
As illustrated in Fig. 4A
, forskolin treatment resulted
in a 4-fold increase over control levels of luciferase activity with
the -186/+12Luc wild type plasmid. A promoter construct containing the
mutation between -57 and -32 bp, namely -186/+12SF1mLuc, showed
markedly decreased basal and forskolin-induced luciferase activity
compared with -186/+12Luc. Similar results were also obtained when the
wild type and mutant -186/-32 bp sequences were inserted into the
OVEC-ß-globin reporter gene vector containing the heterologous
minimal promoter of ß-globin gene and transfected into bovine luteal
cells (Fig. 4B
).
|
|
The effect of this mutation (GG to CC) within the -118/-101 bp
sequence was further examined employing gel mobility shift assay (Fig. 6
). Use of the wild type -118/-101 bp sequence as a
probe resulted in complexes A and B in the presence of bovine luteal
cell (Fig. 6A
) or Y1 cell nuclear extracts (Fig. 6B
), typical of Sp1
binding in those cells (12). A supershift complex was also formed when
nuclear extracts from either bovine luteal cells or Y1 cells were
incubated with the wild type -118/-101 bp sequence in the presence of
Sp1 antibody. Formation of two complexes was efficiently competed by
the unlabeled -118/-101 bp sequence, the -111/-101 bp sequence, and
the consensus Sp1 oligonucleotide, but not by the mutant
oligonucleotide, -118/-95M (TGGGAGGAGCT to
TGccAGGAGCT). Consistent with the gel competition results,
when the -111/-101 bp sequence was used as a probe, a binding
pattern similar to that observed with the -118/-101 bp was observed
(Fig. 6B
). Upon employing the -118/-95M sequence as a probe, no
DNA-protein complex was formed, indicating that the mutation abolished
nuclear protein binding. Thus, these results confirm that Sp1 binds to
the region from -111 bp to -101 bp and that the mutation within this
region eliminated the formation of DNA-protein complexes and markedly
reduced the response to cAMP and PKA in bovine luteal cells and Y1
cells, employing the homologous promoter.
|
To further characterize the functional relationship between SF-1 and
Sp1 elements, a -118/+12
52Luc construct, which contains the Sp1
element adjacent to the SF-1 site upstream of the endogenous CYP11A
TATA box, was created and transfected into Y1 cells. As shown in Fig. 7A
, this construct exhibited about 4-fold induction in
luciferase activity in the presence of overexpressed free catalytic
subunit of PKA. Its fold-induction is comparable to that of the
-118/+12Luc construct with the native P450scc promoter region from
-118 to +12 bp (5-fold). It is known that the region from -118 to +12
bp of the P450scc promoter is required for cAMP responsiveness (7, 12, 13), and the results from Fig. 7A
suggest that Sp1 and SF-1 are both
necessary for this response to cAMP. To investigate whether Sp1 could
interact with SF-1, gel mobility shift assay was performed with the
probes derived from the -118/+12
52Luc plasmid. When incubated with
Y1 cell nuclear extracts (Fig. 7B
), in addition to two complexes due to
Sp1 and one complex due to SF-1, a new complex was detected. This
slower mobility complex was competed by an excess of the -118/-101 bp
sequence, the consensus Sp1 element, the -57/-32 bp sequence, and the
consensus SF-1 sequence. It was also displaced partially by incubation
with anti-Sp1 antibody or totally by the presence of SF-1 antibody.
These data suggest that the complex contains both transcription
factors. Consistent with this, previous results from DNase I footprint
analysis of the bovine CYP11A 5'-flanking sequence have shown that a
broad region from -114 to -91 bp and a short sequence at -49 to -33
bp within the fragment from -186 to +12 bp are protected by increasing
amounts of Y1 nuclear proteins (7).
|
The GAL4-Sp1 and VP16-SF-1 expression vectors were transfected singly
or pairwise into Y1 cells along with G5Luc, a GAL4-responsive reporter
plasmid that contains five GAL4-binding sites upstream of the
luciferase gene (19). It has been shown that the GAL-Sp1 fusion protein
can activate transcription in a GAL4 binding site-dependent manner
(30). While optimal GAL4-Sp1 activation is achieved in Y1 and CV-1
cells with microgram quantities of the activator gene (Ref. 30 and data
not shown), we used smaller quantities to optimize for activation by
VP16-SF-1. As illustrated in Fig. 8A
, expression of the
VP16-SF-1 polypeptide alone had limited effect on luciferase activity.
However, coexpression of both GAL4-Sp1 and VP16-SF-1 polypeptides
generated a dramatic increase in luciferase activity to levels 6- or
28-fold higher, respectively, than those observed with GAL4-Sp1 or
VP16-SF-1 alone. We also applied this two-hybrid assay in
nonsteroidogenic COS-1 cells. As shown in Fig. 8B
, coexpression of the
GAL4-Sp1 and VP16-SF-1 polypeptides generated a marked increase in
luciferase activity, to levels 4- or 82-fold higher than those observed
with either GAL4-Sp1 or VP16-SF-1 alone, respectively. These data
suggest that Sp1 and SF-1 are either capable of a direct association or
interact via a common adapter protein in vivo.
|
| DISCUSSION |
|---|
|
|
|---|
In the present study, we have identified another sequence in the region
between -57 and -32 bp that is required for basal and cAMP-stimulated
expression. This sequence contains an SF-1-binding site in the inverted
orientation, which, as a consequence, had previously escaped detection.
Gel shift analysis indicates that the -57/-32 bp region is
specifically bound by one nuclear protein from bovine luteal cells and
Y1 cells, but not from nonsteroidogenic COS-1 cells. Forskolin
treatment does not affect the DNA-binding activity of this nuclear
protein. The bound nuclear protein is identified by antibody supershift
analysis to be the orphan nuclear receptor, SF-1, which is expressed in
a tissue-specific fashion (24, 25). Mutations within the SF-1 binding
region, which abolished nuclear protein binding, decreased both basal
and cAMP-dependent transcription (Figs. 5
and 6
), and eliminated
activation of the bovine P450scc promoter resulting from expression of
SF-1 in COS-1 cells (Fig. 3
).
From the results of the present study, it is apparent that SF-1 alone
is necessary, but not sufficient, for cAMP responsiveness, because
mutations within the -57/-32 bp sequence reduced, but did not
eliminate, basal and cAMP-stimulated luciferase activity compared with
the wild type construct (Figs. 5
and 6
). Additionally, the -101/+12Luc
construct that contains only the SF-1-binding site was expressed at
levels lower than the -186/+12Luc construct including both Sp1- and
SF-1-binding sites (Fig. 3
). To explore the functional synergism
between SF-1 and Sp1 in the regulation of bovine CYP11A gene
expression, the -186/+12Sp1mSF1mLuc construct that contains double
mutations of both the Sp1- and the SF-1-binding sequences was employed
in transient transfection assays. The double mutation abolished
promoter activity in either unstimulated or stimulated bovine luteal
cells, as well as in Y1 cells. In addition, the -118/+12
52Luc
construct containing only Sp1 and SF-1 elements upstream of CYP11A TATA
box showed a similar fold increase in the promoter activity, compared
with the construct with the native -118 to +12 bp region, although
basal activity was less. Furthermore, a complex composed of both Sp1
and SF-1 was detected by gel mobility shift assay (Fig. 7
). These
results suggest that a cooperative relationship exists between SF-1 and
Sp1 to mediate basal and cAMP-stimulated expression of the bovine
CYP11A gene. To our knowledge, this is the first report to show the
cooperative involvement of both Sp1 and SF-1 in the regulation of
bovine CYP11A expression.
Recent studies (13) have demonstrated the presence of a second sequence
element located at -70 to -50 bp of the bovine CYP11A gene, which
also binds Sp1 and supports cAMP-induced transcription when subcloned
into the OVEC vector and transfected into Y1 cells. However, the OVEC
vector has a potential SF-1-binding site in the reverse orientation
adjacent to its TATA box. This SF-1 site was shown to bind the SF-1
protein by gel mobility shift assay (data not shown). These data
suggest that the -70/-50 bp sequence may also mediate cAMP
responsiveness in cooperation with SF-1. They may explain also why
constructs containing mutations within the -111/-101 bp sequence
still show modest responsiveness to cAMP in Y1 cells (Fig. 5
). However,
the -118/+12
15Luc construct with an internal deletion of the
-70/-50 bp element exhibited similar level of transcriptional
activity to the wild type -118/+12Luc construct (data not shown), and
the -118/+12
52Luc construct showed a similar fold increase in
luciferase activity to the -118/+12Luc construct, although basal
activity was less. These results indicate that the promoter region
lacking the -70/-50-bp sequence is sufficient for basal and
cAMP-dependent transcription of bovine CYP11A gene, although the
-70/-50 bp sequence might play a complementary role in modulating
cAMP responsiveness.
SF-1 is known as a regulator for many steroidogenic genes, such
as human (11, 31) and rat (9) CYP11A, human CYP19 (32), bovine CYP11B
(31), and rat CYP17 (33). All those studies showed that SF-1 could
mediate cAMP responsiveness, but the mechanism for the functional role
of SF-1 in the cAMP-PKA signal transduction pathway was not clear.
While the role of SF-1 may not be mediated by increased DNA-binding
activity, but in part mediated by induced SF-1 expression (32) and/or
phosphorylation by PKA, SF-1 was suspected to interact with other
nuclear factor(s) that bound to specific DNA sequences in mediating the
cAMP-induced transcription of bovine CYP11B (31), human (11, 31), and
rat (9) CYP11A. The two-hybrid analysis (Fig. 8
) further suggests that
interaction between Sp1 and SF-1 may be involved in this regulation of
the bovine CYP11A promoter activity. Thus, our present study provides
evidence for the first time which suggests that the transcription
factor Sp1 is able to interact with SF-1 to regulate bovine CYP11A
promoter activity.
It has been shown that Sp1 can interact with several other transcription factors, such as p53, bovine papillomavirus type 1 (BPV-1) protein E2, retinoblastoma (RB) protein, and CCAAT/enhancer binding protein ß (C/EBPß), to regulate gene transcription (30, 34, 35, 36). Since Sp1 does not have a PKA phosphorylation site, it was suspected that an unidentified coactivator might be a target for PKA in execution of its role in coupling the ubiquitous transcription factor Sp1 with cAMP-dependent transcription (13). From our studies, it appears that cAMP and PKA might stimulate bovine CYP11A gene expression through an Sp1-SF-1 interaction. However, an attempt to show direct interaction between Sp1 and SF-1 by coimmunoprecipitation was unsuccessful. Furthermore, no significant induction of luciferase activity was produced in the reciprocal two-hybrid experiment involving coexpression of GAL4-SF-1 and VP16-Sp1 (data not shown). It is possible that Sp1 interacts with SF-1 through unidentified adapter protein(s). Perhaps the adapter protein(s) functions like CREB-binding protein (CBP), which serves as a common coactivator required for the function of nuclear receptors such as cAMP response element-binding protein (CREB) and AP-1 (37). Thus, it is not clear, at this point, whether PKA stimulates CYP11A gene expression by stabilizing an SF-1-Sp1 interaction, by potentiating SF-1 activity, or by regulation of the activity of an unknown adapter protein.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture
Bovine ovaries were obtained at a local slaughterhouse,
and corpora lutea corresponding to early or midstages of the luteal
phase were selected. Luteal cells were prepared as described previously
(5, 15), cultured in McCoys 5A medium supplemented as described
previously (5), and allowed to grow to confluency (56 days) before
transfection. The Y1 and COS-1 cells were routinely maintained in DMEM
supplemented with 10% bovine calf serum at 37 C in a 5%
CO2 incubator.
Oligonucleotides
Complementary single-stranded oligonucleotides were synthesized
and annealed to generate the following double-stranded oligonucleotides
representing both wild type and mutant bovine P450scc promoter
elements. The sequences containing consensus GC-rich double-strand
oligonucleotide, which binds transcription factor Sp1, and a consensus
SF-1 binding site are also shown. a) -118/-101
ACTGAGTCTGGGAGGAGCG
tcgagTGACTCAGACCCTCCTCGCagct b) -111/-101
TGGGAGGAGCG
tcgagACCCTCCTCGCagct c) -118/-95 M
ACTGAGTCTGccAGGAGCTGTGTG
TGACTCAGACggTCCTCGACACAC d) -57/-32
GCTTCTCACTTAGCCTTGAGCTGGTG
CGAAGAGTGAATCGGAACTCGACCAC e) -57/-32 M
GCTTCTCACTTAGtaTTGAGCTGGTG
CGAAGAGTGAATCatAACTCGACCAC f) consensus Sp1
GCGATCGGGGCGGGGCG
tcgaCGCTAGCCCCGCCCCGCagct g) consensus SF-1 motif
CACTCTACCAAGGTCAGAAATG
tcgaGTGAGATGGTTCCAGTCTTTACagct h) -114/-35
52
AGTCTGGGAGGAGCTTTAGCCTTGAGCTG
TCAGACCCTCCTCGAAATCGGAACTCGAC
DNA Reporter Gene Constructs
The expression systems used are the luciferase reporter gene
plasmid, pGL3basic, which is a promoterless vector, purchased from
Promega (Madison, WI), and the OVEC vector containing a minimal
ß-globin promoter as described previously (6) and generously provided
by Dr. W. Schaffner.
Luciferase reporter gene constructs containing -186/+12 bp, -118/+12
bp, and -101/+12 bp of the bovine CYP11A gene were made in the
following way: the -186/-9 bp fragment was amplified by PCR using the
-896/-32 bp fragment as a template and a primer containing the
sequence from -32 to -9 bp. The second PCR reaction was conducted to
amplify the -186/+12 bp fragment, using the -186/-9 bp fragment as a
template and a primer including the region from -9 to +12 bp. A
SalI site and a SacI site were introduced in the
3' and 5'-primer, respectively, to facilitate cloning into the
pGL3basic vector. The resultant fragment was cloned into the
SacI-SalI sites of the pGL3basic vector, just
upstream of the coding region of the luciferase reporter gene. From
this plasmid a series of CYP11A gene fragments were deleted by PCR. The
construction of plasmids containing the mutated -186/+12 bp fragment
was conducted as follows: the -186/+12 bp fragment was mutagenized by
overlap extension using PCR (16) and then subcloned into the
SacI-SalI sites of the pGL3basic vector. The
-118/+12
52Luc construct was also made by a similar method. All
plasmid constructions were confirmed by restriction digestion and
dideoxy sequencing. The expression vectors for the wild type and the
mutated catalytic subunit of PKA were kindly provided by Dr. R.
Maurer.
The OVEC reporter gene constructs containing the wild type -186/-32 bp fragment and mutants thereof inserted upstream of the rabbit ß-globin TATA box were made as described by Ahlgren et al. (6).
Plasmids encoding the GAL4-Sp1 and VP16-Sp1 hybrid polypeptides were constructed by inserting the XhoI fragment from pPacSp1, kindly provided by Dr. R. Tjian, into the SalI site of the pM and pVP16 expression vectors (17), respectively. To produce plasmids encoding GAL4-SF-1 and VP16-SF-1, the fragment including the entire SF-1-coding region was amplified by PCR from the pRc/RSV-SF-1 expression vector, kindly provided by Dr. K. Morohashi. A HindIII site was introduced in both 5'- and 3'-primers. The amplified fragment was cloned into the HindIII site of pM and pVP16 vectors, respectively.
Transient Cell Transfections
Mouse Y1 adrenocortical tumor cells were maintained in
DMEM supplemented with 10% bovine calf serum and antibiotics. On the
day before transfection, about 2 x 106 cells were
seeded in each 60-mm dish. The next morning the medium was changed, and
2 h later the DNA was added to the cells by the calcium-phosphate
method (18) using 5 µg of plasmid/60-mm dish. After 4 h of
exposure to the DNA precipitates, the cells were shocked with 15%
glycerol for 1 min at room temperature. The medium was changed the
morning after transfection, and the cells were maintained in the
presence of 10% serum.
Confluent bovine luteal cells were removed from the culture dishes using trypsin/EDTA solution and resuspended in McCoys 5A medium. Transfection was achieved by electroporation using a cell porator (Bethesda Research Laboratories). Two consecutive discharges (750 V/cm and 1180 µFarads) were applied to 3 x 106 cells in 1 ml of McCoys 5A medium containing 75 µg of test plasmid and 4 µg of internal reference plasmid pCMVLac, as reported previously by Lauber et al. (5). After an overnight plating of the transfected cells in McCoys 5A medium containing 2.5% bovine calf serum, the treatments were started the day after transfection in McCoys 5A medium without serum for 12 h and continued in the presence of 25 µM forskolin for 12 h. For OVEC reporter gene constructs, the transfection procedure was the same as described except 100 µg of test plasmid and 2 µg of internal reference vector OVEC-REF were used, and the cells were exposed to forskolin for 9 h the day after transfection.
COS-1 cells were maintained in DMEM supplemented with 10% bovine calf serum and antibiotics. Plasmid DNA (1 µg) was transfected into COS-1 cells using the lipofectamine method (Bethesda Research Laboratories). After 48 h, the cells were lysed and the cell lysates were used for luciferase assay.
The Two-Hybrid Assay
Approximately 2 x 106 Y1 cells were
seeded onto each 60-mm plate and cultured in 5 ml of growth medium.
After 1 day, each 60-mm culture was transfected with 1.5 µg of the
G5LUC reporter plasmid (19), 25 ng of a GAL4-hybrid expression plasmid,
and/or 1.5 µg of a VP16-hybrid expression plasmid, and 0.25 µg of
internal reference plasmid pCMVLac. After 48 h of culture the
cells were lysed and used for luciferase assay.
Gel Retardation Assay
Nuclear extracts were prepared from mouse Y1
adrenocortical tumor cells and bovine luteal cells in primary culture
as described by Dignam et al. (20). The double-stranded
oligonucleotides were labeled by T4 polynucleotide kinase using
[
-32P]dATP or by Klenow labeling using
[
-32P]dCTP, and then incubated (10,000 cpm) with
nuclear extracts (10 µg of protein) on ice for 10 min (21). For the
competition assays, 500-fold molar excess of unlabeled oligonucleotide
used as a competitor was added simultaneously with the labeled
fragment. The resulting DNA-protein complexes were analyzed by
electrophoresis using an 8% polyacrylamide gel with 0.5 x
Tris-borate-EDTA as the running buffer (22). Supershift assays were
also conducted as described above except 1 µg of anti-Sp1 antibody
(Santa Cruz Biotech., Santa Cruz, CA) was added to the DNA-protein
complexes after 10 min incubation on ice. Incubation of the DNA-protein
complexes with the antibody continued for an additional 30 min at room
temperature before electrophoresis. In some experiments, nuclear
extract proteins were preincubated with anti-SF-1 polyclonal antibody,
provided by Dr. K. Morohashi, or preimmune serum at room temperature
for 30 min before addition to the binding reaction.
Luciferase and ß-Galactosidase Assays
Forty-eight hours after the transfection, the cells
were lysed with 300 µl of 1% Triton X-100, 0.1 M
phosphate buffer, pH 7.8, 2 mM EDTA, and 1 mM
dithiothreitol. The luciferase assays were conducted essentially after
the protocol provided by Analytical Luminescence Laboratory (San Diego,
CA). Fifty microliters of lysate were added to 100 µl of substrate A,
and the luciferase reaction was initiated by the injection of 100 µl
of substrate B. Light output was measured for 10 sec at room
temperature using a monolight luminometer (Analytical Luminescence
Laboratory, San Diego, CA). ß-Galactosidase activity was measured
using a chemiluminescent reporter assay kit (TROPIX, Bedford, MA).
Twenty microliters of lysate were added to 200 µl of reaction buffer
and incubated at room temperature for 60 min. After the addition of 300
µl of light emission accelerator, light output was measured for 5 sec
using a monolight luminometer.
S1 Nuclease Protection Assay
Total RNA was isolated using a RNAzol B method
(Biotecx Laboratories, Inc. Houston, TX). ß-Globin transcripts were
detected and quantitated using a single-stranded rabbit
ß-globin-specific oligonucleotide (93 mer) (6). After hybridization
of the 32P-labeled probe with RNA (10 µg), it was
digested with S1 nuclease, and correctly initiated protected fragments
(75 nucleotides) were separated from free probe (93 nucleotides) by
electrophoresis. Specific bands were visualized by autoradiography.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported, in part, by USPHS Grant 5-ROI-HD13234 and by Grant I-1228 from the Robert A. Welch Foundation.
Received for publication September 3, 1996. Revision received November 18, 1996. Accepted for publication November 20, 1996.
| REFERENCES |
|---|
|
|
|---|
) gene
expression in bovine luteal cells in primary culture. J Biol Chem 266:1117011175
-hydroxylase/c1720 lyase). Mol Endocrinol 10:147158This article has been cited by other articles:
![]() |
A. C. Kim, F. M. Barlaskar, J. H. Heaton, T. Else, V. R. Kelly, K. T. Krill, J. O. Scheys, D. P. Simon, A. Trovato, W.-H. Yang, et al. In Search of Adrenocortical Stem and Progenitor Cells Endocr. Rev., May 1, 2009; 30(3): 241 - 263. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-H. Yang, J. H. Heaton, H. Brevig, S. Mukherjee, J. A. Iniguez-Lluhi, and G. D. Hammer SUMOylation Inhibits SF-1 Activity by Reducing CDK7-Mediated Serine 203 Phosphorylation Mol. Cell. Biol., February 1, 2009; 29(3): 613 - 625. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fukami, Y. Wada, M. Okada, F. Kato, N. Katsumata, T. Baba, K.-i. Morohashi, J. Laporte, M. Kitagawa, and T. Ogata Mastermind-like Domain-containing 1 (MAMLD1 or CXorf6) Transactivates the Hes3 Promoter, Augments Testosterone Production, and Contains the SF1 Target Sequence J. Biol. Chem., February 29, 2008; 283(9): 5525 - 5532. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Kuhl, S. M. Ross, and K. W. Gaido CCAAT/Enhancer Binding Protein {beta}, But Not Steroidogenic Factor-1, Modulates the Phthalate-Induced Dysregulation of Rat Fetal Testicular Steroidogenesis Endocrinology, December 1, 2007; 148(12): 5851 - 5864. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Yaspan, J. P. Breyer, Q. Cai, Q. Dai, J. B. Elmore, I. Amundson, K. M. Bradley, X.-O. Shu, Y.-T. Gao, W. D. Dupont, et al. Haplotype Analysis of CYP11A1 Identifies Promoter Variants Associated with Breast Cancer Risk Cancer Res., June 15, 2007; 67(12): 5673 - 5682. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sher, N. Yivgi-Ohana, and J. Orly Transcriptional Regulation of the Cholesterol Side Chain Cleavage Cytochrome P450 Gene (CYP11A1) Revisited: Binding of GATA, Cyclic Adenosine 3',5'-Monophosphate Response Element-Binding Protein and Activating Protein (AP)-1 Proteins to a Distal Novel Cluster of cis-Regulatory Elements Potentiates AP-2 and Steroidogenic Factor-1-Dependent Gene Expression in the Rodent Placenta and Ovary Mol. Endocrinol., April 1, 2007; 21(4): 948 - 962. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A Brown, K. Sayasith, N. Bouchard, J. G Lussier, and J. Sirois Molecular cloning of equine 17{beta}-hydroxysteroid dehydrogenase type 1 and its downregulation during follicular luteinization in vivo J. Mol. Endocrinol., January 1, 2007; 38(1): 67 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Winnay, J. Xu, B. W. O'Malley, and G. D. Hammer Steroid Receptor Coactivator-1-Deficient Mice Exhibit Altered Hypothalamic-Pituitary-Adrenal Axis Function Endocrinology, March 1, 2006; 147(3): 1322 - 1332. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Bassett, B. Mayhew, K. Rehman, P. C. White, F. Mantero, G. Arnaldi, P. M. Stewart, I. Bujalska, and W. E. Rainey Expression Profiles for Steroidogenic Enzymes in Adrenocortical Disease J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5446 - 5455. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Huang, A. Dardis, and W. L. Miller Regulation of Cytochrome b5 Gene Transcription by Sp3, GATA-6, and Steroidogenic Factor 1 in Human Adrenal NCI-H295A Cells Mol. Endocrinol., August 1, 2005; 19(8): 2020 - 2034. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Seenundun and B. Robaire Cloning and Characterization of the 5{alpha}-Reductase Type 2 Promoter in the Rat Epididymis Biol Reprod, April 1, 2005; 72(4): 851 - 861. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Pierre, C Pisselet, J Dupont, B Mandon-Pepin, D Monniaux, P Monget, and S Fabre Molecular basis of bone morphogenetic protein-4 inhibitory action on progesterone secretion by ovine granulosa cells J. Mol. Endocrinol., December 1, 2004; 33(3): 805 - 817. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Curtin, H. A. Ferris, M. Hakli, M. Gibson, O. A. Janne, J. J. Palvimo, and M. A. Shupnik Small Nuclear RING Finger Protein Stimulates the Rat Luteinizing Hormone-{beta} Promoter by Interacting with Sp1 and Steroidogenic Factor-1 and Protects from Androgen Suppression Mol. Endocrinol., May 1, 2004; 18(5): 1263 - 1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Manna, D. W. Eubank, and D. M. Stocco Assessment of the Role of Activator Protein-1 on Transcription of the Mouse Steroidogenic Acute Regulatory Protein Gene Mol. Endocrinol., March 1, 2004; 18(3): 558 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Sriraman and J. S. Richards Cathepsin L Gene Expression and Promoter Activation in Rodent Granulosa Cells Endocrinology, February 1, 2004; 145(2): 582 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Hammer, N. A. Compagnone, J.-L. Vigne, S. R. Bair, and S. H. Mellon Transcriptional Regulation of P450scc Gene Expression in the Embryonic Rodent Nervous System Endocrinology, February 1, 2004; 145(2): 901 - 912. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Val, C. Aigueperse, B. Ragazzon, G. Veyssiere, A.-M. Lefrancois-Martinez, and A. Martinez Adrenocorticotropin/3',5'-Cyclic AMP-Mediated Transcription of the Scavenger akr1-b7 Gene in Adrenocortical Cells Is Dependent on Three Functionally Distinct Steroidogenic Factor-1-Responsive Elements Endocrinology, February 1, 2004; 145(2): 508 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Borud, G. Mellgren, J. Lund, and M. Bakke Cloning and Characterization of a Novel Zinc Finger Protein that Modulates the Transcriptional Activity of Nuclear Receptors Mol. Endocrinol., November 1, 2003; 17(11): 2303 - 2319. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Whale, D. C. Eckery, and J. L. Juengel Determination of Steroidogenic Potential of Ovarian Cells of the Brushtail Possum (Trichosurus vulpecula) Biol Reprod, September 1, 2003; 69(3): 947 - 958. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sadie, G. Styger, and J. Hapgood Expression of the Mouse Gonadotropin-Releasing Hormone Receptor Gene in {alpha}T3-1 Gonadotrope Cells Is Stimulated by Cyclic 3',5'-Adenosine Monophosphate and Protein Kinase A, and Is Modulated by Steroidogenic Factor-1 and Nur77 Endocrinology, May 1, 2003; 144(5): 1958 - 1971. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Martinez, P. Val, I. Sahut-Barnola, C. Aigueperse, G. Veyssiere, and A.-M. Lefrancois-Martinez Steroidogenic Factor-1 Controls the Aldose Reductase akr1b7 Gene Promoter in Transgenic Mice through an Atypical Binding Site Endocrinology, May 1, 2003; 144(5): 2111 - 2120. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Sriraman, S. C. Sharma, and J. S. Richards Transactivation of the Progesterone Receptor Gene in Granulosa Cells: Evidence that Sp1/Sp3 Binding Sites in the Proximal Promoter Play a Key Role in Luteinizing Hormone Inducibility Mol. Endocrinol., March 1, 2003; 17(3): 436 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sekiguchi, T. Mizutani, K. Yamada, T. Yazawa, H. Kawata, M. Yoshino, T. Kajitani, T. Kameda, T. Minegishi, and K. Miyamoto Transcriptional Regulation of the Epiregulin Gene in the Rat Ovary Endocrinology, December 1, 2002; 143(12): 4718 - 4729. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wei, M. Sasaki, H. Huang, V. L. Dawson, and T. M. Dawson The Orphan Nuclear Receptor, Steroidogenic Factor 1, Regulates Neuronal Nitric Oxide Synthase Gene Expression in Pituitary Gonadotropes Mol. Endocrinol., December 1, 2002; 16(12): 2828 - 2839. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Desclozeaux, I. N. Krylova, F. Horn, R. J. Fletterick, and H. A. Ingraham Phosphorylation and Intramolecular Stabilization of the Ligand Binding Domain in the Nuclear Receptor Steroidogenic Factor 1 Mol. Cell. Biol., October 15, 2002; 22(20): 7193 - 7203. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Val, A. Martinez, I. Sahut-Barnola, C. Jean, G. Veyssiere, and A.-M. Lefrancois-Martinez A 77-Base Pair LINE-Like Sequence Elicits Androgen-Dependent mvdp/akr1-b7 Expression in Mouse Vas Deferens, But Is Dispensable for Adrenal Expression in Rats Endocrinology, September 1, 2002; 143(9): 3435 - 3448. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Salvador, Y. Park, J. Cottom, E. T. Maizels, J. C. R. Jones, R. V. Schillace, D. W. Carr, P. Cheung, C. D. Allis, J. L. Jameson, et al. Follicle-stimulating Hormone Stimulates Protein Kinase A-mediated Histone H3 Phosphorylation and Acetylation Leading to Select Gene Activation in Ovarian Granulosa Cells J. Biol. Chem., October 19, 2001; 276(43): 40146 - 40155. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Lin, J. W. M. Martens, and W. L. Miller NF-1C, Sp1, and Sp3 Are Essential for Transcription of the Human Gene for P450c17 (Steroid 17{alpha}-hydroxylase/17,20 lyase) in Human Adrenal NCI-H295A Cells Mol. Endocrinol., August 1, 2001; 15(8): 1277 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. de Santa Barbara, C. Méjean, B. Moniot, M.-H. Malclès, P. Berta, and B. Boizet-Bonhoure Steroidogenic Factor-1 Contributes to the Cyclic-Adenosine Monophosphate Down-Regulation of Human SRY Gene Expression Biol Reprod, March 1, 2001; 64(3): 775 - 783. [Abstract] [Full Text] |
||||
![]() |
H. Pincas, K. Amoyel, R. Counis, and J.-N. Laverrière Proximal cis-Acting Elements, Including Steroidogenic Factor 1, Mediate the Efficiency of a Distal Enhancer in the Promoter of the Rat Gonadotropin-Releasing Hormone Receptor Gene Mol. Endocrinol., February 1, 2001; 15(2): 319 - 337. [Abstract] [Full Text] |
||||
![]() |
C. Aigueperse, P. Val, C. Pacot, C. Darne, E. Lalli, P. Sassone-Corsi, G. Veyssiere, C. Jean, and A. Martinez SF-1 (Steroidogenic Factor-1), C/EBP{beta} (CCAAT/Enhancer Binding Protein), and Ubiquitous Transcription Factors NF1 (Nuclear Factor 1) and Sp1 (Selective Promoter Factor 1) Are Required for Regulation of the Mouse Aldose Reductase-Like Gene (AKR1B7) Expression in Adrenocortical Cells Mol. Endocrinol., January 1, 2001; 15(1): 93 - 111. [Abstract] [Full Text] |
||||
![]() |
D. Boerboom and J. Sirois Equine P450 Cholesterol Side-Chain Cleavage and 3{beta}-Hydroxysteroid Dehydrogenase/{{Delta}}5-{{Delta}}4 Isomerase: Molecular Cloning and Regulation of Their Messenger Ribonucleic Acids in Equine Follicles During the Ovulatory Process Biol Reprod, January 1, 2001; 64(1): 206 - 215. [Abstract] [Full Text] |
||||
![]() |
S. Chen, X. Liu, and D. L. Segaloff A Novel Cyclic Adenosine 3',5'-Monophosphate-Responsive Element Involved In the Transcriptional Regulation of the Lutropin Receptor Gene in Granulosa Cells Mol. Endocrinol., September 1, 2000; 14(9): 1498 - 1508. [Abstract] [Full Text] |
||||
![]() |
U. B. Kaiser, L. M. Halvorson, and M. T. Chen Sp1, Steroidogenic Factor 1 (SF-1), and Early Growth Response Protein 1 (Egr-1) Binding Sites Form a Tripartite Gonadotropin-Releasing Hormone Response Element in the Rat Luteinizing Hormone-{beta} Gene Promoter: an Integral Role for SF-1 Mol. Endocrinol., August 1, 2000; 14(8): 1235 - 1245. [Abstract] [Full Text] |
||||
![]() |
T. Sugawara, M. Saito, and S. Fujimoto Sp1 and SF-1 Interact and Cooperate in the Regulation of Human Steroidogenic Acute Regulatory Protein Gene Expression Endocrinology, August 1, 2000; 141(8): 2895 - 2903. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Xie, R. Duan, I. Chen, I. Samudio, and S. Safe Transcriptional Activation of Thymidylate Synthase by 17{beta}-Estradiol in MCF-7 Human Breast Cancer Cells Endocrinology, July 1, 2000; 141(7): 2439 - 2449. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Vines and D. A. Weigent Identification of SP3 as a Negative Regulatory Transcription Factor in the Monocyte Expression of Growth Hormone Endocrinology, March 1, 2000; 141(3): 938 - 946. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Barnea and Y. Bergman Synergy of SF1 and RAR in Activation of Oct-3/4 Promoter J. Biol. Chem., February 25, 2000; 275(9): 6608 - 6619. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ito, Y. Park, J. Weck, K. E. Mayo, and J. L. Jameson Synergistic Activation of the Inhibin {alpha}-Promoter by Steroidogenic Factor-1 and Cyclic Adenosine 3',5'-Monophosphate Mol. Endocrinol., January 1, 2000; 14(1): 66 - 81. [Abstract] [Full Text] |
||||
![]() |
D. Lopez and M. P. McLean Sterol Regulatory Element-Binding Protein-1a Binds to cis Elements in the Promoter of the Rat High Density Lipoprotein Receptor SR-BI Gene Endocrinology, December 1, 1999; 140(12): 5669 - 5681. [Abstract] [Full Text] |
||||
![]() |
K. Kawabe, T. Shikayama, H. Tsuboi, S. Oka, K. Oba, T. Yanase, H. Nawata, and K.-i. Morohashi Dax-1 as One of the Target Genes of Ad4BP/SF-1 Mol. Endocrinol., August 1, 1999; 13(8): 1267 - 1284. [Abstract] [Full Text] |
||||
![]() |
P. Pena, A. T. Reutens, C. Albanese, M. DAmico, G. Watanabe, A. Donner, I-W. Shu, T. Williams, and R. G. Pestell Activator Protein-2 Mediates Transcriptional Activation of the CYP11A1 Gene by Interaction with Sp1 Rather than Binding to DNA Mol. Endocrinol., August 1, 1999; 13(8): 1402 - 1416. [Abstract] [Full Text] |
||||
![]() |
Y.-K. Lee, K. L. Parker, H.-S. Choi, and D. D. Moore Activation of the Promoter of the Orphan Receptor SHP by Orphan Receptors That Bind DNA as Monomers J. Biol. Chem., July 23, 1999; 274(30): 20869 - 20873. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ahlgren, G. Suske, M. R. Waterman, and J. Lund Role of Sp1 in cAMP-dependent Transcriptional Regulation of the Bovine CYP11A Gene J. Biol. Chem., July 2, 1999; 274(27): 19422 - 19428. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lopez, T. W. Sandhoff, and M. P. McLean Steroidogenic Factor-1 Mediates Cyclic 3',5'-Adenosine Monophosphate Regulation of the High Density Lipoprotein Receptor Endocrinology, July 1, 1999; 140(7): 3034 - 3044. [Abstract] [Full Text] |
||||
![]() |
E. Silverman, S. Eimerl, and J. Orly CCAAT Enhancer-binding Protein beta and GATA-4 Binding Regions within the Promoter of the Steroidogenic Acute Regulatory Protein (StAR) Gene Are Required for Transcription in Rat Ovarian Cells J. Biol. Chem., June 18, 1999; 274(25): 17987 - 17996. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chen, H. Shi, X. Liu, and D. L. Segaloff Multiple Elements and Protein Factors Coordinate the Basal and Cyclic Adenosine 3',5'-Monophosphate-Induced Transcription of the Lutropin Receptor Gene in Rat Granulosa Cells Endocrinology, May 1, 1999; 140(5): 2100 - 2109. [Abstract] [Full Text] |
||||
![]() |
T. W. Sandhoff, D. B. Hales, K. H. Hales, and M. P. McLean Transcriptional Regulation of the Rat Steroidogenic Acute Regulatory Protein Gene by Steroidogenic Factor 1 Endocrinology, December 1, 1998; 139(12): 4820 - 4831. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Young and M. J. McPhaul A Steroidogenic Factor-1-Binding Site and Cyclic Adenosine 3',5'-Monophosphate Response Element-Like Elements Are Required for the Activity of the Rat Aromatase Promoter in Rat Leydig Tumor Cell Lines Endocrinology, December 1, 1998; 139(12): 5082 - 5093. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dajee, G. H. Fey, and J. S. Richards Stat 5b and the Orphan Nuclear Receptors Regulate Expression of the {alpha}2-Macroglobulin ({alpha}2M) Gene in Rat Ovarian Granulosa Cells Mol. Endocrinol., September 1, 1998; 12(9): 1393 - 1409. [Abstract] [Full Text] |
||||
![]() |
J. W. Clemens, R. L. Robker, W. L. Kraus, B. S. Katzenellenbogen, and J. S. Richards Hormone Induction of Progesterone Receptor (PR) Messenger Ribonucleic Acid and Activation of PR Promoter Regions in Ovarian Granulosa Cells: Evidence for a Role of Cyclic Adenosine 3',5'-Monophosphate but Not Estradiol Mol. Endocrinol., August 1, 1998; 12(8): 1201 - 1214. [Abstract] [Full Text] |
||||
![]() |
L. M. Halvorson, M. Ito, J. L. Jameson, and W. W. Chin Steroidogenic Factor-1 and Early Growth Response Protein 1 Act through Two Composite DNA Binding Sites to Regulate Luteinizing Hormone beta -Subunit Gene Expression J. Biol. Chem., June 12, 1998; 273(24): 14712 - 14720. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. B. Kaiser, E. Sabbagh, M. T. Chen, W. W. Chin, and B. D. Saunders Sp1 Binds to the Rat Luteinizing Hormone beta (LHbeta ) Gene Promoter and Mediates Gonadotropin-releasing Hormone-stimulated Expression of the LHbeta Subunit Gene J. Biol. Chem., May 22, 1998; 273(21): 12943 - 12951. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Harris and P. L. Mellon The Basic Helix-Loop-Helix, Leucine Zipper Transcription Factor, USF (Upstream Stimulatory Factor), Is a Key Regulator of SF-1 (Steroidogenic Factor-1) Gene Expression in Pituitary Gonadotrope and Steroidogenic Cells Mol. Endocrinol., May 1, 1998; 12(5): 714 - 726. [Abstract] [Full Text] |
||||
![]() |
J. M. Burrin, S. J. B. Aylwin, J. G. Holdstock, and U. Sahye Mechanism of Action of Pituitary Adenylate Cyclase-Activating Polypeptide on Human Glycoprotein Hormone {alpha}-Subunit Transcription in {alpha}T3-1 Gonadotropes Endocrinology, April 1, 1998; 139(4): 1731 - 1737. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Monte, F. DeWitte, and D. W. Hum Regulation of the Human P450scc Gene by Steroidogenic Factor 1 Is Mediated by CBP/p300 J. Biol. Chem., February 20, 1998; 273(8): 4585 - 4591. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ito, R. N. Yu, and J. L. Jameson Steroidogenic Factor-1 Contains a Carboxy-Terminal Transcriptional Activation Domain That Interacts with Steroid Receptor Coactivator-1 Mol. Endocrinol., February 1, 1998; 12(2): 290 - 301. [Abstract] [Full Text] |
||||
![]() |
Y. Sadovsky and P. A. Crawford Developmental and Physiologic Roles of the Nuclear Receptor Steroidogenic Factor-I in the Reproductive System Reproductive Sciences, January 1, 1998; 5(1): 6 - 12. [Abstract] [PDF] |
||||
![]() |
T. N. Alliston, A. C. Maiyar, P. Buse, G. L. Firestone, and J. S. Richards Follicle Stimulating Hormone-Regulated Expression of Serum/Glucocorticoid-Inducible Kinase in Rat Ovarian Granulosa Cells: A Functional Role for the Sp1 Family in Promoter Activity Mol. Endocrinol., December 1, 1997; 11(13): 1934 - 1949. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Mizutani, K. Yamada, T. Minegishi, and K. Miyamoto Transcriptional Regulation of Rat Scavenger Receptor Class B Type I Gene J. Biol. Chem., July 14, 2000; 275(29): 22512 - 22519. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stoner, F. Wang, M. Wormke, T. Nguyen, I. Samudio, C. Vyhlidal, D. Marme, G. Finkenzeller, and S. Safe Inhibition of Vascular Endothelial Growth Factor Expression in HEC1A Endometrial Cancer Cells through Interactions of Estrogen Receptor alpha and Sp3 Proteins J. Biol. Chem., July 21, 2000; 275(30): 22769 - 22779. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Gizard, B. Lavallee, F. DeWitte, and D. W. Hum A Novel Zinc Finger Protein TReP-132 Interacts with CBP/p300 to Regulate Human CYP11A1 Gene Expression J. Biol. Chem., August 31, 2001; 276(36): 33881 - 33892. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Jacob, J. Lund, P. Martinez, and L. Hedin Acetylation of Steroidogenic Factor 1 Protein Regulates Its Transcriptional Activity and Recruits the Coactivator GCN5 J. Biol. Chem., September 28, 2001; 276(40): 37659 - 37664. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |