help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Malley, B. W.
Right arrow Articles by Duan, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Malley, B. W., Jr.
Right arrow Articles by Duan, L.
Molecular Endocrinology 11 (6): 667-673
Copyright © 1997 by The Endocrine Society

The Role of Interleukin-2 in Combination Adenovirus Gene Therapy for Head and Neck Cancer

Bert W. O’Malley, Jr., Duane A. Sewell, Daqing Li, Ken-ichiro Kosai, Shu-Hsia Chen, Savio L.C. Woo and Ling Duan

Department of Otolaryngology — Head & Neck Surgery (B.W.O., D.A.S., D.L., L.D), Johns Hopkins University, Baltimore, Maryland 21203,
Department of Cell Biology (S.L.C.W., S.-H.C.), Baylor College of Medicine, Houston, Texas 77030,
Department of Pathology (K.-i.K.), Osaka University Medical Center, Osaka 565, Japan


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Interleukin-2 (IL-2) gene therapy alone and in combination with the herpes thymidine kinase gene (tk) was used to evaluate immunological responses and antitumor effects in head and neck cancer. Established floor of mouth squamous cell carcinomas in C3H/HeJ mice were directly injected with recombinant adenoviral vectors carrying both therapeutic and control genes. One week after adenoviral gene transfer, only the animals treated with combination IL-2+tk or tk alone demonstrated significant tumor regression. Residual tumors were harvested for microscopic evaluation and immunohistochemistry staining, which revealed a predominance of CD8+ lymphocytes in the tumor beds of the animals treated with IL-2. To evaluate the systemic immune effects of IL-2, animals treated with single or combination gene therapy received a second site challenge with parental tumor cells or a heterologous but syngeneic sarcoma cell line. Mice treated with combination IL-2 and tk demonstrated a protective systemic immunity specific to the parental tumor cell line, whereas no systemic immune response was evident in mice receiving IL-2 alone. In a separate experiment, a range of concentrations of the adenovirus IL-2 vector were used to treat established tumors. Even with the maximal single-dose adenovirus concentration, IL-2 alone was ineffective as a single therapy. These results support the use of adenovirus-mediated gene transfer of IL-2 as an effective immunotherapy when used adjuvantly with the tk "suicide gene".


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The idea of treating cancer with immune stimulating factors is not new, but the understanding of the immune system’s role in allowing tumor formation as well as in treating established tumors is in evolution. A recent hypothesis is that tumor-specific antigens may actually be expressed in many, if not all, human tumors, and the immune system fails because of an inadequate or incomplete antitumor response (1). Based on this hypothesis, the prospect of using cytokines to enhance the natural immune response is encouraging. One cytokine, in particular, that has shown promise in the treatment of cancer is interleukin-2 (IL-2) (2, 3).

IL-2 is produced by stimulated T lymphocytes (4) and is a known T cell growth factor as well as T cell activation factor. IL-2 also appears to be a potent growth and activation factor for natural killer (NK) cells (5, 6, 7). In experimental animal tumor studies, IL-2 has been shown to augment the effect of concurrently administered cytotoxic T cells and has restored normal proliferative responses in patients with cancer and acquired immunodeficiency syndrome (8). Phase I clinical trials using systemically administered IL-2 have demonstrated some success in tumor regression (2, 3). A major limitation of systemic IL-2, however, is the severe toxicity, which includes fever, chills, headaches, and capillary leak syndrome (2, 3, 9).

In addition to the toxicity, the systemic administration of cytokines to stimulate an immunological response bypasses a critical principle in lymphokine physiology. This principle is that lymphokines act in a paracrine fashion to generate and maintain the specificity of the immunological response (10). Under physiological circumstances, specific cytokines are produced locally in high concentrations at the antigen site. These cytokines act locally in concert with antigen-driven signals to generate effector responses. Pharmacological doses of cytokines administered systemically, however, result in high concentrations in the vasculature at sites distant from the antigen but often in suboptimal levels in tissues at the site of antigen.

Considering both the toxicity and the lack of paracrine function, local delivery of cytokines appears to be a safer and more physiological approach to cytokine-based cancer therapy. Important to this concept are studies that have shown that local cytokine delivery can produce dramatic inflammatory effects without significant systemic toxicity (1, 11, 12).

A pilot clinical trial for inoperable squamous cell cancer of the head and neck was reported by Forni and co-workers (13). In this study, patients received daily local injections of recombinant IL-2 around the regional draining lymph nodes for 10 days, which were repeated on a monthly basis for 1 yr. Twenty five percent of the patients demonstrated partial or complete tumor regression after local IL-2 therapy. Although disease-free survival was increased compared with nontreated controls, the responding patients developed a recurrence 3–5 months after treatment. These and other promising results of local cytokine delivery have led to the interest in developing cancer vaccine strategies.

A notable limitation to local delivery of the recombinant protein is the quick clearance of the protein and the need for multiple closely spaced injections to maintain an antitumor response. A solution to this limitation may lie in the application of gene transfer of cytokines such as IL-2 to provide local sustained release of the therapeutic protein. The replication-defective adenovirus is a widely studied vector for gene transfer and has many important features that are useful for cancer therapy strategies. Adenoviral vectors can carry therapeutic genes at titers of up to 1011 plaque-forming units (pfu)/ml, which is significantly greater than retroviral vectors (14). The adenoviral isolate can also be injected alone and directly into tumors with resulting effective gene expression. Furthermore, the adenovirus genome remains episomal rather than integrating into the chromosome as occurs with retroviruses. The adenovirus is also being used in multiple safety studies and human clinical trials for various human diseases (15, 16, 17, 18).

We have developed a head and neck cancer model to study gene transfer strategies and have demonstrated antitumor efficacy in both single and combination gene therapy treatments (19, 20). Our investigations center on combining a popular "suicide gene", the herpes virus thymidine kinase gene (tk) with the gene for IL-2 for the treatment of squamous cell carcinoma of the head and neck. Delivery of the tk gene coupled to systemic administration of the nucleoside analog ganciclovir (GCV) results in necrosis and direct cytotoxicity to dividing cells. When local IL-2 expression is combined at the site of tumor necrosis, we propose that a synergistic antitumor response results (20, 21). With respect to the safety of this strategy, we have not detected any local or distant pathological effects either from a direct adenovirus vector toxicity or from a secondary inflammatory response in the brain, liver, or floor of mouth and neck (19, 20, 22). The immune response after gene transfer of IL-2 in the head and neck cancer model, however, has yet to be evaluated. The following study investigates the immunological role IL-2 plays in single or combination gene therapy and provides insight into the limitations of adenoviral-mediated cytokine delivery to head and neck cancer.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Effects of Adenoviral Transduction in Vitro
Adenovirus (ADV)/Rous sarcoma virus (RSV)-murine (m)IL-2 was delivered to squamous cell carcinoma (SCC) VII cells in vitro to determine the presence of direct cytotoxicity from the vector and to confirm functional transduction of the tumor cells. The ADV/RSV-mIL-2 vector had no effect on cell viability (P > 0.4, Student’s t test) compared with the control (Fig. 1AGo). Previous in vitro studies have demonstrated no toxic effects of tk or ß-gal control adenovirus vectors (19, 20).



View larger version (57K):
[in this window]
[in a new window]
 
Figure 1. In Vitro Response to Adenovirus Transduction with mIL-2

A, ADV/RSV-mIL-2 transduction of SCC VII squamous carcinoma cells in vitro at MOIs ranging from 0 (PBS) to 50. Cell survival was assessed 3 days after transduction. There was no evidence of direct cytotoxicity from the IL-2 vector compared with the PBS control (P = 0.4). B, PCR confirming the presence of vector within the cells at 72 h posttransduction. Note the bands at 207 bp, which represent the region specific to the ADV/RSV-mIL-2 vector. Lanes 1–4 represent cells that have been transduced at descending MOIs of 50, 20, 15, and 10.

 
To demonstrate the presence of the IL-2 gene within the transduced cells, PCR amplification was performed using primers specific to the ADV/RSV-mIL-2 vector. The vector was amplified in the 10–50 multiplicity of infection (MOI) treatment groups, but not in the 0 MOI control (Fig. 1BGo). Functional transduction was confirmed by assaying the tumor cell culture supernatant for IL-2. Using an IL-2-specific enzyme-linked immunosorbent assay kit, IL-2 protein was detected in supernatants at both 24 and 72 h after transduction (950 pg/liter x 106 cells).

Characterization of Immune Infiltrates after Adenovirus Treatment in Vivo
The purpose of this experiment was to evaluate the role of designated lymphocytes in the therapeutic effect of adenovirus gene transfer. Twenty mice received floor of mouth injections with the squamous carcinoma cells as described. At the time of adenovirus injection, tumor sizes ranged from 70–100 mm3. There were no significant differences in pretreatment tumor sizes between experimental groups. In the four experimental groups (tk+IL-2, tk alone, IL-2+ ß-gal, and ß-gal control), each tumor was treated with a total of 1 x 109 pfu in a total volume of 50 µl. For animals receiving combined therapy, 2 x 108 pfu of ADV/RSV-mIL-2 was delivered. All animals subsequently received intraperitoneal administration of GCV at 25 mg/kg twice daily for six days and were killed on day 7. Consistent with our previous findings, only the groups treated with tk + IL-2 and tk alone demonstrated significant tumor regression compared with the ß-gal alone control animals (P = 0.0004; Mann Whitney analysis). Also consistent was the finding that the tk + IL-2-treated animals demonstrated significant regression as compared with the tk alone-treated animals (P = 0.0006).

Immunohistochemical analysis was performed on all tumor specimens, and positive staining cells were counted per ten high-powered fields (Fig. 2Go). There were no statistical differences between groups for CD4 staining, but CD8 staining in the tk+IL-2 group was statistically greater than in the tk or ß-gal alone group. Although CD8 staining in the tk+IL-2 group was higher than in the IL-2+ß-gal group, significant differences were not evident. Notable was the fact that all samples showed a minimum staining for both CD4 and CD8 lymphocytes, whereas the residual tumors treated with IL-2 alone or in combination with tk showed an average of 2 to 5 times more positive CD8 cells. The enhanced CD8 lymphocyte tumor infiltration appears to be a direct result of adenoviral gene transfer of IL-2. Despite the increased CD8 lymphocytes in the IL-2+ß-gal group, however, no therapeutic benefit was seen. This finding indicates a lack of significant tumor recognition by these cytotoxic T lymphocytes in the groups not treated with tk.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Summary of Immunohistochemical Staining on Residual Tumor Specimens 1 Week after Adenoviral Treatment

Five residual tumors from each animal group were randomly selected and stained for CD8, CD4, and NK lymphocytes with the mean staining and range depicted for each group. The CD8 staining in the tk+IL-2 group was statistically greater than the tk or ß-gal alone group (P = 0.009 to 0.016; Mann-Whitney analysis).

 
Systemic Antitumor Immunity in Animals Receiving mIL-2 and tk Adenoviral Therapy
Head and neck tumors were established in 44 mice. After 5 days, neck skin flaps were raised surgically, and tumors were identified in all animals. Tumor sizes ranged from 8 to 24 mm3 based on caliper measurements. Although the animals were randomly placed into four experimental groups, there were some significant differences in pretreatment tumor sizes. The pretreatment tumor sizes for both the IL-2+ß-gal and the ß-gal alone groups were significantly smaller than the tk+IL-2 and tk alone groups (P = 0.0003 and 0.0019; Mann-Whitney analysis). There were no significant differences in pretreatment sizes when the IL-2+ß-gal vs. the ß-gal alone group or the tk+IL-2 vs. the tk alone group (P = .2–.9) were compared. Animals received GCV at the same dosing scheme as before, and tumor sizes were calculated on live animals by external caliper measurements in three dimensions. The external measurements were performed because of the need for the survival experiment with the second tumor challenge. Posttreatment tumor sizes ranged from 0–800 mm3. Despite the larger pretreatment size, both the tk+IL-2 and the tk groups demonstrated significant tumor regression compared with both IL-2+ß-gal and ß-gal alone groups (P = 0.0001–0.007; Mann-Whitney analysis) (Fig. 3Go). Although the IL-2+ß-gal group had the widest range of posttreatment tumor sizes, the mean value was very close to the ß-gal alone group, and there was no significant difference from the control (P = 0.7). Based on previous experience, tumors less than 10 mm3 do not project from the floor of mouth enough to allow identification and caliper measurement. Therefore, tumors less than 10 mm3 could have been present in the tk+IL-2 and tk animals that received a tumor size calculation of 0 mm3.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 3. Box and Whisker Plot of Residual Tumor Sizes (ranging from 0–800 mm3) after Various Adenoviral Treatments in 44 C3H/HeJ mice with Established Floor of Mouth Tumors

The full range of data points is depicted by the vertical lines, and each subsequent horizontal line depicts percentiles in descending order of 90, 75, 50, 25, and 10th percentile where applicable. The geometric shape within the box represents the median. Only the tk+IL-2 and tk groups demonstrate a significant antitumor response (P = 0.0003 and 0.0019).

 
After the floor of mouth tumors were measured, the mice received opposite flank injections of tumorigenic doses of SCC VII cells and control RIF-1 sarcoma cells. Animals were killed after 14 days, and the flanks were examined externally as well as incised and dissected to assess second-site tumor growth. The time point of 14 days was chosen because of the limitation in survival for the control groups and animal care and use committee restrictions on tumor burden. As compared with the control RIF-1 flank, 100% of the mice treated with tk+IL-2 and 25% of the mice treated with tk alone failed to develop a SCC VII flank tumor. For the IL-2+ß-gal and ß-gal alone groups, only 15% of the animals failed to develop a parental SCC VII tumor (Fig. 4Go). All tumors at second sites were greater than 100 mm3 in size. The protective systemic antitumor immunity is dependent on the combination of tk+IL-2 as this group was significantly different from all other groups (P = 0.003; Fisher Exact analysis).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Systemic Immunity against the SCC VII Squamous Carcinoma at a Distant Site Challenge

Tumorigenic doses of SCC VII and the heterologous, but syngeneic, fibrosarcoma RIF-1 tumor line were injected into flanks of C3H/HeJ mice that received previous adenoviral treatment to their primary floor of mouth tumors. Palpable SCC VII tumors were present in all groups except the tk+IL-2 combination group at the 2 week sacrifice point. Subcutaneous dissection confirmed the lack of SCC VII tumor growth in the tk+IL-2 animals. Tumor-specific immunity was supported by the failure to suppress RIF-1 tumor growth in all groups.

 
Dose Response to ADV/RSV-mIL-2 in Vivo
The experimental results have shown no significant antitumor effect after treatment with adenovirus vector containing IL-2 at 2 x 108 pfu. A dose response experiment was performed in 35 animals to determine whether an antitumor effect could be generated with either more or less total adenovirus delivered to established tumors. Floor of mouth tumors were generated as before, and pretreatment tumor sizes ranged from 20–60 mm3 (no significant pretreatment size differences). Five groups were divided as follows: group 1, 5 x 108 ADV/RSV-mIL-2; group 2, 2.5 x 108 pfu; group 3, 1 x 108 pfu; group 4, 5 x 107 pfu; and group 5, PBS-treated control. One week after adenovirus or PBS control treatment, animals were killed and tumors were measured. Large tumors grew in all groups with no significant differences between any group (P = 0.94; Mann-Whitney analysis) (Fig. 5Go). Microscopic evaluation of all residual tumors was performed after routine hematoxylin and eosin staining. A minimal inflammatory infiltrate was detected equally in each group, and no tumor necrosis or evidence of cytotoxic effect was seen (data not shown). These results suggest that adenovirus delivery of IL-2 alone is ineffective as a single injection in the established tumors.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 5. Dose Response to ADV/RSV-mIL-2 Treatment in Established Tumors

No significant antitumor effect was noted up to the maximum plaque-forming units obtainable with this vector in a single controlled injection (P = 0.94). Solid bars represent the mean tumor sizes with SD shown.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Although both CD4 and CD8 lymphocytes appear to be important in the generation of a synergistic antitumor response after combination gene therapy, it is the specificity of the lymphocytes for the parental tumor that appears most important. This concept is supported by the immunohistochemistry results of the treated tumors. Both the combination tk+IL-2- and IL-2+ß-gal-treated animals revealed both CD4 and CD8 infiltration with an increase in CD8 vs. the other non-IL-2-containing groups (only the tk+IL-2 group was significantly increased by statistical analyses). Despite the similar total numbers and distribution of CD4 and CD8 lymphocytes in these two groups, only the tk+IL-2 group had significant tumor regression compared with the ß-gal alone control. Also, nonspecific tumor killing from NK cells stimulated by IL-2 does not appear to be present as no NK-positive staining was seen in tumor specimens. We thus conclude that the combination of tk+IL-2 creates a local atmosphere conducive to generating tumor-specific immune responses.

Tumor regression was significant in the tk alone group, but the combination tk+IL-2 therapy was more effective. Inasmuch as CD8 infiltration was 2 to 5 times more intense in the tk+IL-2 group, local IL-2 production appears to be a critical component in increasing tumor-specific lymphocytes and inducing synergistic effects on tumor regression when combined with tk treatment. It is possible that the CD8 cell infiltrate may also reflect, to some degree, an immune response against tk or ß-gal proteins. However, the CD8 values are significantly lower than the IL-2-containing groups. In ongoing work with these vectors, we have never seen a significant antitumor response to tumors treated with tk or tk+IL-2 without GCV or to tumors treated with ß-gal with or without GCV (Refs. 19, 20 and our unpublished data). Furthermore, when established tumors are treated with ADV/RSV-mIL-2 alone (without ß-gal), there is still an increased CD8 infiltrate vs. those tumors treated with ADV/RSV-ß-gal alone (our unpublished data). These findings collectively support the importance of the IL-2 and not tk or ß-gal on both the extent and tumor specificity of inflammatory infiltrate.

The results of the second tumor challenge experiment support the hypothesis that combination therapy creates a tumor-specific immune response. Effective tumor regression was seen in both tk+IL-2 and tk alone groups; however, only the combination therapy provided a tumor-specific immunity. After the various adenoviral treatments to floor of mouth tumors, SCC VII cells injected in the flanks grew as tumors in all groups except those treated with combination tk+ IL-2. The specificity of this antitumor immunity was further illustrated by the significant growth of a heterologous sarcoma cell line (RIF-1) injected concurrently in the opposite flank. Therefore, the systemic immunity in the tk+IL-2-treated animals was specific for the parental SCC VII tumor cells.

The in vitro experiments reveal a lack of direct cytotoxicity ADV/RSV-mIL-2 up to MOI values well above those achievable in vivo and demonstrate effective IL-2 expression in transduced cells. To determine whether our lack of efficacy for IL-2 alone was simply a matter of concentration of adenovirus delivered to the floor of mouth tumors, the dose-response experiment was performed. Adenovirus containing a range of IL-2 up to the maximum possible dose for 50 µl (5 x 108 pfu) was delivered to established tumors. No significant tumor regression was seen as compared with controls, and microscopic examination revealed no necrosis or other pathological effects. The combination therapy data coupled to the dose-response results strongly support the adjuvant role of IL-2 in conjunction with adenovirus tk therapy.

Based on the above results, it appears that direct tumor killing from tk (and GCV administration) provides a medium that enables enhanced local IL-2 expression to generate tumor-specific immune responses. We hypothesize that the necrosis and cellular debris from tk’s direct tumor killing results in release or concentration of tumor-specific antigens. Local antigen-presenting cells present the tumor antigens to CD8 cells and stimulate a tumor-specific immune response. The increased local production of IL-2 after intratumor adenovirus delivery enhances the complete immune response, providing both effective local tumor regression and systemic antitumor immunity. Although the data are consistent with such a conclusion, more extensive immune studies are needed to provide stronger support of this hypothesis in the head and neck tumor model.

The notable weakness of this system is a lack of complete cure despite effective tumor regression, immune system stimulation, and increased survival. We have thus far been unable to consistently prevent tumor recurrence with this strategy. The majority of animals develop recurrent floor of mouth tumors within 1–4 weeks after the response (20). As in most animal tumor models, recurrence signifies persistence of the original tumor. The persistence of tumor may be a result of incomplete tumor transduction with adenovirus vector or possibly immunoselection. Future studies will address these issues and will include both repeat adenovirus injection and the addition of other cytokines, such as granulocyte-macrophage colony-stimulating factor, which may enhance antigen presentation as well as long-term antitumor effects. The adenovirus gene therapy strategy is still in its infancy, but the findings of effective tumor regression and tumor-specific immune stimulation support the need for continued work toward future clinical application in the treatment of head and neck cancer.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Construction of Recombinant Adenoviral Vectors
Construction of a replication-defective adenoviral vector containing the tk gene under transcriptional controls of the Rous sarcoma virus (RSV) long-terminal repeat (ADV/RSV-tk) has been reported previously (19, 22). A replication-defective adenoviral vector containing the mIL-2 cDNA under the transcriptional control of the RSV long-terminal repeat promoter (ADV/RSV-mIL-2) was similarly constructed and plaque purified. The viral titer (plaque-forming units/ml) was determined by plaque assay.

In Vitro Experiments
The squamous carcinoma cell line SCC VII was used in all experiments. Originally, the SCC VII squamous cell carcinoma arose spontaneously in C3H/HeJ mice and has subsequently been propagated in vivo (23). The cells were cultured in T-75 tissue culture flasks (Corning Glass Works, Corning, NY) containing 30 cc RPMI 1640 media (Sigma Chemical Co., St. Louis, MO), 12% bovine calf serum, 1% penicillin-streptomycin, and 1% L-glutamine. Cells were maintained in 5% CO2 incubators. The recombinant adenovirus containing IL-2 was added at MOI values ranging from 0–50 to the different wells just after the cells were plated. Seventy-two hours after plating, the cells were trypsinized and counted with a hemacytometer.

PCR reaction was performed to confirm the presence of the vector construct within the cells. Cells were digested with 1% SDS-proteinase K at 42 C for 12 h. DNA was extracted by ethanol precipitation. PCR amplification was performed with the primers RSV 270A (GACTCCTAACCGCGTACA) and ADV 3205 (GTGTTACTCATAGCGCGTAA), which are specific for the ADV/RSV-mIL-2 vector, with the following PCR protocol: 95 C for 1 min, 5x for 1 min, and 7x for 1 min for 35 cycles, and then 7x for 5 min. Five microliters of the 50-µl reaction was run on a 1% agarose gel.

In Vivo Experiments
All animal experiments were performed on C3H/HeJ mice (Jackson Laboratories, Bar Harbor, ME) using sterile technique under a laminar flow hood in accordance with the Johns Hopkins Animal Care and Use Committee regulations. Mice 6–10 weeks old were anesthetized using the inhalational agent Metophane, and a 0.1 cc suspension of 5 x 105 SCC VII cells in HBSS was injected directly into the floor of the mouth. The animals were then maintained in standard housing conditions.

Five days after cell implantation, mice were anesthetized with 0.5 cc avertin at a concentration of 20 mg/ml with the depth of anesthesia determined by toe pinch. A skin incision was made in the lower neck, and surgical dissection revealed the established floor of mouth tumors. Tumors were measured in three dimensions with calipers. Using a 100-µl syringe (Hamilton, Reno, NV) and 26-gauge needle, 1.0 x 109 total pfu of either ADV/RSV-tk, ADV/RSV-ß-gal control, ADV/RSV-tk+ADV/RSV-mIL-2 (2.0 x 108), or ADV/RSV-mIL-2 (2.0 x 108) + ADV/RSV-ß-gal in 50 µl solution were injected directly into the tumors. Neck incisions were closed with 4–0 silk suture (Ethicon, Somerville, NJ). Eighteen hours after adenoviral injection, the mice were administered GCV ip at a regimen of 25 mg/kg twice daily for 6 days.

For the second tumor challenge experiments, tumor sizes were assessed on the seventh day after adenoviral treatment by external caliper measurements. The right and left flanks were then injected separately with tumorigenic doses of either SCC VII or the syngeneic fibrosarcoma cell line RIF-1. Tumor growth was evaluated 1 and 2 weeks after injection.

Immunohistochemistry
For the immunohistochemistry studies, mice were killed 1 week after adenoviral treatment of the floor of mouth tumors. Tumor sizes were measured, and the fluorescein anti-fluorescein system was used to identify infiltrating inflammatory cells in residual tumor masses. Frozen tissues were sectioned at 4 µm and placed on silane-coated slides. Endogenous peroxidase activity in the tissue was blocked by H2O2 treatment. Nonspecific binding was blocked with PBS containing 0.3% BSA. Fluorescein-conjugated primary monoclonal antibodies used in the assay were as follows: rat anti-mouse CD4 (L3T4) (GIBCO BRL, Grand Island, NY), rat anti-mouse CD8a (Ly-2) (GIBCO, BRL), mouse anti-mouse NK (5E6) (Pharmingen, San Diego, CA). After reaction with primary antibodies, the sections were rinsed and incubated with peroxidase-conjugated rabbit anti-fluorescein isothiocyanate (DAKO, Carpinteria, CA) for 2 h at room temperature. After rinsing, the slides were incubated in chromogen solution (diaminobenzidine, 3 mg; PBS, 10 ml; 8% NiCl, 50 µl; 30% H2O2, 1 µl) for 10 min. The reaction was stopped in running distilled water for 1 min, and the slides were counterstained with Nuclear Fast Red for 5 min.


    ACKNOWLEDGMENTS
 
This work was supported in part by the Johns Hopkins Clinician Scientist Award and Grant 1 R29 Grant DE 11772–01 from the National Institute of Dental Research (to B.W.O. Jr.).


    FOOTNOTES
 
Address requests for reprints to: Bert W. O’Malley, Jr., M.D., Department of Otolaryngology-Head & Neck Surgery, Johns Hopkins University, P.O. Box 41402, Baltimore, Maryland 21203-6402.

Received for publication January 29, 1997. Accepted for publication March 21, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Fearon ER, Pardoll DM, Itaya R, Golumbek P, Levitsky H, Simons J 1990 Interleukin-2 production by tumor cells bypasses T helper function in the generation of an antitumor response. Cell 60:397–403[CrossRef][Medline]
  2. Rosenberg SA, Lotze M, Maul LM 1987 A progress report on the treatment of 157 patients with advanced cancer using lymphokine-activated killer cells and interleukin-2 or high-dose interleukin-2 alone. N Engl J Med 316:889–897[Abstract]
  3. West WH, Touer KW, Yanelli JR 1987 Constant infusion of recombinant interleukin-2 in adoptive immunotherapy of advanced cancer. N Engl J Med 316:898–905[Abstract]
  4. Morgan DA, Ruscetti FW, Gallo R 1976 Selective in vitro growth of T lymphocytes from normal human bone marrow. Science 193:1007–1008[Abstract/Free Full Text]
  5. Kuribayashi K, Gillis S, Kern DE, Henney CS 1981 Murine NK cell cultures: effects of interleukin-2 and interferon on cell growth and cytotoxic reactivity. J Immunol 126:2321–2327[Medline]
  6. Henney CS, Kern DE, Gillis S 1982 Cytotoxic responses: the regulatory influence of interleukin-2. Transplant Proc 14:565–569[Medline]
  7. Henney CS, Kuribayashi K, Kern DE, Gillis S 1981 Interleukin-2 augments natural killer cell activity. Nature 291:335–338[CrossRef][Medline]
  8. Rook AH, Masur H, Lane HC, et al. 1983 Interleukin-2 enhances the depressed natural killer and cytomegalo-virus-specific cytotoxic activities of lymphocytes from patients with the acquired immune deficiency syndrome. J Clin Invest 72:398–403
  9. West WH, Tauer KW, Yanelli JR, Marshall GD, Orr DW, Thurman GB, Oldham RK 1987 Constant infusion recombinant interleukin-2 in adoptive immunotherapy of advanced cancer. N Engl J Med 316:898–905
  10. Pardoll DM 1993 Cancer vaccines. Immunol Today 14:310–316[CrossRef][Medline]
  11. Gansbacher B, Zier K, Daniels B, Cronin K, Bannerji R, Gilboa E 1990 Interleukin-2 gene transfer into tumor cells abrogates tumorigenicity and induces protective immunity. J Exp Med 172:1217–1224[Abstract/Free Full Text]
  12. Golumbek PT, Lazenby AJ, Levitsky HI, Jaffee LM, Karasuyama H, Baker M, Pardoll DM 1991 Treatment of established renal cancer by tumor cells engineered to secrete interleukin-4. Science 254:713–716[Abstract/Free Full Text]
  13. De Stefani A, Valente G, Forni G, Lerda W, Ragona R, Cortesina G 1996 Treatment of oral cavity and oropharynx squamous cell carcinoma with perilymphatic interleukin-2: clinical and pathologic correlations. J Immunother 19:125–133
  14. Kozarsky KF, Wilson JM 1993 Gene therapy: adenovirus vectors. Curr Opin Gen Dev 3:499–503[CrossRef][Medline]
  15. Boucher RC, Knowles MR, Johnson LG, Olsen JC 1994 Gene therapy for cystic fibrosis using E1-deleted adenovirus: a phase I trial in the nasal cavity. Hum Gene Ther 5:615–639[Medline]
  16. Rosenfeld MA, Yoshimurea K, Trapnell BC, Yoneyama K, Rosenthal ER, Dalemans W, Bargon J, Stier LE, Stratford-Perricaudet LD, Perricaudet M, Guggino WB, Pavirani A, Lecocq JP, Crystal RG 1992 In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithelium. Cell 68:143–155[CrossRef][Medline]
  17. Rich DP, Couture M, Carodoza LM, Guiggio VM, Armantano D, Espino PC, Hehir K, Welsh MJ, Smith AE, Gregory RJ 1993 Development and analysis of recombinant adenoviruses for gene therapy of cystic fibrosis. Hum Gene Ther 4:461–476[Medline]
  18. Welsh MJ, Smith AE, Zabner J, Rich DP, Graham SM, Gregory RJ, Pratt BM, Moscicki RA 1994 Cystic fibrosis gene therapy using an adenovirus vector: in vivo safety and efficacy in nasal epithelium. 5:209–219
  19. O’Malley Jr BW, Chen S-H, Schwartz MR, Woo SLC 1995 Adenovirus-mediated gene therapy for human head and neck squamous cell cancer in a nude mouse model. Cancer Res 55:1080–1085[Abstract/Free Full Text]
  20. O’Malley Jr BW, Cope KA, Chen S-H, Li D, Schwartz MR, Woo SLC 1996 Combination Gene Therapy for Oral Cancer in a Murine Model. Cancer Res 56:1737–1741[Abstract/Free Full Text]
  21. Chen S-H, Li Chen XH, Wang Y, KosaiK, Finegold MJ, Rich SS, Woo SLC 1995 Combination gene therapy for liver metastasis of colon carcinoma in vivo. Proc Natl Acad Sci USA 92:2577–2581[Abstract/Free Full Text]
  22. Chen S-H, Shine D, Goodman JC, Grossman RG, Woo SLC 1994 Gene therapy for brain tumors: regression of experimental gliomas by adenovirus-mediated gene transfer. Proc Natl Acad Sci USA 91:3054–3057[Abstract/Free Full Text]
  23. Fu KK, Rayner PA, Lam KN 1984 Modification of the effects of continuous low dose irradiation by concurrent chemotherapy infusion. Int J Radiat Oncol Biol Phys 10:1473–1478[Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
K. Minemura, T. Takeda, K. Minemura, T. Nagasawa, R. Zhang, R. Leopardi, and L. J. DeGroot
Cell-Specific Induction of Sensitivity to Ganciclovir in Medullary Thyroid Carcinoma Cells by Adenovirus-Mediated Gene Transfer of Herpes Simplex Virus Thymidine Kinase
Endocrinology, May 1, 2000; 141(5): 1814 - 1822.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Li, W. Jiang, J. S. Bishop, R. Ralston, and B. W. O'Malley Jr.
Combination Surgery and Nonviral Interleukin 2 Gene Therapy for Head and Neck Cancer
Clin. Cancer Res., June 1, 1999; 5(6): 1551 - 1556.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Zhang, F. H. Straus, and L. J. DeGroot
Effective Genetic Therapy of Established Medullary Thyroid Carcinomas with Murine Interleukin-2: Dissemination and Cytotoxicity Studies in a Rat Tumor Model
Endocrinology, May 1, 1999; 140(5): 2152 - 2158.
[Abstract] [Full Text]


Home page
J. Virol.Home page
X. Danthinne, K. Aoki, A. L. Kurachi, G. J. Nabel, and E. G. Nabel
Combination Gene Delivery of the Cell Cycle Inhibitor p27 with Thymidine Kinase Enhances Prodrug Cytotoxicity
J. Virol., November 1, 1998; 72(11): 9201 - 9207.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Zhang, K. Minemura, and L. J. De Groot
Immunotherapy for Medullary Thyroid Carcinoma by a Replication-Defective Adenovirus Transducing Murine Interleukin-2
Endocrinology, February 1, 1998; 139(2): 601 - 608.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Malley, B. W.
Right arrow Articles by Duan, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Malley, B. W., Jr.
Right arrow Articles by Duan, L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals