| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
1 Functionally Binds as a Monomer to Extended Half-Site Sequences Including Ones Contained within Estrogen-Response Elements
McArdle Laboratory for Cancer Research University of Wisconsin Medical School Madison, Wisconsin 53706-1599
| ABSTRACT |
|---|
|
|
|---|
1
(hERR
1) is an orphan member of the steroid/thyroid hormone receptor
superfamily. A cDNA encoding this protein was originally isolated on
the basis of sequence similarity in its DNA-binding domain with
estrogen receptor
(ER
). Previously, we reported the purification
of hERR
1 from HeLa cell nuclear extracts on the basis of its ability
to bind two sites in the late promoter of simian virus 40 (SV40). We
have now determined the primary structure and the DNA and protein
binding specificities of hERR
1 and developed in vivo and
in vitro assays for its functional activities. hERR
1 was
found to bind as a monomer, with a high-affinity binding site
containing the extended half-site sequence 5'-TCAAGGTCA-3'. Binding
sites for hERR
1 were identified in many cellular promoters,
including some that were previously shown to function as
estrogen-response elements (EREs). hERR
1 was shown to function as a
sequence-specific repressor of the SV40 late promoter in both cell
culture and cell-free transcription sytems. It was also shown to
interact with both ER
and the transcription factor TFIIB by direct
protein-protein contacts. Thus, hERR
1 may play a role in the
response of some genes to estrogen via heterodimerization with ERs or
competition with ERs for binding to EREs. | INTRODUCTION |
|---|
|
|
|---|
Ligands for many members of the superfamily have been well studied;
they include the steroid hormones, thyroid hormones, retinoids, and
vitamin D3. Other members of the superfamily have no known
ligand; they are referred to as "orphan" receptors. Orphan
receptors can bind DNA as heterodimers, homodimers, or monomers
(reviewed in Ref.7). The human estrogen-related receptor 1 (hERR1;
renamed hERR
) is an orphan member of this superfamily. Complementary
DNAs encoding portions of this protein and hERR2 (renamed hERRß) were
initially isolated by a reduced-stringency screening of cDNA libraries
with probes corresponding to the DBD of the human estrogen receptor
(ER
; formerly ER) (8). Using chimeric receptors in transfected
cells, Lydon et al. (9) demonstrated that hERR
contains a
transcriptional activation domain. On the basis of amino acid sequence
similarity with the receptor SF-1 in part of the DBD, Wilson et
al. (4) predicted that hERR
might bind as a monomer to the
extended half-site sequence 5'-TCAAGGTCA-3' recognized by SF-1.
Recently, Yang et al. (10) isolated new cDNA clones encoding
most of hERR
by screening a cDNA expression library for proteins
capable of binding to sequences present in the promoter region of the
human lactoferrin gene.
Previously, we reported the purification of proteins from a HeLa cell
nuclear extract that bind the transcriptional initiation site of the
major late promoter (MLP) of simian virus 40 (SV40) (11). These
proteins, collectively referred to as IBP-s (initiator binding proteins
of SV40) were shown to consist of multiple members of the
steroid/thyroid hormone receptor superfamily (11, 12). Partial peptide
sequence analysis indicated that a major component of IBP-s was hERR
(11). Thus, we had identified at least one binding site for hERR
in
the SV40 late promoter. To identify functional activities of IBP-s, we
performed a variety of genetic and biochemical experiments (1112a).
The data from these experiments indicated the following: 1) The
SV40-MLP contains at least two high-affinity binding sites for IBP-s
situated immediately surrounding (+1 site) and approximately 55 bp
downstream (+55 site) of the transcriptional start site. 2) These
high-affinity binding sites include the consensus half-site sequence
5'-AGGTCA-3'. 3) The binding of IBP-s to these sites results in
repression of transcription from the SV40 late promoter both in
transfected CV-1 cells (derived from SV40s natural host) and in a
cell-free transcription system. 4) Transfection of CV-1 cells with a
plasmid encoding an ER
-hERR
chimeric protein containing all but
the first 38 amino acid residues of hERR
results in
sequence-specific superrepression of the SV40 late promoter. Thus,
hERR
likely possesses the functional activities of IBP-s.
We (Ref. 13; see below) and others (C. T. Teng, personal communication)
have recently found that a 53-kDa protein, called hERR
1, is a major
isoform expressed in vivo from the hERR
gene. Using this
biologically relevant, nonchimeric, recombinant hERR
1 protein, we
demonstrate here that hERR
1 protein can, indeed, bind DNA as a
monomer, with a high-affinity binding site containing 5'-TCAAGGTCA-3'.
We also report the development of in vitro and in
vivo functional assays for hERR
1 activity. Lastly, binding
sites for hERR
1 are identified in cellular promoters, some of which
contain functional EREs, and hERR
1 is shown to bind directly ER
.
We speculate that hERR
1 can play a role in the response of some
genes to estrogen via heterodimerization with ER or competition with ER
for binding to EREs.
| RESULTS |
|---|
|
|
|---|
1
cDNA was deduced from putatively
overlapping cDNA clones (8). It encodes a 521-amino acid protein with
an apparent molecular mass of 63 kDa by SDS-PAGE (13). We failed by
pulse-labeling/immunoprecipitation and immunoblotting techniques to
find a protein of this size in any of numerous natural sources that
cross-reacted with our hERR
-specific antiserum; instead, we
identified a faster-migrating protein (Ref. 13; see below). We
hypothesized that this naturally existing protein is an isoform encoded
by the hERR
gene in which translation initiates at the second
methionine codon, corresponding to amino acid residue 98 in the
published sequence (see Fig. 1
gene is named hERR
1.
|
1 was used in immunoblotting experiments to
compare the hERR
proteins present in a HeLa cell nuclear extract
with hERR
1 produced by in vitro transcription and
translation in a rabbit reticulocyte lysate (TNT). The predominant
protein found in each sample comigrated (Fig. 2A
|
proteins were
also determined by metabolic labeling of HeLa cells with
[35S] methionine and cysteine, followed by
immunoprecipitation. Again, a 53-kDa protein was identified (Fig. 2B
E6/E72)
(13) and was found to have a half-life of 1012 h (13). Thus, we
conclude that hERR
1 probably corresponds to the authentic, major
isoform synthesized from the hERR
gene in vivo.
To confirm this hypothesis, we also analyzed the location of the 5'-end
of the hERR
mRNA present in HeLa cells by S1 nuclease mapping with
the probe shown in Fig. 1
. Whereas RNA that could encode full-length
hERR
would be expected to protect 634 nt of this probe, we observed
a protected fragment only 510 nt in length (Fig. 3A
).
Thus, most of the hERR
mRNA accumulated in HeLa cells was
discontinuous with the deduced hERR
sequence described by
Giguère et al. (8) at approximately nt +180 relative
to the AUG codon presumed to be used for the synthesis of full-length
hERR
.
|
1 (Fig. 1
1 cDNA isolated by Yang et
al. (10) from a human endometrium carcinoma cell line. Thus, it is
highly likely that this is the location of the 5'-end of the major
species of hERR
mRNA that accumulates in at least some human cell
lines. Because the first AUG codon in this mRNA is the codon present at
the amino terminus of hERR
1, this mRNA likely encodes hERR
1, but
cannot encode full-length hERR
. The minor, 266-nt band observed by
primer extension analysis also cannot correspond to an mRNA encoding
full-length hERR
. Thus, we conclude that the major, hERR
-encoded
protein that accumulates in HeLa cells is probably identical in primary
structure to the hERR
1 protein depicted in Fig. 1
gene may also exist in minor
quantities or in different tissues or times during development.
DNA Binding by hERR
1
Because hERR
1 was initially cloned on the basis of amino acid
similarity with ER
, the DNA sequence(s) it binds was unknown. We,
therefore, investigated the DNA-binding properties of hERR
1. Since
Wilson et al. (4) hypothesized that hERR
1 might bind a
DNA sequence similar to the one bound by SF-1, we first looked for
binding by a gel mobility shift assay with a probe consisting of a
double-stranded synthetic oligonucleotide containing the
high-affinity SF-1-binding site sequence, 5'-TCAAGGTCA-3'. Glutathione
S-transferase (GST)-hERR
1 was, indeed, found to bind this
SF-1 probe (Fig. 4
, lane 2). Incubation with our
polyclonal anti-hERR
1 serum resulted in both the supershifting of a
portion of this hERR
1-DNA complex and the prevention of the
formation of another portion of it (Fig. 4
, lane 4 vs. 3).
Thus, we conclude that hERR
1 binds specifically to the high-affinity
binding site of SF-1.
|
1,
we tested the ability of hERR
1 to bind to sequences from a variety
of promoters, including many hormone-response elements. Because prior
work from our laboratory indicated that hERR
1 probably binds to two
sites in the SV40-MLP, the +1 and +55 sites (11, 12), we tested the
affinity of hERR
1 for these sites relative to the SF-1 site using a
quantitative, competition gel mobility shift assay (Fig. 4
|
1 and ER
have 68% amino acid identity
(8, 10). These data are summarized in Fig. 5
1 with
one-tenth to one-fifth the affinity observed with the highest affinity
binding site. Thus, some EREs contain binding sites for hERR
1.
By comparing the sequences that bound hERR
1 well with those that
bound it poorly or not at all, we deduced that a high-affinity,
consensus DNA-binding site for hERR
1 is 5'-TCAAGGTCA-3'. However,
some of the oligonucleotides containing this consensus sequence
(e.g. P450scc) did not bind hERR
1 well; thus, bases
beyond the 9-bp consensus sequence also affect the binding affinity. We
also deduced that hERR
1 likely binds to DNA as a monomer because
several of the high-affinity binding sites (e.g. SF-1,
CYP1A22, PRL D) contain only a single extended half-site in
isolation.
hERR
1 Binds DNA as a Monomer
To confirm that hERR
1 can truly bind to extended half-sites as
a monomer, footprinting assays were performed of GST-hERR
1 bound to
the MLP region of wild-type SV40 DNA. Consistent with the data
summarized in Fig. 5
, GST-hERR
1 was found to strongly protect the +1
and +55 sites present in the SV40-MLP from digestion by DNase I (Fig. 6A
). Within each of these protected regions are two
half-site sequences, either or both of which could potentially be
recognized by hERR
1. The exact bases protected were determined by
comparison with dideoxy-sequencing reactions of the probe DNA that were
co-electrophoresed next to the footprinting reactions (data not shown)
(summarized in Fig. 6C
, solid bars). At each site, only one
of the two half-sites was covered by hERR
1. Therefore, hERR
1 can
bind to a single half-site sequence as a monomer.
|
1-binding site was done using a
hydroxyl radical footprinting technique with a probe made from an SV40
mutant, pm322C, which is defective in the +1 site (11) and,
thus, contains only the +55 site. As is shown in Fig. 6B
1. Footprint
analyses with probe DNAs containing mutations in the unprotected
half-site sequences present in the +1 and +55 regions of the SV40-MLP
(Refs. 11 and 14 and data not shown) confirmed that these unprotected
half-site sequences do not contribute to the binding of hERR
1. This
finding is also consistent with glycerol gradient sedimentation
analysis of purified IBP-s that indicated that at least some of
hERR
1 as purified from mammalian cells exists in solution as a
monomer (14). Thus, we conclude that hERR
1 can bind to extended
half-site sequences as a monomer.
hERR
1 Sequence Specifically Inhibits Transcription from the SV40
Late Promoter
Previous data indicated that a component(s) of IBP-s sequence
specifically repressed transcription from the SV40-MLP in a cell-free
system made from HeLa cell nuclear extract (11). To confirm that
hERR
1 has this biochemical activity, this assay was repeated with
recombinant hERR
1 protein (Fig. 7
). Addition of
GST-hERR
1 reproducibly decreased transcription approximately 3-fold
from the wild type SV40-MLP, but had no effect on transcription from
the SV40 early promoter present on the same template DNA (Fig. 7
, lane
3 vs. 1 and 2). Transcription from the minor late promoters
was also inhibited. When the template contained point mutations in the
+1 and +55 hERR
1-binding sites of SV40, the basal level of
transcription from the SV40-MLP and minor late promoters increased as a
result of the relief from repression by members of the superfamily
present in the HeLa cell nuclear extract. Transcription of the mutant
template was also not significantly affected by the addition of
GST-hERR
1 (Fig. 7
, lanes 4 and 5). These data indicate clearly and
definitively that hERR
1 can, indeed, repress transcription from the
SV40-MLP in vitro in a site- and sequence-specific manner.
Furthermore, the fact that the SV40 early promoter present in the same
reactions was unaffected by hERR
1 indicates that the repression was
not a trivial consequence of squelching, e.g. the binding of
a limiting amount of the transcription factor TFIIB.
|
-hERR
chimeric
protein can repress transcription from the SV40-MLP in vivo.
They also showed that either chicken ovalbumin upstream promoter
transcription factor 1 (COUP-TF1) (12) or thyroid hormone receptor-
1
/retinoid X receptor-
(12a) can repress transcription from the SV40
late promoter at early times during the lytic cycle of infection of
CV-1 cells when viral DNA template copy number is low, but not at late
times when viral DNA template copy number is high. To show definitively
that this repression activity can also be encoded by hERR
1, CV-1
cells were cotransfected with wild type SV40 and pRSV-hERR
1, a
plasmid encoding wild type hERR
1 and containing an SV40 origin
of replication (Fig. 8
1 (Fig. 8
1 resulted in a
decreased rate of accumulation of the SV40 late, but not early, mRNAs
until late times after transfection (e.g. 48 h), a time
at which the exogenous as well as endogenous hERR
1 and other IBP-s
have been titrated out as a consequence of viral DNA replication to
high template copy number (1112a). Therefore, we conclude that
hERR
1 can, indeed, repress transcription from the SV40-MLP both
in vitro and in vivo in a sequence-specific
manner by binding as a monomer to extended half-site sequences present
in the DNA.
|
1 Interactions
1 with TFIIB. Fusion proteins bound to glutathione-Sepharose
were incubated with 35S-labeled proteins synthesized in a
rabbit reticulocyte lysate. The affinity resin was washed, and
specifically retained proteins were eluted by denaturation, resolved by
SDS-PAGE, and detected by fluorography. In this in vitro
system, TFIIB was retained by GST-hERR
1 as well as it was retained
by GST-COUP-TF1 or GST-ER
(Fig. 9A
1 was specifically retained by
GST-TFIIB (Fig. 9A
1 (13). Thus, we conclude that TFIIB
directly associates with hERR
1 in vitro even in the
absence of eukaryotic-specific post-translational modifications.
|
1 shares considerable sequence similarity with ER
in its
ligand- binding domain (LBD) as well as its DBD (8, 10). Therefore,
hERR
1 might also exist under certain circumstances as a heterodimer
with ER
. Yang et al. (10) recently showed that
GST-hERR
1 interacts with a fragment of ER
fused to GST in a far
Western assay. Furthermore, some of the sequences to which hERR
1
binds (Fig. 5
well (e.g. vitellogenin ERE) (16),
others bind ER
poorly or not at all (e.g. PRL D, creatine
kinase B) (17, 18). Thus, binding to these latter EREs might be
accomplished by an ER/ERR
1 heterodimer.
To provide additional evidence in support of this hypothesis, we
performed a series of in vitro protein-protein binding
assays as described above. hERR
1 was retained by GST-ER
as well
as it was retained by GST-TFIIB (Fig. 9A
, lanes 68). In a reciprocal
experiment, labeled ER
was efficiently retained by GST-hERR
1
(Fig. 9B
, lanes 14). To ensure that these findings were truly a
result of protein-protein interactions rather than concurrent binding
to DNA fragments present in the protein preparations, this experiment
was repeated in the presence of ethidium bromide, a chemical that
disrupts protein-DNA interactions because it distorts the structure of
the DNA (19): the presence of ethidium bromide did not significantly
affect the retention of ER
by GST-hERR
1 (Fig. 9B
, lanes 68
vs. 14). To confirm that the hERR
1/ER
protein-protein interaction was direct rather than via a third protein
present in the lysates, the GST-fusion protein-binding experiment was
also performed with purified, recombinant ER
: ER
still bound to
hERR
1 as efficiently as it did to TFIIB (13). Therefore, we conclude
that hERR
1 and ER
can directly heterodimerize in
vitro.
| DISCUSSION |
|---|
|
|
|---|
1, which
corresponds to the major mRNA (Fig. 3
gene. Using recombinant
protein, we identified DNA-binding sites in a variety of promoters
(Fig. 5
1 can bind DNA as a monomer (Fig. 6
1 belongs in the subfamily of steroid/thyroid hormone receptors
that can bind DNA as monomers. In addition, we showed that hERR
1 is
capable of modulating transcription through its binding sites both
in vitro (Fig. 7
1. They may prove useful as
the basis for a screen for ligands to hERR
1. We also showed that
hERR
1 interacts in vitro with ER
and TFIIB (Fig. 9
1 may modify the estrogen-responsiveness of
some genes.
The hERR
1 Protein
We and others (10) have failed to find evidence for a protein
encoded by the hERR
cDNA described by Giguère et
al. (8). We detected, instead, an mRNA (Fig. 3
) with a 5'-end
located 3' of the site needed to encode hERR
. This mRNA has the
potential to code for a smaller hERR
protein, which we named
hERR
1. Its existence in vivo was confirmed by
immunoblotting and immunoprecipitation experiments (Fig. 2
). The
structure of the mRNA identified here is in agreement with the genomic
structure of the hERR
gene (C. T. Teng, personal communication).
hERR
1 is a protein of approximately 53 kDa; however, other isoforms
of hERR
may exist as well. hERR
1 is probably the same protein as
the larger of two hERR
isoforms recently described by Yang et
al. (10). We failed to detect the smaller, 42-kDa protein that
Yang et al. (10) found by immunoblotting. This discrepancy
is likely due to the use of different hERR
-specific antisera.
The hERR
1-Binding Site
A high-affinity hERR
1-binding site was determined to be the
extended half-site sequence, 5'-TCAAGGTCA-3' (Fig. 5
). This finding is
in agreement with the prediction of Wilson et al. (4) made
on the basis of the sequence similarity of the proximal A box of
hERR
1 to SF-1. We also confirmed that the FP1 sequence of the human
lactoferrin promoter is a strong hERR
1- binding site (Fig. 5
and
Ref.10). Significant sequence variability in the 5'-extension of the
consensus half-site sequence is tolerated by hERR
1. Most notably,
the SV40 +55 UP mutant and the PRL D sites each have a single base
difference from the consensus 5'-extension, but were found to bind
hERR
1 very well (Fig. 5
). Indeed, many sequences that do not contain
the 5'-TCA-3' extension were bound by hERR
1 at moderate levels. For
example, the vitellogenin ERE, which contains two consensus half-sites
(5'-AGGTCA-3') without an upstream 5'-TCA-3', was bound at reasonable
levels by hERR
1 (Fig. 5
).
Sequences outside of the 9-bp extended half-site also appear to play a
role in determining a sites strength. For example, the SF-1,
CYP1A21, and P450scc oligonucleotides each contain a perfect
consensus extended half-site, but their relative affinities varied more
than 60-fold (Fig. 5
). This finding is in agreement with the
observation that hERR
1 contacts at least one base outside of the
extended half-site (10). On the other hand, the integrity of the core
half-site sequence is clearly necessary, as mutations in the core of
the vitellogenin estrogen-response element (ERE) and SV40 +1 and +55
sites led to a complete loss of binding (Fig. 5
).
hERR
1 was initially cloned on the basis of its sequence, rather than
its function. Therefore, genes regulated by hERR
1 are largely
unknown. The data from the quantitative, competition gel mobility shift
assays (summarized in Fig. 5
) indicated several promoters that may be
regulated by hERR
1. However, the strongest binding sites may not be
the true physiological targets. For example, the SV40-MLP contains two
moderate-strength binding sites (Fig. 5
), yet was repressed by hERR
1
in vitro (Fig. 7
) and in vivo (Fig. 8
) at least
5-fold. On the other hand, the lactoferrin promoter is affected only
modestly by hERR
1 (10) despite the presence of a high-affinity site
(Ref. 10 and Fig. 5
). The importance of these other hERR
1-binding
sites awaits additional experiments.
Many Sequences Are Recognized by Multiple Members of the
Steroid/Thyroid Hormone Receptor Superfamily
Many of the DNA sequences that have been shown here to be bound by
hERR
1 are already known to bind other members of the steroid/thyroid
hormone receptor superfamily. The highest-affinity binding site we
found is identical to an oligonucleotide that is strongly bound by SF-1
(4). Additionally, the vitellogenin ERE (16), the PRL D sequence (17, 20), and the creatine kinase B sequence (18) are all known to be bound
by ER
and to mediate transcriptional induction by estrogens. The
SV40 +1 and +55 sites are functionally bound by COUP-TF1, COUP-TF2, and
thyroid hormone receptor-
1/retinoid X receptor-
(12, 12a, 21) as
well as by hERR
1 (
Figs. 48![]()
![]()
![]()
![]()
). In this latter case, any of these
superfamily members can repress transcription from the SV40-MLP. Thus,
hERR
1 can bind to sequences that are also recognized by other
members of the superfamily. The meaning of overlapping binding
specificity remains unclear.
COUP-TFs have been shown to repress transactivation by many members of
the steroid/thyroid hormone receptor superfamily (22). COUP-TFs can
repress by multiple mechanisms, including competition for DNA-binding
sites (23, 24). Because hERR
1 binds to several functional EREs (Fig. 5
), it may function in a similar manner to COUP-TFs by acting as a
general repressor of estrogen-regulated genes in the absence of
liganded ERs. In the presence of estrogen, activated ER may displace
hERR
1, allowing for both true activation and antirepression of the
target genes. Alternatively, because hERR
1 can associate directly
with ER
(Figs. 9
and 10) and, likely, ERß (25), hERR
1/ER
heterodimers may recognize EREs with an effect different from either
hERR
1 monomers or ER homodimers. hERR
1 has also been demonstrated
to contain a transactivation domain (9). Thus, it is likely that
hERR
1 can transcriptionally activate targets in some contexts. In
the case of the lactoferrin promoter, the hERR
1-binding site is
necessary for maximal transactivation by ER
acting through a weak,
downstream ERE (10). Because most members of the steroid/thyroid
hormone receptor superfamily are not ubiquitously expressed, the
ability of some sites to be bound by several members of the superfamily
may effectively increase the number of tissues in which an element is
recognized. Finally, there may be additional requirements for receptor
binding to these promoter sites that are not fully reproduced in these
in vitro systems.
In summary, we have shown that a major isoform of the hERR
gene is
hERR
1. We have characterized high-affinity binding sites for
hERR
1, shown that hERR
1 can bind DNA as a monomer, and developed
functional assays for hERR
1 activity. Furthermore, because this
receptor binds both ER
and EREs, we propose that hERR
1 likely
plays a role in estrogen responsiveness.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-hERR
, a gift from R. Evans, directs the
expression of a fusion protein consisting of the first 44 amino acids
of ER
and all but the first 38 amino acid residues of the previously
published hERR
sequence constructed from putatively overlapping cDNA
clones (8, 12). Plasmid pSP72-hERR
1, encoding full-length hERR
,
was generated by RT-PCR amplification of the 5'-end of full-length
hERR
cDNA synthesized from HeLa cell mRNA, appropriate recombination
with the hERR
segment present in pRSV-ER-hERR
, and insertion of
the resulting full-length hERR
cDNA into the
KpnI-to-HindIII sites of pSP72 (Promega, Madison,
WI). Plasmid pSP72-hERR
1 was generated by PCR amplification of a
portion of the full-length hERR
coding sequence (using the 5'-primer
AGCGCCATGGCCAGCCAGGTGGTGGGCATT, with the translation start
codon for hERR
1 underlined) and ligation back into
NcoI- and XmaI-cut pSP72-hERR
. Plasmid
pGEX-hERR
1 was constructed similarly. The plasmids directing the
expression of GST-COUP-TF1 and GST-ßglobin1-123 have
been described previously (27). The NaeI fragment of
the hERR
cDNA was cloned into a pGEX-2T vector (Pharmacia,
Piscataway, NJ) to generate pGEX-hERR
17-329. The
plasmid pGEX-ER was constructed by subcloning the ER
-encoding
EcoRI fragment of pHEGO, a gift of P. Chambon (28), into
pGEX. Plasmids pGEX-TFIIB and phIIB (29) were gifts from D. Reinberg.
The pseudo-wild type SV40 used in the experiment described in Fig. 8
1 was generated by
subcloning the sequences coding for hERR
1 from pGEX-hERR
1 into
pRSV-0+, a derivative of pRSV-0 (12) containing a
functional SV40 origin of DNA replication.
Cell Culture and Transfections
CV-1 cells were grown at 37 C in DMEM supplemented with 5% FBS.
HeLa S3 cells were grown in RPMI-1640 with 2 mM glutamine
and 10% FBS. All media were supplemented with penicillin and
streptomycin. Cotransfections were performed by a modification of the
diethylaminoethyl-dextran/chloroquine procedure as described (30). SV40
viral sequences were excised from the plasmid-cloning vector and
ligated to form monomer circles before transfection.
Recombinant Proteins and Antiserum
Recombinant GST-fusion proteins were purified essentially as
described (27). HeLa cell nuclear extract was prepared as previously
described (11, 31). In vitro transcribed and translated
(TNT) proteins were synthesized with a rabbit reticulocyte lysate
(Promega) and 35S-labeled methionine and cysteine
(Tran35S Label; ICN, Cleveland, OH) following the
manufacturers suggested protocol. A polyclonal antiserum was raised
in a New Zealand white rabbit against GST-hERR
117-329.
Molecular mass determination was performed with Combithek (Boehringer
Mannheim, Indianapolis, IN) and Mark 12 (Novex, San Diego, CA)
calibration proteins as standards.
Metabolic Labeling and Immunoprecipitation
Cells were metabolically labeled when approximately 80%
confluent by incubation for 4 h with medium containing
35S-labeled methionine and cysteine (250 mCi
Tran35S Label; ICN) as described (13). Protein lysates were
prepared (13) and were precleared by incubation for 1 h with
protein A-agarose (Santa Cruz Biotech, Santa Cruz, CA). The resulting
supernatant was incubated for 1 h on ice with 1 ml of
anti-GST-hERR
117-329 serum or preimmune serum from the
same animal. Afterward, protein A-agarose was added and the lysate was
incubated for 1 h at 4 C. The beads were washed three times and
the proteins were eluted by boiling in 2x SDS loading buffer. The
radiolabeled proteins were separated in a 10% SDS-PAGE gel and
detected by fluorography.
S1 Nuclease Mapping and Primer Extension Analysis
Total cellular RNA was prepared by lysis of the cells in SDS and
treatment with Proteinase K. Nucleic acids were extracted and DNA was
degraded by treatment with DNase I (21). Poly(A)+ HeLa S3
RNA was prepared with an mRNA Separator kit (Clontech, Palo Alto, CA).
The S1 nuclease mapping probe used in the experiment in Fig. 3A
consisted of the PvuII-to-HpaI fragment of
pSP72-hERR
(Fig. 1
). The S1 nuclease mapping probe used in the
experiment in Fig. 8
consisted of the origin promoter-containing the nt
4924446 region of wild type SV40 DNA described previously (12, 12a).
These probes were gel-purified and end-labeled with
[
-32P]ATP using T4 polynucleotide kinase (32). The
hybridization and S1 nuclease digestion reactions were performed
essentially as described (33). The resulting protected fragments were
separated by electrophoresis through a 7 M urea, 5%
polyacrylamide gel.
Primer extension analyses were performed essentially as described (30)
using the 5'-end-labeled oligonucleotide
5'-GCGTCTAGAGATGTAGAGAGGCTCAATGCCCACCACC-3' as primer
(Fig. 1
). The resulting DNAs were resolved in a 7 M urea,
8% polyacrylamide gel.
Quantitative Gel-Mobility-Shift Assays
DNA binding was assayed in 20 ml of a buffer containing 10
mM HEPES (pH 7.5), 2.5 mM MgCl2, 50
mM EDTA, 1 mM dithiothreitol, 6% glycerol, and
100 ng/ml of poly(dI-dC)xpoly(dI-dC). Competition binding assays
included unlabeled competitor oligonucleotide as well; 250 pg of
5'-end-labeled, double-stranded oligonucleotide (
5 x
104 cpm) were incubated with approximately 0.85 ng
GST-hERR
1 or GST-ßglobin1-123. Supershift assays
contained 1 ml of a 1:10 dilution of whole antiserum. All components
were mixed before the addition of protein. The final mixtures were
incubated on ice for 15 min, followed by incubation at 25 C for 15 min
before separation by electrophoresis at 4 C for 2 h through a
nondenaturing 4% polyacrylamide gel at 160 V. Quantification was
performed with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
The relative affinities of different sequences for binding by the
protein were determined from the moles of unlabeled competitor
oligonucleotide needed to reduce the fraction of probe shifted by
50%.
Footprinting
The probes used in the DNase I footprinting assays were
PCR-amplified DNA corresponding to SV40 nt 272446. Sense and
anti-sense probes were created by 5'-end-labeling one of the PCR
primers. The PCR products were gel-purified before use. Approximately
30 ng GST-hERR
1 were incubated 20 min at room temperature with
35 x 105 cpm of the probe in 50 mM
HEPES (pH 7.6), 6 mM MgCl2, 500 mM
EDTA, 20% glycerol, 8% polyethylene glycol, and 0.1 mg/ml
poly(dI-dC)xpoly(dI-dC). Incubation was continued for 1 min after
addition of 0.15 U of DNase I (Pharmacia). The reactions were
electrophoresed through a nondenaturing 4% polyacrylamide gel. The
protein-DNA complexes and unbound DNA were visualized by
autoradiography and excised and eluted from the gel. The DNAs were
purified by phenol-chloroform extraction and ethanol precipitation.
Equal counts from the unbound and bound complexes were loaded onto a 7
M urea, 6% denaturing polyacrylamide gel. After
electrophoresis, the gel was dried and exposed to x-ray film.
Hydroxyl radical footprinting was performed essentially as described by
Tullius and Dombroski (34). The probes were synthesized by PCR
amplification from an SV40 mutant, pm322C, containing a
hERR
1 binding-site only at +55 (11). Approximately 1 x
107 cpm of this probe was cleaved before use in the
footprinting reactions. Thereafter, the DNAs were treated essentially
as described above.
Cell-Free Transcription
Cell-free transcription assays were performed as described (11, 12). In brief, 200 ng of circular, plasmid SV40 DNA as template were
incubated for 15 min at 4 C with approximately 37 ng of the indicated
fusion protein, followed by 15 min at 25 C before addition of the
nuclear extract. The resulting SV40 transcripts were analyzed by primer
extension (12, 30) with synthetic oligonucleotides corresponding to
SV40 nt 51785201 and nt 446422 serving as primers for the detection
of the early and late RNAs, respectively.
Binding Assays
Protein-protein associations were assayed essentially as
described (27). Briefly, bacterial lysate containing approximately 4
pmol of the GST fusion protein was thawed on ice and mixed with
GSH-Sepharose at 4 C for at least 30 min. The beads were washed twice
at 4 C with 500 µl NETN buffer (20 mM Tris-HCl, pH 8.0,
100 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40, 0.1
mM phenylmethylsulfonyl fluoride, 0.02 mg aprotinin per
ml), resuspended in 50 µl NETN buffer, mixed at 4 C for at least
1 h with the test protein (typically in 0.22 ml of reticulocyte
lysate), and washed three times at 4 C with NETN buffer. The bound
proteins were eluted from the beads by boiling in SDS loading buffer
and were resolved by SDS-PAGE. For the experiment shown in Fig. 9B
, the
lysates were treated with 50 mg/ml ethidium bromide as described (19)
before use in this binding assay. The gels were stained with Coomassie
brilliant blue, destained, equilibrated in water, and treated with 1
M salicylic acid for 30 min before being dried and exposed
to x-ray film.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This material is based upon work supported under U.S. Public Health Service Grants CA-07175, CA-22443, and GM-07125.
1 Present address: Department of Plant Biology, University of Minnesota,
St. Paul, Minnesota 55108. ![]()
2 Present address: Whitehead Institute for Biomedical Research,
Cambridge, MA 02142. ![]()
3 Present address: Department of Immunology and Rheumatology, Stanford
University Medical School, Stanford, California 94305. ![]()
4 Present address: Abbott Laboratories, Inc., Abbott Park, Illinois
60064. ![]()
Received for publication July 19, 1996. Revision received November 27, 1996. Accepted for publication December 5, 1996.
| REFERENCES |
|---|
|
|
|---|
repressor and Cro protein. Proc Natl
Acad Sci USA 83:54695473This article has been cited by other articles:
![]() |
G. Mittler, F. Butter, and M. Mann A SILAC-based DNA protein interaction screen that identifies candidate binding proteins to functional DNA elements Genome Res., February 1, 2009; 19(2): 284 - 293. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bonnelye, N. Laurin, P. Jurdic, D. A. Hart, and J. E. Aubin Estrogen receptor-related receptor-{alpha} (ERR-{alpha}) is dysregulated in inflammatory arthritis Rheumatology, December 1, 2008; 47(12): 1785 - 1791. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Stein, C.-y. Chang, D. A. Kazmin, J. Way, T. Schroeder, M. Wergin, M. W. Dewhirst, and D. P. McDonnell Estrogen-Related Receptor {alpha} Is Critical for the Growth of Estrogen Receptor-Negative Breast Cancer Cancer Res., November 1, 2008; 68(21): 8805 - 8812. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Giguere Transcriptional Control of Energy Homeostasis by the Estrogen-Related Receptors Endocr. Rev., October 1, 2008; 29(6): 677 - 696. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Conzen Minireview: Nuclear Receptors and Breast Cancer Mol. Endocrinol., October 1, 2008; 22(10): 2215 - 2228. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hummasti and P. Tontonoz Adopting New Orphans into the Family of Metabolic Regulators Mol. Endocrinol., August 1, 2008; 22(8): 1743 - 1753. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hu, H. K. Kinyamu, L. Wang, J. Martin, T. K. Archer, and C. Teng Estrogen Induces Estrogen-related Receptor {alpha} Gene Expression and Chromatin Structural Changes in Estrogen Receptor (ER)-positive and ER-negative Breast Cancer Cells J. Biol. Chem., March 14, 2008; 283(11): 6752 - 6763. [Abstract] [Full Text] [PDF] |
||||
![]() |
Mst. H. Akter, T. Chano, H. Okabe, T. Yamaguchi, F. Hirose, and T. Osumi Target Specificities of Estrogen Receptor-Related Receptors: Analysis of Binding Sequences and Identification of Rb1-Inducible Coiled-Coil 1 (Rb1cc1) as a Target Gene J. Biochem., March 1, 2008; 143(3): 395 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bonnelye, R. A. Zirngibl, P. Jurdic, and J. E. Aubin The Orphan Nuclear Estrogen Receptor-Related Receptor-{alpha} Regulates Cartilage Formation in Vitro: Implication of Sox9 Endocrinology, March 1, 2007; 148(3): 1195 - 1205. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Ariazi, R. J. Kraus, M. L. Farrell, V. C. Jordan, and J. E. Mertz Estrogen-Related Receptor {alpha}1 Transcriptional Activities Are Regulated in Part via the ErbB2/HER2 Signaling Pathway Mol. Cancer Res., January 1, 2007; 5(1): 71 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Benoit, A. Cooney, V. Giguere, H. Ingraham, M. Lazar, G. Muscat, T. Perlmann, J.-P. Renaud, J. Schwabe, F. Sladek, et al. International Union of Pharmacology. LXVI. Orphan Nuclear Receptors Pharmacol. Rev., December 1, 2006; 58(4): 798 - 836. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Nichol, M. Christian, J. H. Steel, R. White, and M. G. Parker RIP140 Expression Is Stimulated by Estrogen-related Receptor {alpha} during Adipogenesis J. Biol. Chem., October 27, 2006; 281(43): 32140 - 32147. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, K. Chen, J. C. Shih, and C. T. Teng Estrogen-Related Receptors-Stimulated Monoamine Oxidase B Promoter Activity Is Down-Regulated by Estrogen Receptors Mol. Endocrinol., July 1, 2006; 20(7): 1547 - 1561. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Watanabe, Y. Kinoshita, K. Hosokawa, T. Mori, T. Yamaguchi, and H. Honjo Function of Estrogen-Related Receptor {alpha} in Human Endometrial Cancer J. Clin. Endocrinol. Metab., April 1, 2006; 91(4): 1573 - 1577. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Barry, J. Laganiere, and V. Giguere A Single Nucleotide in an Estrogen-Related Receptor {alpha} Site Can Dictate Mode of Binding and Peroxisome Proliferator-Activated Receptor {gamma} Coactivator 1{alpha} Activation of Target Promoters Mol. Endocrinol., February 1, 2006; 20(2): 302 - 310. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhou, Z. Liu, J. Wu, J.-h. Liu, S. M. Hyder, E. Antoniou, and D. B. Lubahn Identification and Characterization of Two Novel Splicing Isoforms of Human Estrogen-Related Receptor {beta} J. Clin. Endocrinol. Metab., February 1, 2006; 91(2): 569 - 579. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Herzog, J. Cardenas, R. K. Hall, J. A. Villena, P. J. Budge, V. Giguere, D. K. Granner, and A. Kralli Estrogen-related Receptor {alpha} Is a Repressor of Phosphoenolpyruvate Carboxykinase Gene Transcription J. Biol. Chem., January 6, 2006; 281(1): 99 - 106. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Wende, J. M. Huss, P. J. Schaeffer, V. Giguere, and D. P. Kelly PGC-1{alpha} Coactivates PDK4 Gene Expression via the Orphan Nuclear Receptor ERR{alpha}: a Mechanism for Transcriptional Control of Muscle Glucose Metabolism Mol. Cell. Biol., December 15, 2005; 25(24): 10684 - 10694. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Cartoni, B. Leger, M. B. Hock, M. Praz, A. Crettenand, S. Pich, J.-L. Ziltener, F. Luthi, O. Deriaz, A. Zorzano, et al. Mitofusins 1/2 and ERR{alpha} expression are increased in human skeletal muscle after physical exercise J. Physiol., August 15, 2005; 567(1): 349 - 358. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Seely, K. S. Amigh, T. Suzuki, B. Mayhew, H. Sasano, V. Giguere, J. Laganiere, B. R. Carr, and W. E. Rainey Transcriptional Regulation of Dehydroepiandrosterone Sulfotransferase (SULT2A1) by Estrogen-Related Receptor {alpha} Endocrinology, August 1, 2005; 146(8): 3605 - 3613. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Barry and V. Giguere Epidermal Growth Factor-Induced Signaling in Breast Cancer Cells Results in Selective Target Gene Activation by Orphan Nuclear Receptor Estrogen-Related Receptor {alpha} Cancer Res., July 15, 2005; 65(14): 6120 - 6129. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bonnelye and J. E. Aubin Estrogen Receptor-Related Receptor {alpha}: A Mediator of Estrogen Response in Bone J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3115 - 3121. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Liu, Z Zhang, and C T Teng Estrogen-related receptor-{gamma} and peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} regulate estrogen-related receptor-{alpha} gene expression via a conserved multi-hormone response element J. Mol. Endocrinol., April 1, 2005; 34(2): 473 - 487. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Miller, K. W. Jarosinski, and K. A. Schat Positive and Negative Regulation of Chicken Anemia Virus Transcription J. Virol., March 1, 2005; 79(5): 2859 - 2868. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Cheung, S. Yu, K. B. Wong, L. W. Chan, F. M. M. Lai, X. Wang, M. Suetsugi, S. Chen, and F. L. Chan Expression and Functional Study of Estrogen Receptor-Related Receptors in Human Prostatic Cells and Tissues J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1830 - 1844. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Stokes, B. Alston-Mills, and C. Teng Estrogen response element and the promoter context of the human and mouse lactoferrin genes influence estrogen receptor {alpha}-mediated transactivation activity in mammary gland cells J. Mol. Endocrinol., October 1, 2004; 33(2): 315 - 334. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Horard, A Castet, P-L Bardet, V Laudet, V Cavailles, and J-M Vanacker Dimerization is required for transactivation by estrogen-receptor-related (ERR) orphan receptors: evidence from amphioxus ERR J. Mol. Endocrinol., October 1, 2004; 33(2): 493 - 509. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Greschik, R. Flaig, J.-P. Renaud, and D. Moras Structural Basis for the Deactivation of the Estrogen-related Receptor {gamma} by Diethylstilbestrol or 4-Hydroxytamoxifen and Determinants of Selectivity J. Biol. Chem., August 6, 2004; 279(32): 33639 - 33646. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Willy, I. R. Murray, J. Qian, B. B. Busch, W. C. Stevens Jr., R. Martin, R. Mohan, S. Zhou, P. Ordentlich, P. Wei, et al. Regulation of PPAR{gamma} coactivator 1{alpha} (PGC-1{alpha}) signaling by an estrogen-related receptor {alpha} (ERR{alpha}) ligand PNAS, June 15, 2004; 101(24): 8912 - 8917. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Laganiere, G. B. Tremblay, C. R. Dufour, S. Giroux, F. Rousseau, and V. Giguere A Polymorphic Autoregulatory Hormone Response Element in the Human Estrogen-related Receptor {alpha} (ERR{alpha}) Promoter Dictates Peroxisome Proliferator-activated Receptor {gamma} Coactivator-1{alpha} Control of ERR{alpha} Expression J. Biol. Chem., April 30, 2004; 279(18): 18504 - 18510. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Schreiber, R. Emter, M. B. Hock, D. Knutti, J. Cardenas, M. Podvinec, E. J. Oakeley, and A. Kralli The estrogen-related receptor {alpha} (ERR{alpha}) functions in PPAR{gamma} coactivator 1{alpha} (PGC-1{alpha})-induced mitochondrial biogenesis PNAS, April 27, 2004; 101(17): 6472 - 6477. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. K. Mootha, C. Handschin, D. Arlow, X. Xie, J. St. Pierre, S. Sihag, W. Yang, D. Altshuler, P. Puigserver, N. Patterson, et al. Err{alpha} and Gabpa/b specify PGC-1{alpha}-dependent oxidative phosphorylation gene expression that is altered in diabetic muscle PNAS, April 27, 2004; 101(17): 6570 - 6575. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Melvin, C. Harrell, J. S. Adelman, W. L. Kraus, M. Churchill, and D. P. Edwards The Role of the C-terminal Extension (CTE) of the Estrogen Receptor {alpha} and {beta} DNA Binding Domain in DNA Binding and Interaction with HMGB J. Biol. Chem., April 9, 2004; 279(15): 14763 - 14771. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sumi and L. J. Ignarro Estrogen-related receptor {alpha}1 up-regulates endothelial nitric oxide synthase expression PNAS, November 25, 2003; 100(24): 14451 - 14456. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Luo, R. Sladek, J. Carrier, J.-A. Bader, D. Richard, and V. Giguere Reduced Fat Mass in Mice Lacking Orphan Nuclear Receptor Estrogen-Related Receptor {alpha} Mol. Cell. Biol., November 15, 2003; 23(22): 7947 - 7956. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Liu, Z. Zhang, W. Gladwell, and C. T. Teng Estrogen Stimulates Estrogen-Related Receptor {alpha} Gene Expression through Conserved Hormone Response Elements Endocrinology, November 1, 2003; 144(11): 4894 - 4904. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Schreiber, D. Knutti, K. Brogli, T. Uhlmann, and A. Kralli The Transcriptional Coactivator PGC-1 Regulates the Expression and Activity of the Orphan Nuclear Receptor Estrogen-Related Receptor alpha (ERRalpha ) J. Biol. Chem., March 7, 2003; 278(11): 9013 - 9018. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Ariazi, G. M. Clark, and J. E. Mertz Estrogen-related Receptor {alpha} and Estrogen-related Receptor {gamma} Associate with Unfavorable and Favorable Biomarkers, Respectively, in Human Breast Cancer Cancer Res., November 15, 2002; 62(22): 6510 - 6518. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Kraus, E. A. Ariazi, M. L. Farrell, and J. E. Mertz Estrogen-related Receptor alpha 1 Actively Antagonizes Estrogen Receptor-regulated Transcription in MCF-7 Mammary Cells J. Biol. Chem., June 28, 2002; 277(27): 24826 - 24834. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Farrell and J. E. Mertz Cell Type-Specific Replication of Simian Virus 40 Conferred by Hormone Response Elements in the Late Promoter J. Virol., June 5, 2002; 76(13): 6762 - 6770. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Klinge, S. C. Jernigan, and K. E. Risinger The Agonist Activity of Tamoxifen Is Inhibited by the Short Heterodimer Partner Orphan Nuclear Receptor in Human Endometrial Cancer Cells Endocrinology, March 1, 2002; 143(3): 853 - 867. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lu, Y. Kiriyama, K. Y. Lee, and V. Giguere Transcriptional Regulation of the Estrogen-inducible pS2 Breast Cancer Marker Gene by the ERR Family of Orphan Nuclear Receptors Cancer Res., September 1, 2001; 61(18): 6755 - 6761. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bonnelye, L. Merdad, V. Kung, and J.E. Aubin The Orphan Nuclear Estrogen Receptor-related Receptor {alpha} (ERR{alpha}) Is Expressed throughout Osteoblast Differentiation and Regulates Bone Formation In Vitro J. Cell Biol., May 21, 2001; 153(5): 971 - 984. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Falkenstein, H.-C. Tillmann, M. Christ, M. Feuring, and M. Wehling Multiple Actions of Steroid Hormones---A Focus on Rapid, Nongenomic Effects Pharmacol. Rev., December 1, 2000; 52(4): 513 - 556. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Heard, P. L. Norby, J. Holloway, and H. Vissing Human ERR{gamma}, a Third Member of the Estrogen Receptor-Related Receptor (ERR) Subfamily of Orphan Nuclear Receptors: Tissue-Specific Isoforms Are Expressed during Development and in the Adult Mol. Endocrinol., March 1, 2000; 14(3): 382 - 392. [Abstract] [Full Text] |
||||
![]() |
W. Xie, H. Hong, N. N. Yang, R. J. Lin, C. M. Simon, M. R. Stallcup, and R. M. Evans Constitutive Activation of Transcription and Binding of Coactivator by Estrogen-Related Receptors 1 and 2 Mol. Endocrinol., December 1, 1999; 13(12): 2151 - 2162. [Abstract] [Full Text] |
||||
![]() |
V. Giguère Orphan Nuclear Receptors: From Gene to Function Endocr. Rev., October 1, 1999; 20(5): 689 - 725. [Abstract] [Full Text] |
||||
![]() |
C. Yang and S. Chen Two Organochlorine Pesticides, Toxaphene and Chlordane, Are Antagonists for Estrogen-related Receptor {{alpha}}-1 Orphan Receptor Cancer Res., September 1, 1999; 59(18): 4519 - 4524. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Vanacker, E. Bonnelye, S. Chopin-Delannoy, C. Delmarre, V. Cavaillès, and V. Laudet Transcriptional Activities of the Orphan Nuclear Receptor ERR{alpha} (Estrogen Receptor-Related Receptor-{alpha}) Mol. Endocrinol., May 1, 1999; 13(5): 764 - 773. [Abstract] [Full Text] |
||||
![]() |
S.-K. Lee, H.-S. Choi, M.-R. Song, M.-O. Lee, and J. W. Lee Estrogen Receptor, a Common Interaction Partner for a Subset of Nuclear Receptors Mol. Endocrinol., August 1, 1998; 12(8): 1184 - 1192. [Abstract] [Full Text] |
||||
![]() |
C. M. Klinge, B. F. Silver, M. D. Driscoll, G. Sathya, R. A. Bambara, and R. Hilf Chicken Ovalbumin Upstream Promoter-Transcription Factor Interacts with Estrogen Receptor, Binds to Estrogen Response Elements and Half-Sites, and Inhibits Estrogen-induced Gene Expression J. Biol. Chem., December 12, 1997; 272(50): 31465 - 31474. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Vega and D. P. Kelly A Role for Estrogen-related Receptor alpha in the Control of Mitochondrial Fatty Acid beta -Oxidation during Brown Adipocyte Differentiation J. Biol. Chem., December 12, 1997; 272(50): 31693 - 31699. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang and C. T. Teng Estrogen Receptor-related Receptor alpha 1 Interacts with Coactivator and Constitutively Activates the Estrogen Response Elements of the Human Lactoferrin Gene J. Biol. Chem., June 30, 2000; 275(27): 20837 - 20846. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sanyal, J.-Y. Kim, H.-J. Kim, J. Takeda, Y.-K. Lee, D. D. Moore, and H.-S. Choi Differential Regulation of the Orphan Nuclear Receptor Small Heterodimer Partner (SHP) Gene Promoter by Orphan Nuclear Receptor ERR Isoforms J. Biol. Chem., January 11, 2002; 277(3): 1739 - 1748. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |