help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cleutjens, K. B. J. M.
Right arrow Articles by Trapman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cleutjens, K. B. J. M.
Right arrow Articles by Trapman, J.
Molecular Endocrinology 11 (2): 148-161
Copyright © 1997 by The Endocrine Society

An Androgen Response Element in a Far Upstream Enhancer Region Is Essential for High, Androgen-Regulated Activity of the Prostate-Specific Antigen Promoter

Kitty B. J. M. Cleutjens, Hetty A. G. M. van der Korput, Conny C. E. M. van Eekelen, Henri C. J. van Rooij, Peter W. Faber1 and Jan Trapman

Department of Pathology Erasmus University 3000 DR Rotterdam, The Netherlands


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Prostate-specific antigen (PSA) is expressed at a high level in the luminal epithelial cells of the prostate and is absent or expressed at very low levels in other tissues. PSA expression can be regulated by androgens. Previously, two functional androgen-response elements were identified in the proximal promoter of the PSA gene. To detect additional, more distal control elements, DNaseI-hypersensitive sites (DHSs) upstream of the PSA gene were mapped in chromatin from the prostate-derived cell line LNCaP grown in the presence and absence of the synthetic androgen R1881. In a region 4.8 to 3.8 kb upstream of the transcription start site of the PSA gene, a cluster of three DHSs was detected. The middle DNAseI-hypersensitive site (DHSII, at ~-4.2 kb) showed strong androgen responsiveness in LNCaP cells and was absent in chromatin from HeLa cells. Further analysis of the region encompassing DHSII provided evidence for the presence of a complex, androgen-responsive and cell-specific enhancer. In transient transfected LNCaP cells, PSA promoter constructs containing this upstream enhancer region showed approximately 3000-fold higher activity in the presence than in the absence of R1881. The core region of the enhancer could be mapped within a 440-bp fragment. The enhancer showed synergistic cooperation with the proximal PSA promoter and was found to be composed of at least three separate regulatory regions. In the center, a functionally active, high-affinity androgen receptor binding site (GGAACATATTGTATC) could be identified. Mutation of this element almost completely abolished PSA promoter activity. Transfection experiments in prostate and nonprostate cell lines showed largely LNCaP cell specificity of the upstream enhancer region, although some activity was found in the T47D mammary tumor cell line.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Prostate-specific antigen (PSA) is a kallikrein-like serine protease that is almost exclusively synthesized by the luminal epithelial cells of the human prostate. It is well known as a prostate tumor marker (1, 2). The PSA gene is a member of the human kallikrein gene family. Further members of the kallikrein gene family are the hGK-1 gene, which is also expressed in the prostate, and the tissue kallikrein gene (KLK1), which is expressed in the pancreas and kidney (3, 4, 5, 6). The three genes are clustered in the order [KLK-1]-[PSA]-[hGK-1], in an area of 60 kb on human chromosome 19q13.2-13.4 (7). The PSA and hGK-1 genes are separated by 12 kb; the distance between KLK1 and PSA, which are transcribed from opposite strands, is approximately 31 kb (7). PSA expression does not only show cell-specificity, but is also tightly regulated by androgens, as mediated by the androgen receptor (AR) (8, 9, 10, 11, 12). The strong tissue specificity makes the PSA promoter a good candidate through which to deliver therapeutic genes in prostate cancer.

Two functionally active AR-binding sites (androgen response elements or AREs) were identified in the proximal PSA promoter, at positions -170 (ARE-I) and -394 (ARE-II), respectively (11, 13). Although the proximal PSA promoter, including ARE-I and ARE-II, is more active in LNCaP prostate cells than in nonprostate cells, its activity is relatively low. This low level of activity suggested that the proximal PSA promoter is not sufficient to account completely for androgen regulation of the endogenous PSA gene, as observed in LNCaP cells (11). This indicated to us that additional cis-acting control elements residing outside the proximal promoter might contribute to androgen-regulated PSA gene expression. For several strong, tissue-specific promoters, like those of the ß-globin and tyrosine amino transferase (TAT) genes, it has been well established that important control elements are located in regions far upstream of the proximal promoter (14, 15, 16). These distal enhancers cooperate with the proximal promoter for high expression of the specific gene.

To identify putative regulatory elements upstream of the PSA gene, DNaseI- hypersensitive sites (DHSs) were mapped in chromatin from LNCaP prostate cells. Functional analysis of a DNaseI-hypersensitive region far upstream of the PSA gene showed the presence of a complex, androgen-regulated enhancer. In this study we present a detailed analysis of this strong enhancer, which contains a functionally active, high-affinity AR-binding site (ARE-III). Furthermore, we compare the AR-binding affinity and the functionality of this novel ARE with that of the previously identified ARE-I and ARE-II (11, 13). An abstract describing parts of this work has been published previously (17).

While this work was in progress, Schuur et al. (18) reported the identification of a 1.6-kb upstream enhancer fragment (-3.7 to -5.3). This fragment encompasses the 440-bp core enhancer region, which is the basis of the present study.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mapping of DHSs in the PSA Upstream Region
In a previous study we identified two regions in the PSA proximal promoter that are involved in androgen regulation (13). A functional active, high-affinity AR-binding site, ARE-I (AGAACAgcaAGTGCT), was found to be present at position -170. ARE-I by itself gave rise to a weak (2-fold) stimulation of the PSA promoter activity in the presence of R1881. ARE-I had to cooperate with a second, low-affinity AR-binding site, ARE-II (GGATCAgggAGTCTC) at position -394 for maximal (~6-fold) androgen induction of proximal PSA promoter activity in transfected LNCaP cells.

To identify additional regulatory elements, we mapped DHSs in the 31-kb region between the PSA and KLKI genes in chromatin from the prostate-derived cell line LNCaP, grown in the presence and absence of androgens, and in HeLa cell chromatin. DNA from DNaseI-treated nuclei was digested with EcoRI and evaluated for location of DHSs by Southern blot analysis with the appropriate hybridization probes. With two different probes, DHSs could be found (Fig. 1Go). No other DHSs were detected over the 31-kb region with any of the probes tested (data not shown). Hybridization of EcoRI-digested DNA from LNCaP cells with a 1.1-kb HindIII-EcoRI fragment, spanning exon 1 and intron 1 of the PSA gene, showed one DHS (DHSIV), which was most prominent in the presence of R1881 (Fig. 1CGo). This DHS mapped to the proximal promoter region. Hybridization of genomic DNA from R1881-treated LNCaP cells with a 0.5-kb EcoRI-HindIII probe (-6 kb) revealed the presence of a cluster of three DHSs, approximately 4 kb upstream of the PSA gene (Fig. 1AGo). The position of this cluster of DHSs could be confirmed by hybridization with a more downstream located probe (data not shown). Analysis of the same region in chromatin from LNCaP cells grown in the absence of hormone showed that DHSII at -4.2 kb is clearly androgen regulated. Intensity of DHSI, at approximately -4.8 kb, is also influenced by the presence of R1881 during LNCaP culturing. The weak DHSIII (at -3.8 kb) could be found both in the absence and presence of R1881. Although weak, DHSI and DHSIII might also be present in chromatin from HeLa cells, which do not express PSA (Fig. 1BGo). In contrast, DHSII was clearly absent in HeLa cell chromatin, indicating cell specificity.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 1. DHSs in Chromatin Upstream of the PSA Gene

Southern blot analysis of genomic DNA from nuclei of LNCaP (A and C) and HeLa (B) cells incubated with increasing amounts of DNaseI (lanes 2–7 and 9–14 in panel A; 2–6 in panel B; and 2–7 and 9–14 in panel C; lanes 1 and 8 in panel A, lane 1 in panel B, and lanes 1 and 8 in panel C are controls without DNAseI treatment), and digested with EcoRI. Hybridization was with an EcoRI-HindIII probe at -6 kb (A and B) or a HindIII-EcoRI probe at +1 kb (C). Nuclei were isolated from LNCaP cells grown in the absence (panel A, lanes 1–7; panel C, lanes 1–7) or presence of R1881 (panel A, lanes 8–14; panel C, lanes 8–14), or from HeLa cells grown in 5% complete FCS (panel B). D, Schematic representation of the PSA gene. Black squares represent the five exons of the PSA gene. Hybridization probes are indicated by horizontal bars in the partial restriction map. Positions of DHSs are indicated by arrows (DHSI-IV).

 
Functional Analysis of the DNaseI-Hypersensitive Region Upstream of the PSA Gene
To identify the function of the DNA segment containing the upstream DHSs, a 6-kb PSA promoter fragment was inserted upstream of the luciferase reporter gene (PSA-61-LUC), and the activity of this fragment was compared with that of 2.2-kb (PSA-1-LUC) and 632-bp (PSA-4-LUC) PSA promoter fragments. Transient transfection to LNCaP cells showed for PSA-61-LUC a much higher (3000-fold) activity in the presence than in the absence of R1881 (Fig. 2AGo). PSA-1-LUC and PSA-4-LUC gave rise to a 6-fold and 4-fold induction, respectively, upon hormone treatment. These experiments clearly indicated the presence of a very potent enhancer between -6 and -2.2 kb.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Androgen Regulation of the PSA Promoter in LNCaP Cells

A, LNCaP cells were transiently transfected with PSA-LUC constructs as described in Materials and Methods. After 4 h incubation with the plasmid precipitate, transfected cells were cultured for 24 h in the absence or in the presence of R1881 (1 nM). The absolute activity and relative induction factor were calculated as the mean of four or more independent experiments, which were done in duplicate. Solid bar, Activity in the presence of R1881; open bar, activity in the absence of R1881. The SEM of the absolute activity is represented by a horizontal stripe. The induction level is indicated at the right side of the bars. Positions of ARE-I and ARE-II in PSA promoter constructs are represented by black squares. Positions of DHS I, II, and III are indicated by arrows. B, Partial restriction map of the PSA promoter. "SalI" represents the position of an artificial SalI site derived from the border of a human genomic DNA fragment in {lambda} EMBL3.

 
To map this upstream region in more detail, a 2.2-kb XbaI-StuI fragment (see Fig. 2BGo for a partial restriction map of the PSA promoter), encompassing the three upstream DHSs, was inserted in front of the proximal PSA promoter in PSA-4-LUC, which starts at the EcoRI site at -632 and contains ARE-I (-170) and ARE-II (-394) (13) (Fig. 3AGo), giving rise to construct PSA-64-s-LUC. Transfection of PSA-64-s-LUC to LNCaP cells resulted in an even higher (>6000-fold) induction of promoter activity upon R1881 activation (Fig. 3AGo), indicating that the upstream enhancer activity resides within this 2.2-kb fragment. The 2.2-kb XbaI-StuI fragment in the opposite orientation gave rise to a similar high activity (PSA-64-as-LUC in Fig. 3AGo).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Identification of the Androgen-Regulated Core Enhancer Region, Upstream of the PSA Gene

A, Detailed deletion mapping of the upstream region of the PSA gene in transfected LNCaP cells. Experimental details of the transfections are described in Materials and Methods and in the legend to Fig. 2AGo. The activity of the PSA-61-LUC construct in the presence of R1881 is set at 100%. The mean of the luciferase activity and the relative induction levels are from at least four independent experiments. B, Sequence of the 440-bp BstEII-PstI upstream core enhancer fragment. Important restriction sites are indicated above the sequence. The ARE-III sequence is underlined, with the two half-sites in capital letters. C, Effect of the core enhancer region on TK promoter activity in LNCaP cells. The hatched box represents the 440-bp core enhancer. Experimental details are as in Fig. 2AGo.

 
To determine the borders of the upstream enhancer region, a series of truncated fragments was linked to the proximal PSA promoter in LUC reporter gene constructs. Both PSA-73-LUC (1-kb PstI-BamHI) and PSA-74-LUC (0.9-kb PstI-PstI) showed an induction and absolute activity, which was approximately 50% of PSA-64 activity. A further 200-bp 3'-truncation in construct PSA-78-LUC (PstI-EcoRV) resulted in a 4-fold decrease in activity upon R1881 treatment. Similarly, deletion of the distal end (PSA-83-LUC) resulted in an 8-fold reduction in activity. The 440-bp BstEII-PstI fragment (PSA-85-LUC) turned out to be the smallest fragment with strong enhancer activity (Fig. 3AGo). We defined the BstEII-PstI fragment as the core enhancer. The sequence of this core enhancer is shown in Fig. 3BGo. Because further 5'- or 3'- deletion resulted in a partial decrease of core enhancer activity, two or more separate enhancer elements must be present in this fragment. Most accurate calculations of the positions of DHSI, -II, and -III showed that DHSII is located within the core enhancer fragment; however, this is not the case for DHSI and DHSIII. Most likely, DHSI is situated close to the PstI site at -4.8 kb, and DHSIII is located close to the BamHI site at -3.8 kb (see Fig. 2BGo).

To determine whether core enhancer activity was directly androgen regulated, the BstEII-PstI fragment was linked in both orientations to the TK promoter (TK-85-s-LUC and TK-85-as-LUC, respectively), and LNCaP cells were transfected with these constructs (Fig. 3CGo). The result clearly showed that this 440-bp fragment contained orientation-independent, intrinsic androgen- responsive enhancer activity. This observation correlated with the strong androgen regulation of DHSII, linking results of the transient transfection studies with the activity of the promoter of the endogenous PSA gene. Additionally, the results indicated synergistic cooperation between the upstream enhancer and the proximal PSA promoter, because PSA-61-LUC and PSA-85-LUC were considerably more active than TK-85-LUC (Figs. 2AGo and 3Go, A and C, and data not shown).

Identification of an ARE in the Core Enhancer Region
To identify candidate AR-binding sites, DNaseI footprints were determined over four overlapping core enhancer segments, utilizing the purified AR DNA-binding domain (AR-DBD). The only clear protection that was observed was located in the middle part of the fragment, over the sequence 5'-ACTCTGGAGGAACATATTGTATCGATT-3', directly upstream of the ClaI site (Fig. 4AGo). The protected area contained the sequence GGAACAtatTGTATC, which shows high homology (overall 9 of 12 bp), with the consensus sequence GGT/AACAnnnTGTTCT for high-affinity AR binding (19). Competition was found with a 100-fold excess ARE consensus oligo, but not with an excess of an NF-1 consensus oligo (Fig. 4AGo, lanes 4 and 5), indicating specificity of the interaction. Although both the BstEII-SalI and EcoRV-PstI subfragments contributed to maximal activity of the core enhancer (Fig. 3AGo), AR binding was not observed in one of these fragments (data not shown). Gel retardation analysis of a double-stranded oligonucleotide encompassing the upstream AR-binding site (ARE-III: ggaGGAACAtatTGTATCgat) with AR-DBD confirmed that this fragment contains a specific, high-affinity AR-binding site (Fig. 4BGo).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 4. Identification of a Functionally Active AR-Binding Site in the Core Enhancer Region

A, DNAseI footprint analysis over ARE-III. The lower strand of pHS2 ("SalI"-EcoRV fragment in the core enhancer) was 32P-end-labeled, digested with DNaseI in the absence (lanes 1 and 6) and presence of 10 (lane 2) and 20 pmol (lanes 3–5) AR(DBD) fusion protein, and subjected to gel electrophoresis (see Materials and Methods). Lanes 4 and 5, Competition with a 100-fold excess double-stranded nonspecific (NF-1 consensus oligo, lane 4), and specific oligonucleotide (ARE consensus, lane 5). Maxam and Gilbert sequence reactions are run alongside the footprint (G and G+A). The sequence of the protected area is depicted at the right. The two ARE-III half-sites are in capital letters. LS, Lower strand; US, upper strand. B, Gel retardation analysis of the ARE-III*AR(DBD) complex. Experimental details are as described in Materials and Methods. Lane 1, Free ARE-III probe; lanes 2–5, ARE-III probe incubated with AR(DBD). Lanes 3–5, Competition with a 100-fold excess ARE-III oligo (lane 3), ARE consensus oligo (lane 4), and NF-1 consensus oligo (lane 5). The arrow indicates the position of the AR-III*AR(DBD) complex. The ARE-III sequence is presented below the figure. C, The effect of ARE-III inactivation on the androgen-regulated core enhancer activity in transiently transfected LNCaP cells. Experimental details are as described in Materials and Methods and in the legend to Fig. 2AGo. Solid bar, Activity in the presence of R1881 (1 nM); open bar, activity in the absence of hormone. Mean values of luciferase activities and induction levels, and the SEM (horizontal stripe) are from three independent, duplicate experiments. The hatched bar in the constructs represents the core enhancer. ARE-III is given as a black square. The inactivated ARE-III is represented by a cross.

 
To test whether ARE-III was functionally active, the sequence was mutated to GCATAAtatTTCAAC in TK-85-s-LUC, resulting in construct TK-85-I-LUC. In transfection experiments, the mutated enhancer was no longer R1881 inducible (Fig. 4CGo). This not only indicated that ARE-III was functionally active, but also provided evidence for a pivotal role of ARE-III in androgen regulation by the core enhancer region.

Comparison of ARE-I, ARE-II, and ARE-III
The presence of (at least) three AREs [ARE-I(-170): AGAACAgcaAGTGCT; ARE-II(-394): GGATCAgggAGTCTC, and ARE-III (-4200): GGAACAtatTGTATC] in the PSA promoter raised the question of relative AR-binding affinities of the individual AREs and their separate contribution to overall androgen regulation of PSA promoter activity. To compare AR binding to these AREs, gel retardation analyses were performed with serial dilutions of purified AR-DBD (Fig. 5AGo). ARE-I and ARE-III turned out to be high-affinity AR-DBD-binding sites, with comparable AR-binding affinity. The in vitro interaction of AR-DBD with ARE-II was much weaker.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 5. Comparison of ARE-I, ARE-II, and ARE-III in Vitro AR(DBD) Binding and Functional Activity

A, Gel retardation analysis of ARE-I, ARE-II, and ARE-III complexed with AR(DBD). ARE-1 (lanes 1–5), ARE-II (lanes 6–10), and ARE-III (lanes 11–15) (50 x 103 cpm) are incubated with an increasing amount of AR(DBD) and analyzed by gel retardation assay as described in Material and Methods. Lanes 1, 6, and 11, Free probe. Lanes 2, 7 and 12, 30 fmol AR(DBD). In each panel, the following lane contains four times more AR(DBD). The arrow indicates the position of the ARE*AR(DBD) complex. ARE-I, ARE-II, and ARE-III sequences are presented below the figure. B, Effect of ARE-I, ARE-II, and ARE-III on minimal TK promoter activity in transiently transfected LNCaP cells. LNCaP cells were cotransfected with the indicated reporter gene construct and the AR expression vector pSVARo (2.5 µg). The ARE fragments are represented by triangles; mean values and SEM are from three independent, duplicate experiments. Further experimental details are described in Materials and Methods and in the legend to Fig. 2AGo.

 
Next, three copies of ARE-III were inserted in front of the minimal TK promoter in TK-LUC, and the activity was compared with similar ARE-I and ARE-II TK-LUC constructs. Transient transfection experiments in LNCaP cells showed ARE-III to be functionally active, albeit less than ARE-I: 10-fold and 34-fold induction upon R1881 stimulation, respectively (see Fig. 5BGo). However, both ARE-I and ARE-III were more active than ARE-II.

Mutational Analysis of ARE-I, -II, and -III
To investigate the role of the individual AREs in overall androgen- induced transcriptional responsiveness of the 6-kb PSA promoter, for each individual ARE two different knock out mutations were introduced in PSA-61-LUC (see Materials and Methods for sequences of mutated AREs). Transient transfection of LNCaP cells with the resulting mutated PSA promoter-LUC constructs showed that all three AREs contributed to androgen regulation. ARE-I(-170) mutations resulted in an 80% reduction of promoter activity (Fig. 6Go). Both mutations in ARE-II(-394) had a limited effect (50% or less reduction). Mutations in ARE-III had by far the most dramatic effect. As compared with wild type PSA-61-LUC, less than 1% of activity was retained in the mutated promoter. This finding indicated that ARE-III is not only a key element in the 440-bp upstream core enhancer, as shown in Fig. 4CGo, but also in the context of the 6-kb PSA promoter.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 6. The Effect of the Inactivation of ARE-I, ARE-II, and ARE-III on Androgen Regulation of the PSA Promoter

Experimental details are as described in Materials and Methods and in the legend to Fig. 2AGo. PSA-61-LUC activity in LNCaP cells cultured in the presence of R1881 is set at 100%. The ARE mutations in the 6 kb PSA-61-LUC construct are indicated by crosses. Mean values and SEM are from four independent, duplicate experiments. Hormone induction values are given at the right side of the bars.

 
Tissue Specificity of the PSA Promoter
Previous work in our laboratory showed that the proximal PSA promoter is more active in LNCaP prostate cells than in nonprostate cells (13). To study whether the androgen-induced activity of the upstream core enhancer also showed cell specificity, reporter constructs PSA-61-LUC (Fig. 2Go), TK-85-s-LUC, and the TK-LUC control (Fig. 3CGo) were cotransfected with the AR expression plasmid pSVARo to a series of AR-negative prostate and nonprostate cell lines. In contrast to the high activity in LNCaP cells, TK-85-s-LUC showed hardly any activity over basal TK promoter activity in the androgen-independent prostate cell lines PC-3 and DU145 and in COS (monkey kidney) and Hep3B (human hepatoma) cells (Table 1Go). Furthermore, the 6-kb PSA promoter was hardly active in these cells. For comparison, MMTV-LUC was transfected to the same set of cell lines. In PC3 and DU145 cells, a low R1881-induced activity was detected. In COS, Hep3B, and LNCaP cells, the MMTV promoter was strongly induced. Interestingly, in COS and HeLa cells, induction of MMTV promoter activity was 40–60 times higher than that of PSA-61. In contrast, in LNCaP cells, PSA-61-LUC was 6 times more active than MMTV-LUC. These findings clearly indicate cell specificity of the PSA promoter.


View this table:
[in this window]
[in a new window]
 
Table 1. Effect of R1881 on PSA-61-LUC, TK-85-LUC, and MMTV-LUC Activity in PC3, DU145, COS, and Hep3B Cells, Cotransfected with the AR Expression Plasmid pSVARo, as Compared to LNCaP Cells

 
The only tested cells, other than LNCaP cells, in which the PSA promoter was active was the human mammary carcinoma cell line T47D. Transfection of TK-85-s-LUC to T47D cells resulted in a 25-fold induction of luciferase activity upon R1881 stimulation, even in the absence of pSVARo cotransfection (Table 2A). PSA-61-LUC could be stimulated approximately 100-fold by R1881. Because T47D cells are known to contain the progesterone receptor (PR) and a low level of AR, and because R1881 can activate both AR and PR, experiments were repeated with the pure androgen dihydrotestosterone (DHT) and the pure progestin R5020. DHT stimulation of T47D cells transfected with TK-85-s-LUC and PSA-61-LUC resulted in a 4-fold and 15-fold induction of LUC activity, respectively. R5020 stimulation of T47D cells transfected with TK-85-s-LUC and PSA-61-LUC gave rise to induction levels, comparable to R1881 stimulation. Cotransfection of T47D cells with pSVARo slightly increased DHT-induced PSA promoter activity (Table 2B). These results indicate that the PSA promoter is not completely cell specific and, also, that PSA promoter activity is not completely AR specific. However, comparison of PSA (PSA-61 and TK-85) and MMTV promoter activity in T47D cells with that in LNCaP cells (Tables 1Go and 2Go) still indicates a strong preference of the PSA promoter for LNCaP cells.


View this table:
[in this window]
[in a new window]
 
Table 2. Effect of R1881, DHT, and R5020 on PSA-61-LUC, TK-85-LUC, and MMTV-LUC Activity in T47D Cells, without (A) and with Cotransfection of the AR Expression Plasmid pSVARo (B)

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
It is well established that PSA expression is directly androgen regulated and cell specific. Previously, in transient transfection experiments with PSA promoter constructs, combined with in vitro protein-DNA interaction assays, two AREs were identified in the proximal PSA promoter: ARE-I at position -170, and ARE-II at -394 (11, 13). Activity of a 632-bp proximal promoter was approximately 6-fold induced by R1881 in LNCaP cells. Cotransfection with an AR or glucocorticoid receptor (GR) expression plasmid resulted in an increase of absolute activity and induction level of the proximal promoter upon R1881 treatment. The low level of induction obtained with the endogenous AR suggested that the proximal PSA promoter was not sufficient to account completely for the androgen induction as observed for the endogenous PSA gene (11). In the present study we characterized a strong upstream enhancer, which is required for high, androgen-regulated and cell- specific expression of the PSA gene. The results described extend our own previous work and the recent work of Schuur et al. (18). As compared with the latter study, two major differences seem obvious: 1) In the experiments described in the present study, approximately 50% of the activity of the upstream enhancer region is retained within the 440-bp BstEII-PstI (-4.3 to -3.9) fragment (see Fig. 3AGo), whereas in the work of Schuur et al. essentially all activity is lost by deletion of sequences downstream of the XbaI site at -5.3 kb. At the 3'-border of the enhancer region the differences are less dramatic. Deletion from the PstI site to the EcoRV site in constructs PSA-73 and PSA-74 results in an approximately 5-fold loss of activity (see Fig. 3AGo); the comparable constructs in Ref. 18 (CN70 and CN71) show a 2-fold decrease in activity. In summary, we found the minimal region with high enhancer activity to be approximately 1 kb smaller at the 5'-border. Although it can always be argued that different LNCaP sublines and culture conditions have been used, there is no obvious explanation for the differences observed. 2) A second difference between the data in Ref. 18 and our findings concerns the induction level of the 6-kb PSA promoter (3000 as compared with 38). Part of the difference in induction might be accounted for by the reporter genes used (LUC and CAT, respectively). The higher sensitivity of the LUC assay enabled us to compare the properties of ARE-III in the upstream enhancer with those of ARE-I and ARE-II in the proximal promoter.

An important goal of the present study was the analysis of the chromatin structure in a 31-kb region upstream of the PSA gene by the identification of DHSs. Although other explanations are possible, DHSs in chromatin, which reflect structural alterations, are a strong indication for the interruption of the nucleosome structure due to binding of transcription factors to the DNA. In chromatin from LNCaP cells, three DHSs were found clustered in the area from 3.8 to 4.8 kb upstream of the PSA gene. DHSIII (at -3.8 kb) is weak and also present in chromatin from HeLa cells, which do not express PSA. DHSI (at -4.8 kb) is clearly androgen induced in LNCaP cells. DHSII (at -4.2 kb) is by far the most prominent: it is strongly androgen induced in LNCaP cells and absent in HeLa cells. The differences in structure between chromatin from LNCaP cells, grown in the presence and absence of R1881, and from HeLa cells indicated to us a functional role of the DHS cluster in androgen-regulated and cell-specific expression of the endogenous PSA gene.

In transient transfection experiments, the -4.8 to -3.8 region showed strong, androgen-regulated enhancer activity (PSA-64-s-LUC and PSA-64-as-LUC in Fig. 3AGo). It is not clear whether sequences corresponding to DHSI and DHSIII are present in the shorter active enhancer construct PSA-73-LUC. Most likely, DHSI maps very close to the PstI site, which is at the 5'-border of PSA-73-LUC; DHSIII maps close to the BamHI site, which determines the 3'-border of PSA-73-LUC. An even shorter fragment, PSA-85-LUC, lacks both DHSI and DHSIII, but contains DHSII, which maps close to the ClaI site. The finding that PSA-85-LUC still shows approximately 50% of the enhancer activity suggests that, in transient transfections, DHSI and DHSIII sequences play no or only a minor part in PSA promoter activity. Whether they are required for proper expression of the endogenous PSA gene remains to be determined. The finding that ARE-III at -4.2 kb corresponds to DHSII in the chromatin suggests that ARE-III is not only essential in the PSA promoter in transient transfections, but also in androgen-regulated expression of the endogenous PSA gene.

The upstream core enhancer most probably has a complex structure. We were unable to narrow down the size of the core enhancer to less than 440 bp without loosing substantial activity. Combined with the essential role of ARE-III in the enhancer, at least three separate active regions can be identified in the core enhancer: ARE-III, and the 5'- and 3'-end fragments (see Fig. 3Go). In each of the two end fragments, one or more binding sites of ubiquitous or prostate-specific transcription factors might be located. The possibility that these fragments contain one or more weak, so far not identified, AR-binding sites cannot be excluded. In cooperation with ARE-III, and additional cis-acting sequences within the 130-bp SalI-EcoRV fragment, a complex enhancer might be formed with cooperative interactions between the different components. Further experiments are obviously required to elucidate the detailed composition of this core enhancer.

A functional ARE-III is a prerequisite for high activity of the upstream enhancer. Inactivation of ARE-III almost completely abolished core enhancer activity. In contrast, truncation of the 5'- and 3'-fragments resulted only in a partial reduction of enhancer activity. However, there is little doubt about a synergistic cooperation of ARE-III with other cis-acting elements in the core enhancer: when attached to the TK promoter, the core enhancer, containing one ARE-III, is superior to even three copies of ARE-III coupled to the TK promoter. A mechanism explaining the central role of ARE-III could be AR-induced DNA bending, enabling the direct or indirect interaction between other transcription factors in the core enhancer. Alternatively, ARE-III-bound AR might be a key element in the interaction of the upstream enhancer with the proximal promoter region or in the recruitment of the RNA polymerase II holoenzyme to the PSA promoter (20, 21). In this respect the PSA upstream enhancer might function as a classic complex, steroid hormone- regulated control region. Similar upstream glucocorticoid-regulated enhancers, composed of GR-binding sites, binding sites for the liver-enriched transcription factors HNF-3 and HNF-4, and binding sites for more ubiquitous transcription factors, have been identified for the TAT gene, which is highly expressed in liver parenchymal cells (15, 16). The enhancer motifs restrict the hormonal activation of the TAT gene to liver cells, not only in cultured cells, but also in transgenic mice (22). The PSA gene is the first example of an androgen-regulated, prostate-specific gene for which such a potent upstream enhancer is documented. Further study of this enhancer may be of great help in the identification of prostate-specific transcription factors and in the elucidation of the mechanism of cooperative interaction between the AR and other transcription factors.

The identification of three AREs in the PSA promoter in the present and in our previous studies (11, 13) readily raised the question of relative AR- binding affinities and functional activities. ARE-I and ARE-III were found to be of similar potency, whereas ARE-II was less active. Mutational analysis indicated a clear synergistic cooperativity between ARE-I and ARE-III and, to a lesser extent, ARE-II. However, inactivation of ARE-III had a far more impressive effect on the 6-kb PSA promoter than mutation of ARE-I. From these findings it can be concluded that the context in which the ARE is present has a pivotal effect on its functional activity. As indicated above, this might involve interactions with other transcription factors, including the spacing between specific cis-acting elements.

Although the PSA gene is the first example of a gene containing a very potent far upstream ARE, clear synergistic interaction between multiple ARE sequences has also been found in the proximal (600-bp) PSA promoter (see Ref. 13, as discussed above) and in the proximal (426-bp) prostate-specific rat probasin (PB) promoter (23). Both the proximal PSA and the PB promoter contain one high-affinity and one low-affinity, functionally active AR-binding site (13, 23). Although much more active in their natural setting, multimers of the different, separate AREs from the PSA promoter are functionally active when fused to a heterologous promoter (Fig. 5BGo, and Ref.13). In contrast, cooperative binding of the AR to both AREs in the PB promoter is required for androgen induction (24).

To investigate cell specificity of PSA upstream core enhancer, we compared its activity in several prostate and nonprostate cell lines. Transient transfection experiments in (PSA negative) PC3, DU145, Hep3B, and COS cells did not reveal any activity, although two of the cell lines (PC3, DU145) originate from a prostate background. The MMTV promoter showed a very limited activity in AR-cotransfected PC3 and DU145 cells, but was clearly active in COS and HeLa cells. Together these findings indicate the absence of one or more transcription factor(s) or coactivator(s) essential for PSA promoter activity in these cells. Alternatively, a specific inhibitor of PSA promoter activity is present. The specificity of DHSII provided additional evidence for cell-specific activity of the PSA promoter.

TK-85-LUC and PSA-61-LUC were both found to be active in T47D cells. In T47D cells, PSA promoter activity was not only mediated through the AR but also via the PR (Table 2Go). These results indicate that activity of the 6-kb PSA promoter is not entirely prostate- and androgen-specific. However, PSA promoter activity in LNCaP cells is superior to T47D cell activity. The issue of receptor specificity should be investigated in more detail in cell lines containing comparable amounts of PR and AR, either endogenously or after cotransfection with the respective steroid receptor expression plasmid. In a similar type of experimental setup, we generated LNCaP sublines containing a stable transfected GR expression plasmid. This resulted in dexamethasone induction of the endogenous PSA gene and GR-regulated activity of the 6-kb PSA promoter in transient transfections (K. B. J. M. Cleutjens, in preparation). In summary, steroid hormone-regulated expression of the PSA promoter depends on the properties of the cell line: the presence of AR, PR, or GR is an essential, but not the only, factor. Absence of specific inhibitors or presence of additional transcription factors and/or coactivators will also be essential.

Although PSA expression was originally thought to be strictly restricted to prostate epithelial cells, low PSA expression in mammary tumor cells has been recently published (25, 26). The activity of the PSA promoter in transfected T47D cells, which are negative on Northern blots for endogenous PSA expression, could be in accordance with these findings. It would be of interest to determine whether, in mammary tumor tissue, PSA expression is progesterone regulated and could be used as a reliable marker for PR-positive tumors. To obtain more definite information on tissue specificity of the 6-kb PSA promoter in both normal and tumor cells, animal studies with PSA promoter constructs are required. If the upstream enhancer is able to confer preferential expression of a target gene to prostate cells, in vivo applications in humans, including gene therapy for delivery of pharmaceutical reagents to the prostate, can be further explored.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture
LNCaP cells (FGC), originally obtained from Dr. Horoszewicz (27), were cultured in RPMI 1640 and supplemented with 5% FCS and antibiotics. For transfection, cells were grown in DMEM supplemented with 5% steroid-depleted (dextran-charcoal treated) FCS. For examination of androgen-induced DHSs and androgen-driven promoter activity in transfection experiments, the synthetic androgen R1881 (DuPont NEN, Boston, MA) was added to a final concentration of 1 nM. In indicated cases, DHT (Steraloids, Wilton, NH) and R5020 (DuPont NEN) were added to final concentrations of 100 nM and 10 nM, respectively.

HeLa, T47D, and COS cells were grown in DMEM; Hep3B cells were grown in MEM{alpha}, supplemented with 5% FCS and antibiotics. PC3 and DU145 cells were grown in RPMI 1640, supplemented with 7.5% FCS and antibiotics. For transfection, PC3 and DU145 cells were grown in DMEM.

Mapping of DHSs
Cultured cells (LNCaP cells, grown in the presence and absence of 1 nM R1881, and HeLa cells) were washed with ice-cold PBS. Cells were suspended in 3 ml ice-cold HS buffer (15 mM Tris-HCl, pH 7.4, 60 mM KCl, 15 mM NaCl, 0.2 mM EDTA, 0.2 mM EGTA, and 5% glycerol, supplemented with 1 mM dithiothreitol, 0.15 mM spermine, and 0.5 mM spermidine, directly before use). The cells were disrupted by passing five to 10 times through a 0.5 x 16 mm (25G) needle. Disruption was monitored by light microscopic examination. Nuclei were collected by centrifugation for 5 min at 2500 rpm and resuspended in HS buffer to a final concentration of 5 x 107 nuclei/ml. Limited DNaseI digestion was carried out in a final volume of 0.5 ml HS buffer containing 5 x 106 nuclei, 5 mM MgCl2, and DNaseI (0–800 U; Boehringer Mannheim, Mannheim, Germany). The mixture was incubated for 30 min on ice, and the reaction was stopped by addition of 10 µl 0.5 M EDTA, 12.5 µl 20% SDS, and 50 µl Proteinase K (10 mg/ml). Next, the sample was incubated overnight at 37 C. Subsequent to phenol/chloroform extraction, the DNA was collected by isopropanol precipitation. The DNA was dissolved in 100 µl Tris-EDTA buffer and digested with EcoRI. Restriction fragments were separated by electrophoresis in a 1% agarose gel and transferred to a nylon membrane (Hybond N+, Amersham, Cardiff, UK). Filters were hybridized at high stringency with random primed 32P-labeled probes (as indicated in Fig. 1Go) using standard procedures (28).

Construction of Plasmids
All plasmid constructs were prepared using standard methods (28). The promoterless basic plasmid pLUC, PSA-4-LUC, TKLUC, the human AR expression plasmid pSVARo, the AR(DBD) expression plasmid pRIT2TAR, and pMMTV-LUC were described previously (13, 29, 30, 31). PSA-61-LUC was generated by insertion of the HindIII/HindIII (-6 kb/+12) fragment of the PSA promoter in the multiple cloning site (MCS) of pLUC. PSA-1-LUC was generated by ligation of the BamHI/HindIII (-2.2 kb/+12) fragment in the MCS of pLUC. PSA-64-s-LUC and PSA-64-as-LUC (XbaI-StuI, -5.4/-3.2 kb), PSA-73-LUC (PstI-PstI, -4.7/-3.9 plus PstI-BamHI -3.9/-3.8 kb), PSA-74-LUC (PstI-PstI, -4.7/-3.9 kb), PSA-78-LUC (PstI-EcoRV, -4.8/-4.1 kb), PSA-83-LUC (SalI-BamHI, -4.25/-3.8 kb), and PSA-85-LUC (BstEII-PstI, -4.35/-3.9 kb) were generated by insertion of the appropriate fragments in front of the proximal PSA promoter (-632/+12) in construct PSA-4-LUC. The artificial SalI site (-4.25 kb) was derived from the 5'-end of a human genomic DNA phage insert (4P1, see Ref.7).

Constructs TK-85-s-LUC and TK-85-as-LUC were generated by insertion of the 440-bp BstEII-PstI fragment into the MCS of TKLUC. Constructs ARE-I-TKLUC and ARE-III-TKLUC were generated by cloning three copies of ARE-I and ARE-III oligonucleotides in TKLUC, respectively (sequences of oligonucleotides are shown below). ARE-II-TKLUC was generated by ligation of the double-stranded 3ARE-II oligonucleotide in the SalI site of TKLUC. ARE-I: 5' GATCCTTGCAGAACAGCAAGTGCTAGCTG3' 3' GAACGTCTTGTCGTTCACGATCGACCTAG 5' 3ARE-II: 5' TCGACAGGGATCAGGGAGTCTCACCAGGGATCA- 3' GTCCCTAGTCCCTCAGACTGGTCCCTAGT- GGGAGTCTCACCAGGGATCAGGGAGTCTCACG 3' CCCTCAGAGTGGTCCCTAGTCCCTCAGAGTGCAGCT 5' ARE-III: 5' TCGACGAGGAACATATTGTATCGAG 3' 3' GCTCCTTGTATAACATAGCTCAGCT 5'

pHS1, pHS2, pHS3, and pHS4, which were the starting material for footprint experiments, were obtained by insertion of the blunt-ended BstEII/ClaI, SalI/EcoRV, EcoRV/PstI, and ClaI/NcoI fragments, respectively, into the SmaI site of pTZ19 (Pharmacia, Uppsala, Sweden).

Generation of ARE Mutations
Mutations were introduced in ARE-I (-170), ARE-II (-394), and ARE-III (-4200) essentially according to the PCR method of Higuchi et al. (32). Standard amplification conditions were 30 cycles of denaturation for 1 min at 95 C, annealing for 1 min at 55 C, and extension for 2 min at 72 C. The oligonucleotides that were used for the generation of the different mutations are listed below. Two different sets of outer primers were used, one set for ARE-I and -II mutations and a separate set for ARE-III mutations. Substitutions in complementary sets of inner primers ARE-I-1, -2; ARE-II-1 and -2; ARE-III-1 and -2 are underlined (see below). PSA-61-LUC was used as the template for the first PCR step. In the second PCR step, appropriate samples of the purified products of the first amplification reactions were mixed at a 1:1 ratio. The resulting PCR fragments were cloned and, after sequencing, exchanged with the corresponding fragment of PSA-61-LUC. ARE-I and -II outer primers:

forward primer: 5' CCACAAGATCTTTTTATGATGACAG 3'

reverse primer: 5' GCTCTCCAGCGGTTCCATCCTCTAG 3' ARE-III outer primers:

forward primer: 5' CTTCTAGGGTGACCAGAGCAG 3'

reverse primer: 5' GCAGGCATCCTTGCAAGATG 3' Inner primers: ARE-I-1: 5' GTAATTGCACATTAGCAATGGGTAACTCTCCC 3' 3' CATTAACGTGTAATCGTTACCCATTGAGAGGG 5' ARE-I-2: 5' GTAATTGCATAGTAGCAAAAGGTAACTCTCCC 3' 3' CATTAACGTATCATCGTTTTCCATTGAGAGGG 5' ARE-II-1: 5' GGTGCAGGCATAAGGGATGCTCACAATCT 3' 3' CCACGTCCGTATTCCCTACGAGTGTTAGA 5' ARE-II-2: 5' GGTGCAGGCATTAGGCAACCTGACAATCT 3' 3' CCACGTCCGTAATCCGTTGGACTGTTAGA 5' ARE-III-1: 5' CTCTGGAGCATAATATTTCAACGATTGTC 3' 3' GAGACCTCGTATTATAAAGTTGCTAACAG 5' ARE-III-2: 5' CTCTGGAGTAGTATATTACAGCGATTGTC 3' 3' GAGACCTCATCATATAATGTCGCTAACAG 5'

Transfections
Cells were transfected according to the calcium phosphate precipitation method essentially as described (33), using 1 x 106 cells per 25-cm2 flask and 5 µg of the appropriate PSA-LUC construct. After 4 h incubation with the precipitate, the culture medium was replaced by PBS containing 15% glycerol (incubation for 90 sec at room temperature). Subsequently, transfected cells were incubated in culture medium in the absence or presence of the appropriate hormone for 24 h. Transfections were performed in duplicate. Experiments were repeated at least three times using two independent plasmid isolates.

Luciferase Assay
Cells were washed in PBS and lysed in 300 µl lysis buffer (25 mM Tris-phosphate, pH 7.8, 8 mM MgCl2, 1 mM dithiothreitol, 1% Triton X-100, 15% glycerol). Next, 0.1 ml luciferin (0.25 µM) (Sigma, St. Louis, MO)/0.25 µM ATP was added to 0.1 ml extract, and luciferase activity was measured in a LUMAC 2500 M Biocounter (LUMAC, Landgraaf, The Netherlands). After a delay of 2 sec (according to supplier), the light emission was recorded for 5 sec. Luciferase activities were corrected for variations in protein concentrations of the cell extracts. Luciferase activities and relative induction factors are expressed as mean and SEM of at least three independent experiments.

DNAseI Footprint Analysis
Production and purification of AR(DBD) was done as described previously (13, 30). Fragments for footprinting were generated by digestion of pHS1, pHS2, pHS3, and pHS4 with XbaI and SacI, or with SphI and EcoRI, in order to identify protected windows on both the upper and lower strand. Subsequently, fragments were filled in with MMLV-reverse transcriptase (Boehringer) in the presence of [{alpha}-32P]dATP and isolated from nondenaturing polyacrylamide gel. The DNaseI footprinting experiments were performed essentially according to Lemaigre et al. (34). Labeled probe (50,000 cpm) was incubated with 10–20 pmol AR(DBD) fusion protein for 30 min at 0 C, in the presence of 10 µM ZnCl2. In indicated cases, a 100-fold excess competitor oligos (consensus ARE or consensus NF-1; 5'-GATCCAGGGAACAGGGTGTTCTACG-3', and 5'-ATTTTGGCTTGAAGCCAATATG-3', respectively)) was added. Digestion with 0.04 U of DNaseI (Boehringer) was for 60 sec at 20 C in a final volume of 50 µl. In the absence of AR(DBD), 0.025 U of DNAseI was used. After phenol/chloroform extraction and ethanol precipitation, DNA was dissolved in 5 µl formamide-dye mix (98% formamide, 10 mM EDTA, 0.2% bromophenol blue, and 0.2% xylene cyanol). After heating to 95 C for 2 min and rapid cooling on ice, the DNA was separated on a denaturing (7 M urea) 6% polyacrylamide gel. G and (G+A) sequence reactions according to Maxam and Gilbert (35) of the same fragment were run as markers alongside each footprint. After electrophoresis, gels were fixed, dried, and exposed to x-ray film.

Gel Retardation Analysis
The gel retardation experiments were performed as described previously (13). Double- stranded oligonucleotides used in gel retardations: ARE-I: 5' GATCCTTGCAGAACAGCAAGTGCTAGCTG 3' 3' GAACGTCTTGTCGTTCACGATCGACCTAG 5' ARE-II: 5' GATCCAGGGATCAGGGAGTCTCAGG 3' 3' GTCCCTAGTCCCTCAGAGTCCTAG 5' ARE-III: 5' TCGACGAGGAACATATTGTATCGAG 3' 3' GCTCCTTGTATAACATAGCTCAGCT 5'

Shortly, probes were filled in with MMLV-reverse transcriptase in the presence of [{alpha}-32P]dATP and subsequently isolated from nondenaturing polyacrylamide gel. Labeled probe, 50,000 cpm, was incubated with AR(DBD) (30 fmol to 2 pmol). In indicated cases 100-fold excess ARE or NF-1 competitor oligonucleotides were added. After incubation for 20 min, samples were run on a 4% nondenaturing polyacrylamide gel. Subsequently, gels were fixed, dried, and exposed to x-ray film.


    ACKNOWLEDGMENTS
 
We thank Dr. A. O. Brinkmann for critical reading of the manuscript, Dr. P. De Vos for the gift of pRIT2TAR, Dr. R. Dijkema for the gift of pMMTV-LUC, and Mr. F.L. van der Panne for photography.


    FOOTNOTES
 
Address requests for reprints to: Dr. C.B.J.M. Cleutjens, Department of Pathology, Erasmus University, PO Box 1738, 3000 DR Rotterdam, The Netherlands, Phone: 31–10-4088227, Fax: 31–10-4366660.

This study was supported in part by a grant of the Dutch Cancer Society.

1 Current address: Department of Neurogenetics, Massachusetts General Hospital, Charlestown, Massachusetts. Back

Received for publication July 12, 1996. Revision received October 28, 1996. Accepted for publication November 1, 1996.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Catalona WJ, Smith DS, Ratcliff TL, Dodds KM, Coplen DE, Yuan JJ, Petros JA, Andriole GL 1991 Measurement of prostate-specific antigen in serum as a screening test for prostate cancer. N Engl J Med 324:1156–1161[Abstract]
  2. Oesterling JE 1991 Prostate specific antigen: a critical assessment of the most useful tumor marker for adenocarcinoma of the prostate. J Urol 145:907–923[Medline]
  3. Riegman PHJ, Vlietstra RJ, Korput JAGM van der, Romijn JC, Trapman J 1989 Characterization of the prostate specific antigen gene: a novel kallikrein-like gene. Biochem Biophys Res Commun 159:95–102[CrossRef][Medline]
  4. Lundwall A 1989 Characterization of the gene for prostate specific antigen, a human glandular kallikrein. Biochem Biophys Res Commun 161:1151–1159[CrossRef][Medline]
  5. Schedlich LJ, Bennets BH, Morris BJ 1987 Primary structure of a human glandular kallikrein gene. DNA 6:429–437[Medline]
  6. Evans BA, Zhang XY, Close JA, Tregear GW, Kitamura N, Nakanishi S, Callen DF, Baker E, Hyland VJ, Sutherland GR, Richards RI 1988 Structure and chromosomal localization of the human renal kallikrein gene. Biochemistry 27:3124–3129[CrossRef][Medline]
  7. Riegman PHJ, Vlietstra RJ, Suurmeijer L, Cleutjens CBJM, Trapman J 1992 Characterization of the human kallikrein locus. Genomics 14:6–11[CrossRef][Medline]
  8. Riegman PHJ, Vlietstra RJ, Korput JAGM van der, Romijn JC, Trapman J 1991 Identification and androgen regulated expression of two major human glandular kallikrein-1 (hGK-1) mRNA species. Mol Cell Endocrinol 76:181–190[CrossRef][Medline]
  9. Henntu P, Liao S, Vikho P 1992 Androgens upregulate the human prostate specific antigen messenger ribonucleic acid, but down-regulate the prostatic phosphatase mRNA in LNCaP cells. Endocrinology 130:766–772[Abstract/Free Full Text]
  10. Young CYF, Andrews PE, Montgomery BT, Tindall DJ 1992 Tissue specific and hormonal regulation of human prostate-specific glandular kallikrein. Biochemistry 31:818–824[CrossRef][Medline]
  11. Riegman PHJ, Vlietstra RJ, Korput JAGM van der, Brinkmann AO, Trapman J 1991 The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. Mol Endocrinol 5:1921–1930[Abstract/Free Full Text]
  12. Wolf DA, Schulz P, Fittler F 1992 Transcriptional regulation of prostate kallikrein-like genes by androgen. Mol Endocrinol 6:753–762[Abstract/Free Full Text]
  13. Cleutjens KBJM, van Eekelen CCEM, van der Korput HAGM, Brinkmann AO, Trapman J 1996 Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter. J Biol Chem 271:6379–6388[Abstract/Free Full Text]
  14. Wood WG 1996 The complexities of ß-globin gene regulation. Trends Genet 12:204–206[CrossRef][Medline]
  15. Nitsch D, Boshart M, Schütz G 1993 Activation of the tyrosine aminotransferase gene is dependent on synergy between liver-specific and hormone-responsive elements. Proc Natl Acad Sci USA 90:5479–5483[Abstract/Free Full Text]
  16. Grange T, Roux J, Rigaud G, Pictet R 1989 Two remote glucocorticoid responsive units interact cooperatively to promote glucocorticoid induction of rat tyrosine animotransferase gene expression. Nucleic Acids Res 17:8695–8709[Abstract/Free Full Text]
  17. Cleutjens CBJM, van der Korput JAGM, van Eekelen CCEM, van Rooij HCJ, Faber PW, Trapman J 1995 Identification of three regions involved in androgen regulated activity of the prostate-specific antigen promoter in LNCaP prostate cells. Urol Res 23:269
  18. Schuur ER, Henderson GA, Kmetec LA, Miller JD, Lamparski HG, Henderson DR 1996 Prostate-specific antigen expression is regulated by an upstream enhancer. J Biol Chem 271:7043–7051[Abstract/Free Full Text]
  19. Roche PJ, Hoare SA, Parker MG 1992 A consensus DNA-binding site for the androgen receptor. Mol Endocrinol 6:2229–2235[Abstract/Free Full Text]
  20. Tjian R, Maniatis T 1994 Transcriptional activation: a complex puzzle with few easy pieces. Cell 77:5–8[CrossRef][Medline]
  21. Koleske AJ, Young RA 1995 The RNA polymerase II holoenzyme and its implications for gene regulation. Trends Biochem Sci 20:113–116[CrossRef][Medline]
  22. Sassi H, Fromont-Racine M, Grange T, Pictet R 1995 Tissue specificity of a glucocorticoid-dependent enhancer in transgenic mice. Proc Natl Acad Sci USA 92:7197–7201[Abstract/Free Full Text]
  23. Rennie PS, Bruchovsky N, Leco KJ, Sheppard PC, McQueen SA, Cheng H, Snoek R, Hamel A, Bock ME, MacDonald BS, Nickel BE, Chang C, Liao S, Cattini PA, Matusik RJ 1993 Characterization of two cis-acting DNA elements involved in the androgen regulation of the probasin gene. Mol Endocrinol 7:23–36[Abstract/Free Full Text]
  24. Kasper S, Rennie PS, Bruchovsky N, Sheppard PC, Cheng H, Lin L, Shiu RPC, Snoek R, Matusik RJ 1994 Cooperative binding of androgen receptors to two DNA sequences is required for androgen induction of the probasin gene. J Biol Chem 269:31763–31769[Abstract/Free Full Text]
  25. Monne M, Croce CM, Yu H, Diamandis EP 1994 Molecular characterization of prostate-specific antigen messenger RNA expressed in breast tumors. Cancer Res 54:6344–6347[Abstract/Free Full Text]
  26. Giai M, Yu H, Roagna R, Ponzone R, Katsaros D, Levesque MA, Diamandis EP 1995 Prostate-specific antigen in serum of women with breast cancer. Br J Cancer 72:728–731[Medline]
  27. Horoszewicz JS, Leong SS, Kawinski E, Karr J, Rosenthal H, Chu TM, Mirand EA, Murphy GP 1983 LNCaP model of human prostatic carcinoma. Cancer Res 43:1809–1818[Abstract/Free Full Text]
  28. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  29. Brinkmann AO, Faber PW, Rooij HCJ van, Kuiper GGJM, Ris C, Klaassen P, Korput JAGM van der, Voorhorst MM, Laar JH van, Mulder E, Trapman J 1989 The human androgen receptor: domain structure, genomic organization and regulation of expression. J Steroid Biochem 34:307–310[CrossRef][Medline]
  30. De Vos P, Claessens F, Winderickx J, Van Dijck P, Celis L, Peeters B, Rombauts W, Heyns W, Verhoeven G 1991 Interaction of androgen response elements with the DNA-binding domain of the rat androgen receptor expressed in Escherichia coli. J Biol Chem 266:3439–3443[Abstract/Free Full Text]
  31. de Ruiter PE, Teuwen R, Trapman J, Dijkma R, Brinkmann AO 1995 Synergism between androgens and protein kinase-C on androgen-regulated gene expression. Mol Cell Endocrinol 110:R1–R6
  32. Higuchi R, Krummel B, Saiki RK 1988 A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res 16:7351–7367[Abstract/Free Full Text]
  33. Chen C, Okyama H 1987 High efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol 7:2745–2752[Abstract/Free Full Text]
  34. Lemaigre FP, Courtois SJ, Lafontaine DA, Rousseau GG 1989 Evidence that the upstream stimulatory factor and the SpI transcription factor bind in vitro to the promoter of the human-growth-hormone gene. Eur J Biochem 181:555–561[Medline]
  35. Maxam AM, Gilbert W 1980 Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol 65:499–560[Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
D. J. van de Wijngaart, H. J. Dubbink, M. Molier, C. de Vos, J. Trapman, and G. Jenster
Functional Screening of FxxLF-Like Peptide Motifs Identifies SMARCD1/BAF60a as an Androgen Receptor Cofactor that Modulates TMPRSS2 Expression
Mol. Endocrinol., November 1, 2009; 23(11): 1776 - 1786.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C.-H. Tsai, F.-M. Lin, Y.-C. Yang, M.-T. Lee, T.-L. Cha, G.-J. Wu, S.-C. Hsieh, and P.-W. Hsiao
Herbal Extract of Wedelia chinensis Attenuates Androgen Receptor Activity and Orthotopic Growth of Prostate Cancer in Nude Mice
Clin. Cancer Res., September 1, 2009; 15(17): 5435 - 5444.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. V. Heemers, K. M. Regan, L. J. Schmidt, S. K. Anderson, K. V. Ballman, and D. J. Tindall
Androgen Modulation of Coregulator Expression in Prostate Cancer Cells
Mol. Endocrinol., April 1, 2009; 23(4): 572 - 583.
[Abstract] [Full Text] [PDF]


Home page
Anticancer ResHome page
E. KALAY, A. ERGEN, F. NARTER, B. AGACHAN, U. GORMUS, N. YIGIT, and T. ISBIR
ARE-I Polymorphism on PSA Gene in Prostate Cancer Patients of a Turkish Population
Anticancer Res, April 1, 2009; 29(4): 1395 - 1398.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
J. Lai, S. A. Myers, M. G. Lawrence, D. M. Odorico, and J. A. Clements
Direct Progesterone Receptor and Indirect Androgen Receptor Interactions with the Kallikrein-Related Peptidase 4 Gene Promoter in Breast and Prostate Cancer
Mol. Cancer Res., January 1, 2009; 7(1): 129 - 141.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. A. Krum, G. A. Miranda-Carboni, M. Lupien, J. Eeckhoute, J. S. Carroll, and M. Brown
Unique ER{alpha} Cistromes Control Cell Type-Specific Gene Regulation
Mol. Endocrinol., November 1, 2008; 22(11): 2393 - 2406.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. G. Hermans, H. A. van der Korput, R. van Marion, D. J. van de Wijngaart, A. Ziel-van der Made, N. F. Dits, J. L. Boormans, T. H. van der Kwast, H. van Dekken, C. H. Bangma, et al.
Truncated ETV1, Fused to Novel Tissue-Specific Genes, and Full-Length ETV1 in Prostate Cancer
Cancer Res., September 15, 2008; 68(18): 7541 - 7549.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Niu, S. Yeh, H. Miyamoto, G. Li, S. Altuwaijri, J. Yuan, R. Han, T. Ma, H.-C. Kuo, and C. Chang
Tissue Prostate-Specific Antigen Facilitates Refractory Prostate Tumor Progression via Enhancing ARA70-Regulated Androgen Receptor Transactivation
Cancer Res., September 1, 2008; 68(17): 7110 - 7119.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F.-M. Lin, C.-H. Tsai, Y.-C. Yang, W.-C. Tu, L.-R. Chen, Y.-S. Liang, S.-Y. Wang, L.-F. Shyur, S.-C. Chien, T.-L. Cha, et al.
A Novel Diterpene Suppresses CWR22Rv1 Tumor Growth In vivo through Antiproliferation and Proapoptosis
Cancer Res., August 15, 2008; 68(16): 6634 - 6642.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
H. V. Heemers and D. J. Tindall
Androgen Receptor (AR) Coregulators: A Diversity of Functions Converging on and Regulating the AR Transcriptional Complex
Endocr. Rev., December 1, 2007; 28(7): 778 - 808.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. K. Mukhopadhyay, B. Cinar, L. Mukhopadhyay, M. Lutchman, A. S. Ferdinand, J. Kim, L. W. K. Chung, R. M. Adam, S. K. Ray, A. B. Leiter, et al.
The Zinc Finger Protein Ras-Responsive Element Binding Protein-1 Is a Coregulator of the Androgen Receptor: Implications for the Role of the Ras Pathway in Enhancing Androgenic Signaling in Prostate Cancer
Mol. Endocrinol., September 1, 2007; 21(9): 2056 - 2070.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. T. Kesler, D. Gioeli, M. R. Conaway, M. J. Weber, and B. M. Paschal
Subcellular Localization Modulates Activation Function 1 Domain Phosphorylation in the Androgen Receptor
Mol. Endocrinol., September 1, 2007; 21(9): 2071 - 2084.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. G. Nickols and P. B. Dervan
Suppression of androgen receptor-mediated gene expression by a sequence-specific DNA-binding polyamide
PNAS, June 19, 2007; 104(25): 10418 - 10423.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
S. E. Trasino, E. H. Harrison, and T. T. Y. Wang
Androgen Regulation of Aldehyde Dehydrogenase 1A3 (ALDH1A3) in the Androgen-Responsive Human Prostate Cancer Cell Line LNCaP
Experimental Biology and Medicine, June 1, 2007; 232(6): 762 - 771.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C.-S. Yang, H.-W. Xin, J. B. Kelley, A. Spencer, D. L. Brautigan, and B. M. Paschal
Ligand Binding to the Androgen Receptor Induces Conformational Changes That Regulate Phosphatase Interactions
Mol. Cell. Biol., May 1, 2007; 27(9): 3390 - 3404.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J. Lai, M.-A. Kedda, K. Hinze, R. L.G. Smith, J. Yaxley, A. B. Spurdle, C.P. Morris, J. Harris, and J. A. Clements
PSA/KLK3 AREI promoter polymorphism alters androgen receptor binding and is associated with prostate cancer susceptibility
Carcinogenesis, May 1, 2007; 28(5): 1032 - 1039.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. E. van Royen, S. M. Cunha, M. C. Brink, K. A. Mattern, A. L. Nigg, H. J. Dubbink, P. J. Verschure, J. Trapman, and A. B. Houtsmuller
Compartmentalization of androgen receptor protein-protein interactions in living cells
J. Cell Biol., April 9, 2007; 177(1): 63 - 72.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
K. Horii, Y. Suzuki, Y. Kondo, M. Akimoto, T. Nishimura, Y. Yamabe, M. Sakaue, T. Sano, T. Kitagawa, S. Himeno, et al.
Androgen-Dependent Gene Expression of Prostate-Specific Antigen Is Enhanced Synergistically by Hypoxia in Human Prostate Cancer Cells
Mol. Cancer Res., April 1, 2007; 5(4): 383 - 391.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
R. Jasavala, H. Martinez, J. Thumar, A. Andaya, A.-C. Gingras, J. K. Eng, R. Aebersold, D. K. Han, and M. E. Wright
Identification of Putative Androgen Receptor Interaction Protein Modules: Cytoskeleton and Endosomes Modulate Androgen Receptor Signaling in Prostate Cancer Cells
Mol. Cell. Proteomics, February 1, 2007; 6(2): 252 - 271.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
M. H. Slagter, L. J.G. Gooren, W. de Ronde, A. Soosaipillai, A. Scorilas, E. J. Giltay, M. Paliouras, and E. P. Diamandis
Serum and Urine Tissue Kallikrein Concentrations in Male-to-Female Transsexuals Treated with Antiandrogens and Estrogens
Clin. Chem., July 1, 2006; 52(7): 1356 - 1365.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. K. Lyons, E. Lim, A. O. Clermont, J. Dusich, L. Zhu, K. D. Campbell, R. J. Coffee, D. S. Grass, J. Hunter, T. Purchio, et al.
Noninvasive Bioluminescence Imaging of Normal and Spontaneously Transformed Prostate Tissue in Mice.
Cancer Res., May 1, 2006; 66(9): 4701 - 4707.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. J. Burd, C. E. Petre, L. M. Morey, Y. Wang, M. P. Revelo, C. A. Haiman, S. Lu, C. M. Fenoglio-Preiser, J. Li, E. S. Knudsen, et al.
Cyclin D1b variant influences prostate cancer growth through aberrant androgen receptor regulation
PNAS, February 14, 2006; 103(7): 2190 - 2195.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. A. Magee, L.-w. Chang, G. D. Stormo, and J. Milbrandt
Direct, Androgen Receptor-Mediated Regulation of the FKBP5 Gene via a Distal Enhancer Element
Endocrinology, January 1, 2006; 147(1): 590 - 598.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
F. Xiao, A. Mirwald, M. Papaioannou, A. Baniahmad, and J. Klug
Secretoglobin 2A1 Is under Selective Androgen Control Mediated by a Peculiar Binding Site for Sp Family Transcription Factors
Mol. Endocrinol., December 1, 2005; 19(12): 2964 - 2978.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
C-L Hsieh, Z Xie, Z-Y Liu, J E Green, W D Martin, M W Datta, F Yeung, D Pan, and L W K Chung
A luciferase transgenic mouse model: visualization of prostate development and its androgen responsiveness in live animals
J. Mol. Endocrinol., October 1, 2005; 35(2): 293 - 304.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. Farla, R. Hersmus, J. Trapman, and A. B. Houtsmuller
Antiandrogens prevent stable DNA-binding of the androgen receptor
J. Cell Sci., September 15, 2005; 118(18): 4187 - 4198.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Ma, A. C. Ziel-van der Made, B. Autar, H. A. van der Korput, M. Vermeij, P. van Duijn, K. B. Cleutjens, R. de Krijger, P. Krimpenfort, A. Berns, et al.
Targeted Biallelic Inactivation of Pten in the Mouse Prostate Leads to Prostate Cancer Accompanied by Increased Epithelial Cell Proliferation but not by Reduced Apoptosis
Cancer Res., July 1, 2005; 65(13): 5730 - 5739.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K.-H. Chuang, Y.-F. Lee, W.-J. Lin, C.-Y. Chu, S. Altuwaijri, Y.-J. Y. Wan, and C. Chang
9-cis-Retinoic Acid Inhibits Androgen Receptor Activity through Activation of Retinoid X Receptor
Mol. Endocrinol., May 1, 2005; 19(5): 1200 - 1212.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. A. Link, C. J. Burd, E. Williams, T. Marshall, G. Rosson, E. Henry, B. Weissman, and K. E. Knudsen
BAF57 Governs Androgen Receptor Action and Androgen-Dependent Proliferation through SWI/SNF
Mol. Cell. Biol., March 15, 2005; 25(6): 2200 - 2215.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Jung, R.-S. Kim, H.-J. Zhang, S.-J. Lee, and M.-H. Jeng
HOXB13 Induces Growth Suppression of Prostate Cancer Cells as a Repressor of Hormone-Activated Androgen Receptor Signaling
Cancer Res., December 15, 2004; 64(24): 9185 - 9192.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Z. Kang, O. A. Janne, and J. J. Palvimo
Coregulator Recruitment and Histone Modifications in Transcriptional Regulation by the Androgen Receptor
Mol. Endocrinol., November 1, 2004; 18(11): 2633 - 2648.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
H. Zhang, X. Yi, X. Sun, N. Yin, B. Shi, H. Wu, D. Wang, G. Wu, and Y. Shang
Differential gene regulation by the SRC family of coactivators
Genes & Dev., July 15, 2004; 18(14): 1753 - 1765.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Liu, B. O. Kim, C. Kao, C. Jung, J. T. Dalton, and J. J. He
Tip110, the Human Immunodeficiency Virus Type 1 (HIV-1) Tat-interacting Protein of 110 kDa as a Negative Regulator of Androgen Receptor (AR) Transcriptional Activation
J. Biol. Chem., May 21, 2004; 279(21): 21766 - 21773.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
C. A. Borgono, I. P. Michael, and E. P. Diamandis
Human Tissue Kallikreins: Physiologic Roles and Applications in Cancer
Mol. Cancer Res., May 1, 2004; 2(5): 257 - 280.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. A. Heinlein and C. Chang
Androgen Receptor in Prostate Cancer
Endocr. Rev., April 1, 2004; 25(2): 276 - 308.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Kim, L. Jia, W. D. Tilley, and G. A. Coetzee
Dynamic methylation of histone H3 at lysine 4 in transcriptional regulation by the androgen receptor
Nucleic Acids Res., December 1, 2003; 31(23): 6741 - 6747.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. W. Marshall, K. A. Link, C. E. Petre-Draviam, and K. E. Knudsen
Differential Requirement of SWI/SNF for Androgen Receptor Activity
J. Biol. Chem., August 15, 2003; 278(33): 30605 - 30613.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Zhang, M. Johnson, K. H. Le, M. Sato, R. Ilagan, M. Iyer, S. S. Gambhir, L. Wu, and M. Carey
Interrogating Androgen Receptor Function in Recurrent Prostate Cancer
Cancer Res., August 1, 2003; 63(15): 4552 - 4560.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Gao, J. Zhang, M. A. Rao, T. C. Case, J. Mirosevich, Y. Wang, R. Jin, A. Gupta, P. S. Rennie, and R. J. Matusik
The Role of Hepatocyte Nuclear Factor-3{alpha} (Forkhead Box A1) and Androgen Receptor in Transcriptional Regulation of Prostatic Genes
Mol. Endocrinol., August 1, 2003; 17(8): 1484 - 1507.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W.-S. Cheng, V. Giandomenico, I. Pastan, and M. Essand
Characterization of the Androgen-Regulated Prostate-Specific T Cell Receptor {gamma}-Chain Alternate Reading Frame Protein (TARP) Promoter
Endocrinology, August 1, 2003; 144(8): 3433 - 3440.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
S. D. Cramer, B.-L. Chang, A. Rao, G. A. Hawkins, S. L. Zheng, W. N. Wade, R. T. Cooke, L. N. Thomas, E. R. Bleecker, W. J. Catalona, et al.
Association Between Genetic Polymorphisms in the Prostate-Specific Antigen Gene Promoter and Serum Prostate-Specific Antigen Levels
J Natl Cancer Inst, July 16, 2003; 95(14): 1044 - 1053.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. P. Balk, Y.-J. Ko, and G. J. Bubley
Biology of Prostate-Specific Antigen
J. Clin. Oncol., January 15, 2003; 21(2): 383 - 391.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
T. Kishi, L. Grass, A. Soosaipillai, C. Shimizu-Okabe, and E. P. Diamandis
Human Kallikrein 8: Immunoassay Development and Identification in Tissue Extracts and Biological Fluids
Clin. Chem., January 1, 2003; 49(1): 87 - 96.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Wang, D. Sharma, Y. Ren, and J. D. Fondell
A Coregulatory Role for the TRAP-Mediator Complex in Androgen Receptor-mediated Gene Expression
J. Biol. Chem., November 1, 2002; 277(45): 42852 - 42858.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Ueda, N. R. Mawji, N. Bruchovsky, and M. D. Sadar
Ligand-independent Activation of the Androgen Receptor by Interleukin-6 and the Role of Steroid Receptor Coactivator-1 in Prostate Cancer Cells
J. Biol. Chem., October 4, 2002; 277(41): 38087 - 38094.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Jain, A. Lam, I. Vivanco, M. F. Carey, and R. E. Reiter
Identification of an Androgen-Dependent Enhancer within the Prostate Stem Cell Antigen Gene
Mol. Endocrinol., October 1, 2002; 16(10): 2323 - 2337.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Masiello, S. Cheng, G. J. Bubley, M. L. Lu, and S. P. Balk
Bicalutamide Functions as an Androgen Receptor Antagonist by Assembly of a Transcriptionally Inactive Receptor
J. Biol. Chem., July 12, 2002; 277(29): 26321 - 26326.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
J. F. Morales, E. T. Snow, and J. P. Murnane
Environmental factors affecting transcription of the human L1 retrotransposon. I. Steroid hormone-like agents
Mutagenesis, May 1, 2002; 17(3): 193 - 200.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Y. B. Wetherill, C. E. Petre, K. R. Monk, A. Puga, and K. E. Knudsen
The Xenoestrogen Bisphenol A Induces Inappropriate Androgen Receptor Activation and Mitogenesis in Prostatic Adenocarcinoma Cells
Mol. Cancer Ther., May 1, 2002; 1(7): 515 - 524.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Dotzlaw, U. Moehren, S. Mink, A. C. B. Cato, J. A. Iniguez Lluhi, and A. Baniahmad
The Amino Terminus of the Human AR Is Target for Corepressor Action and Antihormone Agonism
Mol. Endocrinol., April 1, 2002; 16(4): 661 - 673.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Ueda, N. Bruchovsky, and M. D. Sadar
Activation of the Androgen Receptor N-terminal Domain by Interleukin-6 via MAPK and STAT3 Signal Transduction Pathways
J. Biol. Chem., February 22, 2002; 277(9): 7076 - 7085.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Iyer, L. Wu, M. Carey, Y. Wang, A. Smallwood, and S. S. Gambhir
Two-step transcriptional amplification as a method for imaging reporter gene expression using weak promoters
PNAS, December 4, 2001; 98(25): 14595 - 14600.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Yuan, M. L. Lu, T. Li, and S. P. Balk
SRY Interacts with and Negatively Regulates Androgen Receptor Transcriptional Activity
J. Biol. Chem., November 30, 2001; 276(49): 46647 - 46654.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. L. Shenk, C. J. Fisher, S.-Y. Chen, X.-F. Zhou, K. Tillman, and L. Shemshedini
p53 Represses Androgen-induced Transactivation of Prostate-specific Antigen by Disrupting hAR Amino- to Carboxyl-terminal Interaction
J. Biol. Chem., October 12, 2001; 276(42): 38472 - 38479.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Cinar, K. S. Koeneman, M. Edlund, G. S. Prins, H. E. Zhau, and L. W. K. Chung
Androgen Receptor Mediates the Reduced Tumor Growth, Enhanced Androgen Responsiveness, and Selected Target Gene Transactivation in a Human Prostate Cancer Cell Line
Cancer Res., October 1, 2001; 61(19): 7310 - 7317.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
G. M. Yousef and E. P. Diamandis
The New Human Tissue Kallikrein Gene Family: Structure, Function, and Association to Disease
Endocr. Rev., April 1, 2001; 22(2): 184 - 204.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
X. Li, M. Marani, J. Yu, B. Nan, J. A. Roth, S. Kagawa, B. Fang, L. Denner, and M. Marcelli
Adenovirus-mediated Bax Overexpression for the Induction of Therapeutic Apoptosis in Prostate Cancer
Cancer Res., January 1, 2001; 61(1): 186 - 191.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
P. Oettgen, E. Finger, Z. Sun, Y. Akbarali, U. Thamrongsak, J. Boltax, F. Grall, A. Dube, A. Weiss, L. Brown, et al.
PDEF, a Novel Prostate Epithelium-specific Ets Transcription Factor, Interacts with the Androgen Receptor and Activates Prostate-specific Antigen Gene Expression
J. Biol. Chem., January 14, 2000; 275(2): 1216 - 1225.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. M. Grad, J. Le Dai, S. Wu, and K. L. Burnstein
Multiple Androgen Response Elements and a Myc Consensus Site in the Androgen Receptor (AR) Coding Region Are Involved in Androgen-Mediated Up-Regulation of AR Messenger RNA
Mol. Endocrinol., November 1, 1999; 13(11): 1896 - 1911.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
W. Huang, Y. Shostak, P. Tarr, C. Sawyers, and M. Carey
Cooperative Assembly of Androgen Receptor into a Nucleoprotein Complex That Regulates the Prostate-specific Antigen Enhancer
J. Biol. Chem., September 3, 1999; 274(36): 25756 - 25768.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. T. Abreu-Martin, A. Chari, A. A. Palladino, N. A. Craft, and C. L. Sawyers
Mitogen-Activated Protein Kinase Kinase Kinase 1 Activates Androgen Receptor-Dependent Transcription and Apoptosis in Prostate Cancer
Mol. Cell. Biol., July 1, 1999; 19(7): 5143 - 5154.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Patrikainen, J. Shan, K. Porvari, and P. Vihko
Identification of the Deoxyribonucleic Acid-Binding Site of a Regulatory Protein Involved in Prostate-Specific and Androgen Receptor-Dependent Gene Expression
Endocrinology, May 1, 1999; 140(5): 2063 - 2070.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
K. E. Knudsen, W. K. Cavenee, and K. C. Arden
D-Type Cyclins Complex with the Androgen Receptor and Inhibit Its Transcriptional Transactivation Ability
Cancer Res., May 1, 1999; 59(10): 2297 - 2301.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D.-C. Yu, G. T. Sakamoto, and D. R. Henderson
Identification of the Transcriptional Regulatory Sequences of Human Kallikrein 2 and Their Use in the Construction of Calydon Virus 764, an Attenuated Replication Competent Adenovirus for Prostate Cancer Therapy
Cancer Res., April 1, 1999; 59(7): 1498 - 1504.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. V. Swinnen, P. Alen, W. Heyns, and G. Verhoeven
Identification of Diazepam-binding Inhibitor/Acyl-CoA-binding Protein as a Sterol Regulatory Element-binding Protein-responsive Gene
J. Biol. Chem., August 7, 1998; 273(32): 19938 - 19944.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. Lopez-Otin and E. P. Diamandis
Breast and Prostate Cancer: An Analysis of Common Epidemiological, Genetic, and Biochemical Features
Endocr. Rev., August 1, 1998; 19(4): 365 - 396.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. M. Kokontis, N. Hay, and S. Liao
Progression of LNCaP Prostate Tumor Cells during Androgen Deprivation: Hormone-Independent Growth, Repression of Proliferation by Androgen, and Role for p27Kip1 in Androgen-Induced Cell Cycle Arrest
Mol. Endocrinol., July 1, 1998; 12(7): 941 - 953.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
S. Thornton, D. W. Thomas, P. M. Gallagher, and R. E. Ganschow
Androgen Responsiveness of Mouse Kidney {beta}-Glucuronidase Requires 5'-Flanking and Intragenic Gus-s Sequences
Mol. Endocrinol., March 1, 1998; 12(3): 333 - 341.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
C. B. J. M. Cleutjens, K. Steketee, C. C. E. M. van Eekelen, J. A. G. M. van der Korput, A. O. Brinkmann, and J. Trapman
Both Androgen Receptor and Glucocorticoid Receptor Are Able to Induce Prostate-Specific Antigen Expression, but Differ in Their Growth-Stimulating Properties of LNCaP Cells
Endocrinology, December 1, 1997; 138(12): 5293 - 5300.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. B. J .M. Cleutjens, H. A. G. M. van der Korput, C. C. Ehren-van Eekelen, R. A. Sikes, C. Fasciana, L. W. Chung, and J. Trapman
A 6-kb Promoter Fragment Mimics in Transgenic Mice the Prostate-Specific and Androgen-Regulated Expression of the Endogenous Prostate-Specific Antigen Gene in Humans
Mol. Endocrinol., August 1, 1997; 11(9): 1256 - 1265.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
F. Yeung, X. Li, J. Ellett, J. Trapman, C. Kao, and L. W. K. Chung
Regions of Prostate-specific Antigen (PSA) Promoter Confer Androgen-independent Expression of PSA in Prostate Cancer Cells
J. Biol. Chem., December 22, 2000; 275(52): 40846 - 40855.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. W. Verhaegh, A. van Bokhoven, F. Smit, J. A. Schalken, and M. J. G. Bussemakers
Isolation and Characterization of the Promoter of the Human Prostate Cancer-specific DD3 Gene
J. Biol. Chem., November 22, 2000; 275(48): 37496 - 37503.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Yeung, W. K. Law, C.-H. Yeh, J. J. Westendorf, Y. Zhang, R. Wang, C. Kao, and L. W. K. Chung
Regulation of Human Osteocalcin Promoter in Hormone-independent Human Prostate Cancer Cells
J. Biol. Chem., January 18, 2002; 277(4): 2468 - 2476.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. E. Petre, Y. B. Wetherill, M. Danielsen, and K. E. Knudsen
Cyclin D1: Mechanism and Consequence of Androgen Receptor Co-repressor Activity
J. Biol. Chem., January 11, 2002; 277(3): 2207 - 2215.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Yeh, Y.-C. Hu, M. Rahman, H.-K. Lin, C.-L. Hsu, H.-J. Ting, H.-Y. Kang, and C. Chang
Increase of androgen-induced cell death and androgen receptor transactivation by BRCA1 in prostate cancer cells
PNAS, October 10, 2000; 97(21): 11256 - 11261.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cleutjens, K. B. J. M.
Right arrow Articles by Trapman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cleutjens, K. B. J. M.
Right arrow Articles by Trapman, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals