help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jockers, R.
Right arrow Articles by Strosberg, A. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jockers, R.
Right arrow Articles by Strosberg, A. D.
Molecular Endocrinology 11 (8): 1070-1081
Copyright © 1997 by The Endocrine Society

Novel Isoforms of Mel1c Melatonin Receptors Modulating Intracellular Cyclic Guanosine 3',5'-Monophosphate Levels

Ralf Jockers, Laurence Petit, Isabelle Lacroix, Pierre de Coppet, Perry Barrett, Peter J. Morgan, Beatrice Guardiola, Philippe Delagrange, Stefano Marullo and A. Donny Strosberg

CNRS-UPR 0415 and Université Paris VII (R.J., L.P., I.L., P.C., S.M., A.D.S.) Institut Cochin de Génétique Moléculaire F-75014 Paris, France
Molecular Neuroendocrinology Group (P.B., P.J.M.) Rowett Research Institute Aberdeen, AB2 9SB UK
Institut de Recherches Internationales Servier (B.G., P.D), F-92415 Courbevoie Cedex, France


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Two cDNAs encoding novel isoforms of Xenopus laevis melatonin receptors were cloned using PCR primers specific for the X. laevis-melanophore Mel1c melatonin receptor described in a recent publication. The novel isoforms were highly homologous to the described frog Mel1c cDNA, although the C-terminal tail of both was shorter by 65 amino acid residues. Nucleotide sequences of these novel isoforms, called Mel1c({alpha}) and Mel1c(ß), differed from each other by only 35 nucleotides and six amino acid residues. Studies on several animals of various Xenopus species indicate that Mel1c({alpha}) and Mel1c(ß) receptors may correspond to allelic variants of the same locus.

Studies on cells transfected with both receptor cDNAs showed the expression of high-affinity 2-[125I]iodomelatonin binding sites. Agonist stimulation of Mel1c({alpha}) receptor was associated with the inhibition of cAMP accumulation stimulated by forskolin (IC50 {approx} 10-10 M) in HeLa, Ltk-, and human embryonic kidney 293 (HEK 293) cells. Mel1c(ß) receptor modulated cAMP in HeLa and HEK 293 cells but not in Ltk- cells. Both receptors inhibited, in a dose-dependent manner, cGMP accumulation in all three cell lines incubated with a phosphodiesterase inhibitor. This effect was localized upstream of soluble guanylyl cyclase and was blocked by pertussis toxin treatment. However, IC50 values ({approx}10-10 M for Mel1c(ß) and 10-9 to 10-7 M for Mel1c({alpha})) and maximal inhibition levels showed that Mel1c({alpha}) receptors are much less efficiently coupled to the cGMP pathway.

Coupling differences may be explained by the fact that five of the six amino acid substitutions between Mel1c({alpha}) and Mel1c(ß) receptors are located within cytoplasmic regions potentially involved in signal transduction. The existence of coupling differences is in agreement with the observation that expression of both receptors is evolutionally conserved in native tissue. In conclusion, two novel, potentially allelic, isoforms of Xenopus Mel1c melatonin receptors display identical ligand-binding characteristics, but different potencies in modulating cAMP and cGMP levels through Gi/Go-dependent pathways. Furthermore, to our knowledge, this study provides the first data on the modulation of intracellular cGMP levels by cloned melatonin receptors.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Melatonin is involved in a variety of physiological processes including biological rhythms, seasonal breeding, pigment condensation, and neuroendocrine function (1, 2). This hormone exerts its functions through specific receptors (3) whose corresponding cDNA sequences have been isolated recently in various animal species and humans (4, 5, 6). The amino acid sequence of these receptors indicates that they belong to the seven-transmembrane domain receptor family. All cloned melatonin receptors have been reported to be coupled to pertussis toxin-sensitive proteins and to inhibit adenylyl cyclase, suggesting the involvement of Gi proteins. Recently, stimulation of cAMP accumulation of type II adenylyl cyclase through Gi and Gz proteins has been shown for the melatonin receptor from Xenopus dermal melanophores in transient expression experiments (7). Previous studies have suggested that second messengers, other than cAMP, might be modulated by melatonin, but a clear picture of the spectrum of biochemical signals elicited by melatonin is still lacking (2, 3). In addition, no data on multiple signaling pathways are available so far from experiments reported with cloned melatonin receptors.

The first melatonin receptor cDNA cloned from Xenopus dermal melanophores was reported to contain a C-terminal tail that was 65 residues longer than that of all other cDNAs of melatonin receptors subsequently characterized in mammals and birds. Thus, this study was conducted to isolate a potential shorter melatonin receptor cDNA form from Xenopus that might be equivalent to that found in other species.

Messenger RNA encoding such a short receptor is indeed present in Xenopus skin. In addition, we identified a second highly homologous coding region, which is likely to correspond to an allelic isoform of the short melatonin receptor.

The two putative alleles, which differ by 35 nucleotides and six amino acid residues, modulated intracellular cAMP and cGMP in a dose-dependent manner but with different efficiencies. One of the two alleles was not capable of promoting the inhibition of adenylyl cyclase in one of three cell lines transfected with the corresponding cDNA. The second allele displayed a weaker coupling with the cGMP pathway in all cell lines.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cloning of Melatonin Receptor cDNAs
Several pairs of PCR-primers were selected based on the sequence of a melatonin receptor cDNA isolated from immortalized melanophores of X. laevis (4). These primers were used in RT-PCR reactions to amplify overlapping cDNA fragments from X. laevis skin mRNA (Fig. 1Go). Three amplified fragments that spanned the coding region from the N terminus to Ala349 were obtained (Fig. 1Go, fragments 1–3). However, all attempts failed to amplify the last portion of the coding region and the downstream 3'-untranslated region. This missing 3'-region could be amplified only with a poly T-containing oligonucleotide as lower primer. Two different 3'-fragments of {approx}400 bp (short) and of {approx}600 bp (long) were obtained with this approach (see Fig. 1Go, fragment 4). The nucleotide sequences of both fragments were identical until just before the poly A tail of the short fragment. Whereas the short fragment continued with its poly A tail, the long fragment continued with an additional 162 nucleotides before its own poly A tail (Fig. 2BGo). Amplification products derived from different independent PCRs were cloned and characterized by enzymatic digestion and dideoxy sequencing (four to six individual clones for each fragment).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. RT-PCR Cloning Strategy of Melatonin Receptor cDNAs

Location of sense (S) (->) and antisense (AS) (<-) primers specific for the melatonin receptor cDNA sequence previously identified from Xenopus dermal melanophores (4 ) and primers that do not correspond to this sequence (<-) are shown. PCR amplification products used to reconstitute the entire Mel1c({alpha}) and Mel1c(ß) cDNAs are numbered 1 to 5. TM indicates sequences encoding putative transmembrane regions.

 


View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. Comparison of Mel1c({alpha}) and Mel1c(ß) Melatonin Receptor Sequences

The sequence of the Mel1c({alpha}) melatonin receptor ({circ}) is shown and amino acid substitutions characterizing Mel1c(ß) receptor (•) are indicated in panel A. DNA sequences of long and short 3'-untranslated region (utr) are shown in panel B. Mel1c({alpha}) receptors are preferentially associated with the short 3'-untranslated region (3:1, short-long) and Mel1c(ß) to the long 3'-untranslated region (1:3). Identical parts of the long and short 3'-untranslated regions are dotted; polyA tails are boxed; EcoRI cloning sites are underlined. Genbank accession numbers are: U67879 (Mel1c({alpha}) short 3'utr); U67880 (Mel1c({alpha}) long 3'utr); U67881 (Mel1c(ß) short 3'utr) and U67882 (Mel1c(ß) long 3'utr).

 
All clones of fragment 1 were 100% homologous to the known Xenopus Mel1c sequence. Among clones of fragments 2 and 3, some were identical to the published sequence while others showed changes in the nucleic acid sequence. In the variant of fragment 2, two silent nucleotide substitutions were found, whereas variants of fragment 3 contained 26 silent nucleotide substitutions and six substitutions causing a change of the corresponding amino acid residue (Fig. 2Go). Both long and short forms of fragments 4 were highly homologous to the sequence of Xenopus melatonin Mel1c receptor up to Met-353 (identical or with a single silent substitution). However, in the six independent clones we analyzed, the two amino acid substitutions after the Met-353 (Leu-354 -> Tyr and Gly-355 -> Val) preceded a stop codon that shortened the C-terminal tail by 65 amino acid residues (Fig. 2AGo). Short and long 3'-noncoding regions were identical up to the polyadenylation signal of the shorter form (Fig. 2BGo).

Finally, the entire melatonin receptor cDNA could be amplified from Xenopus skin cDNA in a single PCR reaction using the N-terminal upper primer 3S and the lower primer 12AS located in the newly identified 3'-noncoding region (see Fig. 1Go). Restriction analysis of several independent clones confirmed that the two different melatonin receptor mRNAs were indeed present in our samples and that the substitutions found in fragments 2–4 belonged to a single mRNA species. Both mRNAs encoded proteins of 354 amino acids, which were most similar to the chicken Mel1c receptor among cloned melatonin receptors (78% homology). Therefore, the receptor form without any substitution other than the shortened C terminus was called Mel1c({alpha}), whereas the form with multiple substitutions was called Mel1c(ß).

Characterization of the Mel1c-Locus in Various Xenopus Species
Highly homologous Mel1c({alpha}) and Mel1c(ß) receptors could represent either two alleles at the same genomic locus or two isoforms encoded by different genes. To address this question, fragment 3 of Mel1c receptors was amplified by PCR from genomic DNA in 43 X. laevis individuals. Several of these animals were inbred, while others were wild animals directly imported from South Africa. Amplified DNA fragments of the expected size were digested with appropriate restriction enzymes specific for either Mel1c({alpha}) and Mel1c(ß) cDNAs (Fig. 3Go). In one X. laevis (ff) individual, homozygous for the major histocompatibility complex and other genetic markers (8), only the Mel1c({alpha}) receptor gene was found. PCR analysis of a second X. laevis (rf) frog, known to be heterozygous for the genetic markers mentioned above, revealed the presence of both Mel1c({alpha}) and Mel1c(ß) receptor genes (Fig. 3Go). This observation supports the hypothesis that the two melatonin receptor isoforms are encoded by the same genomic locus. Analysis of the other 41 animals showed the presence of either both receptor genes (40 individuals) or Mel1c({alpha}) gene alone (one individual). No individual was found to exhibit only the Mel1c(ß) receptor gene. Two other Xenopus species were studied using the same approach. Analysis of genomic DNA from Xenopus ruwenzoriensis, a species known to be polyploid (9), revealed the presence of the Mel1c({alpha}) receptor gene. Two additional melatonin receptor genes clearly different from Mel1c({alpha}) and Mel1c(ß) were revealed by the comparison of enzymatic digestion patterns in Xenopus tropicalis and X. ruwenzoriensis (Fig. 3Go).



View larger version (82K):
[in this window]
[in a new window]
 
Figure 3. Characterization of the Mel1c({alpha})/(ß) DNAs from Various Xenopus Individuals

The PCR amplification used in this study corresponds to fragment 3 of Fig. 1Go. Restriction enzymes used for digesting PCR products are: AflII (one site in both Mel1c({alpha}) and Mel1c(ß) receptors), Bsp120 I (one site in Mel1c({alpha}), absent in Mel1c(ß) receptors), PmlI (one site in Mel1c(ß), absent in Mel1c({alpha}) receptors). Restriction analysis of PCR products from representative cDNAs: 1, X. tropicalis; 2, X. ruwenzoirensis; 3, homozygous X. laevis (ff) individual; 4, cloned Mel1c({alpha}) cDNA; 5, cloned Mel1c(ß) cDNA; 6, X. laevis cDNA amplified from a pool of skin mRNA; 7, heterozygous X. laevis (rf) individual; ND, undigested PCR product.

 
Southern blotting has been used to further characterize the genomic localization of Mel1c receptor genes. Genomic DNA of the X. laevis (ff) individual shown by PCR analysis to contain only Mel1c({alpha}) melatonin receptor-specific sequences (see above) and two individuals shown to contain both Mel1c({alpha}) and Mel1c(ß) melatonin receptor-specific sequences [X. laevis (rf) and another] were digested by EcoRI (no restriction site for this enzyme in Mel1c melatonin receptor isoforms). The digested DNA was separated by gel electrophoresis, transferred to nitrocellulose, and hybridized with a radioactively labeled probe corresponding to the majority of exon 2 of the Mel1c melatonin receptor from X. laevis (fragment 3 of Fig. 1Go). Four hybridization signals were detected in the X. laevis (ff) individual at 6.9 and 5.0, and 3.7 and 3.0 kb, respectively, under high-stringency washing conditions (0.1 x NaCl-sodium citrate, 0.01 x SDS at 65 C). In the X. laevis individuals shown to contain both Mel1c({alpha}) and Mel1c(ß) melatonin receptor-specific sequences the same hybridization pattern was observed under the same washing conditions. No additional hybridization signal was observed (procedure repeated twice with similar results; data not shown). Taken together, Southern blot and PCR analyses support the hypothesis that the two melatonin receptor isoforms (Mel1c({alpha}) and Mel1c(ß)) are encoded by the same genomic locus.

Pharmacological Characterization of Mel1c({alpha}) and Mel1c(ß) Receptors
Mel1c({alpha}) and Mel1c(ß) receptor cDNAs were expressed in murine Ltk- cells as stable clones, under the control of the Rous sarcoma virus (RSV) promoter. Among various clones expressing 2-[125I]iodomelatonin binding sites, one Mel1c({alpha}) clone, expressing 200 fmol receptors per mg of total protein, and one Mel1c(ß) clone, expressing 150 fmol receptors per mg of total protein, were characterized further. KD-values for the radiolabeled agonist 2-[125I]iodomelatonin were 160 ± 32 and 143 ± 25 pM, respectively (Fig. 4AGo), values that are in good agreement with those determined for other high-affinity melatonin receptors, including that cloned previously from X. laevis melanophores (4, 10). Competition experiments showed that the rank order of affinity for several ligands was characteristic of melatonin receptors (Fig. 4BGo and Table 1Go) (10). No significant differences were found between Mel1c({alpha}) and Mel1c(ß) receptors in binding experiments.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 4. Pharmacological Specificity of 2-[125I]Iodomelatonin Binding in Stable Ltk-Cell Clones Expressing Mel1c({alpha}) or Mel1c(ß) Melatonin Receptors

Panel A, Saturation isotherm of 2-[125I]iodomelatonin binding; nonspecific binding was measured in the presence of 10 µM melatonin. Inset, Scatchard representation of data. Panel B, Competition binding of 2-[125I]iodomelatonin (400 pM) on membranes from Ltk- cells, expressing either Mel1c({alpha}), or Mel1c(ß) melatonin receptor, with I-melatonin ({triangleup}), melatonin ({square}), N-acetyl-5-hydroxytryptamine ({circ}), 6-OH-melatonin (•), S22153 ({blacktriangleup}), and S20098 ({blacksquare}). Data represent the mean values of duplicates of a single experiment representative of at least three independent experiments. Data were fitted using the Graph Pad In Plot program Version 4.04 (TC Graphpad Software Inc., San Diego, CA).

 

View this table:
[in this window]
[in a new window]
 
Table 1. Competition Binding Assays with 2-[125I]Iodomelatonin on Ltk- Cell Membranes Expressing Mel1c({alpha}) and MEl1c(ß) Receptors

 
Modulation of cAMP Accumulation
High-affinity melatonin receptors are known to mediate the inhibition of adenylyl cyclase activity (4, 11). As expected, in Ltk- cells expressing the Mel1c({alpha}) receptor, melatonin promoted the inhibition of forskolin-stimulated cAMP accumulation (Fig. 5Go). The IC50 value of this effect was approximately 6 x 10-10 M, in good agreement with values reported for high-affinity melatonin receptors (3, 4). Surprisingly, in cells expressing the Mel1c(ß) receptor, such an effect was not observed even at concentrations of melatonin up to 0.1 mM. Similar observations were made on two additional Ltk- clones. Basal levels of cAMP were not affected by melatonin in either cell line even in the presence of 3-isobutyl-1-methylxanthine (IBMX). Inhibition of cAMP accumulation by melatonin receptors is mediated by {alpha}-subunits of Gi proteins (12). To eliminate the possibility that the impaired signaling of Mel1c(ß) receptor was due to quantitative changes of Gi{alpha} subunits, control Ltk- cells and clones expressing either Mel1c({alpha}) or Mel1c(ß) receptors were compared for their Gi{alpha} subunit content. Western blot analysis with a specific antibody recognizing all three subtypes of Gi{alpha} (13) could not detect major quantitative differences (data not shown).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Modulation of Forskolin-Stimulated cAMP Accumulation by Mel1c({alpha}) and Mel1c(ß) Receptors in Ltk- Cells

Stable clones of Ltk- cells transfected with either Mel1c({alpha}) (•) or Mel1c(ß) ({circ}) melatonin receptor cDNA were stimulated with forskolin (10 µM) in the presence of the indicated concentrations of melatonin; intracellular cAMP levels were determined as described in Materials and Methods. The 100% value ({square}) corresponds to the mean cAMP value in the presence of 10 µM forskolin; ({blacksquare}) indicate the cAMP value in the presence of melatonin (10 µM) alone. Data represent the means ± SE of four independent experiments performed in duplicate (*, P < 0.05).

 
Signal transduction was also studied after transient transfection of both Mel1c cDNA isoforms in Ltk- cells to exclude a potential artifact associated with clonal selection. Ltk- cells were cotransfected with human ß2-adrenergic receptor (ß2AR) cDNA and either Mel1c({alpha}) or Mel1c(ß) receptor cDNA; the coexpression of different receptors allows selective study of the subpopulation of cells that has internalized the exogenous DNA (14). Three days after transfection, cells were studied for the melatonin-dependent inhibition of cAMP accumulation in response to the ß2AR agonist isoproterenol and for the number of ß-adrenergic and melatonin binding sites (Fig. 6Go). No binding sites for either receptor could be measured in wild type control cells. In cells transfected with the ß2AR cDNA alone, isoproterenol incubation resulted in a 5-fold increase of cAMP. In cells cotransfected with identical amounts (1 µg plasmid DNA) of Mel1c({alpha}) and ß2AR receptor cDNAs, simultaneous incubation with isoproterenol and melatonin resulted in a significantly reduced accumulation of cAMP (65 ± 5% of control, P < 0.05) (Fig. 6Go). Under the same conditions, Mel1c(ß) receptors were not able to inhibit isoproterenol-induced cAMP accumulation, despite the expression of an equivalent number of receptor-binding sites. Similar results were obtained when Mel1c(ß) receptor cDNA was in 10-fold excess over ß2AR receptor cDNA (data not shown).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 6. Modulation of Isoproterenol-Induced cAMP Accumulation by Melatonin Receptors in Transient-Transfection Experiments

Mel1c({alpha}) or Mel1c(ß) melatonin receptor cDNA was coexpressed with a equal amount (1 µg) of human ß2-adrenergic receptor (ß2AR) cDNA (in pcDNA3-CMV vector (Invitrogen)) in Ltk- cells and stimulated with isoproterenol (ISO, 10 µM) in the presence or absence of melatonin (Mel, 10 µM): intracellular cAMP levels were measured as described in Materials and Methods. NT, Nontransfected. Data are means ± SE of seven independent experiments performed in duplicate. The number of [125I]CYP and 2-[125I]iodomelatonin binding sites (expressed as femtomoles per mg protein) in each batch of transfected cells were respectively: NT (24/0); Mel1c({alpha}) (5/77); Mel1c(ß) (13/148); ß2AR (622/0), ß2AR/Mel1c({alpha}) (386/54), ß2AR/Mel1c(ß) (416/151). (*, P < 0.05).

 
Modulation of cAMP accumulation was further examined in two other cell lines, human embryonic kidney 293 (HEK 293) cells and HeLa cells stably transfected with Mel1c({alpha}) or Mel1c(ß) cDNA. Clones expressing between 100 and 800 fmol receptor/mg protein were selected for these studies. Interestingly, both receptor isoforms promoted the inhibition of forskolin-stimulated cAMP accumulation in both cell lines (Fig. 7Go). The IC50 value was approximately 10-10 M, which is in good agreement with values obtained in Ltk- cells. No significant difference in IC50 values for Mel1c({alpha}) and Mel1c(ß) receptors was observed. Equivalent results were obtained on two further HEK 293 and HeLa clones expressing Mel1c(ß) receptors (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 7. Modulation of Forskolin-Stimulated cAMP Accumulation by Mel1c({alpha}) and Mel1c(ß) Receptors in HeLa and HEK 293 Cells

Stable clones of HeLa and HEK 293 cells transfected with either Mel1c({alpha}) ({circ}) or Mel1c(ß) (•) melatonin receptor cDNA were stimulated with forskolin (10 µM) in the presence of the indicated concentrations of melatonin; intracellular cAMP levels were determined as described in Materials and Methods. Data represent the means ± SE of three independent experiments performed in triplicate. Data are expressed as percent of mean forskolin-stimulated value (100%).

 
Modulation of cGMP Accumulation
Modulation of cGMP content has been proposed as an additional signaling pathway for melatonin receptor (15). Ltk- cells, HEK 293 cells, and HeLa cells expressing either Mel1c({alpha}) or Mel1c(ß) receptors were incubated with melatonin, and subsequent effects on intracellular cGMP were analyzed. Melatonin (up to 10 µM) had no effect on basal cGMP levels in either cell line. Intracellular cGMP content depends on the opposite activities of guanylyl cyclases, which synthesize cGMP, and of phosphodiesterases (PDE), which degrade cGMP. The PDE inhibitor IBMX was included in the assay to block cGMP degradation by PDE. Under these conditions the cGMP level increased approximately 3-, 2-, and 5-fold in unstimulated Ltk-, HeLa, and HEK 293 cells, respectively, indicating the presence of a basal PDE activity in these cell lines. Incubation with melatonin inhibited IBMX-promoted accumulation of cGMP, in a dose-dependent manner, in all three cell lines expressing either Mel1c({alpha}) or Mel1c(ß) receptors (Fig. 8Go). The IC50 values of this effect were approximately 10-10 M for Mel1c(ß) and 10-9 to 10-7 M for Mel1c({alpha}). The effect of Mel1c({alpha}) receptor activation on cGMP was very weak in Hela cells but was reproducibly observed in every experiment. In the two other cell lines expressing Mel1c({alpha}) receptors, IC50 values were shifted to the right, and maximal inhibition levels were smaller compared with the same cells expressing Mel1c(ß) receptors. When IBMX-promoted accumulation of cGMP was modest, inhibition of cGMP accumulation was not significant, revealing the limitations of this assay. Melatonin stimulation of mock-transfected cells did not affect the cGMP increase promoted by IBMX.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 8. Modulation of cGMP Accumulation by Melatonin Receptors

Stable clones of Ltk-, HEK 293, and HeLa cells transfected with Mel1c({alpha}) ({circ}) or Mel1c(ß) (•) melatonin receptor cDNA were incubated with the indicated concentrations of melatonin in the presence of 1 mM IBMX. Intracellular cGMP levels were determined as described in Materials and Methods. Data are presented as % of IBMX-stimulated basal level (IBMX-stimulation was 3-, 2-, and 5-fold in Ltk-, HeLa, and HEK 293 cells, respectively; basal cGMP levels in the absence of IBMX were 10–30 pmol/106 cells). Data are the mean of triplicates ± SE in one experiment representative of three independent experiments. Data were fitted using the Graph Pad In Plot program Version 4.04. The number of 2-[125I]iodomelatonin binding sites in each clone (expressed as femtomoles per mg protein) were respectively: Ltk--Mel1c({alpha}) (200); Ltk--Mel1c(ß) (150); HEK 293-Mel1c({alpha}) (880); HEK 293-Mel1c(ß) (800); HeLa-Mel1c({alpha}) (330); HeLa-Mel1c(ß) (160).

 
Guanylyl cyclases are subdivided into two major families, soluble guanylyl cyclases, which are stimulated by NO, and membrane-bound guanylyl cyclases, which are stimulated by extracellular peptide ligands such as atrial natriuretic peptide (ANP). IBMX-promoted cGMP accumulation could be attributed to a soluble guanylyl cyclase activity in HEK 293 cells because this effect was specifically inhibited by the soluble guanylyl cyclase inhibitor 1H-(1,2,4)oxadiazolo(4,3-{alpha})quinozalin-1-one (ODQ) (16, 17) (Fig. 9AGo). The existence of a soluble guanylyl cyclase activity was further confirmed by an significant increase in cGMP levels by the NO donor nitroprusside, which was completely blocked by ODQ. Neither basal nor ANP-stimulated membrane-bound guanylyl cyclase activity was detectable. Soluble guanylyl cyclase was directly activated by nitroprusside in the absence and presence of increasing melatonin concentrations (Fig. 9BGo). Although melatonin decreased nitroprusside-stimulated cGMP accumulation slightly, no dose-dependent inhibition was observed in the relevant concentration range between 10-12 and 10-5 M melatonin, suggesting no direct effect of melatonin receptor signaling on soluble guanylyl cyclase.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 9. Modulation of cGMP Accumulation by Melatonin Receptors

Panel A, Influence of ODQ on cGMP levels. HEK 293 cells stably transfected with Mel1c(ß) melatonin receptor cDNA were incubated for 15 min in DMEM at 37 C with either IBMX (1 mM), sodium nitroprusside (SNP) (300 µM), or ANP (500 nM) in the presence or absence of ODQ (1 µM), a specific inhibitor of soluble guanylyl cyclase. Cyclic GMP levels were measured as described in Materials and Methods. Data are means of duplicate ± SE of three independent experiments. Panel B, Modulation of SNP-stimulated cGMP accumulation by Mel1c receptors expressed in HEK 293 cells. HEK 293 cells transfected with Mel1c(ß) melatonin receptor cDNA were incubated for 15 min with SNP (300 µM) in the presence or absence of different melatonin concentrations. Cyclic GMP levels were measured as described in Materials and Methods. The 100% value corresponds to the cGMP value in the absence of melatonin. Data represent the mean of duplicate ± SE of three independent experiments. Panel C, Pertussis toxin blocks the ability of melatonin to inhibit IBMX-stimulated cGMP accumulation. Ltk- cells transiently transfected with Mel 1c({alpha}) or Mel1c(ß) melatonin receptor cDNA were preincubated with either vehicle alone or pertussis toxin (PTX: 100 ng/ml) for 18 h and then incubated in the presence of 10 µM melatonin. Cyclic GMP levels were measured as described in Materials and Methods. Data are the mean of duplicates in one experiment representative of three independent experiments.

 
Pertussis toxin, which catalyzes the inactivating ADP ribosylation of Gi/o{alpha} subunits of G proteins, has been shown to block the Gi-mediated inhibition of cAMP accumulation promoted by melatonin receptors (18, 19). Preincubation with pertussis toxin abolished the effect of melatonin on cGMP accumulation, suggesting that this signaling pathway is Gi/o mediated (Fig. 9CGo).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The cDNAs of two novel isoforms of X. laevis melatonin receptors, Mel1c({alpha}) and Mel1c(ß), were cloned from skin mRNA by RT-PCR. These receptors could be classified, based on their high homology with previously identified melatonin receptors in the Mel1c subfamily (5, 6). Both receptors displayed a predicted C terminus that was shorter by 65 amino acids than previously described for the X. laevis Mel1c receptor cloned from an immortalized dermal melanophore cell line (4). Additional nucleotide changes were found in the Mel1c(ß) receptor that did not correspond to any of the PCR amplification products from Xenopus recently reported by Reppert et al. (6). These differences are unlikely to be due to errors caused by the amplification procedure used here because several independent RT-PCR reactions, performed with a high-fidelity Pfu DNA polymerase, yielded the same results. Errors due to reverse transcription may also be excluded because the same nucleotide changes were found in PCR products amplified from genomic DNA of 41 frogs.

We believe that Mel1c({alpha}) and Mel1c(ß) receptors described here are likely to be the true Mel1c receptor subtypes expressed in X. laevis skin: 1) both receptors are identical in length to all other melatonin receptors reported so far (5, 6); 2) no amplification products could be obtained using several antisense PCR primers located in the 3'-coding region of the sequence published previously; 3) PCR reactions, targeted at the 3'-end of the coding region and at the next untranslated region using a nonspecific oligo dT primer, did not amplify other DNA fragments than those corresponding to Mel1c({alpha}) and Mel1c(ß) sequences; 4) finally, the complete cDNA of both Mel1c({alpha}) and Mel1c(ß) receptors and not that of the previously reported Mel1c could be amplified in a single reaction from Xenopus skin mRNA. Although we cannot rule out the possibility that the Xenopus Mel1c receptor reported by Ebisawa et al. (4) is melanophore-specific and the two isoforms presented here are specific for other skin cell types, our data support the hypothesis that the isoform reported by Ebisawa et al. represents an infrequent and/or low abundant form selected by the immortalization of Xenopus melanophore cells.

Both Mel1c({alpha}) and Mel1c(ß) receptor cDNAs are found in either long or short forms as a function of the size of the 3'-untranslated region. The Mel1c({alpha}) receptor cDNA was found mostly in the short form (3:1, short:long), the Mel1c(ß) receptor cDNA being more abundant in the longer form (1:3). The 3'-untranslated regions of several receptor cDNAs of the same family, such as the ß2-adrenergic (20) or the muscarinic receptor (21), have been found to contain molecular determinants involved in the regulation of mRNA stability. It is tempting to speculate that short and long mRNAs encoding Mel1c({alpha}) and Mel1c(ß) receptors undergo differential regulation. Because both receptor isoforms have similar affinities for melatonin but different signaling properties (see below), such a regulation might modulate the cellular response to melatonin stimulation.

X. laevis Mel1c({alpha}) and Mel1c(ß) melatonin receptors are more than 98% homologous at the protein level. This high homology suggests that these two isoforms are alleles rather than subtypes encoded by different genes. To address this question, the PCR amplification products from genomic DNAs of 43 animals (including 12 wild individuals) were analyzed using discriminating restriction enzymes. Forty-one DNAs contained the two forms of Mel1c genes, whereas in two individuals only the Mel1c({alpha}) DNA could be amplified. Interestingly, one of these two latter frogs was known to be homozygous for the histocompatibility locus and for other genetic markers. Southern blot analysis of genomic DNA of three individuals, two containing the two Mel1c-isoforms, according to PCR analysis, and one individual containing only the Mel1c({alpha}) DNA, revealed in each case the presence of four hybridization signals using a probe of exon II under high stringency conditions. Two factors might contribute to the detection of several hybridization signals: 1) Reppert et al. (6) have PCR-amplified three amplification products from Xenopus genomic DNA, whose sequence corresponds to three closely related members of the melatonin receptor family; 2) Xenopus is known to have duplicated its genome during evolution followed by partial genomic deletions, thereby generating several copies of the same locus embedded in different genomic contexts. Taken together, our findings obtained by Southern blot and PCR analysis of genomic DNA support the hypothesis that Mel1c({alpha}) and Mel1c(ß) melatonin receptors are encoded by allelic genes. The low number of Mel1c({alpha})/Mel1c({alpha}) homozygotes (two of 43) and the absence of Mel1c(ß)/Mel1c(ß) homozygotes (zero of 43) would suggest that each of the alleles confers some physiological advantage, lost in Mel1c homozygotes.

Comparison of the pharmacological profiles of the three receptor isoforms, Mel1c({alpha}) and Mel1c(ß) and the reported longer version, does not reveal any significant difference. This is not surprising since amino acid residues located in the putative transmembrane regions, and not in the intracellular domains, are predicted to be involved in ligand binding (22, 23).

The Mel1c({alpha}) receptor mediated inhibition of forskolin-stimulated cAMP accumulation in three different cell lines in a dose-dependent manner with an IC50 of approximately 10-10 M, a value in good agreement with those reported for all melatonin receptors cloned thus far (4, 5, 6). The additional 65 amino acid residues of the C-terminal tail present in the reported Mel1c receptor from dermal melanophores appear not to be involved in G protein coupling because Mel1c({alpha}) receptors inhibit forskolin-stimulated cAMP accumulation with the same efficiency as the longer version. This is in agreement with findings from other G protein-coupled receptors where the receptor C terminus is generally not involved in G protein binding (22).

In contrast, modulation of cAMP levels by melatonin binding to the Mel1c(ß) receptor appeared to be cell type-dependent. In HeLa and HEK 293 cells, inhibition of adenylyl cyclase activity was similar to that observed for Mel1c({alpha}) receptors, but in Ltk- cells no inhibition of cAMP accumulation could be shown. These results were obtained on at least two stable clones for each cell line and after transient transfection of Ltk- cells, arguing against a potential cloning artifact. Functional integrity of adenylyl cyclase in Ltk- cell clones expressing the Mel1c(ß) isoform was assessed based on the fact that forskolin stimulated a similar cAMP accumulation in Ltk- cells expressing either Mel1c({alpha}) or Mel1c(ß) receptors. Inhibition of adenylyl cyclase function is mostly mediated by activated Gi proteins. Western blot analysis showed the presence of similar amounts of Gi {alpha} subunits in both Mel1c({alpha})- and Mel1c(ß)-transfected Ltk- cells, and in control untransfected Ltk- cells, ruling out the potential selection of cell clones expressing lower amounts of Gi proteins.

In the family of serpentine, seven membrane-spanning domain receptors, intracellular regions are known to be involved in G protein coupling (22, 24, 25). Data from signaling experiments in Ltk- cells suggest that the five amino acid substitutions between Mel1c({alpha}) and Mel1c(ß) receptors, located in the intracellular domains, constitute the molecular basis of the difference in cAMP modulation in these cells.

However, the results of experiments conducted in HeLa and HEK 293 cells indicated that the five amino acid substitutions alone are not sufficient to result in signaling differences in any cellular context. Obviously, cell-specific factors are able to rescue the impaired Mel1c(ß) receptor signaling. Differences in receptor-G protein interaction are most likely to be responsible for signaling differences. It is now well established that coupling efficiency is governed by the affinity of the G protein for the receptor. Therefore, functional coupling depends on the absolute and relative amounts of G proteins present in the cell and may thus vary from one cell type to another.

The easiest way to explain our results is to assume that Mel1c receptors are coupled to more than one of the three existing Gi protein subtypes to inhibit cAMP accumulation. This assumption is supported by studies of other Gi-coupled receptors such as adenosine A1 and 5-hydroxytryptamine1A (5-HT1A) serotonin receptors, which couple to all three Gi subtypes although with different affinities (26, 27). Mel1c(ß) receptors may have lost or decreased affinity for at least one Gi subtype. In HEK293 and HeLa cells Mel1c receptors may be coupled functionally via several distinct Gi protein subtypes. Although Mel1c(ß) receptors have lost affinity for one Gi subtype, inhibition of cAMP accumulation is still ensured in these cell lines via the other Gi protein subtypes. The Gi protein composition of Ltk- cells may be more limited than that of HEK293 and HeLa cells. While Mel1c({alpha}) receptors still find a relevant Gi protein interaction partner, Mel1c(ß) may not find a Gi protein in this cellular system because of the loss of affinity for some Gi protein subtypes. Obviously, Ltk- cells provide a cellular context that reveals differences in signaling capacities of both receptors. These differences might explain why both receptors are expressed in vivo, in X. laevis skin.

The role of cGMP as a second messenger in melatonin receptor signaling is still in discussion. Pigment aggregation in Xenopus melanocytes has been reported to be regulated by melatonin (28) and by cAMP, whereas conflicting results exist on its regulation by cGMP (29, 30). The role of cGMP in melatonin signaling in other cellular systems has not been deeply investigated so far (2, 3). The notion of cGMP modulation by melatonin receptors also resulted from experiments on neonatal rat pituitary tissue, where an inhibitory effect of melatonin on cGMP production was observed (15). Here, we report that melatonin-activated Mel1c({alpha}) and Mel1c(ß) receptors indeed inhibit cGMP accumulation in a dose-dependent manner with IC50 values of approximately 10-10 M for Mel1c(ß) and 10-9 to 10-7 M for Mel1c({alpha}). In Ltk- and HEK293 cells, the IC50 values for Mel1c({alpha}) were higher and the maximal inhibitory effects were lower compared with those measured in cells expressing the Mel1c(ß) subtype, whereas in Hela cells, modulation of cGMP was at the limit of sensitivity of our assay. These data suggest that Mel1c({alpha}) receptors are less efficiently coupled to the cGMP pathway than their allelic counterpart.

Inhibition of cGMP accumulation by melatonin could only be observed when the PDE inhibitor IBMX was included in the incubation medium. IBMX significantly increased basal cGMP levels revealing the existence of a strong basal PDE activity, which maintains low cGMP concentrations under basal conditions. This might explain why melatonin does not inhibit basal cGMP accumulation in the absence of IBMX. Guanylyl cyclases are subdivided into two major families: soluble guanylyl cyclases, which are stimulated by NO, and membrane-bound guanylyl cyclases, which are stimulated by extracellular peptide ligands (31). Soluble guanylyl cyclase seems to be responsible for the cGMP accumulation under basal conditions in the presence of IBMX in HEK 293 cells because this effect was completely inhibited by the soluble guanylyl cyclase-specific inhibitor ODQ (16, 17). Although agonist stimulation of melatonin receptors inhibits this effect, nitroprusside-stimulated guanylyl cyclase was not directly inhibited by melatonin, suggesting that melatonin receptors interfere upstream of guanylyl cyclase within the cGMP-signaling pathway. The effect of receptor activation on cGMP concentration was abolished by pertussis toxin, indicating that Gi/o proteins are involved in the transduction of this signal.

Our data show that cloned high-affinity melatonin receptors may modulate cGMP at physiological concentrations of melatonin. Other receptors of the same family can also control intracellular cGMP levels. The retinal rhodopsin receptor, for example, activates transducin, an heterotrimeric G protein, which, in turn, activates a cGMP-dependent PDE. Transducin binds to inhibitory PDE{gamma} subunits, causing the activation of {alpha}- and ß-catalytic subunits that promote cGMP degradation (32). Melatonin receptors are likely to activate a different cascade of signaling events because the melatonin signal does not activate a PDE (inhibition of cGMP accumulation is observed in the presence of IBMX). Maura et al. (33, 34) have shown that 5-HT1D and 5HT1A serotonin receptors inhibit elevation of glutamate receptor-stimulated cGMP in rat brain cerebellum. Interestingly, inhibition of the cGMP pathway was localized upstream of guanylyl cyclase.

Potential candidates involved in the melatonin receptor-signaling pathway via cGMP are proteins further upstream of guanylyl cyclase such as NO synthase or NO synthase-activators including calmodulin or divalent Ca2+ ions. Other members of the Gi/o-coupled receptor subfamily such as somatostatin receptors and the M4 muscarinic receptors have been shown to decrease intracellular Ca2+ levels by inhibiting L-type calcium channels in rat pituitary GH3 cells (35). Whether this is also the case for melatonin receptors requires further investigation.

All melatonin receptors cloned so far display high sequence homology and share the capability of inhibiting adenylyl cyclase activity. Therefore, it is tempting to speculate that cGMP modulation is not restricted to Mel1c subtypes and to Xenopus skin but may have a more general role in melatonin signaling. As a consequence, a new set of downstream effectors, such as cGMP-gated ion channels or cGMP-dependent protein kinases (36), might be modulated by melatonin.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
N-Acetyl-5-hydroxytryptamine, iodomelatonin, melatonin, DL-propranolol, BSA, and forskolin were purchased from Sigma (St. Louis, MO). 2-[125I]iodomelatonin was from DuPont-New England Nuclear (Boston, MA) and [125I]iodocyanopindolol ([125I]CYP) was a generous gift from Dr. Helbo (Université de Liege, Belgium). S20098 and S22153 were provided by the Institut de Recherches Internationales Servier. DMEM, FBS, PBS, trypsin-EDTA, geneticin (G418), penicillin, and streptomycin were from Life Technologies (Gaithersburg, MD). DNA polymerase Pfu was from Stratagene (La Jolla, CA). DOTAP, random primer pd(N)6, and DNA polymerase Pwo were purchased from Boehringer Mannheim (Mannheim, Germany). Polyclonal anti Gi-{alpha} antibodies (Ab84) were a generous gift from Dr. Freissmuth (University of Vienna, Austria).

Cloning of Melatonin Receptor cDNAs
Total RNA from X. laevis skin samples was treated for 20 min at 37 C with 0.3 U of RNase-free DNase I (RQ1 DNase, Promega, Madison, WI) per mg nucleic acid. Complementary DNA synthesis was achieved by incubating 200 ng RNA (heated at 65 C for 5 min before the reaction) with 100 U of Moloney murine leukemia virus reverse transcriptase and random primer pd(N)6 for 30 min at 37 C. After inactivation at 95 C (5 min), cDNA was amplified using appropriate oligonucleotide primers, Pwo DNA polymerase, and PCR buffer provided by the manufacturer in the presence of 2 mM MgSO4. DNA was denatured for 2 min at 94 C and then submitted to 40 cycles of temperature (94 C, 15 sec; 30 sec at the optimal primer’s temperature; 72 C, 90 sec) followed by 3 min of final extension at 72 C in a GeneAmp PCR System 9600 thermal cycler (Perkin-Elmer Cetus, Norwalk, CT). The following oligonucleotide primers were used for the amplification of various fragments of the X. laevis melatonin receptor cDNA: fragment 1, primer 3S: 5'AGAAATGATGGAGGTGAATAGCA3' and primer 3AS: 5'CGGCAATAGACAAACTGACAACA3' (annealing temperature 54 C); fragment 2, primer 5S: 5'TATTGGTCATTTTGTCTGTC and primer 5AS: 5'CCAGGT GCTTCTTTGATTAT3' (annealing temperature 50 C); fragment 3, primer 6S: 5'CTTC AACATAACAGCCATAGC3' and primer 6AS: 5'TGCTTGATTGTTGTTGGTTAC3', (annealing temperature 50 C). The fragment 4, containing the unknown 3'-untranslated region, was amplified using the 3'-AmpliFINDER RACE kit (CLONTECH, Palo Alto, CA) and the following oligonucleotide primer 11S: 5'TATGGTGTGCTAAATCAAAACTTCCGCAAGG AGTA3' and primer 11AS: 5'TACTGATGTCCTTATTGACTCCAAGACTGTTGTTT3' (annealing temperature 58 C). Finally, the entire melatonin receptor cDNA could be amplified with primer 3S: 5'AGAAATGATGGAGGTGAATAGCA3' and primer 12AS: 5'TTAG AATGAATGGACAGAA3' (annealing temperature 52 C).

Melatonin receptor cDNAs were cloned in the expression vector pcDNA3/RSV derived from pcDNA3 (Invitrogen, San Diego, CA). The restriction fragment BglII-HindIII of the pcDNA3, containing the cytomegalovirus promoter, was replaced by the corresponding fragment of the pRC/RSV vector (Invitrogen), containing the RSV promoter. Several clones of each receptor were isolated and sequenced by dideoxy sequencing.

Expression of Melatonin Receptor cDNAs
Murine Ltk- cells were transfected with melatonin receptor cDNAs as described previously (37). Human HeLa cells and human embryonic kidney cells (HEK) 293 were transfected by a liposome-mediated transfection method using the transfection reagent DOTAP according to supplier instructions. Neomycin-resistant cells were selected in DMEM supplemented with 10% (vol/vol) FBS, 4.5 g/liter glucose, 100 U/ml penicillin, 100 mg/ml streptomycin, 1 mM glutamine, and 400 µg/ml G418. Individual clones were screened for melatonin binding, using 2-[125I]iodomelatonin as ligand.

For transient expression, Ltk- cells were plated on either six-well dishes for cAMP assays (0.5 x 106cells per well) or 10-cm diameter dishes for cGMP assays (2 x 106cells per dish) and transfected with the diethylaminoethyl-dextran method (38) the next day. Briefly, after a washing with PBS, serum-free DMEM, containing 50 mM HEPES, 200 µg/ml diethylaminoethyl-dextran, and 1 µg/ml plasmid DNA, was added. After incubation at 37 C for 8 h, the medium was replaced by 10% dimethylsulfoxide in serum-free DMEM for 1.5 min. Cells were washed with PBS and then incubated in DMEM containing 10% FCS. Assays were performed 3 days after transfection. Transfection efficiency was around 50% as determined by transfection of ß-galactosidase cDNA in parallel.

Southern Blot Analysis
Southern blot analysis was performed as described by Jenkins et al. (39) with the following modifications: digested DNA was electrophoresed through 1% agarose gel, Tris-acetate- EDTA 1x, denatured and transferred to Hybond N membranes (Amersham, Arlington Heights, IL) and baked 2 h at 80 C. After a final washing step in 0.1 x NaCl-sodium citrate, 0.01 x SDS for 15 min at 65 C, the membrane was exposed to x-ray film.

Radioligand-Binding Assay
Subconfluent cell monolayers were washed with PBS, incubated for 5 min at 37 C with 2% trypsin-2 mM EDTA, and resuspended in DMEM supplemented with 10% (vol/vol) FBS. After a centrifugation at 450 x g for 5 min at 4 C, cell pellets were resuspended in PBS, pH 7.4. Cell suspensions were incubated with 400 pM 2-[125I]iodomelatonin (for binding assays on melatonin receptors) or 200 pM [125I]CYP (for binding assays on ß2AR) in the absence or presence of 10 µM cold ligands (melatonin or D/L-propranolol, respectively). Binding assays were conducted for 60 min at 25 C in a final reaction volume of 0.25 ml. Reactions were stopped by a rapid filtration through Whatman GF/C glass fiber filters, previously soaked for 30 min in PBS-0.3% polyethyleneimine (to reduce nonspecific binding). Protein concentrations were measured on cell homogenates by the method of Bradford (40) using the Bio-Rad (Bio-Rad Laboratories, Richmond, CA) protein assay system. BSA was used as a standard.

Determination of Intracellular cAMP Levels
Cells grown in six-well dishes were washed twice in serum-free DMEM, preincubated for 15 min at 37 C, and then incubated for 15 min at 37 C in DMEM containing 1 mM IBMX, with or without 10 µM isoproterenol (assays on transiently transfected cells) or 10 µM forskolin (assays on stable cell clones), and increasing concentrations of melatonin. The incubation buffer was discarded and cells lysed in 1 M NaOH for 20 min at 37 C. After the neutralization of pH with 1 M acetic acid, cell lysates were centrifuged in a microcentrifuge at 17000 x g for 5 min. Supernatants were assayed for cAMP using a [3H]cAMP assay system (Amersham). Alternatively, cAMP assays were performed in 24-well plates (0.5 x 106 cells in 300 µl). Cells were incubated for 15 min and the reaction terminated by the addition of 100 µl 20% trichloracetic acid and supernatants assayed for cAMP using [125I]cAMP tyrosyl methyl ester RIA.

Determination of Intracellular cGMP Levels
Cells grown in 10-cm diameter dishes were incubated at 37 C for 15 min in serum-free DMEM, in the presence or absence of 1 mM IBMX and increasing concentrations of melatonin. Medium was then replaced by 1 ml of ice-cold 65% ethanol, and cell extracts were centrifuged at 2000 x g for 15 min at 4 C. Supernatants were dried in a speed-vac; pellets were resuspended in 250 µl assay buffer, acetylated, and assayed for cGMP, following the instructions of the manufacturer of the enzyme immunoassay kit (Amersham).

Immunoblots of Gi Protein {alpha} Subunits
Cells were solubilized in Laemmli sample buffer containing 2% SDS and 40 mM dithiothreitol and sonicated at 4 C. After centrifugation in a microcentrifuge at 17,000 x g, 50 µl of supernatant were resolved on a 12% SDS/polyacrylamide gel. Immunoblot analysis was carried out as described (13) with the 84 antiserum that labels all three subtypes of Gi{alpha} (data not shown).


    ACKNOWLEDGMENTS
 
We thank Dr. J. Moreau (Institut J. Monod, CNRS) for kindly providing Xenopus laevis skin mRNA. We are grateful to Dr. Du Pasquier (Basel Institute for Immunology) for supplying genomic DNA from Xenopus species and for helpful discussions during this study.


    FOOTNOTES
 
Address requests for reprints to: Ralf Jockers, Laboratoire d’Immuno-Pharmacologie Moléculaire, Institut Cochin de Génétique Moléculaire, 22, rue Méchain, F-75014 Paris, France,

This work was supported by grants from CNRS, the Université de Paris, and Institut de Recherches Internationales Servier. R.J. holds a fellowship from the Société de Secours des Amis des Sciences.

Received for publication December 3, 1996. Accepted for publication April 22, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Stankov B, Fraschini F, Reiter RJ 1993 Melatonin: Biosynthesis, Physiological Effects, and Clinical Applications, CRC Press, Boca Raton, FL, pp 155–186
  2. Krause DN, Dubocovich ML 1991 Melatonin receptors. Annu Rev Pharmacol Toxicol 31:549–568[CrossRef][Medline]
  3. Morgan PJ, Barrett P, Howell HE, Helliwell R 1994 Melatonin receptors: localization, molecular pharmacology and physiological significance. Neurochem Int 24:101–146[CrossRef][Medline]
  4. Ebisawa T, Karne S, Lerner MR, Reppert SM 1994 Expression cloning of a high-affinity melatonin receptor from Xenopus dermal melanophores. Proc Natl Acad Sci USA 91:6133–6137[Abstract/Free Full Text]
  5. Reppert SM, Weaver DR, Ebisawa T 1994 Cloning and characterization of a mammalian melatonin receptor that mediates reproductive and circadian responses. Neuron 13:1177–1185[CrossRef][Medline]
  6. Reppert SM, Weaver DR, Cassone VM, Godson C, Kolakowski JLF 1995 Melatonin receptors are for the birds: molecular analysis of two receptor subtypes differentially expressed in chick brain. Neuron 15:1003–1015[CrossRef][Medline]
  7. Yung LY, Tsim ST, Wong YH 1995 Stimulation of cAMP accumulation by the cloned Xenopus melatonin receptor through G(i) and G(z) proteins. FEBS Lett 372:99–102[CrossRef][Medline]
  8. Dupasquier L, Chardonnens X 1975 Genetic aspects of the tolerance to allografts induced at metamorphosis in the toad Xenopus laevis. Immunogenetics 2:431–440[CrossRef]
  9. Kobel HR, Dupasquier L 1986 Genetics of polyploid Xenopus. Trends Genet 310–315
  10. Dubocovich ML 1995 Melatonin receptors: are there multiple subtypes? Trends Pharmacol Sci 16:50–56[CrossRef][Medline]
  11. Abe K, Robison A, Liddle GW, Butcher RW, Nicholson WE, Baird CE 1969 Role of cyclic AMP in mediating the effects of MSH, norepinephrine and melatonin on frog skin color. Endocrinology 85:674–682[Medline]
  12. Rivkees SA, Carlson LL, Reppert SM 1989 Guanine nucleotide binding protein regulation of melatonin receptors in lizard brain. Proc Natl Acad Sci USA 86:3882–3886[Abstract/Free Full Text]
  13. Selzer E, Wilfing A, Schiferer A, Hermann M, Grubeckloebenstein B, Freissmuth M 1993 Stimulation of human thyroid growth via the inhibitory guanine nucleotide binding (G) protein G(i) - constitutive expression of the G-protein alpha-subunit G(ialpha-1) in autonomous adenoma. Proc Natl Acad Sci USA 90:1609–1613[Abstract/Free Full Text]
  14. Fargin A, Raymond JR, Regan JW, Cotecchia S, Lefkowitz RJ, Caron MG 1989 Effector coupling mechanisms of the cloned 5-HT1A receptor. J Biol Chem 264:14848–14852[Abstract/Free Full Text]
  15. Vanecek J, Vollrath L 1989 Melatonin inhibits cyclic AMP and cyclic GMP accumulation in the rat pituitary. Brain Res 505:157–159[CrossRef][Medline]
  16. Garthwaite J, Southam E, Boulton CL, Nielsen EB, Schmidt K, Mayer B 1995 Potent and selective inhibition of nitric oxide-sensitive guanylyl cyclase by 1H-[1,2,4]oxadiazolo[4,3-{alpha}]quinoxalin-1-one. Mol Pharmacol 48:184–188[Abstract]
  17. Moro MA, Russel RJ, Cellek S, Lizasoain I, Su Y, Darley-Usmar VM, Radomski MW, Moncada S 1996 cGMP mediates the vascular and platelet actions of nitric oxide: confirmation using an inhibitor of the soluble guanylyl cyclase. Proc Natl Acad Sci USA 93:1480–1485[Abstract/Free Full Text]
  18. Carlson LL, Weaver DR, Reppert SM 1989 Melatonin signal transduction in hamster brain: inhibition of adenylyl cyclase by a pertussis toxin-sensitive G protein. Endocrinology 125:2670–2676[Abstract]
  19. Morgan PJ, Davidson G, Lawson W, Barrett P 1990 Both pertussis toxin-sensitive and insensitive G-proteins link melatonin receptor to inhibition of adenylyl cyclase in the ovine pars tuberalis. J Neuroendocrinol 2:773–776[CrossRef]
  20. Hadcock JR, Malbon C 1988 Down-regulation of ß-adrenergic receptors: agonist-induced reduction in receptor mRNA levels. Proc Natl Acad Sci USA 85:5021–5025[Abstract/Free Full Text]
  21. Lee NH, Earle-Hughes J, Fraser CF 1994 Agonist-mediated destabilization of m1 muscarinic acetylcholine receptor mRNA. J Biol Chem 269:4291–4298[Abstract/Free Full Text]
  22. Strosberg AD 1991 Structure/function relationship of proteins belonging to the family of receptors coupled to GTP-binding proteins. Eur J Biochem 196:1–10[Medline]
  23. Navajas C, Kokkola T, Poso A, Honka N, Gynther J, Laitinen JT 1996 A rhodopsin-based model for melatonin recognition at its G protein-coupled receptor. Eur J Pharmacol 304:173–183[CrossRef][Medline]
  24. O’Dowd B, Hnatowich M, Regan J, Leader W, Caron M, Lefkowitz R 1988 Site-directed mutagenesis of the cytoplasmic domains of the human ß2-adrenergic receptor. J Biol Chem 263:15985–1599[Abstract/Free Full Text]
  25. Wess J 1993 Molecular basis of muscarinic acetylcholine receptor function. Trends Pharmacol Sci 14:308–313[CrossRef][Medline]
  26. Bertin B, Freissmuth M, Breyer RM, Schütz W, Strosberg AD, Marullo S 1992 Functional expression of the human serotonin 5HT1A receptor in Escherichia coli. J Biol Chem 267:8200–8206[Abstract/Free Full Text]
  27. Jockers R, Linder ME, Hohenegger M, Nanoff C, Bertin B, Strosberg AD, Marullo S, Freissmuth M 1994 Species difference in the G protein selectivity of the human and bovine A(1)-adenosine receptor. J Biol Chem 269:32077–32084[Abstract/Free Full Text]
  28. Rollag MD 1988 Response of amphibian melanophores to melatonin. Pineal Res Rev 6:67–93
  29. Geschwind II, Horowitz JM, Mikuckis GM, Dewey RD 1977 Ionophoretic release of cyclic AMP and dispersion of melanosomes within a single melanophore. J Cell Biol 74:928–939[Abstract/Free Full Text]
  30. Messenger EA, Warner AE 1977 The action of melatonin on single amphibian pigment cells in tissue culture. Br J Pharmacol 61:607–614[Medline]
  31. Garbers DL, Lowe DG 1994 Guanylyl cyclase receptors. J Biol Chem 269:30741–30744[Free Full Text]
  32. Yarfitz S, Hurley JB 1994 Transduction mechanisms of vertebrate and invertebrate photoreceptors. J Biol Chem 269:14329–14332[Free Full Text]
  33. Maura G, Raiteri M 1996 Serotonin 5-HT1D and 5-HT1A receptors respectively mediate inhibition of glutamate release and inhibition of cyclic GMP production in rat cerebellum in vitro. J Neurochem 1:203–209
  34. Maura G, Guadagnin A, Raiteri M 1995 Low nanomolar serotonin inhibits the glutamate receptor/nitric oxide/cyclic GMP pathway in slices from adult rat cerebellum. Neuroscience 68:455–463[CrossRef][Medline]
  35. Kleuss C, Scherübl H, Hescheler J, Schultz G, Wittig B 1992 Selectivity in signal transduction determined by gamma-subunits of heterotrimeric G-proteins. Science 259:832–834
  36. Schmidt HHHW, Lohmann SM, Walter U 1993 The nitric oxide and cGMP signal transduction system: regulation and mechanism of action. Biochim Biophys Acta 1178:153–175[Medline]
  37. Jockers R, Da Silva A, Strosberg AD, Bouvier M, Marullo S 1996 New molecular and structural determinants involved in ß2-adrenergic receptor desensitization and sequestration; delineation using chimeric ß3/ß2-adrenergic receptors. J Biol Chem 271:9355–9362[Abstract/Free Full Text]
  38. Lopata MA, Cleveland DW, Sollnerwebb B 1984 High level transient expression of a chloramphenicol acetyl transferase gene by DEAE-dextran mediated DNA transfection coupled with a dimethyl sulfoxide or glycerol shock treatment. Nucleic Acids Res 12:5707–5717[Abstract/Free Full Text]
  39. Jenkins NA, Copeland NG, Taylor BA, Lee BK 1982 Organization, distribution, and stability of endogenous ecotropic murine leukemia virus DNA sequences in chromosomes of Mus musculus. J Virol 43:26–36[Abstract/Free Full Text]
  40. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
V. S. Chowdhury, K. Yamamoto, I. Saeki, I. Hasunuma, T. Shimura, and K. Tsutsui
Melatonin Stimulates the Release of Growth Hormone and Prolactin by a Possible Induction of the Expression of Frog Growth Hormone-Releasing Peptide and Its Related Peptide-2 in the Amphibian Hypothalamus
Endocrinology, March 1, 2008; 149(3): 962 - 970.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
D. Lanoix, R. Ouellette, and C. Vaillancourt
Expression of melatoninergic receptors in human placental choriocarcinoma cell lines
Hum. Reprod., August 1, 2006; 21(8): 1981 - 1989.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Zubare-