help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johnston, S. D.
Right arrow Articles by Mertz, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnston, S. D.
Right arrow Articles by Mertz, J. E.
Molecular Endocrinology 11 (3): 342-352
Copyright © 1997 by The Endocrine Society

Estrogen-Related Receptor {alpha}1 Functionally Binds as a Monomer to Extended Half-Site Sequences Including Ones Contained within Estrogen-Response Elements

Stephen D. Johnston1, Xuedong Liu2, Fengrong Zuo3, Theresa L. Eisenbraun, Steven R. Wiley4, Richard J. Kraus and Janet E. Mertz

McArdle Laboratory for Cancer Research University of Wisconsin Medical School Madison, Wisconsin 53706-1599


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The human estrogen-related receptor {alpha}1 (hERR{alpha}1) is an orphan member of the steroid/thyroid hormone receptor superfamily. A cDNA encoding this protein was originally isolated on the basis of sequence similarity in its DNA-binding domain with estrogen receptor {alpha} (ER{alpha}). Previously, we reported the purification of hERR{alpha}1 from HeLa cell nuclear extracts on the basis of its ability to bind two sites in the late promoter of simian virus 40 (SV40). We have now determined the primary structure and the DNA and protein binding specificities of hERR{alpha}1 and developed in vivo and in vitro assays for its functional activities. hERR{alpha}1 was found to bind as a monomer, with a high-affinity binding site containing the extended half-site sequence 5'-TCAAGGTCA-3'. Binding sites for hERR{alpha}1 were identified in many cellular promoters, including some that were previously shown to function as estrogen-response elements (EREs). hERR{alpha}1 was shown to function as a sequence-specific repressor of the SV40 late promoter in both cell culture and cell-free transcription sytems. It was also shown to interact with both ER{alpha} and the transcription factor TFIIB by direct protein-protein contacts. Thus, hERR{alpha}1 may play a role in the response of some genes to estrogen via heterodimerization with ERs or competition with ERs for binding to EREs.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The steroid/thyroid hormone receptor superfamily consists of a large number of transcription factors that regulate a wide variety of cellular processes (reviewed in Ref.1). The most highly conserved region of these proteins is their DNA-binding domain (DBD), which contains two zinc finger modules. Each DBD interacts with a six-nucleotide (nt) core recognition motif, or half-site, resembling the sequence 5'-AGGTCA-3'. Most members of the superfamily homo- and/or heterodimerize with other members of this superfamily, thus binding to two half-sites. The orientation and spacing between the half-sites provide the primary basis for specific DNA binding (reviewed in Ref.2). However, some members of this superfamily can bind as monomers to an extended version of this sequence (3, 4, 5, 6). For example, an optimal binding site for steroidogenic factor 1 (SF-1) contains the sequence 5'-TCAAGGTCA-3' (4).

Ligands for many members of the superfamily have been well studied; they include the steroid hormones, thyroid hormones, retinoids, and vitamin D3. Other members of the superfamily have no known ligand; they are referred to as "orphan" receptors. Orphan receptors can bind DNA as heterodimers, homodimers, or monomers (reviewed in Ref.7). The human estrogen-related receptor 1 (hERR1; renamed hERR{alpha}) is an orphan member of this superfamily. Complementary DNAs encoding portions of this protein and hERR2 (renamed hERRß) were initially isolated by a reduced-stringency screening of cDNA libraries with probes corresponding to the DBD of the human estrogen receptor {alpha} (ER{alpha}; formerly ER) (8). Using chimeric receptors in transfected cells, Lydon et al. (9) demonstrated that hERR{alpha} contains a transcriptional activation domain. On the basis of amino acid sequence similarity with the receptor SF-1 in part of the DBD, Wilson et al. (4) predicted that hERR{alpha} might bind as a monomer to the extended half-site sequence 5'-TCAAGGTCA-3' recognized by SF-1. Recently, Yang et al. (10) isolated new cDNA clones encoding most of hERR{alpha} by screening a cDNA expression library for proteins capable of binding to sequences present in the promoter region of the human lactoferrin gene.

Previously, we reported the purification of proteins from a HeLa cell nuclear extract that bind the transcriptional initiation site of the major late promoter (MLP) of simian virus 40 (SV40) (11). These proteins, collectively referred to as IBP-s (initiator binding proteins of SV40) were shown to consist of multiple members of the steroid/thyroid hormone receptor superfamily (11, 12). Partial peptide sequence analysis indicated that a major component of IBP-s was hERR{alpha} (11). Thus, we had identified at least one binding site for hERR{alpha} in the SV40 late promoter. To identify functional activities of IBP-s, we performed a variety of genetic and biochemical experiments (11–12a). The data from these experiments indicated the following: 1) The SV40-MLP contains at least two high-affinity binding sites for IBP-s situated immediately surrounding (+1 site) and approximately 55 bp downstream (+55 site) of the transcriptional start site. 2) These high-affinity binding sites include the consensus half-site sequence 5'-AGGTCA-3'. 3) The binding of IBP-s to these sites results in repression of transcription from the SV40 late promoter both in transfected CV-1 cells (derived from SV40’s natural host) and in a cell-free transcription system. 4) Transfection of CV-1 cells with a plasmid encoding an ER{alpha}-hERR{alpha} chimeric protein containing all but the first 38 amino acid residues of hERR{alpha} results in sequence-specific superrepression of the SV40 late promoter. Thus, hERR{alpha} likely possesses the functional activities of IBP-s.

We (Ref. 13; see below) and others (C. T. Teng, personal communication) have recently found that a 53-kDa protein, called hERR{alpha}1, is a major isoform expressed in vivo from the hERR{alpha} gene. Using this biologically relevant, nonchimeric, recombinant hERR{alpha}1 protein, we demonstrate here that hERR{alpha}1 protein can, indeed, bind DNA as a monomer, with a high-affinity binding site containing 5'-TCAAGGTCA-3'. We also report the development of in vitro and in vivo functional assays for hERR{alpha}1 activity. Lastly, binding sites for hERR{alpha}1 are identified in cellular promoters, some of which contain functional EREs, and hERR{alpha}1 is shown to bind directly ER{alpha}. We speculate that hERR{alpha}1 can play a role in the response of some genes to estrogen via heterodimerization with ER or competition with ER for binding to EREs.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
hERR{alpha}1
The original sequence of hERR{alpha} cDNA was deduced from putatively overlapping cDNA clones (8). It encodes a 521-amino acid protein with an apparent molecular mass of 63 kDa by SDS-PAGE (13). We failed by pulse-labeling/immunoprecipitation and immunoblotting techniques to find a protein of this size in any of numerous natural sources that cross-reacted with our hERR{alpha}-specific antiserum; instead, we identified a faster-migrating protein (Ref. 13; see below). We hypothesized that this naturally existing protein is an isoform encoded by the hERR{alpha} gene in which translation initiates at the second methionine codon, corresponding to amino acid residue 98 in the published sequence (see Fig. 1Go). This product of the hERR{alpha} gene is named hERR{alpha}1.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Schematic Diagram of hERR{alpha}1

hERR{alpha}1, except for lacking the first 97 amino acids, is the same as hERR1 described by Giguère et al. (8). The positions of the DBD and ligand binding domain (LBD) are indicated, as are the percentages of amino acid identity between hERR{alpha}1 and ER{alpha} for each of these domains. Structures of the probes used in the experiments presented in Fig. 3Go are shown at the bottom; the 5'-ends correspond to the regions encoding the amino acid residues of hERR{alpha}1, and the wavy line indicates sequences discontinuous with the hERR{alpha} cDNA.

 
To test this hypothesis, a polyclonal antiserum against amino acid residues 17–329 of hERR{alpha}1 was used in immunoblotting experiments to compare the hERR{alpha} proteins present in a HeLa cell nuclear extract with hERR{alpha}1 produced by in vitro transcription and translation in a rabbit reticulocyte lysate (TNT). The predominant protein found in each sample comigrated (Fig. 2AGo). Careful measurements of its mobility indicated that its apparent molecular mass is 53 kDa (data not shown). A second, less abundant, 58-kDa protein that reacted with our antiserum was also observed in variable quantities in some preparations of HeLa cell nuclear extract (data not shown).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 2. Size of hERR{alpha}1 in Human Cells

A, Proteins present in a HeLa cell nuclear extract (lane 3) and synthesized from a hERR{alpha}1 cDNA clone by in vitro transcription and translation (TNT) (lane 2) were detected by immunoblotting with an antiserum directed against GST-hERR{alpha}117-329. The TNT control (lane 1) was unprogrammed reticulocyte lysate. B, HeLa cells were metabolically labeled with [35S]methionine and [35S]cysteine for 4 h before being washed and lyzed. Radiolabeled proteins were immunoprecipitated with a preimmune serum (lane 1) or a GST-hERR{alpha}117-329 antiserum (lane 2) and detected by fluorography. The molecular mass markers used here had been conjugated to a colored moiety and, thus, were not precise determinants of molecular mass.

 
The sizes of the in vivo-synthesized hERR{alpha} proteins were also determined by metabolic labeling of HeLa cells with [35S] methionine and cysteine, followed by immunoprecipitation. Again, a 53-kDa protein was identified (Fig. 2BGo); no larger protein was ever observed. This 53-kDa protein was also observed in eight other mammalian cell lines derived from a variety of tissues (CV-1, MCF7, T47D, Hs1, Hs181, RL95–2, HepG2, and {alpha}E6/E7–2) (13) and was found to have a half-life of 10–12 h (13). Thus, we conclude that hERR{alpha}1 probably corresponds to the authentic, major isoform synthesized from the hERR{alpha} gene in vivo.

To confirm this hypothesis, we also analyzed the location of the 5'-end of the hERR{alpha} mRNA present in HeLa cells by S1 nuclease mapping with the probe shown in Fig. 1Go. Whereas RNA that could encode full-length hERR{alpha} would be expected to protect 634 nt of this probe, we observed a protected fragment only 510 nt in length (Fig. 3AGo). Thus, most of the hERR{alpha} mRNA accumulated in HeLa cells was discontinuous with the deduced hERR{alpha} sequence described by Giguère et al. (8) at approximately nt +180 relative to the AUG codon presumed to be used for the synthesis of full-length hERR{alpha}.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 3. The Major Species of hERR{alpha} mRNA Present in HeLa Cells Encodes hERR{alpha}1, not hERR{alpha}

A, S1 nuclease mapping analysis of hERR{alpha} mRNA. The structures of the 5'-ends of the hERR{alpha} mRNAs accumulated in HeLa cells were analyzed by S1 nuclease mapping with the probe shown in Fig. 1Go. The reaction mixtures contained no RNA (lane 1), 9 mg whole cell RNA (lane 2), 54 mg whole cell RNA (lane 3), 0.6 mg poly (A)+ RNA (lane 4), or 5.8 mg poly (A)+ RNA (lane 5). M, MspI-cut pBR322 DNA. B, Primer extension analysis of hERR{alpha} mRNA. A synthetic oligonucleotide, 5'-end-labeled 48 nt 3' of the hERR{alpha}1 initiation codon, was hybridized with the RNA and extended with avian myeloblastosis virus reverse transcriptase. The products were resolved by denaturing polyacrylamide gel electrophoresis and visualized by autoradiography. Samples contained either 12 mg whole-cell RNA (lane 1), 60 mg whole-cell RNA (lane 2), 3.6 mg poly(A)+ RNA (lane 3), 18 mg poly(A)+ RNA (lane 4), or no RNA (lane 5). M, MspI-cut pBR322 DNA.

 
To determine whether this discontinuity corresponded to the true 5'-end of the mRNA or a splice site, we also examined the structure of the 5'-end of the RNA by primer extension analysis using a primer that could hybridize to the RNA just 3' of the AUG codon presumed to be used for the synthesis of hERR{alpha}1 (Fig. 1Go): two major bands, 223 and 266 nt in length, were observed (Fig. 3BGo). The 223-nt band corresponded well with the major 5'-end identified by S1 nuclease mapping. It also corresponded to the 5'-end of a hERR{alpha}1 cDNA isolated by Yang et al. (10) from a human endometrium carcinoma cell line. Thus, it is highly likely that this is the location of the 5'-end of the major species of hERR{alpha} mRNA that accumulates in at least some human cell lines. Because the first AUG codon in this mRNA is the codon present at the amino terminus of hERR{alpha}1, this mRNA likely encodes hERR{alpha}1, but cannot encode full-length hERR{alpha}. The minor, 266-nt band observed by primer extension analysis also cannot correspond to an mRNA encoding full-length hERR{alpha}. Thus, we conclude that the major, hERR{alpha}-encoded protein that accumulates in HeLa cells is probably identical in primary structure to the hERR{alpha}1 protein depicted in Fig. 1Go. However, other isoforms synthesized from the hERR{alpha} gene may also exist in minor quantities or in different tissues or times during development.

DNA Binding by hERR{alpha}1
Because hERR{alpha}1 was initially cloned on the basis of amino acid similarity with ER{alpha}, the DNA sequence(s) it binds was unknown. We, therefore, investigated the DNA-binding properties of hERR{alpha}1. Since Wilson et al. (4) hypothesized that hERR{alpha}1 might bind a DNA sequence similar to the one bound by SF-1, we first looked for binding by a gel mobility shift assay with a probe consisting of a double-stranded synthetic oligonucleotide containing the high-affinity SF-1-binding site sequence, 5'-TCAAGGTCA-3'. Glutathione S-transferase (GST)-hERR{alpha}1 was, indeed, found to bind this SF-1 probe (Fig. 4Go, lane 2). Incubation with our polyclonal anti-hERR{alpha}1 serum resulted in both the supershifting of a portion of this hERR{alpha}1-DNA complex and the prevention of the formation of another portion of it (Fig. 4Go, lane 4 vs. 3). Thus, we conclude that hERR{alpha}1 binds specifically to the high-affinity binding site of SF-1.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 4. Gel-Mobility-Shift Assays Showing Sequence-Specific Binding of Recombinant hERR{alpha}1 Protein

Bacterially expressed GST-ßglobin1-123 (lane 1) and GST-hERR{alpha}1 (lanes 2–13) were incubated with radioactive, double-stranded SF-1 oligonucleotide as a probe. A preimmune (lane 3) or polyclonal anti-GST-hERR{alpha}117-329 (lane 4) serum was added to some of the binding reactions before the addition of recombinant protein. Lanes 5–13 show quantitative, competition gel-mobility-shift assays in which the indicated unlabeled, double-stranded oligonucleotides were included in the reactions as competitors at the indicated molar fold excesses. The sequences of one strand of each of these oligonucleotides are shown in Fig. 5Go. The samples in lanes 11–13 were run in a separate gel from those in lanes 5–10. Note that the range of competitor oligonucleotide included in the reactions shown here was varied with ability to compete.

 
To better understand the range of DNA sequences recognized by hERR{alpha}1, we tested the ability of hERR{alpha}1 to bind to sequences from a variety of promoters, including many hormone-response elements. Because prior work from our laboratory indicated that hERR{alpha}1 probably binds to two sites in the SV40-MLP, the +1 and +55 sites (11, 12), we tested the affinity of hERR{alpha}1 for these sites relative to the SF-1 site using a quantitative, competition gel mobility shift assay (Fig. 4Go, lanes 5–13): an oligonucleotide corresponding to the +55 site of the wild-type (WT) SV40-MLP competed moderately well (lanes 5–7); one corresponding to a mutant that binds IBP-s better that WT competed very well (lanes 11–13); and one corresponding to a mutant that fails to bind IBP-s did not compete (lanes 8–10) (summarized in Fig. 5Go).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 5. Relative Affinities of hERR{alpha}1 for DNA Sequences from a Variety of Cellular and Viral Promoters

Quantitative, competition gel-mobility-shift assays were performed as described in the legend to Fig. 4Go with double-stranded oligonucleotides corresponding to the sequences shown in the third column of the table serving as the unlabeled competitors. The fourth column indicates the affinities of hERR{alpha}1 for the competitor sequences relative to the SF-1 probe; these values were determined experimentally from the fold molar excess of competitor oligonucleotide needed to reduce by 50% the fraction of probe shifted. The second column indicates the cases in which these sequences are known from the scientific literature to contain functional EREs. n.d., Not determined. Superscript 1 (third line of table) indicates an oligonucleotide whose complete sequence is reported as the FP1 sequence in Yang et al. (10).

 
Multiple sequences from a variety of cellular promoters were tested likewise (Ref. 13; data not shown), including ones known to function as EREs since the DBDs of hERR{alpha}1 and ER{alpha} have 68% amino acid identity (8, 10). These data are summarized in Fig. 5Go. Some of the EREs tested (e.g., PRL D, vitellogenin) did, indeed, bind hERR{alpha}1 with one-tenth to one-fifth the affinity observed with the highest affinity binding site. Thus, some EREs contain binding sites for hERR{alpha}1.

By comparing the sequences that bound hERR{alpha}1 well with those that bound it poorly or not at all, we deduced that a high-affinity, consensus DNA-binding site for hERR{alpha}1 is 5'-TCAAGGTCA-3'. However, some of the oligonucleotides containing this consensus sequence (e.g. P450scc) did not bind hERR{alpha}1 well; thus, bases beyond the 9-bp consensus sequence also affect the binding affinity. We also deduced that hERR{alpha}1 likely binds to DNA as a monomer because several of the high-affinity binding sites (e.g. SF-1, CYP1A2–2, PRL D) contain only a single extended half-site in isolation.

hERR{alpha}1 Binds DNA as a Monomer
To confirm that hERR{alpha}1 can truly bind to extended half-sites as a monomer, footprinting assays were performed of GST-hERR{alpha}1 bound to the MLP region of wild-type SV40 DNA. Consistent with the data summarized in Fig. 5Go, GST-hERR{alpha}1 was found to strongly protect the +1 and +55 sites present in the SV40-MLP from digestion by DNase I (Fig. 6AGo). Within each of these protected regions are two half-site sequences, either or both of which could potentially be recognized by hERR{alpha}1. The exact bases protected were determined by comparison with dideoxy-sequencing reactions of the probe DNA that were co-electrophoresed next to the footprinting reactions (data not shown) (summarized in Fig. 6CGo, solid bars). At each site, only one of the two half-sites was covered by hERR{alpha}1. Therefore, hERR{alpha}1 can bind to a single half-site sequence as a monomer.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 6. hERR{alpha}1 Binds as a Monomer to Extended Half-Site Sequences Present in the SV40-MLP

A, Autoradiograms of DNase I footprints of GST-hERR{alpha}1 bound to the +1 and +55 sites of the SV40-MLP. Outermost lanes, No protein; interior lanes, GST-hERR{alpha}1. B, Autoradiograms of hydroxyl radical footprints of GST-hERR{alpha}1 bound to the +55 site of the SV40-MLP in isolation from other hERR{alpha}1-binding sites. C, Summary of the nucleotides of the SV40-MLP protected by hERR{alpha}1 as determined from the data in panels A and B. The thick andthin solid bars indicate complete and partial protection, respectively, from digestion with DNase I. The stippled bars indicate nucleotides in the +55 site necessary for binding by hERR{alpha}1 as determined by the hydroxyl radical footprint analysis. The boxed bases are the core half-site sequences present in the +1 and +55 sites (11).

 
Higher resolution mapping of the hERR{alpha}1-binding site was done using a hydroxyl radical footprinting technique with a probe made from an SV40 mutant, pm322C, which is defective in the +1 site (11) and, thus, contains only the +55 site. As is shown in Fig. 6BGo (summarized in Fig. 6CGo, stippled bars), the nucleotides within and directly adjacent to only one of the two +55 site half-site sequences present in the probe DNA were necessary for the binding of GST-hERR{alpha}1. Footprint analyses with probe DNAs containing mutations in the unprotected half-site sequences present in the +1 and +55 regions of the SV40-MLP (Refs. 11 and 14 and data not shown) confirmed that these unprotected half-site sequences do not contribute to the binding of hERR{alpha}1. This finding is also consistent with glycerol gradient sedimentation analysis of purified IBP-s that indicated that at least some of hERR{alpha}1 as purified from mammalian cells exists in solution as a monomer (14). Thus, we conclude that hERR{alpha}1 can bind to extended half-site sequences as a monomer.

hERR{alpha}1 Sequence Specifically Inhibits Transcription from the SV40 Late Promoter
Previous data indicated that a component(s) of IBP-s sequence specifically repressed transcription from the SV40-MLP in a cell-free system made from HeLa cell nuclear extract (11). To confirm that hERR{alpha}1 has this biochemical activity, this assay was repeated with recombinant hERR{alpha}1 protein (Fig. 7Go). Addition of GST-hERR{alpha}1 reproducibly decreased transcription approximately 3-fold from the wild type SV40-MLP, but had no effect on transcription from the SV40 early promoter present on the same template DNA (Fig. 7Go, lane 3 vs. 1 and 2). Transcription from the minor late promoters was also inhibited. When the template contained point mutations in the +1 and +55 hERR{alpha}1-binding sites of SV40, the basal level of transcription from the SV40-MLP and minor late promoters increased as a result of the relief from repression by members of the superfamily present in the HeLa cell nuclear extract. Transcription of the mutant template was also not significantly affected by the addition of GST-hERR{alpha}1 (Fig. 7Go, lanes 4 and 5). These data indicate clearly and definitively that hERR{alpha}1 can, indeed, repress transcription from the SV40-MLP in vitro in a site- and sequence-specific manner. Furthermore, the fact that the SV40 early promoter present in the same reactions was unaffected by hERR{alpha}1 indicates that the repression was not a trivial consequence of squelching, e.g. the binding of a limiting amount of the transcription factor TFIIB.



View larger version (68K):
[in this window]
[in a new window]
 
Figure 7. GST-hERR{alpha}1 Represses Transcription from the SV40-MLP and Minor Late Promoters in a Cell-Free System in a Sequence-Specific Manner

Approximately 37 ng purified GST-ßglobin (lanes 2 and 4) or GST-hERR{alpha}1 (lanes 3 and 5) were incubated with wild type SV40 DNA or a double mutant defective in binding of hERR{alpha}1 to both the +1 and +55 sites of the SV40 genome (see Fig. 5Go for wild type and mutant sequences and relative binding affinities). A HeLa cell nuclear extract was used to transcribe both the early and late promoters of SV40 present on the same template DNA. Transcripts were detected by primer extension and quantified with a PhosphorImager (Molecular Dynamics).

 
Zuo and Mertz (12) previously reported that an ER{alpha}-hERR{alpha} chimeric protein can repress transcription from the SV40-MLP in vivo. They also showed that either chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) (12) or thyroid hormone receptor-{alpha}1 /retinoid X receptor-{alpha} (12a) can repress transcription from the SV40 late promoter at early times during the lytic cycle of infection of CV-1 cells when viral DNA template copy number is low, but not at late times when viral DNA template copy number is high. To show definitively that this repression activity can also be encoded by hERR{alpha}1, CV-1 cells were cotransfected with wild type SV40 and pRSV-hERR{alpha}1, a plasmid encoding wild type hERR{alpha}1 and containing an SV40 origin of replication (Fig. 8Go, lanes 2, 4 and 6). As a control, cells were transfected in parallel with wild type SV40 and pRSV-0+, the empty vector of pRSV-hERR{alpha}1 (Fig. 8Go, lanes 1, 3, and 5). As expected, overexpression of hERR{alpha}1 resulted in a decreased rate of accumulation of the SV40 late, but not early, mRNAs until late times after transfection (e.g. 48 h), a time at which the exogenous as well as endogenous hERR{alpha}1 and other IBP-s have been titrated out as a consequence of viral DNA replication to high template copy number (11–12a). Therefore, we conclude that hERR{alpha}1 can, indeed, repress transcription from the SV40-MLP both in vitro and in vivo in a sequence-specific manner by binding as a monomer to extended half-site sequences present in the DNA.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 8. hERR{alpha}1 Represses Transcription from the SV40 Late Promoter in Vivo

CV-1 cells were cotransfected with wild type SV40 DNA (1.2 µg per 10-cm dish) and 0.5 µg pRSV-hERR{alpha}1, an expression plasmid encoding hERR{alpha}1 (lanes 2, 4, and 6), or pRSV-0+, its empty parental plasmid (lanes 1, 3, and 5). The cells were incubated at 37 C for the indicated times after transfection. Afterward, whole-cell RNA was purified and analyzed by quantitative S1 nuclease mapping with the SV40-specific probe described previously (12, 12a). The relative amounts of SV40 major late (ML) RNA accumulated in the cells were quantified with a PhosphorImager and internally normalized to the amounts of SV40 early (E-E) RNA present in the same samples. The numbers at the bottom indicate the ratios of SV40 major late-to-early RNA accumulated by the indicated times post transfection in the presence vs. absence of the hERR{alpha}1-expressing plasmid; these data are means from two experiments similar to the one shown here and varied by at most 20%. Lanes 1 and 2, 3 and 4, and 5–7 contained RNA from one-fifth, one-tenth, and one-twentieth of a 10-cm dish of cells, respectively. The arrows indicate the DNAs protected by each of the indicated viral RNA species, with L-E RNAs being SV40-specific RNAs synthesized from the early promoter only at late times after transfection. The exposure time for lanes 1 and 2 was 3-fold longer than for lanes 3–7.

 
hERR{alpha}1 Interactions
Many members of the steroid/thyroid hormone receptor superfamily are known to associate functionally with TFIIB (reviewed in Ref.15). Therefore, we sought evidence for a similar protein-protein interaction of hERR{alpha}1 with TFIIB. Fusion proteins bound to glutathione-Sepharose were incubated with 35S-labeled proteins synthesized in a rabbit reticulocyte lysate. The affinity resin was washed, and specifically retained proteins were eluted by denaturation, resolved by SDS-PAGE, and detected by fluorography. In this in vitro system, TFIIB was retained by GST-hERR{alpha}1 as well as it was retained by GST-COUP-TF1 or GST-ER{alpha} (Fig. 9AGo, lanes 1–4). In a reciprocal experiment, labeled hERR{alpha}1 was specifically retained by GST-TFIIB (Fig. 9AGo, lanes 6 vs. 8). To eliminate the possibility that these interactions were mediated by a third protein present in the reticulocyte lysate, this experiment was also performed with proteins synthesized solely in Escherichia coli and assayed by immunoblotting: once again, recombinant TFIIB was efficiently retained by GST-hERR{alpha}1 (13). Thus, we conclude that TFIIB directly associates with hERR{alpha}1 in vitro even in the absence of eukaryotic-specific post-translational modifications.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 9. hERR{alpha}1 Associates in Vitro with TFIIB and ER{alpha}

The indicated GST-fusion protein was bound to glutathione-Sepharose and incubated with 35S-labeled protein produced by in vitro transcription and translation in a rabbit reticulocyte lysate. After washing, retained proteins were eluted by denaturation and separated by SDS-PAGE. The resulting fluorograms are shown here. In lanes 6–9 of panel B, the crude bacterial lysates and the in vitro translation mixtures were preincubated with ethidium bromide (50 µg/ml) to disrupt protein-DNA associations and cleared by centrifugation before being used in the binding assays. Lanes 5 and 9 of panels A and B were loaded with 10% of the indicated proteins added to the binding reactions.

 
hERR{alpha}1 shares considerable sequence similarity with ER{alpha} in its ligand- binding domain (LBD) as well as its DBD (8, 10). Therefore, hERR{alpha}1 might also exist under certain circumstances as a heterodimer with ER{alpha}. Yang et al. (10) recently showed that GST-hERR{alpha}1 interacts with a fragment of ER{alpha} fused to GST in a far Western assay. Furthermore, some of the sequences to which hERR{alpha}1 binds (Fig. 5Go) are known to contain functional EREs. Although some of these EREs bind ER{alpha} well (e.g. vitellogenin ERE) (16), others bind ER{alpha} poorly or not at all (e.g. PRL D, creatine kinase B) (17, 18). Thus, binding to these latter EREs might be accomplished by an ER/ERR{alpha}1 heterodimer.

To provide additional evidence in support of this hypothesis, we performed a series of in vitro protein-protein binding assays as described above. hERR{alpha}1 was retained by GST-ER{alpha} as well as it was retained by GST-TFIIB (Fig. 9AGo, lanes 6–8). In a reciprocal experiment, labeled ER{alpha} was efficiently retained by GST-hERR{alpha}1 (Fig. 9BGo, lanes 1–4). To ensure that these findings were truly a result of protein-protein interactions rather than concurrent binding to DNA fragments present in the protein preparations, this experiment was repeated in the presence of ethidium bromide, a chemical that disrupts protein-DNA interactions because it distorts the structure of the DNA (19): the presence of ethidium bromide did not significantly affect the retention of ER{alpha} by GST-hERR{alpha}1 (Fig. 9BGo, lanes 6–8 vs. 1–4). To confirm that the hERR{alpha}1/ER{alpha} protein-protein interaction was direct rather than via a third protein present in the lysates, the GST-fusion protein-binding experiment was also performed with purified, recombinant ER{alpha}: ER{alpha} still bound to hERR{alpha}1 as efficiently as it did to TFIIB (13). Therefore, we conclude that hERR{alpha}1 and ER{alpha} can directly heterodimerize in vitro.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this report, we identified the protein, hERR{alpha}1, which corresponds to the major mRNA (Fig. 3Go) and protein (Fig. 2Go) products synthesized in vivo from the hERR{alpha} gene. Using recombinant protein, we identified DNA-binding sites in a variety of promoters (Fig. 5Go) and found that the highest affinity sites contain the extended half-site sequence 5'-TCAAGGTCA-3'. Furthermore, footprinting analysis indicated that hERR{alpha}1 can bind DNA as a monomer (Fig. 6Go). Thus, hERR{alpha}1 belongs in the subfamily of steroid/thyroid hormone receptors that can bind DNA as monomers. In addition, we showed that hERR{alpha}1 is capable of modulating transcription through its binding sites both in vitro (Fig. 7Go) and in vivo (Fig. 8Go). These are among the first functional assays of hERR{alpha}1. They may prove useful as the basis for a screen for ligands to hERR{alpha}1. We also showed that hERR{alpha}1 interacts in vitro with ER{alpha} and TFIIB (Fig. 9Go) and speculated that hERR{alpha}1 may modify the estrogen-responsiveness of some genes.

The hERR{alpha}1 Protein
We and others (10) have failed to find evidence for a protein encoded by the hERR{alpha} cDNA described by Giguère et al. (8). We detected, instead, an mRNA (Fig. 3Go) with a 5'-end located 3' of the site needed to encode hERR{alpha}. This mRNA has the potential to code for a smaller hERR{alpha} protein, which we named hERR{alpha}1. Its existence in vivo was confirmed by immunoblotting and immunoprecipitation experiments (Fig. 2Go). The structure of the mRNA identified here is in agreement with the genomic structure of the hERR{alpha} gene (C. T. Teng, personal communication). hERR{alpha}1 is a protein of approximately 53 kDa; however, other isoforms of hERR{alpha} may exist as well. hERR{alpha}1 is probably the same protein as the larger of two hERR{alpha} isoforms recently described by Yang et al. (10). We failed to detect the smaller, 42-kDa protein that Yang et al. (10) found by immunoblotting. This discrepancy is likely due to the use of different hERR{alpha}-specific antisera.

The hERR{alpha}1-Binding Site
A high-affinity hERR{alpha}1-binding site was determined to be the extended half-site sequence, 5'-TCAAGGTCA-3' (Fig. 5Go). This finding is in agreement with the prediction of Wilson et al. (4) made on the basis of the sequence similarity of the proximal A box of hERR{alpha}1 to SF-1. We also confirmed that the FP1 sequence of the human lactoferrin promoter is a strong hERR{alpha}1- binding site (Fig. 5Go and Ref.10). Significant sequence variability in the 5'-extension of the consensus half-site sequence is tolerated by hERR{alpha}1. Most notably, the SV40 +55 UP mutant and the PRL D sites each have a single base difference from the consensus 5'-extension, but were found to bind hERR{alpha}1 very well (Fig. 5Go). Indeed, many sequences that do not contain the 5'-TCA-3' extension were bound by hERR{alpha}1 at moderate levels. For example, the vitellogenin ERE, which contains two consensus half-sites (5'-AGGTCA-3') without an upstream 5'-TCA-3', was bound at reasonable levels by hERR{alpha}1 (Fig. 5Go).

Sequences outside of the 9-bp extended half-site also appear to play a role in determining a site’s strength. For example, the SF-1, CYP1A2–1, and P450scc oligonucleotides each contain a perfect consensus extended half-site, but their relative affinities varied more than 60-fold (Fig. 5Go). This finding is in agreement with the observation that hERR{alpha}1 contacts at least one base outside of the extended half-site (10). On the other hand, the integrity of the core half-site sequence is clearly necessary, as mutations in the core of the vitellogenin estrogen-response element (ERE) and SV40 +1 and +55 sites led to a complete loss of binding (Fig. 5Go).

hERR{alpha}1 was initially cloned on the basis of its sequence, rather than its function. Therefore, genes regulated by hERR{alpha}1 are largely unknown. The data from the quantitative, competition gel mobility shift assays (summarized in Fig. 5Go) indicated several promoters that may be regulated by hERR{alpha}1. However, the strongest binding sites may not be the true physiological targets. For example, the SV40-MLP contains two moderate-strength binding sites (Fig. 5Go), yet was repressed by hERR{alpha}1 in vitro (Fig. 7Go) and in vivo (Fig. 8Go) at least 5-fold. On the other hand, the lactoferrin promoter is affected only modestly by hERR{alpha}1 (10) despite the presence of a high-affinity site (Ref. 10 and Fig. 5Go). The importance of these other hERR{alpha}1-binding sites awaits additional experiments.

Many Sequences Are Recognized by Multiple Members of the Steroid/Thyroid Hormone Receptor Superfamily
Many of the DNA sequences that have been shown here to be bound by hERR{alpha}1 are already known to bind other members of the steroid/thyroid hormone receptor superfamily. The highest-affinity binding site we found is identical to an oligonucleotide that is strongly bound by SF-1 (4). Additionally, the vitellogenin ERE (16), the PRL D sequence (17, 20), and the creatine kinase B sequence (18) are all known to be bound by ER{alpha} and to mediate transcriptional induction by estrogens. The SV40 +1 and +55 sites are functionally bound by COUP-TF1, COUP-TF2, and thyroid hormone receptor-{alpha}1/retinoid X receptor-{alpha} (12, 12a, 21) as well as by hERR{alpha}1 ( Figs. 4–8GoGoGoGoGo). In this latter case, any of these superfamily members can repress transcription from the SV40-MLP. Thus, hERR{alpha}1 can bind to sequences that are also recognized by other members of the superfamily. The meaning of overlapping binding specificity remains unclear.

COUP-TFs have been shown to repress transactivation by many members of the steroid/thyroid hormone receptor superfamily (22). COUP-TFs can repress by multiple mechanisms, including competition for DNA-binding sites (23, 24). Because hERR{alpha}1 binds to several functional EREs (Fig. 5Go), it may function in a similar manner to COUP-TFs by acting as a general repressor of estrogen-regulated genes in the absence of liganded ERs. In the presence of estrogen, activated ER may displace hERR{alpha}1, allowing for both true activation and antirepression of the target genes. Alternatively, because hERR{alpha}1 can associate directly with ER{alpha} (Figs. 9Go and 10) and, likely, ERß (25), hERR{alpha}1/ER heterodimers may recognize EREs with an effect different from either hERR{alpha}1 monomers or ER homodimers. hERR{alpha}1 has also been demonstrated to contain a transactivation domain (9). Thus, it is likely that hERR{alpha}1 can transcriptionally activate targets in some contexts. In the case of the lactoferrin promoter, the hERR{alpha}1-binding site is necessary for maximal transactivation by ER{alpha} acting through a weak, downstream ERE (10). Because most members of the steroid/thyroid hormone receptor superfamily are not ubiquitously expressed, the ability of some sites to be bound by several members of the superfamily may effectively increase the number of tissues in which an element is recognized. Finally, there may be additional requirements for receptor binding to these promoter sites that are not fully reproduced in these in vitro systems.

In summary, we have shown that a major isoform of the hERR{alpha} gene is hERR{alpha}1. We have characterized high-affinity binding sites for hERR{alpha}1, shown that hERR{alpha}1 can bind DNA as a monomer, and developed functional assays for hERR{alpha}1 activity. Furthermore, because this receptor binds both ER{alpha} and EREs, we propose that hERR{alpha}1 likely plays a role in estrogen responsiveness.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Oligonucleotides and Recombinant Plasmids
Oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA) or GIBCO-BRL Life Technologies (Gaithersburg, MD). Complementary strands were annealed by heating to 95 C for 5 min and cooling to room temperature during a period of 2 h. Annealed oligonucleotides were purified with a nondenaturing 15% polyacrylamide gel (26). Plasmid pRSV-ER{alpha}-hERR{alpha}, a gift from R. Evans, directs the expression of a fusion protein consisting of the first 44 amino acids of ER{alpha} and all but the first 38 amino acid residues of the previously published hERR{alpha} sequence constructed from putatively overlapping cDNA clones (8, 12). Plasmid pSP72-hERR{alpha}1, encoding full-length hERR{alpha}, was generated by RT-PCR amplification of the 5'-end of full-length hERR{alpha} cDNA synthesized from HeLa cell mRNA, appropriate recombination with the hERR{alpha} segment present in pRSV-ER-hERR{alpha}, and insertion of the resulting full-length hERR{alpha} cDNA into the KpnI-to-HindIII sites of pSP72 (Promega, Madison, WI). Plasmid pSP72-hERR{alpha}1 was generated by PCR amplification of a portion of the full-length hERR{alpha} coding sequence (using the 5'-primer AGCGCCATGGCCAGCCAGGTGGTGGGCATT, with the translation start codon for hERR{alpha}1 underlined) and ligation back into NcoI- and XmaI-cut pSP72-hERR{alpha}. Plasmid pGEX-hERR{alpha}1 was constructed similarly. The plasmids directing the expression of GST-COUP-TF1 and GST-ßglobin1-123 have been described previously (27). The NaeI fragment of the hERR{alpha} cDNA was cloned into a pGEX-2T vector (Pharmacia, Piscataway, NJ) to generate pGEX-hERR{alpha}17-329. The plasmid pGEX-ER was constructed by subcloning the ER{alpha}-encoding EcoRI fragment of pHEGO, a gift of P. Chambon (28), into pGEX. Plasmids pGEX-TFIIB and phIIB (29) were gifts from D. Reinberg. The pseudo-wild type SV40 used in the experiment described in Fig. 8Go, excised from pSV1773 (30), is a T antigen+, ori+ derivative of pSVS-(WT) containing a frameshift mutation in the major capsid protein-coding region that prevents potential complications from the packaging of viral DNA templates into virions (11). Plasmid pRSV-hERR{alpha}1 was generated by subcloning the sequences coding for hERR{alpha}1 from pGEX-hERR{alpha}1 into pRSV-0+, a derivative of pRSV-0 (12) containing a functional SV40 origin of DNA replication.

Cell Culture and Transfections
CV-1 cells were grown at 37 C in DMEM supplemented with 5% FBS. HeLa S3 cells were grown in RPMI-1640 with 2 mM glutamine and 10% FBS. All media were supplemented with penicillin and streptomycin. Cotransfections were performed by a modification of the diethylaminoethyl-dextran/chloroquine procedure as described (30). SV40 viral sequences were excised from the plasmid-cloning vector and ligated to form monomer circles before transfection.

Recombinant Proteins and Antiserum
Recombinant GST-fusion proteins were purified essentially as described (27). HeLa cell nuclear extract was prepared as previously described (11, 31). In vitro transcribed and translated (TNT) proteins were synthesized with a rabbit reticulocyte lysate (Promega) and 35S-labeled methionine and cysteine (Tran35S Label; ICN, Cleveland, OH) following the manufacturer’s suggested protocol. A polyclonal antiserum was raised in a New Zealand white rabbit against GST-hERR{alpha}117-329. Molecular mass determination was performed with Combithek (Boehringer Mannheim, Indianapolis, IN) and Mark 12 (Novex, San Diego, CA) calibration proteins as standards.

Metabolic Labeling and Immunoprecipitation
Cells were metabolically labeled when approximately 80% confluent by incubation for 4 h with medium containing 35S-labeled methionine and cysteine (250 mCi Tran35S Label; ICN) as described (13). Protein lysates were prepared (13) and were precleared by incubation for 1 h with protein A-agarose (Santa Cruz Biotech, Santa Cruz, CA). The resulting supernatant was incubated for 1 h on ice with 1 ml of anti-GST-hERR{alpha}117-329 serum or preimmune serum from the same animal. Afterward, protein A-agarose was added and the lysate was incubated for 1 h at 4 C. The beads were washed three times and the proteins were eluted by boiling in 2x SDS loading buffer. The radiolabeled proteins were separated in a 10% SDS-PAGE gel and detected by fluorography.

S1 Nuclease Mapping and Primer Extension Analysis
Total cellular RNA was prepared by lysis of the cells in SDS and treatment with Proteinase K. Nucleic acids were extracted and DNA was degraded by treatment with DNase I (21). Poly(A)+ HeLa S3 RNA was prepared with an mRNA Separator kit (Clontech, Palo Alto, CA). The S1 nuclease mapping probe used in the experiment in Fig. 3AGo consisted of the PvuII-to-HpaI fragment of pSP72-hERR{alpha} (Fig. 1Go). The S1 nuclease mapping probe used in the experiment in Fig. 8Go consisted of the origin promoter-containing the nt 4924–446 region of wild type SV40 DNA described previously (12, 12a). These probes were gel-purified and end-labeled with [{gamma}-32P]ATP using T4 polynucleotide kinase (32). The hybridization and S1 nuclease digestion reactions were performed essentially as described (33). The resulting protected fragments were separated by electrophoresis through a 7 M urea, 5% polyacrylamide gel.

Primer extension analyses were performed essentially as described (30) using the 5'-end-labeled oligonucleotide 5'-GCGTCTAGAGATGTAGAGAGGCTCAATGCCCACCACC-3' as primer (Fig. 1Go). The resulting DNAs were resolved in a 7 M urea, 8% polyacrylamide gel.

Quantitative Gel-Mobility-Shift Assays
DNA binding was assayed in 20 ml of a buffer containing 10 mM HEPES (pH 7.5), 2.5 mM MgCl2, 50 mM EDTA, 1 mM dithiothreitol, 6% glycerol, and 100 ng/ml of poly(dI-dC)xpoly(dI-dC). Competition binding assays included unlabeled competitor oligonucleotide as well; 250 pg of 5'-end-labeled, double-stranded oligonucleotide (~5 x 104 cpm) were incubated with approximately 0.85 ng GST-hERR{alpha}1 or GST-ßglobin1-123. Supershift assays contained 1 ml of a 1:10 dilution of whole antiserum. All components were mixed before the addition of protein. The final mixtures were incubated on ice for 15 min, followed by incubation at 25 C for 15 min before separation by electrophoresis at 4 C for 2 h through a nondenaturing 4% polyacrylamide gel at 160 V. Quantification was performed with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). The relative affinities of different sequences for binding by the protein were determined from the moles of unlabeled competitor oligonucleotide needed to reduce the fraction of probe shifted by 50%.

Footprinting
The probes used in the DNase I footprinting assays were PCR-amplified DNA corresponding to SV40 nt 272–446. Sense and anti-sense probes were created by 5'-end-labeling one of the PCR primers. The PCR products were gel-purified before use. Approximately 30 ng GST-hERR{alpha}1 were incubated 20 min at room temperature with 3–5 x 105 cpm of the probe in 50 mM HEPES (pH 7.6), 6 mM MgCl2, 500 mM EDTA, 20% glycerol, 8% polyethylene glycol, and 0.1 mg/ml poly(dI-dC)xpoly(dI-dC). Incubation was continued for 1 min after addition of 0.15 U of DNase I (Pharmacia). The reactions were electrophoresed through a nondenaturing 4% polyacrylamide gel. The protein-DNA complexes and unbound DNA were visualized by autoradiography and excised and eluted from the gel. The DNAs were purified by phenol-chloroform extraction and ethanol precipitation. Equal counts from the unbound and bound complexes were loaded onto a 7 M urea, 6% denaturing polyacrylamide gel. After electrophoresis, the gel was dried and exposed to x-ray film.

Hydroxyl radical footprinting was performed essentially as described by Tullius and Dombroski (34). The probes were synthesized by PCR amplification from an SV40 mutant, pm322C, containing a hERR{alpha}1 binding-site only at +55 (11). Approximately 1 x 107 cpm of this probe was cleaved before use in the footprinting reactions. Thereafter, the DNAs were treated essentially as described above.

Cell-Free Transcription
Cell-free transcription assays were performed as described (11, 12). In brief, 200 ng of circular, plasmid SV40 DNA as template were incubated for 15 min at 4 C with approximately 37 ng of the indicated fusion protein, followed by 15 min at 25 C before addition of the nuclear extract. The resulting SV40 transcripts were analyzed by primer extension (12, 30) with synthetic oligonucleotides corresponding to SV40 nt 5178–5201 and nt 446–422 serving as primers for the detection of the early and late RNAs, respectively.

Binding Assays
Protein-protein associations were assayed essentially as described (27). Briefly, bacterial lysate containing approximately 4 pmol of the GST fusion protein was thawed on ice and mixed with GSH-Sepharose at 4 C for at least 30 min. The beads were washed twice at 4 C with 500 µl NETN buffer (20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40, 0.1 mM phenylmethylsulfonyl fluoride, 0.02 mg aprotinin per ml), resuspended in 50 µl NETN buffer, mixed at 4 C for at least 1 h with the test protein (typically in 0.2–2 ml of reticulocyte lysate), and washed three times at 4 C with NETN buffer. The bound proteins were eluted from the beads by boiling in SDS loading buffer and were resolved by SDS-PAGE. For the experiment shown in Fig. 9BGo, the lysates were treated with 50 mg/ml ethidium bromide as described (19) before use in this binding assay. The gels were stained with Coomassie brilliant blue, destained, equilibrated in water, and treated with 1 M salicylic acid for 30 min before being dried and exposed to x-ray film.


    ACKNOWLEDGMENTS
 
We thank Iain Anderson, Ron Evans, Pierre Chambon, V. Craig Jordan, Jack Gorski, John Pink, Danny Reinberg, Cathy Reznikoff, Ming-Jer Tsai, and Xian-Ming Yu for providing cell lines, plasmids, and reagents. We also thank the members of our laboratory, Iain Anderson, and Jack Gorski for helpful discussions, Chris Bradfield and members of our laboratory for comments on the manuscript, and Xiang Fei and Blue-leaf Hannah for excellent technical assistance. We especially thank Tina Teng and Vincent Giguère for communication of results before publication.


    FOOTNOTES
 
Address requests for reprints to: Janet E. Mertz, McArdle Laboratory for Cancer Research, University of Wisconsin Medical School, Madison, Wisconsin 53706-1599.

This material is based upon work supported under U.S. Public Health Service Grants CA-07175, CA-22443, and GM-07125.

1 Present address: Department of Plant Biology, University of Minnesota, St. Paul, Minnesota 55108. Back

2 Present address: Whitehead Institute for Biomedical Research, Cambridge, MA 02142. Back

3 Present address: Department of Immunology and Rheumatology, Stanford University Medical School, Stanford, California 94305. Back

4 Present address: Abbott Laboratories, Inc., Abbott Park, Illinois 60064. Back

Received for publication July 19, 1996. Revision received November 27, 1996. Accepted for publication December 5, 1996.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schütz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  2. Glass CK 1994 Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr Rev 15:391–407[Abstract/Free Full Text]
  3. Scearce LM, Laz TM, Hazel TG, Lau LF, Taub R 1993 RNR-1, a nuclear receptor in the NGFI-B/Nur77 family that is rapidly induced in regenerating liver. J Biol Chem 268:8855–8861[Abstract/Free Full Text]
  4. Wilson TE, Fahrner TJ, Milbrandt J 1993 The orphan receptors NGFI-B and steroidogenic factor 1 establish monomer binding as a third paradigm of nuclear receptor-DNA interaction. Mol Cell Biol 13:5794–5804[Abstract/Free Full Text]
  5. Harding HP, Lazar MA 1995 The monomer-binding orphan receptor Rev-Erb represses transcription as a dimer on a novel direct repeat. Mol Cell Biol 15:4791–4802[Abstract]
  6. Giguère V, McBroom LDB, Flock G 1995 Determinants of target gene specificity for RORa1: monomeric DNA binding by an orphan nuclear receptor. Mol Cell Biol 15:2517–2526[Abstract]
  7. Mangelsdorf DJ, Evans RM 1995 The RXR heterodimers and orphan receptors. Cell 83:841–850[CrossRef][Medline]
  8. Giguère V, Yang N, Segui P, Evans RM 1988 Identification of a new class of steroid hormone receptors. Nature 331:91–94[CrossRef][Medline]
  9. Lydon JP, Power RF, Conneely OM 1992 Differential modes of activation define orphan subclasses within the steroid/thyroid receptor superfamily. Gene Expr 2:273–283[Medline]
  10. Yang N, Shigeta H, Shi H, Teng CT 1996 Estrogen-related receptor, hERR1, modulates estrogen receptor-mediated response of human lactoferrin gene promoter. J Biol Chem 271:5795–5804[Abstract/Free Full Text]
  11. Wiley SR, Kraus RJ, Zuo F, Murray EE, Loritz K, Mertz JE 1993 SV40 early-to-late switch involves titration of cellular transcriptional repressors. Genes Dev 7:2206–2219[Abstract/Free Full Text]
  12. Zuo F, Mertz JE 1995 Simian virus 40 late gene expression is regulated by members of the steroid/thyroid hormone receptor superfamily. Proc Natl Acad Sci USA 92:8586–8590[Abstract/Free Full Text]
  13. Zuo F, Kraus RJ, Gulick T, Moore DD, Mertz JE 1997 Direct modulation of simian virus 40 late gene expression by thyroid hormone and its receptor. J Virol 71:427–436[Abstract]
  14. Johnston SD 1996 Activation and Repression of the SV40 Late Promoter. Ph.D. Thesis, University of Wisconsin, Madison, WI
  15. Wiley SR 1993 Cellular Factors Regulating Transcription of the Simian Virus 40 Major Late Promoter. Ph.D. Thesis, University of Wisconsin, Madison, WI
  16. Tsai M-J, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  17. Klein-Hitpa ßL, Schorpp M, Wagner U, Ryffel GU 1986 An estrogen-responsive element derived from the 5' flanking region of the Xenopus vitellogenin A2 gene functions in transfected human cells. Cell 46:1053–1061[CrossRef][Medline]
  18. Murdoch FE, Byrne L, Ariazi EA, Furlow JD, Meier DA, Gorski J 1995 Estrogen receptor binding to DNA: affinity for nonpalindromic elements from the rat prolactin gene. Biochemistry 34:9144–9150[CrossRef][Medline]
  19. Wu-Peng XS, Pugliese TE, Dickerman HW, Pentecost BT 1992 Delineation of sites mediating estrogen regulation of the rat creatine kinase B gene. Mol Endocrinol 6:231–240[Abstract/Free Full Text]
  20. Lai J-S, Herr W 1992 Ethidium bromide provides a simple tool for identifying genuine DNA-independent protein associations. Proc Natl Acad Sci USA 89:6958–6962[Abstract/Free Full Text]
  21. Somasekhar MB, Gorski J 1988 Two elements of the rat prolactin 5' flanking region are required for its regulation by estrogen and glucocorticoids. Gene 69:13–21[CrossRef][Medline]
  22. Zuo F 1995 Regulation of the SV40 Late Promoter by Members of the Steroid/Thyroid Hormone Receptor Superfamily. Ph.D. Thesis, University of Wisconsin, Madison, WI
  23. Qiu Y, Tsai SY, Tsai M-J 1994 COUP-TF: an orphan member of the steroid/thyroid hormone receptor superfamily. Trends Endocrinol Metab 5:234–239[CrossRef][Medline]
  24. Cooney AJ, Leng X, Tsai SY, O’Malley BW, Tsai M-J 1993 Multiple mechanisms of chicken ovalbumin upstream promoter transcription factor-dependent repression of transactivation by the vitamin D, thyroid hormone, and retinoic acid receptors. J Biol Chem 268:4152–4160[Abstract/Free Full Text]
  25. Liu Y, Yang N, Teng CT 1993 COUP-TF acts as a competitive repressor for estrogen receptor-mediated activation of the mouse lactoferrin gene. Mol Cell Biol 13:1836–1846[Abstract/Free Full Text]
  26. Kuiper GGJM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson J-Å 1996 Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  27. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory Manual, ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  28. Johnston SD, Yu X-M, Mertz JE 1996 The major transcriptional transactivation domain of simian virus 40 large T antigen associates nonconcurrently with multiple components of the transcriptional preinitiation complex. J Virol 70:1191–1202[Abstract]
  29. Tora L, Mullick A, Metzger D, Ponglikitmongkol M, Park I, Chambon P 1989 The cloned human oestrogen receptor contains a mutation which alters its hormone binding properties. EMBO J 8:1981–1986[Medline]
  30. Ha I, Lane WS, Reinberg D 1991 Cloning of a human gene encoding the general transcription initiation factor IIB. Nature 352:689–695[CrossRef][Medline]
  31. Good PJ, Welch R, Ryu W-S, Mertz JE 1988 The late spliced 19S and 16S RNAs of simian virus 40 can be synthesized from a common pool of transcripts. J Virol 62:563–571[Abstract/Free Full Text]
  32. Dignam JD, Martin PL, Shastry BS, Roeder RG 1983 Eukaryotic gene transcription with purified components. Methods Enzymol 101:582–598[Medline]
  33. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K 1994 Current Protocols in Molecular Biology. John Wiley and Sons, New York
  34. Hertz G, Mertz JE 1988 The enhancer elements and GGGCGG boxes of SV40 provide similar functions in bidirectionally promoting transcription. Virology 163:579–590[CrossRef][Medline]
  35. Tullius TD, Dombroski BA 1986 Hydroxyl radical "footprinting": high-resolution information about DNA-protein contacts and application to {lambda} repressor and Cro protein. Proc Natl Acad Sci USA 83:5469–5473[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
A. A. Peters, G. Buchanan, C. Ricciardelli, T. Bianco-Miotto, M. M. Centenera, J. M. Harris, S. Jindal, D. Segara, L. Jia, N. L. Moore, et al.
Androgen Receptor Inhibits Estrogen Receptor-{alpha} Activity and Is Prognostic in Breast Cancer
Cancer Res., August 1, 2009; 69(15): 6131 - 6140.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
G. Mittler, F. Butter, and M. Mann
A SILAC-based DNA protein interaction screen that identifies candidate binding proteins to functional DNA elements
Genome Res., February 1, 2009; 19(2): 284 - 293.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
E. Bonnelye, N. Laurin, P. Jurdic, D. A. Hart, and J. E. Aubin
Estrogen receptor-related receptor-{alpha} (ERR-{alpha}) is dysregulated in inflammatory arthritis
Rheumatology, December 1, 2008; 47(12): 1785 - 1791.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. A. Stein, C.-y. Chang, D. A. Kazmin, J. Way, T. Schroeder, M. Wergin, M. W. Dewhirst, and D. P. McDonnell
Estrogen-Related Receptor {alpha} Is Critical for the Growth of Estrogen Receptor-Negative Breast Cancer
Cancer Res., November 1, 2008; 68(21): 8805 - 8812.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
V. Giguere
Transcriptional Control of Energy Homeostasis by the Estrogen-Related Receptors
Endocr. Rev., October 1, 2008; 29(6): 677 - 696.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. D. Conzen
Minireview: Nuclear Receptors and Breast Cancer
Mol. Endocrinol., October 1, 2008; 22(10): 2215 - 2228.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Hummasti and P. Tontonoz
Adopting New Orphans into the Family of Metabolic Regulators
Mol. Endocrinol., August 1, 2008; 22(8): 1743 - 1753.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Hu, H. K. Kinyamu, L. Wang, J. Martin, T. K. Archer, and C. Teng
Estrogen Induces Estrogen-related Receptor {alpha} Gene Expression and Chromatin Structural Changes in Estrogen Receptor (ER)-positive and ER-negative Breast Cancer Cells
J. Biol. Chem., March 14, 2008; 283(11): 6752 - 6763.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
Mst. H. Akter, T. Chano, H. Okabe, T. Yamaguchi, F. Hirose, and T. Osumi
Target Specificities of Estrogen Receptor-Related Receptors: Analysis of Binding Sequences and Identification of Rb1-Inducible Coiled-Coil 1 (Rb1cc1) as a Target Gene
J. Biochem., March 1, 2008; 143(3): 395 - 406.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Bonnelye, R. A. Zirngibl, P. Jurdic, and J. E. Aubin
The Orphan Nuclear Estrogen Receptor-Related Receptor-{alpha} Regulates Cartilage Formation in Vitro: Implication of Sox9
Endocrinology, March 1, 2007; 148(3): 1195 - 1205.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
E. A. Ariazi, R. J. Kraus, M. L. Farrell, V. C. Jordan, and J. E. Mertz
Estrogen-Related Receptor {alpha}1 Transcriptional Activities Are Regulated in Part via the ErbB2/HER2 Signaling Pathway
Mol. Cancer Res., January 1, 2007; 5(1): 71 - 85.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
G. Benoit, A. Cooney, V. Giguere, H. Ingraham, M. Lazar, G. Muscat, T. Perlmann, J.-P. Renaud, J. Schwabe, F. Sladek, et al.
International Union of Pharmacology. LXVI. Orphan Nuclear Receptors
Pharmacol. Rev., December 1, 2006; 58(4): 798 - 836.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Nichol, M. Christian, J. H. Steel, R. White, and M. G. Parker
RIP140 Expression Is Stimulated by Estrogen-related Receptor {alpha} during Adipogenesis
J. Biol. Chem., October 27, 2006; 281(43): 32140 - 32147.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Z. Zhang, K. Chen, J. C. Shih, and C. T. Teng
Estrogen-Related Receptors-Stimulated Monoamine Oxidase B Promoter Activity Is Down-Regulated by Estrogen Receptors
Mol. Endocrinol., July 1, 2006; 20(7): 1547 - 1561.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Watanabe, Y. Kinoshita, K. Hosokawa, T. Mori, T. Yamaguchi, and H. Honjo
Function of Estrogen-Related Receptor {alpha} in Human Endometrial Cancer
J. Clin. Endocrinol. Metab., April 1, 2006; 91(4): 1573 - 1577.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. B. Barry, J. Laganiere, and V. Giguere
A Single Nucleotide in an Estrogen-Related Receptor {alpha} Site Can Dictate Mode of Binding and Peroxisome Proliferator-Activated Receptor {gamma} Coactivator 1{alpha} Activation of Target Promoters
Mol. Endocrinol., February 1, 2006; 20(2): 302 - 310.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
W. Zhou, Z. Liu, J. Wu, J.-h. Liu, S. M. Hyder, E. Antoniou, and D. B. Lubahn
Identification and Characterization of Two Novel Splicing Isoforms of Human Estrogen-Related Receptor {beta}
J. Clin. Endocrinol. Metab., February 1, 2006; 91(2): 569 - 579.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Herzog, J. Cardenas, R. K. Hall, J. A. Villena, P. J. Budge, V. Giguere, D. K. Granner, and A. Kralli
Estrogen-related Receptor {alpha} Is a Repressor of Phosphoenolpyruvate Carboxykinase Gene Transcription
J. Biol. Chem., January 6, 2006; 281(1): 99 - 106.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. R. Wende, J. M. Huss, P. J. Schaeffer, V. Giguere, and D. P. Kelly
PGC-1{alpha} Coactivates PDK4 Gene Expression via the Orphan Nuclear Receptor ERR{alpha}: a Mechanism for Transcriptional Control of Muscle Glucose Metabolism
Mol. Cell. Biol., December 15, 2005; 25(24): 10684 - 10694.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
R. Cartoni, B. Leger, M. B. Hock, M. Praz, A. Crettenand, S. Pich, J.-L. Ziltener, F. Luthi, O. Deriaz, A. Zorzano, et al.
Mitofusins 1/2 and ERR{alpha} expression are increased in human skeletal muscle after physical exercise
J. Physiol., August 15, 2005; 567(1): 349 - 358.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Seely, K. S. Amigh, T. Suzuki, B. Mayhew, H. Sasano, V. Giguere, J. Laganiere, B. R. Carr, and W. E. Rainey
Transcriptional Regulation of Dehydroepiandrosterone Sulfotransferase (SULT2A1) by Estrogen-Related Receptor {alpha}
Endocrinology, August 1, 2005; 146(8): 3605 - 3613.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. B. Barry and V. Giguere
Epidermal Growth Factor-Induced Signaling in Breast Cancer Cells Results in Selective Target Gene Activation by Orphan Nuclear Receptor Estrogen-Related Receptor {alpha}
Cancer Res., July 15, 2005; 65(14): 6120 - 6129.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Bonnelye and J. E. Aubin
Estrogen Receptor-Related Receptor {alpha}: A Mediator of Estrogen Response in Bone
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3115 - 3121.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
D Liu, Z Zhang, and C T Teng
Estrogen-related receptor-{gamma} and peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} regulate estrogen-related receptor-{alpha} gene expression via a conserved multi-hormone response element
J. Mol. Endocrinol., April 1, 2005; 34(2): 473 - 487.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. M. Miller, K. W. Jarosinski, and K. A. Schat
Positive and Negative Regulation of Chicken Anemia Virus Transcription
J. Virol., March 1, 2005; 79(5): 2859 - 2868.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. P. Cheung, S. Yu, K. B. Wong, L. W. Chan, F. M. M. Lai, X. Wang, M. Suetsugi, S. Chen, and F. L. Chan
Expression and Functional Study of Estrogen Receptor-Related Receptors in Human Prostatic Cells and Tissues
J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1830 - 1844.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
K. Stokes, B. Alston-Mills, and C. Teng
Estrogen response element and the promoter context of the human and mouse lactoferrin genes influence estrogen receptor {alpha}-mediated transactivation activity in mammary gland cells
J. Mol. Endocrinol., October 1, 2004; 33(2): 315 - 334.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
B Horard, A Castet, P-L Bardet, V Laudet, V Cavailles, and J-M Vanacker
Dimerization is required for transactivation by estrogen-receptor-related (ERR) orphan receptors: evidence from amphioxus ERR
J. Mol. Endocrinol., October 1, 2004; 33(2): 493 - 509.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Greschik, R. Flaig, J.-P. Renaud, and D. Moras
Structural Basis for the Deactivation of the Estrogen-related Receptor {gamma} by Diethylstilbestrol or 4-Hydroxytamoxifen and Determinants of Selectivity
J. Biol. Chem., August 6, 2004; 279(32): 33639 - 33646.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. J. Willy, I. R. Murray, J. Qian, B. B. Busch, W. C. Stevens Jr., R. Martin, R. Mohan, S. Zhou, P. Ordentlich, P. Wei, et al.
Regulation of PPAR{gamma} coactivator 1{alpha} (PGC-1{alpha}) signaling by an estrogen-related receptor {alpha} (ERR{alpha}) ligand
PNAS, June 15, 2004; 101(24): 8912 - 8917.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Laganiere, G. B. Tremblay, C. R. Dufour, S. Giroux, F. Rousseau, and V. Giguere
A Polymorphic Autoregulatory Hormone Response Element in the Human Estrogen-related Receptor {alpha} (ERR{alpha}) Promoter Dictates Peroxisome Proliferator-activated Receptor {gamma} Coactivator-1{alpha} Control of ERR{alpha} Expression
J. Biol. Chem., April 30, 2004; 279(18): 18504 - 18510.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. N. Schreiber, R. Emter, M. B. Hock, D. Knutti, J. Cardenas, M. Podvinec, E. J. Oakeley, and A. Kralli
The estrogen-related receptor {alpha} (ERR{alpha}) functions in PPAR{gamma} coactivator 1{alpha} (PGC-1{alpha})-induced mitochondrial biogenesis
PNAS, April 27, 2004; 101(17): 6472 - 6477.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. K. Mootha, C. Handschin, D. Arlow, X. Xie, J. St. Pierre, S. Sihag, W. Yang, D. Altshuler, P. Puigserver, N. Patterson, et al.
Err{alpha} and Gabpa/b specify PGC-1{alpha}-dependent oxidative phosphorylation gene expression that is altered in diabetic muscle
PNAS, April 27, 2004; 101(17): 6570 - 6575.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. S. Melvin, C. Harrell, J. S. Adelman, W. L. Kraus, M. Churchill, and D. P. Edwards
The Role of the C-terminal Extension (CTE) of the Estrogen Receptor {alpha} and {beta} DNA Binding Domain in DNA Binding and Interaction with HMGB
J. Biol. Chem., April 9, 2004; 279(15): 14763 - 14771.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Sumi and L. J. Ignarro
Estrogen-related receptor {alpha}1 up-regulates endothelial nitric oxide synthase expression
PNAS, November 25, 2003; 100(24): 14451 - 14456.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Luo, R. Sladek, J. Carrier, J.-A. Bader, D. Richard, and V. Giguere
Reduced Fat Mass in Mice Lacking Orphan Nuclear Receptor Estrogen-Related Receptor {alpha}
Mol. Cell. Biol., November 15, 2003; 23(22): 7947 - 7956.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. Liu, Z. Zhang, W. Gladwell, and C. T. Teng
Estrogen Stimulates Estrogen-Related Receptor {alpha} Gene Expression through Conserved Hormone Response Elements
Endocrinology, November 1, 2003; 144(11): 4894 - 4904.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. N. Schreiber, D. Knutti, K. Brogli, T. Uhlmann, and A. Kralli
The Transcriptional Coactivator PGC-1 Regulates the Expression and Activity of the Orphan Nuclear Receptor Estrogen-Related Receptor alpha (ERRalpha )
J. Biol. Chem., March 7, 2003; 278(11): 9013 - 9018.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. A. Ariazi, G. M. Clark, and J. E. Mertz
Estrogen-related Receptor {alpha} and Estrogen-related Receptor {gamma} Associate with Unfavorable and Favorable Biomarkers, Respectively, in Human Breast Cancer
Cancer Res., November 15, 2002; 62(22): 6510 - 6518.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Kraus, E. A. Ariazi, M. L. Farrell, and J. E. Mertz
Estrogen-related Receptor alpha 1 Actively Antagonizes Estrogen Receptor-regulated Transcription in MCF-7 Mammary Cells
J. Biol. Chem., June 28, 2002; 277(27): 24826 - 24834.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. L. Farrell and J. E. Mertz
Cell Type-Specific Replication of Simian Virus 40 Conferred by Hormone Response Elements in the Late Promoter
J. Virol., June 5, 2002; 76(13): 6762 - 6770.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. M. Klinge, S. C. Jernigan, and K. E. Risinger
The Agonist Activity of Tamoxifen Is Inhibited by the Short Heterodimer Partner Orphan Nuclear Receptor in Human Endometrial Cancer Cells
Endocrinology, March 1, 2002; 143(3): 853 - 867.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Lu, Y. Kiriyama, K. Y. Lee, and V. Giguere
Transcriptional Regulation of the Estrogen-inducible pS2 Breast Cancer Marker Gene by the ERR Family of Orphan Nuclear Receptors
Cancer Res., September 1, 2001; 61(18): 6755 - 6761.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
E. Bonnelye, L. Merdad, V. Kung, and J.E. Aubin
The Orphan Nuclear Estrogen Receptor-Related Receptor {alpha} (Err{alpha}) Is Expressed Throughout Osteoblast Differentiation and Regulates Bone Formation in Vitro
J. Cell Biol., May 28, 2001; 153(5): 971 - 984.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
E. Falkenstein, H.-C. Tillmann, M. Christ, M. Feuring, and M. Wehling
Multiple Actions of Steroid Hormones---A Focus on Rapid, Nongenomic Effects
Pharmacol. Rev., December 1, 2000; 52(4): 513 - 556.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. J. Heard, P. L. Norby, J. Holloway, and H. Vissing
Human ERR{gamma}, a Third Member of the Estrogen Receptor-Related Receptor (ERR) Subfamily of Orphan Nuclear Receptors: Tissue-Specific Isoforms Are Expressed during Development and in the Adult
Mol. Endocrinol., March 1, 2000; 14(3): 382 - 392.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
W. Xie, H. Hong, N. N. Yang, R. J. Lin, C. M. Simon, M. R. Stallcup, and R. M. Evans
Constitutive Activation of Transcription and Binding of Coactivator by Estrogen-Related Receptors 1 and 2
Mol. Endocrinol., December 1, 1999; 13(12): 2151 - 2162.
[Abstract] [Full Text]


Home page
Endocr. Rev.Home page
V. Giguère
Orphan Nuclear Receptors: From Gene to Function
Endocr. Rev., October 1, 1999; 20(5): 689 - 725.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
C. Yang and S. Chen
Two Organochlorine Pesticides, Toxaphene and Chlordane, Are Antagonists for Estrogen-related Receptor {{alpha}}-1 Orphan Receptor
Cancer Res., September 1, 1999; 59(18): 4519 - 4524.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J.-M. Vanacker, E. Bonnelye, S. Chopin-Delannoy, C. Delmarre, V. Cavaillès, and V. Laudet
Transcriptional Activities of the Orphan Nuclear Receptor ERR{alpha} (Estrogen Receptor-Related Receptor-{alpha})
Mol. Endocrinol., May 1, 1999; 13(5): 764 - 773.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
S.-K. Lee, H.-S. Choi, M.-R. Song, M.-O. Lee, and J. W. Lee
Estrogen Receptor, a Common Interaction Partner for a Subset of Nuclear Receptors
Mol. Endocrinol., August 1, 1998; 12(8): 1184 - 1192.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
C. M. Klinge, B. F. Silver, M. D. Driscoll, G. Sathya, R. A. Bambara, and R. Hilf
Chicken Ovalbumin Upstream Promoter-Transcription Factor Interacts with Estrogen Receptor, Binds to Estrogen Response Elements and Half-Sites, and Inhibits Estrogen-induced Gene Expression
J. Biol. Chem., December 12, 1997; 272(50): 31465 - 31474.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. B. Vega and D. P. Kelly
A Role for Estrogen-related Receptor alpha  in the Control of Mitochondrial Fatty Acid beta -Oxidation during Brown Adipocyte Differentiation
J. Biol. Chem., December 12, 1997; 272(50): 31693 - 31699.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Zhang and C. T. Teng
Estrogen Receptor-related Receptor alpha 1 Interacts with Coactivator and Constitutively Activates the Estrogen Response Elements of the Human Lactoferrin Gene
J. Biol. Chem., June 30, 2000; 275(27): 20837 - 20846.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Sanyal, J.-Y. Kim, H.-J. Kim, J. Takeda, Y.-K. Lee, D. D. Moore, and H.-S. Choi
Differential Regulation of the Orphan Nuclear Receptor Small Heterodimer Partner (SHP) Gene Promoter by Orphan Nuclear Receptor ERR Isoforms
J. Biol. Chem., January 11, 2002; 277(3): 1739 - 1748.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johnston, S. D.
Right arrow Articles by Mertz, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johnston, S. D.
Right arrow Articles by Mertz, J. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals