| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
CNRS-UPR 0415 and Université Paris VII (R.J., L.P., I.L.,
P.C., S.M., A.D.S.) Institut Cochin de Génétique
Moléculaire F-75014 Paris, France
Molecular
Neuroendocrinology Group (P.B., P.J.M.) Rowett Research
Institute Aberdeen, AB2 9SB UK
Institut de Recherches
Internationales Servier (B.G., P.D), F-92415 Courbevoie Cedex,
France
| ABSTRACT |
|---|
|
|
|---|
) and
Mel1c(ß), differed from each other by only 35
nucleotides and six amino acid residues. Studies on several animals of
various Xenopus species indicate that
Mel1c(
) and
Mel1c(ß) receptors may correspond to allelic
variants of the same locus.
Studies on cells transfected with both receptor cDNAs showed the
expression of high-affinity
2-[125I]iodomelatonin binding sites. Agonist
stimulation of Mel1c(
) receptor was
associated with the inhibition of cAMP accumulation stimulated by
forskolin (IC50
10-10 M) in HeLa,
Ltk-, and human embryonic kidney 293 (HEK 293)
cells. Mel1c(ß) receptor modulated cAMP in
HeLa and HEK 293 cells but not in Ltk- cells.
Both receptors inhibited, in a dose-dependent manner, cGMP accumulation
in all three cell lines incubated with a phosphodiesterase inhibitor.
This effect was localized upstream of soluble guanylyl cyclase and was
blocked by pertussis toxin treatment. However,
IC50 values
(
10-10 M for
Mel1c(ß) and 10-9 to
10-7 M for
Mel1c(
)) and maximal inhibition levels
showed that Mel1c(
) receptors are much less
efficiently coupled to the cGMP pathway.
Coupling differences may be explained by the fact that five of the six
amino acid substitutions between Mel1c(
) and
Mel1c(ß) receptors are located within
cytoplasmic regions potentially involved in signal transduction. The
existence of coupling differences is in agreement with the observation
that expression of both receptors is evolutionally conserved in native
tissue. In conclusion, two novel, potentially allelic, isoforms of
Xenopus Mel1c melatonin receptors
display identical ligand-binding characteristics, but different
potencies in modulating cAMP and cGMP levels through
Gi/Go-dependent
pathways. Furthermore, to our knowledge, this study provides the first
data on the modulation of intracellular cGMP levels by cloned melatonin
receptors.
| INTRODUCTION |
|---|
|
|
|---|
The first melatonin receptor cDNA cloned from Xenopus dermal melanophores was reported to contain a C-terminal tail that was 65 residues longer than that of all other cDNAs of melatonin receptors subsequently characterized in mammals and birds. Thus, this study was conducted to isolate a potential shorter melatonin receptor cDNA form from Xenopus that might be equivalent to that found in other species.
Messenger RNA encoding such a short receptor is indeed present in Xenopus skin. In addition, we identified a second highly homologous coding region, which is likely to correspond to an allelic isoform of the short melatonin receptor.
The two putative alleles, which differ by 35 nucleotides and six amino acid residues, modulated intracellular cAMP and cGMP in a dose-dependent manner but with different efficiencies. One of the two alleles was not capable of promoting the inhibition of adenylyl cyclase in one of three cell lines transfected with the corresponding cDNA. The second allele displayed a weaker coupling with the cGMP pathway in all cell lines.
| RESULTS |
|---|
|
|
|---|
400 bp (short) and of
600 bp (long) were obtained with this
approach (see Fig. 1
|
|
Tyr and Gly-355
Val) preceded a stop codon that shortened the
C-terminal tail by 65 amino acid residues (Fig. 2A
Finally, the entire melatonin receptor cDNA could be amplified from
Xenopus skin cDNA in a single PCR reaction using the
N-terminal upper primer 3S and the lower primer 12AS located in the
newly identified 3'-noncoding region (see Fig. 1
). Restriction analysis
of several independent clones confirmed that the two different
melatonin receptor mRNAs were indeed present in our samples and that
the substitutions found in fragments 24 belonged to a single mRNA
species. Both mRNAs encoded proteins of 354 amino acids, which were
most similar to the chicken Mel1c receptor among cloned
melatonin receptors (78% homology). Therefore, the receptor form
without any substitution other than the shortened C terminus was called
Mel1c(
), whereas the form with multiple substitutions
was called Mel1c(ß).
Characterization of the Mel1c-Locus in
Various Xenopus Species
Highly homologous Mel1c(
) and
Mel1c(ß) receptors could represent either two alleles at
the same genomic locus or two isoforms encoded by different genes. To
address this question, fragment 3 of Mel1c receptors was
amplified by PCR from genomic DNA in 43 X. laevis
individuals. Several of these animals were inbred, while others were
wild animals directly imported from South Africa. Amplified DNA
fragments of the expected size were digested with appropriate
restriction enzymes specific for either Mel1c(
) and
Mel1c(ß) cDNAs (Fig. 3
). In one X. laevis (ff)
individual, homozygous for the major histocompatibility complex and
other genetic markers (8), only the Mel1c(
) receptor
gene was found. PCR analysis of a second X. laevis (rf)
frog, known to be heterozygous for the genetic markers mentioned above,
revealed the presence of both Mel1c(
) and
Mel1c(ß) receptor genes (Fig. 3
). This
observation supports the hypothesis that the two melatonin receptor
isoforms are encoded by the same genomic locus. Analysis of the other
41 animals showed the presence of either both receptor genes (40
individuals) or Mel1c(
) gene alone (one individual). No
individual was found to exhibit only the Mel1c(ß)
receptor gene. Two other Xenopus species were studied using
the same approach. Analysis of genomic DNA from Xenopus
ruwenzoriensis, a species known to be polyploid (9), revealed the
presence of the Mel1c(
) receptor gene. Two additional
melatonin receptor genes clearly different from Mel1c(
)
and Mel1c(ß) were revealed by the comparison of enzymatic
digestion patterns in Xenopus tropicalis and X.
ruwenzoriensis (Fig. 3
).
|
) melatonin receptor-specific sequences (see
above) and two individuals shown to contain both Mel1c(
)
and Mel1c(ß) melatonin receptor-specific sequences
[X. laevis (rf) and another] were digested by
EcoRI (no restriction site for this enzyme in
Mel1c melatonin receptor isoforms). The digested DNA was
separated by gel electrophoresis, transferred to nitrocellulose, and
hybridized with a radioactively labeled probe corresponding to the
majority of exon 2 of the Mel1c melatonin receptor from
X. laevis (fragment 3 of Fig. 1
) and Mel1c(ß) melatonin
receptor-specific sequences the same hybridization pattern was observed
under the same washing conditions. No additional hybridization signal
was observed (procedure repeated twice with similar results; data not
shown). Taken together, Southern blot and PCR analyses support the
hypothesis that the two melatonin receptor isoforms
(Mel1c(
) and Mel1c(ß)) are encoded by the
same genomic locus.
Pharmacological Characterization of
Mel1c(
) and
Mel1c(ß) Receptors
Mel1c(
) and Mel1c(ß) receptor
cDNAs were expressed in murine Ltk- cells as stable
clones, under the control of the Rous sarcoma virus (RSV) promoter.
Among various clones expressing 2-[125I]iodomelatonin
binding sites, one Mel1c(
) clone, expressing 200 fmol
receptors per mg of total protein, and one Mel1c(ß)
clone, expressing 150 fmol receptors per mg of total protein, were
characterized further. KD-values for the radiolabeled
agonist 2-[125I]iodomelatonin were 160 ± 32 and
143 ± 25 pM, respectively (Fig. 4A
),
values that are in good agreement with those determined for other
high-affinity melatonin receptors, including that cloned previously
from X. laevis melanophores (4, 10). Competition experiments
showed that the rank order of affinity for several ligands was
characteristic of melatonin receptors (Fig. 4B
and Table 1
) (10). No significant differences were found between
Mel1c(
) and Mel1c(ß) receptors in binding
experiments.
|
|
) receptor,
melatonin promoted the inhibition of forskolin-stimulated cAMP
accumulation (Fig. 5
-subunits
of Gi proteins (12). To eliminate the possibility that the
impaired signaling of Mel1c(ß) receptor was due to
quantitative changes of Gi
subunits, control
Ltk- cells and clones expressing either
Mel1c(
) or Mel1c(ß) receptors were
compared for their Gi
subunit content. Western blot
analysis with a specific antibody recognizing all three subtypes of
Gi
(13) could not detect major quantitative differences
(data not shown).
|
) or Mel1c(ß) receptor cDNA;
the coexpression of different receptors allows selective study of the
subpopulation of cells that has internalized the exogenous DNA (14).
Three days after transfection, cells were studied for the
melatonin-dependent inhibition of cAMP accumulation in response to the
ß2AR agonist isoproterenol and for the number of
ß-adrenergic and melatonin binding sites (Fig. 6
) and ß2AR receptor cDNAs,
simultaneous incubation with isoproterenol and melatonin resulted in a
significantly reduced accumulation of cAMP (65 ± 5% of control,
P < 0.05) (Fig. 6
|
) or Mel1c(ß) cDNA.
Clones expressing between 100 and 800 fmol receptor/mg protein were
selected for these studies. Interestingly, both receptor isoforms
promoted the inhibition of forskolin-stimulated cAMP accumulation in
both cell lines (Fig. 7
) and Mel1c(ß) receptors was
observed. Equivalent results were obtained on two further HEK 293 and
HeLa clones expressing Mel1c(ß) receptors (data not
shown).
|
)
or Mel1c(ß) receptors were incubated with melatonin, and
subsequent effects on intracellular cGMP were analyzed. Melatonin (up
to 10 µM) had no effect on basal cGMP levels in either
cell line. Intracellular cGMP content depends on the opposite
activities of guanylyl cyclases, which synthesize cGMP, and of
phosphodiesterases (PDE), which degrade cGMP. The PDE inhibitor IBMX
was included in the assay to block cGMP degradation by PDE. Under these
conditions the cGMP level increased approximately 3-, 2-, and 5-fold in
unstimulated Ltk-, HeLa, and HEK 293 cells, respectively,
indicating the presence of a basal PDE activity in these cell lines.
Incubation with melatonin inhibited IBMX-promoted accumulation of cGMP,
in a dose-dependent manner, in all three cell lines expressing either
Mel1c(
) or Mel1c(ß) receptors (Fig. 8
). The effect of
Mel1c(
) receptor activation on cGMP was very weak in
Hela cells but was reproducibly observed in every experiment. In the
two other cell lines expressing Mel1c(
) receptors,
IC50 values were shifted to the right, and maximal
inhibition levels were smaller compared with the same cells expressing
Mel1c(ß) receptors. When IBMX-promoted accumulation of
cGMP was modest, inhibition of cGMP accumulation was not significant,
revealing the limitations of this assay. Melatonin stimulation of
mock-transfected cells did not affect the cGMP increase promoted by
IBMX.
|
)quinozalin-1-one (ODQ) (16, 17) (Fig. 9A
|
subunits of G proteins, has been shown to block the
Gi-mediated inhibition of cAMP accumulation promoted by
melatonin receptors (18, 19). Preincubation with pertussis toxin
abolished the effect of melatonin on cGMP accumulation, suggesting that
this signaling pathway is Gi/o mediated (Fig. 9C| DISCUSSION |
|---|
|
|
|---|
) and Mel1c(ß), were
cloned from skin mRNA by RT-PCR. These receptors could be classified,
based on their high homology with previously identified melatonin
receptors in the Mel1c subfamily (5, 6). Both receptors
displayed a predicted C terminus that was shorter by 65 amino acids
than previously described for the X. laevis
Mel1c receptor cloned from an immortalized dermal
melanophore cell line (4). Additional nucleotide changes were found in
the Mel1c(ß) receptor that did not correspond to any of
the PCR amplification products from Xenopus recently
reported by Reppert et al. (6). These differences are
unlikely to be due to errors caused by the amplification procedure used
here because several independent RT-PCR reactions, performed with a
high-fidelity Pfu DNA polymerase, yielded the same results. Errors due
to reverse transcription may also be excluded because the same
nucleotide changes were found in PCR products amplified from genomic
DNA of 41 frogs.
We believe that Mel1c(
) and Mel1c(ß)
receptors described here are likely to be the true Mel1c
receptor subtypes expressed in X. laevis skin: 1) both
receptors are identical in length to all other melatonin receptors
reported so far (5, 6); 2) no amplification products could be obtained
using several antisense PCR primers located in the 3'-coding region of
the sequence published previously; 3) PCR reactions, targeted at the
3'-end of the coding region and at the next untranslated region using a
nonspecific oligo dT primer, did not amplify other DNA fragments than
those corresponding to Mel1c(
) and
Mel1c(ß) sequences; 4) finally, the complete cDNA of both
Mel1c(
) and Mel1c(ß) receptors and not
that of the previously reported Mel1c could be amplified in
a single reaction from Xenopus skin mRNA. Although we cannot
rule out the possibility that the Xenopus Mel1c
receptor reported by Ebisawa et al. (4) is
melanophore-specific and the two isoforms presented here are specific
for other skin cell types, our data support the hypothesis that the
isoform reported by Ebisawa et al. represents an infrequent
and/or low abundant form selected by the immortalization of
Xenopus melanophore cells.
Both Mel1c(
) and Mel1c(ß) receptor cDNAs
are found in either long or short forms as a function of the size of
the 3'-untranslated region. The Mel1c(
) receptor cDNA
was found mostly in the short form (3:1, short:long), the
Mel1c(ß) receptor cDNA being more abundant in the longer
form (1:3). The 3'-untranslated regions of several receptor cDNAs of
the same family, such as the ß2-adrenergic (20) or the
muscarinic receptor (21), have been found to contain molecular
determinants involved in the regulation of mRNA stability. It is
tempting to speculate that short and long mRNAs encoding
Mel1c(
) and Mel1c(ß) receptors undergo
differential regulation. Because both receptor isoforms have similar
affinities for melatonin but different signaling properties (see
below), such a regulation might modulate the cellular response to
melatonin stimulation.
X. laevis Mel1c(
) and Mel1c(ß)
melatonin receptors are more than 98% homologous at the protein level.
This high homology suggests that these two isoforms are alleles rather
than subtypes encoded by different genes. To address this question, the
PCR amplification products from genomic DNAs of 43 animals (including
12 wild individuals) were analyzed using discriminating restriction
enzymes. Forty-one DNAs contained the two forms of Mel1c
genes, whereas in two individuals only the Mel1c(
) DNA
could be amplified. Interestingly, one of these two latter frogs was
known to be homozygous for the histocompatibility locus and for other
genetic markers. Southern blot analysis of genomic DNA of three
individuals, two containing the two Mel1c-isoforms,
according to PCR analysis, and one individual containing only the
Mel1c(
) DNA, revealed in each case the presence of four
hybridization signals using a probe of exon II under high stringency
conditions. Two factors might contribute to the detection of several
hybridization signals: 1) Reppert et al. (6) have
PCR-amplified three amplification products from Xenopus
genomic DNA, whose sequence corresponds to three closely related
members of the melatonin receptor family; 2) Xenopus is
known to have duplicated its genome during evolution followed by
partial genomic deletions, thereby generating several copies of the
same locus embedded in different genomic contexts. Taken together, our
findings obtained by Southern blot and PCR analysis of genomic DNA
support the hypothesis that Mel1c(
) and
Mel1c(ß) melatonin receptors are encoded by allelic
genes. The low number of Mel1c(
)/Mel1c(
)
homozygotes (two of 43) and the absence of
Mel1c(ß)/Mel1c(ß) homozygotes (zero of 43)
would suggest that each of the alleles confers some physiological
advantage, lost in Mel1c homozygotes.
Comparison of the pharmacological profiles of the three receptor
isoforms, Mel1c(
) and Mel1c(ß) and the
reported longer version, does not reveal any significant difference.
This is not surprising since amino acid residues located in the
putative transmembrane regions, and not in the intracellular domains,
are predicted to be involved in ligand binding (22, 23).
The Mel1c(
) receptor mediated inhibition of
forskolin-stimulated cAMP accumulation in three different cell lines in
a dose-dependent manner with an IC50 of approximately
10-10 M, a value in good agreement with those
reported for all melatonin receptors cloned thus far (4, 5, 6). The
additional 65 amino acid residues of the C-terminal tail present in the
reported Mel1c receptor from dermal melanophores appear not
to be involved in G protein coupling because Mel1c(
)
receptors inhibit forskolin-stimulated cAMP accumulation with the same
efficiency as the longer version. This is in agreement with findings
from other G protein-coupled receptors where the receptor C terminus is
generally not involved in G protein binding (22).
In contrast, modulation of cAMP levels by melatonin binding to the
Mel1c(ß) receptor appeared to be cell type-dependent. In
HeLa and HEK 293 cells, inhibition of adenylyl cyclase activity was
similar to that observed for Mel1c(
) receptors, but in
Ltk- cells no inhibition of cAMP accumulation could be
shown. These results were obtained on at least two stable clones for
each cell line and after transient transfection of Ltk-
cells, arguing against a potential cloning artifact. Functional
integrity of adenylyl cyclase in Ltk- cell clones
expressing the Mel1c(ß) isoform was assessed based on the
fact that forskolin stimulated a similar cAMP accumulation in
Ltk- cells expressing either Mel1c(
) or
Mel1c(ß) receptors. Inhibition of adenylyl cyclase
function is mostly mediated by activated Gi proteins.
Western blot analysis showed the presence of similar amounts of
Gi
subunits in both Mel1c(
)- and
Mel1c(ß)-transfected Ltk- cells, and in
control untransfected Ltk- cells, ruling out the potential
selection of cell clones expressing lower amounts of Gi
proteins.
In the family of serpentine, seven membrane-spanning domain receptors,
intracellular regions are known to be involved in G protein coupling
(22, 24, 25). Data from signaling experiments in Ltk-
cells suggest that the five amino acid substitutions between
Mel1c(
) and Mel1c(ß) receptors, located in
the intracellular domains, constitute the molecular basis of the
difference in cAMP modulation in these cells.
However, the results of experiments conducted in HeLa and HEK 293 cells indicated that the five amino acid substitutions alone are not sufficient to result in signaling differences in any cellular context. Obviously, cell-specific factors are able to rescue the impaired Mel1c(ß) receptor signaling. Differences in receptor-G protein interaction are most likely to be responsible for signaling differences. It is now well established that coupling efficiency is governed by the affinity of the G protein for the receptor. Therefore, functional coupling depends on the absolute and relative amounts of G proteins present in the cell and may thus vary from one cell type to another.
The easiest way to explain our results is to assume that
Mel1c receptors are coupled to more than one of the three
existing Gi protein subtypes to inhibit cAMP accumulation.
This assumption is supported by studies of other Gi-coupled
receptors such as adenosine A1 and 5-hydroxytryptamine1A
(5-HT1A) serotonin receptors, which couple to all three
Gi subtypes although with different affinities (26, 27).
Mel1c(ß) receptors may have lost or decreased affinity
for at least one Gi subtype. In HEK293 and HeLa cells
Mel1c receptors may be coupled functionally via several
distinct Gi protein subtypes. Although
Mel1c(ß) receptors have lost affinity for one
Gi subtype, inhibition of cAMP accumulation is still
ensured in these cell lines via the other Gi protein
subtypes. The Gi protein composition of Ltk-
cells may be more limited than that of HEK293 and HeLa cells. While
Mel1c(
) receptors still find a relevant Gi
protein interaction partner, Mel1c(ß) may not find a
Gi protein in this cellular system because of the loss of
affinity for some Gi protein subtypes. Obviously,
Ltk- cells provide a cellular context that reveals
differences in signaling capacities of both receptors. These
differences might explain why both receptors are expressed in
vivo, in X. laevis skin.
The role of cGMP as a second messenger in melatonin receptor signaling
is still in discussion. Pigment aggregation in Xenopus
melanocytes has been reported to be regulated by melatonin (28) and by
cAMP, whereas conflicting results exist on its regulation by cGMP (29, 30). The role of cGMP in melatonin signaling in other cellular systems
has not been deeply investigated so far (2, 3). The notion of cGMP
modulation by melatonin receptors also resulted from experiments on
neonatal rat pituitary tissue, where an inhibitory effect of melatonin
on cGMP production was observed (15). Here, we report that
melatonin-activated Mel1c(
) and Mel1c(ß)
receptors indeed inhibit cGMP accumulation in a dose-dependent manner
with IC50 values of approximately 10-10
M for Mel1c(ß) and 10-9 to
10-7 M for Mel1c(
). In
Ltk- and HEK293 cells, the IC50 values for
Mel1c(
) were higher and the maximal inhibitory effects
were lower compared with those measured in cells expressing the
Mel1c(ß) subtype, whereas in Hela cells, modulation of
cGMP was at the limit of sensitivity of our assay. These data suggest
that Mel1c(
) receptors are less efficiently coupled to
the cGMP pathway than their allelic counterpart.
Inhibition of cGMP accumulation by melatonin could only be observed when the PDE inhibitor IBMX was included in the incubation medium. IBMX significantly increased basal cGMP levels revealing the existence of a strong basal PDE activity, which maintains low cGMP concentrations under basal conditions. This might explain why melatonin does not inhibit basal cGMP accumulation in the absence of IBMX. Guanylyl cyclases are subdivided into two major families: soluble guanylyl cyclases, which are stimulated by NO, and membrane-bound guanylyl cyclases, which are stimulated by extracellular peptide ligands (31). Soluble guanylyl cyclase seems to be responsible for the cGMP accumulation under basal conditions in the presence of IBMX in HEK 293 cells because this effect was completely inhibited by the soluble guanylyl cyclase-specific inhibitor ODQ (16, 17). Although agonist stimulation of melatonin receptors inhibits this effect, nitroprusside-stimulated guanylyl cyclase was not directly inhibited by melatonin, suggesting that melatonin receptors interfere upstream of guanylyl cyclase within the cGMP-signaling pathway. The effect of receptor activation on cGMP concentration was abolished by pertussis toxin, indicating that Gi/o proteins are involved in the transduction of this signal.
Our data show that cloned high-affinity melatonin receptors may
modulate cGMP at physiological concentrations of melatonin. Other
receptors of the same family can also control intracellular cGMP
levels. The retinal rhodopsin receptor, for example, activates
transducin, an heterotrimeric G protein, which, in turn, activates a
cGMP-dependent PDE. Transducin binds to inhibitory PDE
subunits,
causing the activation of
- and ß-catalytic subunits that promote
cGMP degradation (32). Melatonin receptors are likely to activate a
different cascade of signaling events because the melatonin signal does
not activate a PDE (inhibition of cGMP accumulation is observed in the
presence of IBMX). Maura et al. (33, 34) have shown that
5-HT1D and 5HT1A serotonin receptors inhibit
elevation of glutamate receptor-stimulated cGMP in rat brain
cerebellum. Interestingly, inhibition of the cGMP pathway was localized
upstream of guanylyl cyclase.
Potential candidates involved in the melatonin receptor-signaling pathway via cGMP are proteins further upstream of guanylyl cyclase such as NO synthase or NO synthase-activators including calmodulin or divalent Ca2+ ions. Other members of the Gi/o-coupled receptor subfamily such as somatostatin receptors and the M4 muscarinic receptors have been shown to decrease intracellular Ca2+ levels by inhibiting L-type calcium channels in rat pituitary GH3 cells (35). Whether this is also the case for melatonin receptors requires further investigation.
All melatonin receptors cloned so far display high sequence homology and share the capability of inhibiting adenylyl cyclase activity. Therefore, it is tempting to speculate that cGMP modulation is not restricted to Mel1c subtypes and to Xenopus skin but may have a more general role in melatonin signaling. As a consequence, a new set of downstream effectors, such as cGMP-gated ion channels or cGMP-dependent protein kinases (36), might be modulated by melatonin.
| MATERIALS AND METHODS |
|---|
|
|
|---|
antibodies (Ab84) were a generous gift
from Dr. Freissmuth (University of Vienna, Austria).
Cloning of Melatonin Receptor cDNAs
Total RNA from X. laevis skin samples was treated for
20 min at 37 C with 0.3 U of RNase-free DNase I (RQ1 DNase, Promega,
Madison, WI) per mg nucleic acid. Complementary DNA synthesis was
achieved by incubating 200 ng RNA (heated at 65 C for 5 min before the
reaction) with 100 U of Moloney murine leukemia virus reverse
transcriptase and random primer pd(N)6 for 30 min at 37 C.
After inactivation at 95 C (5 min), cDNA was amplified using
appropriate oligonucleotide primers, Pwo DNA polymerase, and PCR buffer
provided by the manufacturer in the presence of 2 mM
MgSO4. DNA was denatured for 2 min at 94 C and then
submitted to 40 cycles of temperature (94 C, 15 sec; 30 sec at the
optimal primers temperature; 72 C, 90 sec) followed by 3 min of final
extension at 72 C in a GeneAmp PCR System 9600 thermal cycler
(Perkin-Elmer Cetus, Norwalk, CT). The following oligonucleotide
primers were used for the amplification of various fragments of the
X. laevis melatonin receptor cDNA: fragment 1,
primer 3S: 5'AGAAATGATGGAGGTGAATAGCA3' and primer 3AS:
5'CGGCAATAGACAAACTGACAACA3' (annealing temperature 54 C);
fragment 2, primer 5S: 5'TATTGGTCATTTTGTCTGTC and primer
5AS: 5'CCAGGT GCTTCTTTGATTAT3' (annealing temperature 50 C);
fragment 3, primer 6S: 5'CTTC AACATAACAGCCATAGC3' and primer
6AS: 5'TGCTTGATTGTTGTTGGTTAC3', (annealing temperature 50 C). The
fragment 4, containing the unknown 3'-untranslated region,
was amplified using the 3'-AmpliFINDER RACE kit (CLONTECH, Palo Alto,
CA) and the following oligonucleotide primer 11S:
5'TATGGTGTGCTAAATCAAAACTTCCGCAAGG AGTA3' and primer 11AS:
5'TACTGATGTCCTTATTGACTCCAAGACTGTTGTTT3' (annealing temperature 58 C).
Finally, the entire melatonin receptor cDNA could be amplified with
primer 3S: 5'AGAAATGATGGAGGTGAATAGCA3' and primer 12AS: 5'TTAG
AATGAATGGACAGAA3' (annealing temperature 52 C).
Melatonin receptor cDNAs were cloned in the expression vector pcDNA3/RSV derived from pcDNA3 (Invitrogen, San Diego, CA). The restriction fragment BglII-HindIII of the pcDNA3, containing the cytomegalovirus promoter, was replaced by the corresponding fragment of the pRC/RSV vector (Invitrogen), containing the RSV promoter. Several clones of each receptor were isolated and sequenced by dideoxy sequencing.
Expression of Melatonin Receptor cDNAs
Murine Ltk- cells were transfected with melatonin
receptor cDNAs as described previously (37). Human HeLa cells and human
embryonic kidney cells (HEK) 293 were transfected by a
liposome-mediated transfection method using the transfection reagent
DOTAP according to supplier instructions. Neomycin-resistant cells were
selected in DMEM supplemented with 10% (vol/vol) FBS, 4.5 g/liter
glucose, 100 U/ml penicillin, 100 mg/ml streptomycin, 1 mM
glutamine, and 400 µg/ml G418. Individual clones were screened for
melatonin binding, using 2-[125I]iodomelatonin as
ligand.
For transient expression, Ltk- cells were plated on either six-well dishes for cAMP assays (0.5 x 106cells per well) or 10-cm diameter dishes for cGMP assays (2 x 106cells per dish) and transfected with the diethylaminoethyl-dextran method (38) the next day. Briefly, after a washing with PBS, serum-free DMEM, containing 50 mM HEPES, 200 µg/ml diethylaminoethyl-dextran, and 1 µg/ml plasmid DNA, was added. After incubation at 37 C for 8 h, the medium was replaced by 10% dimethylsulfoxide in serum-free DMEM for 1.5 min. Cells were washed with PBS and then incubated in DMEM containing 10% FCS. Assays were performed 3 days after transfection. Transfection efficiency was around 50% as determined by transfection of ß-galactosidase cDNA in parallel.
Southern Blot Analysis
Southern blot analysis was performed as described by Jenkins
et al. (39) with the following modifications: digested DNA
was electrophoresed through 1% agarose gel, Tris-acetate- EDTA 1x,
denatured and transferred to Hybond N membranes (Amersham, Arlington
Heights, IL) and baked 2 h at 80 C. After a final washing step in
0.1 x NaCl-sodium citrate, 0.01 x SDS for 15 min at 65 C,
the membrane was exposed to x-ray film.
Radioligand-Binding Assay
Subconfluent cell monolayers were washed with PBS, incubated for
5 min at 37 C with 2% trypsin-2 mM EDTA, and resuspended
in DMEM supplemented with 10% (vol/vol) FBS. After a centrifugation at
450 x g for 5 min at 4 C, cell pellets were
resuspended in PBS, pH 7.4. Cell suspensions were incubated with 400
pM 2-[125I]iodomelatonin (for binding assays
on melatonin receptors) or 200 pM [125I]CYP
(for binding assays on ß2AR) in the absence or presence of 10
µM cold ligands (melatonin or
D/L-propranolol, respectively). Binding assays
were conducted for 60 min at 25 C in a final reaction volume of 0.25
ml. Reactions were stopped by a rapid filtration through Whatman GF/C
glass fiber filters, previously soaked for 30 min in PBS-0.3%
polyethyleneimine (to reduce nonspecific binding). Protein
concentrations were measured on cell homogenates by the method of
Bradford (40) using the Bio-Rad (Bio-Rad Laboratories, Richmond, CA)
protein assay system. BSA was used as a standard.
Determination of Intracellular cAMP Levels
Cells grown in six-well dishes were washed twice in serum-free
DMEM, preincubated for 15 min at 37 C, and then incubated for 15 min at
37 C in DMEM containing 1 mM IBMX, with or without 10
µM isoproterenol (assays on transiently transfected
cells) or 10 µM forskolin (assays on stable cell clones),
and increasing concentrations of melatonin. The incubation buffer was
discarded and cells lysed in 1 M NaOH for 20 min at 37 C.
After the neutralization of pH with 1 M acetic acid, cell
lysates were centrifuged in a microcentrifuge at 17000 x
g for 5 min. Supernatants were assayed for cAMP using a
[3H]cAMP assay system (Amersham). Alternatively, cAMP
assays were performed in 24-well plates (0.5 x 106
cells in 300 µl). Cells were incubated for 15 min and the reaction
terminated by the addition of 100 µl 20% trichloracetic acid and
supernatants assayed for cAMP using [125I]cAMP tyrosyl
methyl ester RIA.
Determination of Intracellular cGMP Levels
Cells grown in 10-cm diameter dishes were incubated at 37 C for
15 min in serum-free DMEM, in the presence or absence of 1
mM IBMX and increasing concentrations of melatonin. Medium
was then replaced by 1 ml of ice-cold 65% ethanol, and cell extracts
were centrifuged at 2000 x g for 15 min at 4 C.
Supernatants were dried in a speed-vac; pellets were resuspended in 250
µl assay buffer, acetylated, and assayed for cGMP, following the
instructions of the manufacturer of the enzyme immunoassay kit
(Amersham).
Immunoblots of Gi Protein
Subunits
Cells were solubilized in Laemmli sample buffer containing 2%
SDS and 40 mM dithiothreitol and sonicated at 4 C. After
centrifugation in a microcentrifuge at 17,000 x g, 50
µl of supernatant were resolved on a 12% SDS/polyacrylamide gel.
Immunoblot analysis was carried out as described (13) with the 84
antiserum that labels all three subtypes of Gi
(data not
shown).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by grants from CNRS, the Université de Paris, and Institut de Recherches Internationales Servier. R.J. holds a fellowship from the Société de Secours des Amis des Sciences.
Received for publication December 3, 1996. Accepted for publication April 22, 1997.
| REFERENCES |
|---|
|
|
|---|
]quinoxalin-1-one.
Mol Pharmacol 48:184188[Abstract]
This article has been cited by other articles:
![]() |
V. S. Chowdhury, K. Yamamoto, I. Saeki, I. Hasunuma, T. Shimura, and K. Tsutsui Melatonin Stimulates the Release of Growth Hormone and Prolactin by a Possible Induction of the Expression of Frog Growth Hormone-Releasing Peptide and Its Related Peptide-2 in the Amphibian Hypothalamus Endocrinology, March 1, 2008; 149(3): 962 - 970. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lanoix, R. Ouellette, and C. Vaillancourt Expression of melatoninergic receptors in human placental choriocarcinoma cell lines Hum. Reprod., August 1, 2006; 21(8): 1981 - 1989. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zubare-Samuelov, I. Peri, M. Tal, M. Tarshish, A. I. Spielman, and M. Naim Some sweet and bitter tastants stimulate inhibitory pathway of adenylyl cyclase via melatonin and {alpha}2-adrenergic receptors in Xenopus laevis melanophores Am J Physiol Cell Physiol, November 1, 2003; 285(5): C1255 - C1262. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. Kudlacek, J. L. Pluznick, R. Ma, B. Padanilam, and S. C. Sansom Role of h{beta}1 in activation of human mesangial BK channels by cGMP kinase Am J Physiol Renal Physiol, August 1, 2003; 285(2): F289 - F294. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Yang, E. Scalbert, P. Delagrange, P. M. Vanhoutte, and S. T. O'Rourke Melatonin potentiates contractile responses to serotonin in isolated porcine coronary arteries Am J Physiol Heart Circ Physiol, January 1, 2001; 280(1): H76 - H82. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Brydon, F. Roka, L. Petit, P. de Coppet, M. Tissot, P. Barrett, P. J. Morgan, C. Nanoff, A. D. Strosberg, and R. Jockers Dual Signaling of Human Mel1a Melatonin Receptors via Gi2, Gi3, and Gq/11 Proteins Mol. Endocrinol., December 1, 1999; 13(12): 2025 - 2038. [Abstract] [Full Text] |
||||
![]() |
M. Fukao, H. S. Mason, F. C. Britton, J. L. Kenyon, B. Horowitz, and K. D. Keef Cyclic GMP-dependent Protein Kinase Activates Cloned BKCa Channels Expressed in Mammalian Cells by Direct Phosphorylation at Serine 1072 J. Biol. Chem., April 16, 1999; 274(16): 10927 - 10935. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |