Molecular Endocrinology 11 (8): 1082-1093
Copyright © 1997 by The Endocrine Society
A GT Box Element Is Essential for Basal and Cyclic Adenosine 3',5'-Monophosphate Regulation of the Human Surfactant Protein A2 Gene in Alveolar Type II Cells: Evidence for the Binding of Lung Nuclear Factors Distinct from Sp1
Pampee Paul Young and
Carole R. Mendelson
Departments of Biochemistry and Obstetrics-Gynecology The Cecil
H. and Ida Green Center for Reproductive Biology Sciences
University of Texas Southwestern Medical Center at Dallas Dallas,
Texas 75235-9038
 |
ABSTRACT
|
|---|
The gene encoding surfactant protein-A (SP-A) is
developmentally regulated in type II cells of the fetal lung. In humans
there are two SP-A genes, SP-A1 and SP-A2. The SP-A2 gene is more
highly regulated by cAMP and during fetal development than SP-A1. In
earlier studies we determined that 296 bp of sequence flanking the
5'-end of the SP-A2 gene is sufficient to mediate high basal and
cAMP-inducible reporter gene expression in primary cultures of
transfected type II cells, suggesting that this region contains
important cis-acting elements involved in tissue-specific
and hormonal regulation of SP-A2 promoter activity. We also observed
that mutagenesis of a cAMP response element (CRE)-like sequence at
-242 bp (CRESP-A2) greatly reduced basal and
cAMP-stimulated expression in transfected type II cells. In the present
study, we identified a GT box (GGGGTGGGG) at -61 bp of SP-A2
5'-flanking sequence that is highly conserved among the SP-A genes of
different species. In type II cell transfection studies, we found that
mutagenesis of the GT box of SP-A2 markedly reduced basal and abolished
cAMP-induced reporter gene expression. Thus,
CRESP-A2 and the GT box cooperatively interact
to mediate basal and cAMP induction of SP-A2 promoter activity in type
II cells. By electrophoretic mobility shift assays (EMSA), it was
observed that nuclear proteins isolated from primary cultures of type
II cells bound the GT box as five specific complexes. By contrast,
nuclear proteins isolated from lung fibroblasts displayed notably
reduced binding activity. Competition and supershift EMSA indicate that
the ubiquitously expressed transcription factor Sp1, a GC box-binding
protein of
100 kDa, is a component of the complex of proteins that
bind the GT box of SP-A2. The finding that only two of the five GT
box-binding complexes were supershifted by incubation with Sp1 antibody
suggests that a factor(s) in type II cell nuclear extracts that is
distinct from Sp1 also interacts with the GT box. By UV
cross-linking and SDS-PAGE/EMSA analysis, we have identified a
55-kDa GT box-binding factor in type II cell nuclear proteins that
preferentially binds the GT box of SP-A2 over the consensus Sp1 GC box
sequence. This 55-kDa factor was able to bind the GT box independently
of Sp1.
 |
INTRODUCTION
|
|---|
Premature infants born with a deficiency of pulmonary surfactant
suffer from respiratory distress syndrome, a condition associated with
alveolar collapse and severely impaired lung compliance (1). Pulmonary
surfactant, a lipoprotein produced by lung type II cells, is
developmentally and hormonally regulated in fetal lung (see Ref. 2 for
review). To define the molecular mechanisms involved in type II cell
differentiation and the developmental regulation of surfactant
synthesis in the human fetal lung, we have studied regulation of the
gene encoding surfactant protein A (SP-A), the major surfactant
protein. SP-A provides a useful model because its expression is lung
specific and developmentally and hormonally regulated in fetal lung in
association with surfactant phospholipid synthesis (3, 4). Elevated
levels of SP-A are detectable in amniotic fluid only after
75% of
gestation is complete. Hormones and agents that increase intracellular
cAMP enhance the rate of type II cell differentiation in human fetal
lung tissue in culture and concomitantly increase transcriptional
activity of the SP-A gene (5, 6). The mechanisms whereby cAMP regulates
SP-A gene transcription in human fetal lung have not been defined.
The human has two genes encoding SP-A, SP-A1 and SP-A2 (7, 8). The gene
encoding SP-A2 is more highly regulated during development and is more
sensitive to the inductive effects of cAMP than that encoding SP-A1
(9). We, therefore, have focused our efforts on identifying essential
cis-acting elements and the corresponding
trans-acting factors that mediate expression of the SP-A2
gene in a type II cell-specific and cAMP-regulated manner in human
fetal lung.
Functional analysis of putative regulatory sequences upstream of the
human SP-A2 gene in transfected type II cells has revealed that as
little as -296 bp of 5'-flanking region directs type II cell-specific
and cAMP-stimulated expression of SP-A2 promoter activity (10). By
mutational analysis, a cAMP response element (CRE)-like sequence
located at -242 bp (TGACCTTA), which we have termed
CRESP-A2, was found to be essential for high basal and
cAMP-inducible expression (10). A similar element located at -261 bp
upstream of the rabbit SP-A gene also was found to be essential for
cAMP-mediated induction of the rabbit SP-A promoter activity (11).
Although the transcription factor(s) that binds this region has not yet
been identified, studies to characterize this factor indicate that it
is distinct from the cAMP-response element binding protein (CREB) and
may be a member of the nuclear receptor family (12, 10). Additionally,
putative binding sites for thyroid transcription factor-1 (TTF-1),
which appears to be important for lung morphogenesis and expression of
SP-A as well as other surfactant protein genes (13, 14), are also
located within this -296 bp upstream region (J. Li, E. Gao, and C. R.
Mendelson, unpublished observations).
In the present study, we have characterized a novel G-rich sequence (GT
box), located at -61 bp upstream of the SP-A2 structural gene, that is
crucial both for cAMP-inducible and basal expression of SP-A2 fusion
genes in type II cells. Our studies indicate that the GT box-binding
factors are enriched in type II cells as compared with lung
fibroblasts, and that the ubiquitous transcription factor Sp1 is a
component of a complex of type II cell nuclear proteins that interacts
with this sequence. Furthermore, we provide evidence for the existence
of an additional GT box-binding activity that clearly is distinct from
Sp1 and may work together with Sp1 to regulate SP-A2 gene expression in
type II cells.
 |
RESULTS
|
|---|
The GT Box Located at -61 bp Is Necessary for Basal and
cAMP-Inducible Expression of
SP-A2-296:Human (h)GH Fusion Genes in
Type II Cells
In previous studies we found that the -296 bp SP-A2 5'-flanking
region is sufficient to direct type II cell-specific and cAMP-inducible
expression of SP-A2 fusion genes, suggesting that important
cis-acting elements reside within this region (10). Sequence
comparison of human (15), rabbit (16), baboon (E. Gao, J. Li, and C. R.
Mendelson, unpublished observations), rat (17), and mouse (18) SP-A
gene 5'-flanking regions indicates the presence of several highly
conserved sequences within 300 bp upstream of the transcription start
site (Fig. 1
). One conserved region located at -242 bp
contains a CRE-like sequence termed CRESP-A2. (TGACCTTA)
(Fig. 1
). In previous studies we observed that mutagenesis of the
CRE-like sequence in the 5'-flanking region of the human (10) and
rabbit (12) SP-A genes markedly reduced basal and cAMP-induced
expression of SP-A:hGH fusion genes in transfected type II cells. Four
potential binding sites for the transcription factor TTF-1 were
identified in the murine SP-A promoter within a region corresponding to
-175 to -125 bp upstream of the human SP-A2 gene (13); however, the
consensus TTF-1 site at -172 bp in the 5'-flanking sequence of the
human SP-A2 gene appears to be the most highly conserved among
the promoters of the various species (Fig. 1
). Another conserved region
located near the TATA box at -61 bp contains a core sequence of
GGGGTGGGG that we have termed the GT box; homologous regulatory
sequences (CA boxes) have recently been characterized in the bovine
papilloma virus promoter and in the locus control region of the
ß-globin gene (19, 20). The GT box sequence of the SP-A promoter has
not been previously studied.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 1. Schematic Diagram of the Human SP-A2 Structural
Gene and 300 bp of 5'-Flanking Region
Transcription start site is indicated by a bent arrow.
The location of regions that are highly conserved with respect to
location and sequence among the SP-A genes of a number of species is
noted.
|
|
To examine the role of the GT box of SP-A2 in regulating promoter
activity and in mediating the response to cAMP, we used site-directed
mutagenesis to alter five bases of the core sequence within the context
of the SP-A2-296:hGH fusion gene (depicted in
schematic in Fig. 2A
).
SP-A2-296:hGH fusion genes containing the wild type and
mutated GT box were incorporated into replication-defective human
adenoviruses and introduced into primary cultures of human type II
cells by infection. Mutagenesis of the GT box within the -296 bp
fusion gene dramatically reduced basal (by >90%) and abolished
cAMP-induced expression. Expression of SP-A2-296GTmut:hGH
was similar to that of the minimal promoter construct,
SP-A2-47:hGH, which lacks the GT box sequence and includes
only the TATA motif (Fig. 2A
). Basal expression of the
SP-A2-62:hGH construct, which just includes the GT box,
was >3-fold higher than the -47 bp minimal promoter construct (Fig. 2A
). These data indicate that the GT box is essential for elevated
levels of basal and cAMP induction of SP-A2 promoter activity. In
previous studies, we observed that mutagenesis of the
CRESP-A2 sequence within the context of -296 bp fusion
gene reduced basal and abolished cAMP-inducible expression of the
fusion gene construct (10). In the present study, this construct was
transfected into type II cells for comparison with the GT box mutant.
As can be seen, expression of the SP-A2-296CREmut:hGH
fusion gene was decreased to levels comparable to those of the
SP-A2-62:hGH fusion gene, which includes only the GT and
TATA boxes. These findings suggest that both CRESP-A2 and
the GT box are necessary for basal and cAMP-inducible SP-A2 gene
expression and that the GT box plays a more crucial role in the
regulation of the SP-A2 promoter than does CRESP-A2.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 2. Cyclic AMP Induction of Expression of the
SP-A2-296:hGH Fusion Gene Requires Both
CRESP-A2 and GT Box Sequences
A, Primary cultures of human fetal type II cells were infected with
recombinant adenoviruses containing the SP-A2-296:hGH
fusion gene construct containing the wild type sequence or containing
mutations in the GT box or CRESP-A2 as shown in
schematic on left. The infected cells
were incubated in the absence (control) or presence of dibutyryl cAMP
(Bt2cAMP). Expression of these constructs is compared with
that of an SP-A2-62:hGH fusion gene or one containing the
minimal promoter (SP-A2-47:hGH). B, GT box is necessary
for elevated expression of SP-A2 fusion genes in lung epithelial cells.
Primary cultures of human fetal type II cells, as well as A549 and
NCI-H441 cell lines, were infected with recombinant adenoviruses
containing the SP-A2-296:hGH,
SP-A2-296GTmut:hGH, and SP-A2-47:hGH fusion
gene constructs. After infection with recombinant adenoviruses, the
cells were incubated in serum-free medium for 5 days. Shown are levels
of hGH secreted by these cells over a 24-h period between days 4 and 5
of incubation. Values are the mean ± SEM of data from
two independent experiments, each conducted in triplicate (n =
6).
|
|
We next examined the role of the GT box in expression of SP-A2:hGH
fusion genes in lung epithelial cell lines. It should be noted that
although basal expression of SP-A2-296:hGH fusion genes is
detectable in both H441 and A549 cells, in contrast to primary cultures
of human fetal type II cells, neither cell line supports cAMP induction
of SP-A:hGH fusion gene expression (10). As can be seen, mutagenesis of
the GT box in the context of the SP-A2-296:hGH fusion gene
(SP-A2-296GTmut:hGH) resulted in a similar fold reduction
of basal expression (>90%), as compared with the wild type
SP-A2-296:hGH construct, in the lung adenocarcinoma cell
lines A549 and H441, as observed in primary cultures of type II cells
(Fig. 2B
). In each cell line, expression of
SP-A2-296GTmut:hGH was reduced to levels comparable to
those of the minimal promoter construct. These findings indicate that
the GT box contributes significantly to basal expression and cAMP
induction of SP-A2 promoter activity in primary cultures of type II
cells and to basal levels of SP-A2 promoter activity in pulmonary
epithelial cell lines H441 and A549.
GT Box of SP-A2 Binds Lung Nuclear Proteins; Protein Binding Is
Enriched in Type II Cells as Compared with Lung Fibroblasts
To investigate the interactions of putative
trans-acting factors with the GT box-regulatory sequence, we
performed electrophoretic mobility shift assays (EMSAs) using nuclear
proteins prepared from primary cultures of human lung type II cells,
primary cultures of human lung fibroblasts, and the two lung cell
lines, A549 and H441. Nuclear extracts isolated from each cell type
were incubated with a 32P-labeled oligonucleotide
containing the core sequence of the GT box of SP-A2 plus flanking
nucleotides. The DNA-protein complexes subsequently were resolved on a
nondenaturing acrylamide gel. The radiolabeled probe containing the GT
box of SP-A2 bound nuclear proteins isolated from type II cells as five
distinct complexes (lane 2, Fig. 3A
). Each complex was
effectively competed with 100-fold excess of self but not with 100-fold
excess of an oligonucleotide containing the same five mutated residues
tested in transfection experiments (-296GTmut) (Fig. 3A
, lanes 3 and 4, respectively). Because the GT box was found to be
functionally important for basal expression of SP-A2 promoter activity
in lung cell lines, we also examined the interaction of nuclear
proteins isolated from A549 (lane 4) and H441 (data not shown) cells
with the radiolabeled GT box. The binding pattern and activity of A549
and H441 nuclear proteins for the GT box were very similar to proteins
isolated from primary cultures of human fetal type II cells (Fig. 3B
, lanes 3 and 4, and data not shown). By contrast, the protein binding
activity of the GT box was markedly reduced in nuclear extracts
prepared from primary cultures of human fetal lung fibroblasts as
compared with type II cells isolated from the same preparation of
cultured fetal lung tissue (Fig. 3B
, lane 2). To assess the integrity
of the nuclear extracts prepared from the different cell types, we also
analyzed their binding activity for an oligonucleotide containing a
consensus CRE (TGACGTCA) sequence present in the rat somatostatin gene
(known to bind the ubiquitously expressed transcription factor CREB).
As can be seen, binding to the oligonucleotide containing the consensus
CRE was similar in type II cells, A549 cells, and lung fibroblasts
(Fig. 3C
). These results indicate that factors that bind the GT box
element of SP-A2 are enriched in type II cells as compared with lung
fibroblasts and suggest that they may play an important role in
activating genes of pulmonary epithelial cells.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 3. The GT Box of SP-A2 Specifically Binds Type II Cell
Nuclear Proteins: Protein-Binding Activity Is Higher in Lung Epithelial
Cells than in Lung Fibroblasts
A, EMSA of nuclear proteins isolated from primary cultures of human
fetal lung type II cells with a radiolabeled probe spanning -66 to
-48 bp of SP-A2 5'-flanking DNA that contains the core sequence
GGGGTGGGG, termed GT box of SP-A2. Lane 1: (-), free probe;
i.e. nuclear proteins were not added to the binding
reaction. Lane 2, Probe incubated with type II cell nuclear proteins.
Five complexes are observed and labeled with arrows.
Lane 3, A 100-fold molar excess of the nonradiolabeled GT box
containing oligonucleotide (self) was added to the binding reaction.
Lane 4, A 100-fold excess of an oligonucleotide containing a mutated GT
box (mut) (see Materials and Methods) was added to the
binding reaction. B, EMSA of the binding of nuclear proteins (5 µg)
isolated from primary cultures of human fetal lung fibroblasts (lane
2), primary cultures of human fetal type II cells (lane 3), or the lung
adenocarcinoma cell line A549 (lane 4) to the 32P-labeled
GT box oligonucleotide as probe. Lane 1, - indicates free probe. C,
The same preparations of nuclear proteins isolated from type II cells,
fibroblasts, and A549 cells used in panel A were incubated with
radiolabeled oligonucleotide containing the canonical CRE (TGACGTCA)
and analyzed by EMSA. Lane 1, - indicates free probe.
|
|
Sp1 Is a Component of a Complex of Proteins that Interact with the
GT Box of SP-A2
The GT box in SP-A2 resembles the binding sequence recognized by
the Cys2-His2 zinc finger-containing
transcription factor Sp1 (GGGCGG, GC box) (21). To determine whether
the GT box of SP-A2 binds Sp1 in type II cell nuclear proteins, we
performed EMSA using the GT box as probe and a consensus Sp1 site as
competitor. Again, the radiolabeled GT box of SP-A2 bound nuclear
proteins isolated from type II cells as five distinct complexes (Fig. 4A
, lane 2); each complex was effectively competed with
200-fold excess of self (lane 3) but not with up to 200-fold excess of
an oligonucleotide containing a mutated GT box (lane 5) or with one
containing a consensus-binding site for transcription factor AP2 (lane
6), a protein also known to bind a GC-rich sequence (22). This provides
additional evidence that factors that comprise complexes 15 are
specific for the GT box of SP-A2. Interestingly, we observed that
excess nonradiolabeled Sp1 consensus oligonucleotide effectively
competed for the two lowest mobility complexes (complex 1 and 2) but
not the higher mobility complexes, 3, 4, or 5 (Fig. 4A
, lane 4). In
parallel, we performed studies using an oligonucleotide containing the
Sp1 consensus site as the radiolabeled probe (Fig. 5A
).
The radiolabeled GC box bound type II cell nuclear protein as only
three specific bands labeled a, b, and c (Fig. 5A
, lane 2,); each
protein-DNA complex was competed by 200-fold excess of nonradiolabeled
GC box oligonucleotide (lane 3). Whereas the GT box oligonucleotide
effectively competed with the radiolabeled GC box for binding to
complexes b and c, it competed less well for binding to complex a (lane
4). On the other hand, an oligonucleotide containing the AP2 consensus
site failed to compete for binding (lane 5). It is unlikely that the
highest mobility GC box-binding complex, complex c, represents complex
3 observed in experiments using the GT box as probe because complex c
was effectively competed both by nonradiolabeled GC box and GT box,
whereas complex 3 was competed only by the GT box. These studies
suggest that the type II cell nuclear proteins that comprise complexes
3, 4, and 5 observed in EMSA using the radiolabeled GT box of SP-A2
failed to bind to the GC box under the conditions used.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 4. The GT Box of SP-A2 Interacts with Sp1 and One or
More Other Factor(s) in Type II Cell Nuclear Extracts that Is Distinct
from Sp1
A, Nuclear extracts isolated from primary cultures of type II cells
were incubated with a radiolabeled GT box probe in the absence of
nonradiolabeled competitor (+) (complexes 15 are detectable) or in
the presence of a 200-fold excess of nonradiolabeled oligonucleotides
containing the GT box (Self, lane 3), an Sp1 consensus sequence, GC box
(Sp1, lane 4), mutated GT box (Self Mut, lane 5), or an AP2 consensus
sequence (AP2, lane 6). B, Supershift EMSA using an oligonucleotide
containing the GT box as radiolabeled probe and nuclear proteins
isolated from type II cells (lane 3). Lane 2, The radiolabeled probe
was incubated with the Sp1 antibody in the absence of nuclear proteins.
Lane 4, Type II cell nuclear proteins were incubated with Sp1 antibody
for 1 h prior to the addition of the radiolabeled GT box probe. A
supershifted complex was apparent; however, only complexes 1 and 2
appeared to be diminished in intensity. Lane 1, - indicates free
probe.
|
|

View larger version (44K):
[in this window]
[in a new window]
|
Figure 5. The Sp1 Consensus GC Box Interacts Specifically
with Sp1 in Type II Cell Nuclear Extracts
A, EMSA of type II cell nuclear proteins incubated with a radiolabeled
GC box as probe in the absence (+, lane 2) or presence of a 200-fold
excess of nonradiolabeled GC box (lane 3), nonradiolabeled GT box of
SP-A2 (lane 4), or of an oligonucleotide containing the AP2 consensus
sequence (lane 5). Lane 1, - indicates free probe. B, Supershift EMSA
using the radiolabeled consensus GC box and Sp1 antibody. Lane 1, Free
probe. Lane 2, The antibody was incubated with the probe in the absence
of nuclear proteins. Lane 3, Radiolabeled GC box was incubated with
type II cell nuclear proteins. Lane 4, Sp1 antibody was incubated with
nuclear proteins and the radiolabeled GC box probe.
|
|
The results of competitive EMSA using the radiolabeled GT box and the
consensus GC box as nonradiolabeled competitor suggest that Sp1 is a
component of the complex of proteins that bind the GT Box of SP-A2. To
substantiate this hypothesis, we further analyzed the binding complexes
by supershift EMSA using a polyclonal antibody directed against Sp1
(Santa Cruz, Biotech, Santa Cruz, CA) and radiolabeled GT and GC boxes
as probes. The antibody used in this study recognizes both the
phosphorylated and nonphosphorylated forms of Sp1 and does not
cross-react with the highly related proteins Sp2, Sp3, or Sp4. As can
be seen, the addition of 0.1 µg Sp1 antibody to the binding reaction
containing the radiolabeled GT box as probe supershifted complexes 1
and 2; however, complexes 3, 4, and 5 were not affected (Fig. 4B
, lane
4). By contrast, in experiments using the canonical GC box as the
labeled probe, the addition of an equivalent amount of antibody (0.1
µg) altered the mobility of complexes a and c, but had no detectable
effect on complex b (Fig. 5B
, lane 4). The antibody itself did not
interact with either the radiolabeled GT box or GC box probes in the
absence of nuclear proteins (Figs. 4B
and 5B
, lane 2 of each). In
studies to directly analyze the interaction of Sp1 and the GT box, we
found that recombinant Sp1 bound both to the GT and the GC box as a
single complex; however, binding activity of Sp1 at low concentrations,
as determined by intensity of the shifted complex, was higher for the
GC box than for the GT box (data not shown). As a control, the binding
of purified AP2 protein to the radiolabeled GT box was also tested; no
interaction of AP2 and the GT box of SP-A2 could be detected (data not
shown). Additionally, as shown in Fig. 4
, an AP2 consensus sequence
failed to compete for binding to any of the five GT box-nuclear protein
complexes in EMSA. Together, these studies suggest that Sp1 is a
component of a complex of proteins that interact with the GT box.
Furthermore, unlike the canonical Sp1 sequence, the GT box of SP-A2
also interacted specifically with another factor(s) in type II cell
nuclear proteins that is distinct from Sp1.
The GT Box of SP-A2 Interacts with a Factor(s) Distinct from
Sp1
In an attempt to further characterize the lung nuclear protein(s)
that comprises complexes 3, 4, and 5 and to begin to understand the
relationship between this factor(s) and Sp1, we performed UV
cross-linking. The GT box of SP-A2 was uniformly labeled and incubated
with type II cell nuclear proteins. The reaction was subjected to long
wave UV irradiation to covalently cross-link the proteins in contact
with the radiolabeled DNA, and the products were analyzed by SDS-PAGE.
Results of these experiments demonstrate that a protein of
55 kDa in
type II cell nuclear extracts specifically bound the radiolabeled GT
box probe (Fig. 6A
, lane 2). This band was effectively
competed by 1000-fold excess of self (lane 4) but was more modestly
diminished by 1000-fold excess of the canonical GC box (Fig. 6A
, lanes
7 and 8). The intensity of the 55-kDa band was unaffected by 1000-fold
excess of an oligonucleotide containing a mutated GT box (Fig. 6A
, lanes 5 and 6). These findings suggest that the
55-kDa protein that
interacts with the GT box of SP-A2 has reduced binding activity for the
consensus Sp1-binding site, the GC box. A high molecular mass band
corresponding in size to Sp1 was not detected as a cross-linked product
using either the GT box or the canonical GC box as labeled probe. This
may be due to the low sensitivity of the UV cross-linking assay or,
alternatively, the amino acids in the DNA-binding domain of Sp1 may not
cross-link effectively to DNA. In the autoradiogram shown in Fig. 6A
, specific binding of a number of proteins of <35 kDa also was apparent.
This was not a consistent finding from one experiment to another, and
we considered that they may be degradation products of the 55-kDa GT
box-binding protein. However, it should be noted that binding of low
molecular mass proteins distinct from Sp1 to the GT box of the human
c-myc gene promoter has been described; one of these is the
17-kDa PuF (nm23-H2 nucleoside diphosphate kinase) (23).

View larger version (48K):
[in this window]
[in a new window]
|
Figure 6. A Nuclear Factor of 55 kDa Interacts with the GT
Box in UV Cross-Linking Studies
A, Type II cell nuclear extracts were incubated with a body-labeled GT
box oligonucleotide in the absence (lane 2) or presence of various
nonradiolabeled competitors. Lanes 34 also contain 500- and 1000-fold
molar excess of nonradiolabeled GT box oligonucleotide, respectively;
lanes 56 also contain 500- and 1000-fold molar excess of
nonradiolabeled mutated GT box oligonucleotide, respectively; lanes
78 also contain contain 500- and 1000-fold molar excess of
nonradiolabeled GC box, respectively, as competitor. B, UV
cross-linking was performed using nuclear proteins isolated from
primary cultures of fetal type II cells (lane 2), primary cultures of
fetal lung fibroblasts (lane 3), and lung adenocarcinoma cell line A549
(lane 4). In lane 1 of panels A and B, type II cell nuclear proteins
were incubated with radiolabeled probe in the absence of UV light.
|
|
Based on EMSA studies in which we found that nuclear protein-binding
activity to the GT box in lung fibroblasts was low as compared with
type II cells and A549 cells, we expected the levels of the 55-kDa GT
box binding protein to be reduced in lung fibroblasts. We performed UV
cross-linking using the radiolabeled GT box and nuclear proteins
isolated from primary cultures of type II cells, and primary cultures
of lung fibroblasts as well as from lung adenocarcinoma A549 cells
(Fig. 6B
). Binding of the 55-kDa factor was barely detectable in lung
fibroblasts (Fig. 6B
, lane 3); by contrast, binding activity in A549
cells was comparable to that in primary cultures of human fetal type II
cells (Fig. 6B
, lanes 2 and 4).
To confirm that a 55-kDa nuclear factor did indeed interact with the GT
box of SP-A2, we size fractionated type II cell nuclear proteins by
SDS-PAGE and analyzed binding activity of the eluted proteins by EMSA.
Type II cell nuclear proteins were heated at 100 C in SDS-containing
sample buffer and resolved by SDS-PAGE. The gel was then cut into
slices, each slice spanning a molecular mass range as shown in Fig. 7
. The proteins from each fragment were eluted in a
buffer containing Triton X-100, which serves to renature the proteins
by extracting the SDS. An aliquot of eluted proteins from each
fraction, which represented a distinct molecular mass range, was used
in two EMSAs, one using the GT box and the second using the consensus
GC box as radiolabeled probes. The GT box was found to bind strongly to
a factor in the molecular mass range 5060 kDa as a single band on
EMSA (Fig. 7A
). Intriguingly, in three of four independent experiments,
this factor failed to bind the radiolabeled GC box as determined by
EMSA (Fig. 7B
). Very weak binding of a 5060 kDa protein to the GC box
was detected in a fourth experiment (data not shown). On the other
hand, the GC box bound a factor in the size range of 90150 kDa, which
is within the appropriate size range for Sp1 (
100 kDa) (Fig. 7B
). No
binding activity within this size range for the GT box was evident in
the experiment shown. In other experiments, we were able to detect some
binding activity of a high molecular mass factor(s); however, binding
activity of a 90150 kDa protein(s) for the GT box was markedly
reduced as compared with the GC box (data not shown). Low levels of
binding activity for the GC box also were detected in the fraction
containing proteins of >150 kDa; however, this was not consistently
observed in all experiments. Neither of the radiolabeled probes was
found to bind nuclear proteins below 35 kDa (data not shown). These
findings support those of the UV cross-linking studies, which indicated
that a factor of
55 kDa in type II cell nuclear extracts interacts
with the GT box of SP-A2. By contrast, the
55 kDa protein has
dramatically reduced binding activity for the GC box. The SDS-PAGE/EMSA
experiments also indicate that this factor is able to interact directly
with the GT box, independent of Sp1.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 7. A Type II Cell Nuclear Factor of 55 kDa
Molecular Mass Preferentially Binds to the GT Box of SP-A2, Whereas a
Protein of 90150 kDa Binds to a GC Box
Heat-treated type II cell nuclear proteins were separated by SDS-PAGE.
Gel slices ( 40 µg) spanning the size range indicated were excised,
and the proteins from each slice were eluted and renatured as described
in Materials and Methods. The eluates from each gel
slice were analyzed by EMSA using a radiolabeled GT box (A) or
radiolabeled GC box (B) as probe.
|
|
 |
DISCUSSION
|
|---|
SP-A gene expression is highly restricted to lung epithelial
cells, specifically type II cells and to a lesser extent
bronchioalveolar epithelial cells (6). SP-A gene expression is also
regulated developmentally; mRNA first becomes detectable in human fetal
lung at
22 weeks and increased levels of SP-A protein are detected
in amniotic fluid after 30 weeks of gestation (24). Cyclic AMP
treatment of human fetal lung in culture increases the rate of
differentiation of type II cells and SP-A gene expression (25). In
previous studies, we observed that the human SP-A2 gene is more highly
regulated during development and by cAMP than that encoding SP-A1
(9).
In previous studies to map important cis-acting regulatory
elements of the human SP-A2 gene, we found that the sequences between
-47 and -296 bp are required for cAMP-induced transcription of
SP-A2:hGH fusion genes in primary cultures of type II cells. We found
that mutagenesis of a CRE-like element at -242 bp markedly reduced
basal levels of expression and abolished cAMP-induction of SP-A2
promoter activity (10). In the present study, we found that a 9-bp
G-rich sequence (GGGGTGGGG) present between -61 and -53 bp also acts
as an essential regulatory element. This element is conserved in the
promoter regions of the SP-A genes of a number of species thus far
studied. The functional significance of the GT box element in SP-A2
gene transcription was clearly demonstrated by the finding that
mutagenesis of this element within the context of the
SP-A2-296:hGH fusion gene reduced basal promoter activity
by >90% and abolished cAMP responsiveness in primary cultures of
human type II cells. A similar reduction of basal expression of SP-A2
promoter activity was observed in lung epithelial cell lines A549 and
H441. Furthermore, the SP-A2-62:hGH fusion gene construct,
which contains the TATA box and the GT box, was expressed at levels
that were
3-fold greater than those of the SP-A2-47:hGH
fusion gene, which lacks the GT box sequence. In previous studies, we
observed that fusion genes containing the wild type GT box but a
mutated CRESP-A2 sequence also lacked cAMP inducibility
(10). These findings suggest that basal and cAMP induction of SP-A
promoter activity is mediated by the concerted actions of transcription
factors bound to the GT box and at least one upstream sequence,
CRESP-A2, within the 296-bp 5'-flanking region. Cyclic AMP
stimulation of a number of eukaryotic genes has been found to be
mediated by cooperative interactions of transcription factors bound to
their respective cis-acting elements. For example, cAMP
responsiveness of the promoter for phosphoenolpyruvate carboxykinase
appears to be dependent upon the synergistic interaction of CREB bound
to a CRE with liver-enriched transcription factors, including
CCAAT/enhancer binding protein (C/EBP) family members and AP-1, bound
to their response elements (26).
Nuclear proteins isolated from primary cultures of type II cells bound
the radiolabeled GT box probe as five specific complexes. Competitive
and supershift EMSA analysis of the five complexes that comprise the GT
box-binding activity in type II cell nuclear extracts indicates that
the transcription factor Sp1 is a component of the lowest mobility
complexes 1 and 2. Binding activity was similar in the lung epithelial
cell lines A549 and H441 but was dramatically reduced in lung
fibroblasts, suggesting that within the lung, specific binding is
restricted to pulmonary epithelial cells. Mutagenesis of the same five
GT box residues that were found to dramatically reduce fusion gene
expression in functional assays also abolished the ability of the
mutated oligonucleotide to compete with the radiolabeled wild type GT
box probe for protein binding in EMSA. Interestingly, a GT box (or a
homologous CA box)-like sequence is located at -51 bp upstream of the
transcription initiation site of the human SP-B gene (27) and at -61
and -272 bp within the 5'-flanking sequence of the murine SP-C gene
(28). The role of the GT/CA box sequences in the SP-B and SP-C genes
has not yet been studied.
Sp1 was originally identified as a ubiquitously expressed protein that
binds to the hexanucleotide consensus GC box (GGGCGG). More recently,
Sp1 has also been found to bind GT box motifs, such as those found in
the rat LH receptor (29), SV40 (30), and T cell receptor (20) genes.
Although Sp1 is known to regulate basal expression of a variety of
housekeeping genes, its role in directing tissue-specific,
developmental, and hormonal regulation of gene expression has also
recently been explored. Thus far, Sp1 has been found to regulate
expression of erythroid- (31), lymphocyte- (32), and monocyte- (33)
specific genes. Additionally, Sp1 is also believed to serve a role in
the regulation of expression of the CYP11A gene through binding to an
element required for cAMP responsiveness (34). Sp1 is also implicated
as a modulator of the retinoic acid/cAMP-dependent transcription of the
tissue plasminogen activator gene (35). The mechanism by which Sp1
regulates expression of these genes is not yet defined. However,
modulation of Sp1 activity has been found to be mediated by changes in
binding activity (36), alternative splicing of its mRNA (37, 38), and
posttranslational modification, including phosphorylation (39). Sp1 may
also regulate gene expression through interactions with transcription
factors bound to other cis-acting elements. Sp1 has been
found to interact with NF-
B (40), Ets (41), and steroid receptors
(42, 43). Our findings that cAMP induction of
SP-A2-296:hGH expression in transfected type II cells
requires the presence of both an intact GT box and CRESP-A2
sequences (Fig. 2
and Ref. 10) suggest that cAMP induction of SP-A2
gene promoter activity is dependent upon the cooperative interaction of
Sp1 and the 55-kDa protein bound to the GT box with transcription
factors bound to CRESP-A2. Studies of the leukocyte
integrin gene CD11c suggest that myeloid-specific expression and
phorbol ester induction are facilitated by the cooperative interaction
of Sp1 and AP-1 transcription factors bound to their respective
response elements (44).
Analysis of the GT box-binding activity by competition and supershift
EMSA revealed that whereas Sp1 is a component of complexes 1 and 2, a
protein(s) distinct from Sp1 is a component of complexes 3, 4, and 5.
The finding, that similar complexes were not detected by EMSA using the
radiolabeled GC box as probe, supports our hypothesis that this
factor(s) differs from Sp1 in its binding activity. By UV cross-linking
analysis using a body-labeled GT box oligonucleotide as probe, we
consistently detected a single binding protein that migrated at
55
kDa. The finding that binding of the 55-kDa factor was reduced in lung
fibroblasts as compared with type II cells supports those of EMSA,
which indicated that the GT box-binding activity is enriched in lung
epithelial cells. Our inability to detect a binding protein of the
apparent size of Sp1 by UV cross-linking may be due to the relatively
poor ability of Sp1 to cross-link to DNA. To further characterize the
GT box factors, we resolved type II cell nuclear proteins by SDS-PAGE
and analyzed binding of the eluted proteins by EMSA. Our findings
confirmed that a factor of a molecular mass between 5060 kDa does
indeed interact with the GT box and that this factor manifested
significantly higher binding activity for the GT box of SP-A2 as
compared with the GC box. By contrast, a higher molecular mass protein,
corresponding in size to Sp1, manifested increased binding activity
toward the consensus GC box as compared with the GT box. Our finding
that the 5060 kDa factor can bind the GT box in the absence of Sp1
suggests that the binding of Sp1 and the
55-kDa factor to the GT box
can occur independently in vitro. This is further supported
by the findings of competitive EMSA, in which a nonradiolabeled GC box
specifically competed for complexes 1 and 2 without altering the
intensity or pattern of migration of complexes 3, 4, and 5 (Fig. 4A
).
We considered the possibility that this 55-kDa band could represent an
Sp1 degradation product. However, this is unlikely because the same
size protein was consistently observed in all type II cell nuclear
extracts as well as in nuclear extracts from A549 and H441 cells (data
not shown). On the other hand, the 55-kDa protein could be an
alternatively spliced form of Sp1. Each of the previously characterized
alternatively spliced Sp1 mRNAs encode proteins that exhibit varying
degrees of amino-terminal truncation and contain an intact Sp1
DNA-binding domain. Consequently, these isoforms exhibit very similar
DNA- binding activity to that of full-length Sp1 (38). However, we
observed that a 1000-fold excess of consensus Sp1 oligonucleotide
competed only weakly with the radiolabeled GT box for binding to the
55-kDa protein in UV cross-linking assays, whereas a 1000-fold excess
of nonradiolabeled GT box oligonucleotide effectively competed for
binding to this protein. This finding indicates that the 55-kDa protein
binds the GT box preferentially over the GC box sequence and suggests
that the 55-kDa protein is distinct from Sp1. Furthermore, a 55- kDa
alternatively spliced Sp1 isoform has not as yet been reported (37, 38).
Utilizing EMSA, supershift analysis, UV cross-linking, and
SDS-PAGE combined with EMSA, we have demonstrated clearly that both Sp1
and a factor(s) distinct from Sp1 in molecular mass, binding activity,
and antigenicity interact with the GT box of SP-A2. Although Sp1 has
long been thought to be a unique GC box- and GT/CA box-binding protein,
several groups have recently cloned cDNAs for novel GT/CA box-binding
proteins. Like Sp1, these proteins contain three zinc fingers in their
DNA-binding domains, but exhibit varying degrees of similarity within
their transactivation domains (20, 45, 46, 47). On the basis of homology of
Sp1 and the GT box-binding proteins to that of a Drosophila
body pattern-determining gap gene, Krüppel, these factors
constitute a new family of Krüppel-like proteins. Sp1, basic
transcription element binding protein-1 (BTEB1), basic
Krüppel-like factor (BKLF/TEF-2), and Krox20 represent members of
this family that are widely expressed (21, 45, 48, 49). By contrast,
basic transcription element binding protein-2 (BTEB2) appears to be
restricted to the testis and placenta (46), while expression of
erythroid Krüppel-like factor (EKLF) is limited to erythroid
cells, suggesting that these proteins may be involved in the regulation
of tissue-specific gene expression (50). Analysis of the DNA-binding
activity of EKLF and BKLF indicate that they bind to CACCC sequence
more avidly than to the GC consensus sequence (48).
Recently, a new member of this family of transcription factors, termed
lung Krüppel-like factor (LKLF), has been identified. Expression
of LKLF occurs predominantly in lung and spleen. Reduced levels of LKLF
expression can also be detected in heart, skeletal muscle, and testis
(51). Within the zinc finger DNA-binding domain, LKLF shares a high
degree of amino acid identity with the other GT box-binding proteins,
EKLF and BTEB2, and somewhat lower similarity with Sp1. In a
cotransfection assay of mouse NIH 3T3 cells, LKLF transactivated the
human ß-globin promoter through a GT (CA) box. This suggests that a
GT box may be the in vivo binding site for LKLF (51). The
calculated size of LKLF deduced from the amino acid sequence is
38
kDa; however, the apparent molecular mass estimated from SDS-PAGE of
LKLF has not been reported. Intriguingly, LKLF contains a highly
proline-rich transactivation domain (23% proline-rich excluding zinc
finger region); high proline content has been found to contribute to
slower migration in SDS-PAGE than expected based on the amino acid
sequence (52). Thus, we must consider the possibility that the apparent
molecular mass of LKLF on SDS/PAGE may be somewhat higher than the
calculated value, and that LKLF could be the factor that transactivates
SP-A2 promoter activity through the GT box at -61 bp. Currently, we
are investigating whether the 55-kDa factor represents LKLF or is a new
member of the Krüppel family. Isolation and characterization of
this 55-kDa factor and further study of its interaction with Sp1 will
provide insight into the regulatory mechanisms involved in SP-A gene
transcription in pulmonary type II cells.
 |
MATERIALS AND METHODS
|
|---|
Primary Cell Culture
Lung tissues of midtrimester human abortuses were obtained
in accordance with the Donors Anatomical Gift Act of the State of
Texas. Consent forms and protocols were approved by the Human Research
Review Committee of the University of Texas Southwestern Medical Center
at Dallas. The fetal lung tissues were maintained in organ culture for
up to 6 days in serum-free Waymouths MB752/1 medium in the absence or
presence of the cAMP analog, (Bu)2cAMP (1 mM)
(53). Primary cultures of type II cells or fibroblasts were prepared
from cultured fetal lung tissue after incubation with collagenase (0.5
mg/ml), and type II cells were separated from fibroblasts by
differential adhesion (11). The enriched type II cell or fibroblast
suspensions were plated onto culture dishes that were coated with
extracellular matrix from Madin-Darby canine kidney (MDCK) cells (11)
and cultured overnight in Waymouths MB752/1 medium containing FCS
(10% vol/vol).
Preparation and Maintenance of Cell Lines
The lung adenocarcinoma cell line A549 (ATCC CCL 185) of
presumed type II cell origin was maintained in Waymouths MB752/1
medium (GIBCO, Grand Island, NY) supplemented with FCS (10%, vol/vol),
100 U/ml penicillin, and 100 µg/ml streptomycin. The human lung
adenocarcinoma-derived cell line of presumed Clara cell origin,
NCI-H441 (54), was maintained in RPMI 1640 medium (GIBCO) containing
FCS (10%, vol/vol). Cells were grown to approximately 75% confluence
on 60-mm dishes and infected with 1 x 106 recombinant
infectious adenoviral particles containing various SP-A2:hGH fusion
genes. Alternatively, the cultured cells were used to prepare nuclear
extracts.
Construction of SP-A2:Human GH (hGH) Fusion Genes and Preparation
of Recombinant Adenoviruses
Fusion genes containing various amounts of the human SP-A2
5'-flanking DNA linked to the human GH (hGH) structural gene, as
reporter, were constructed as described previously (10). Briefly, SP-A2
genomic sequences were subcloned into the BamHI site of the
plasmid pACOGH, which contains the promoterless hGH structural gene
subcloned into the BamHI and EcoRI sites in the
polylinker of plasmid pAC1RR.5 (11). In this manner, the first 20-bp
segment of exon I of the SP-A2 gene was fused to the first exon of the
hGH structural gene. pAC1RR.5 contains sequences corresponding to the
left end of the adenovirus 5 genome from 0 to 1.4 and 9.117 map
units.
To construct the fusion gene containing mutations in the GT box of
SP-A2, -1500 bp of SP-A2 5'-flanking sequence was subcloned into
pBluescript KS. CJ236 Escherichia coli strain deficient in
dUTPase and uracyl-N-glycosylase was transformed with
pBluescript:SP-A2-1500 and M13K07 helper phage;
single-stranded uracil containing phage DNA was isolated. This DNA
template was used for site-directed mutagenesis that was performed
according to the method outlined in Bio-Rad Mutagene Kit (Bio-Rad
Laboratories, Richmond, CA) using the following oligonucleotide as
primer (5'...
GTAGAGCTCTCAGAATTCAGGAA
GAAGCCTG... 3' [mutated nucleotides in italics and
underlined]). The resulting plasmid,
pBluescript:SP-A2-1500GTmut, was used to derive the
SP-A2-296GTmut:hGH fusion gene. The accuracy of each
construct was verified by double-stranded sequencing using the dideoxy
chain termination method and a Sequenase kit (US Biochemical,
Cleveland, OH).
To obtain recombinant viruses, 293 cells, a permissive human embryonic
kidney cell line that has the capacity to produce E1a, were
cotransfected with the recombinant pAC1RR.5 plasmids containing the
fusion genes and with pJM17. The pJM17 plasmid, which contains the
entire adenovirus genome plus insertion of a 4.3-kb pBR322 plasmid, is
too large to be packaged into viral particles. Homologous recombination
in vivo of the plasmids results in the formation of a
recombinant viral genome that lacks the inserted pBR322 sequence and
thus can be packaged into infectious viral particles (55, 56). Viral
DNA was analyzed for the presence of the fusion genes by restriction
endonuclease digestion followed by Southern analysis; the sequence was
further verified by PCR sequencing (New England Biolabs, Beverly, MA).
The recombinant viruses were titered to determine the concentration of
infectious particles.
Expression of SP-A Fusion Genes in Transfected Cells
Type II cells in primary monolayer culture and lung cell lines
were incubated for 1 h with 1 x 106 recombinant
infectious viral particles; these were limiting with respect to the
number of plated cells, to achieve a multiplicity of infection of 0.2.
In this manner, the same number of cells (1 x 106)
were infected in each experiment, and fusion gene expression remained
consistent from experiment to experiment. After incubation with
recombinant adenoviruses, the medium was aspirated and replaced with
fresh medium with or without (Bu)2cAMP (1 mM).
Media from transfected cells were collected at 24-h intervals and
assayed for hGH by RIA using an hGH kit (Nichols Institute, San Juan
Capistrano, CA). The levels of hGH in the culture medium have been
shown to be proportional to the levels of hGH mRNA transcripts in the
cultured cells as determined by Northern blotting (11).
Synthetic Oligonucleotides for EMSAs and for UV Cross-Linking
Oligonucleotides were purchased from the custom primer synthesis
laboratory of GIBCO BRL (Gaithersburg, MD). Complementary strands were
annealed and chromatographed on Biospin 6 columns (Bio-Rad). The
following sequences were synthesized: the region from -66 to -48 bp
upstream of the SP-A2 gene transcription initiation site that contains
the GT box (5'..TCTCAGGGGTGGGGAAGAA..3') and a GT box in which the
nucleotides in italics have been mutated
(5'..TCTCAGAATTCAGGAAGAA. 3'). Oligonucleotides
were also synthesized containing the consensus binding sites of: Sp1,
(5'..ATTCGATCGGGGCGGGGCGAG..3'), AP2
(5'..GATCGAACTGACCGCCCGGCCCGT..3'); the CRE (in italics) of
the somatostatin gene (5'..AGCTCTCTCTGACGTCAGCCAAGG..3').
Purified double stranded oligonucleotides were used both as
radiolabeled probe and nonradiolabeled competitor.
EMSA
Nuclear extracts were prepared using a procedure described by
Dignam et al. (57) except that protease inhibitors (0.5
mM phenylmethylsulfonyl fluoride, 50 µg/ml aprotinin, 200
µg/ml leupeptin, and 10 µM pepstatin) were added to all
extraction solutions. Recombinant Sp1 and AP2 protein were purchased
from Promega (Madison, WI). Synthetic oligonucleotides were end-labeled
with T4 polynucleotide kinase and
[32P]ATP, incubated
with nuclear proteins (5 µg) at room temperature for 30 min in
binding buffer (20 mM HEPES, pH 7.6, 12% glycerol, 70
mM KCl, 1 mM EDTA, 1 mM
dithiothreitol) and 0.5 µg of
poly(deoxyinosinic-deoxycytidylic)-poly(deoxyinosinic-deoxycytidylic)
acid as nonspecific competitor and resolved on a 6% polyacrylamide gel
(10, 58). The DNA-protein complexes were visualized by
autoradiography.
UV Cross-Linking
Double-stranded oligonucleotides containing the GT box of SP-A2
were phosphorylated with T4 kinase and subcloned into the
SmaI site of pUC 19 followed by body labeling using strand
synthesis as follows. The recombinant plasmids were denatured with 0.2
M NaOH and hybridized to a 5-fold molar excess of pUC/M13
universal primer (-40) and used as template for Sequenase (US
Biochemical Corp.) in the presence of dATP (60 µM), dTTP
(60 µM), dGTP (5 µM), dCTP (5
µM), [
-32P]dCTP (0.5 µM),
and [
-32P]dGTP (0.5 µM). The labeled
DNAs were digested with BamHI and EcoRI to
produce a 52-bp fragment containing a portion of pUC19 polylinker plus
the sequences between -65 and -47 bp of the SP-A2 gene 5'-flanking
region. The resulting fragments were purified by microcon 100 (Amicon,
Beverly, MA) and bio-spin 6 (Bio-Rad), incubated with nuclear proteins
isolated from human fetal lung type II cells before and after culture
in the presence of (Bu)2cAMP using conditions described
above for EMSA, and subjected to UV irradiation for 60 min.
After digestion with DNase I and micrococcal nuclease, the DNA protein
complexes were resolved on an 11% SDS-polyacrylamide gel and
visualized by autoradiography.
Renaturation of Gel-Purified Type II Cell Nuclear Proteins
Followed by EMSA
Renaturation of lung nuclear proteins was performed as described
by Ossipow et al. (59) with minor modifications. Briefly,
type II cell nuclear proteins were boiled for 5 min in SDS-PAGE loading
buffer and separated in a SDS 11% polyacrylamide mini gel in parallel
with molecular mass standards (Amersham). The gel lane containing type
II cell nuclear proteins that had been separated by molecular mass was
subsequently cut into 13 slices of
30 mg, and each piece was
homogenized in 3 volumes of elution-renaturation buffer (1% Triton
X-100, 20 mM HEPES, pH 7.6, 1 mM EDTA, 100
mM NaCl, 5 mg/ml BSA, 2 mM dithiothreitol, 1
mM phenylmethylsulfonyl fluoride, 50 µg/ml aprotinin, 200
µg/ml leupeptin, and 10 µM pepstatin) to remove SDS
from protein-SDS complexes. This process sequesters SDS into micelles
so that SDS no longer interferes with DNA binding. Microcentrifuge
tubes containing the various homogenized gel fragments were incubated
for 3 h at 37 C and the polyacrylamide gel pieces were removed by
spinning at 56,000 rpm for 20 min using TLA 100.3 rotor (Beckman,
Fullerton, CA). Aliquots (14 ml) of supernatant from each fraction were
used in an EMSA using the radiolabeled GT box or GC box as probe.
 |
ACKNOWLEDGMENTS
|
|---|
The authors are grateful to Margaret Smith and Jo Smith for
their expert help with tissue and cell culture and to Drs. Erwei Gao
and Joseph Alcorn for their helpful discussions regarding this
work.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Carole R. Mendelson, Ph.D., Department of Biochemistry, University of Texas Southwestern Medical Center at Dallas, 5323 Harry Hines Boulevard, Dallas, Texas 75235-9038.
This research was supported in part by Basic Research Grant
1-FY940879 from the March of Dimes Birth Defects Foundation and by
NIH Grant HL-50022. Pampee P. Young was supported in part by NIH
Training Grant 5-T32-GM08014, a grant from the Perot Family Foundation,
and by a predoctoral fellowship from The Chilton Foundation, Dallas,
Texas.
Received for publication January 8, 1997.
Revision received March 17, 1997.
Accepted for publication April 2, 1997.
 |
REFERENCES
|
|---|
-
Avery ME, Mead J 1959 Surface properties in relation to
atelectasis and hyaline membrane disease. Am J Dis Child 97:517523
-
Mendelson CR, Boggaram V 1991 Hormonal control of the
surfactant system in fetal lung. Annu Rev Physiol 53:415440[CrossRef][Medline]
-
Auten RL, Watkins RH, Shapiro DL, Horowitz S 1990 Surfactant
apoprotein A (SP-A) is synthesized in airway cells. Am J Respir
Cell Mol Biol 3:491496
-
Wohlford-Lenane CL, Snyder JM 1992 Localization of the
surfactant associated proteins SP-A and SP-B mRNA in fetal rabbit lung
tissue by in situ hybridization. Am J Respir Cell Mol
Biol 7:335342
-
Ballard PL, Hawgood S, Liley H, Wellenstein G, Gonzales LW,
Benson B, Cordell B, White RT 1986 Regulation of pulmonary surfactant
apoprotein SP-A 2836 gene in fetal human lung. Proc Natl Acad Sci USA 83:95279531[Abstract/Free Full Text]
-
Snyder JM, Mendelson CR 1987 Induction and characterization
of the major surfactant apoprotein during rabbit fetal lung
development. Biochim Biophys Acta 920:226236[Medline]
-
Katyal SL, Singh G, Locker J 1992 Characterization of a
second human pulmonary surfactant associated protein SP-A gene. Am
J Respir Cell Mol Biol 6:446452
-
McCormick SM, Boggaram V, Mendelson CR 1994 Characterization of mRNA transcripts and organization of human
SP-A1 and SP-A2 genes. Am J Physiol 266:L354L366
-
McCormick SM, Mendelson CR 1994 Human SP-A1 and SP-A2 genes
are differentially regulated during development and by cAMP and
glucocorticoids. Am J Physiol 266:L367L373
-
Young PP, Mendelson CR 1996 A CRE-like element plays an
essential role in cAMP regulation of human SP-A2 gene in alveolar type
II cells. Am J Physiol 271:L287L299
-
Alcorn JL, Gao E, Chen Q, Smith ME, Gerard RD, Mendelson
CR 1993 Genomic elements involved in transcriptional regulation of the
rabbit surfactant protein A (SP-A) gene. Mol Endocrinol 7:10721085[Abstract]
-
Michael LF, Alcorn JL, Gao E, Mendelson CR 1996 Characterization of the cyclic AMP response element of the rabbit
surfactant protein-A gene: evidence for transactivators distinct from
CREB/ATF family members. Mol Endocrinol 10:159170[Abstract]
-
Bruno MD, Bohinski RJ, Huelsman KM, Whitsett JA, Korfhagen TR 1995 Lung cell-specific expression of the murine surfactant protein A
(SP-A) gene is mediated by interactions between the SP-A promoter and
thyroid transcription factor-1. J Biol Chem 270:65316536[Abstract/Free Full Text]
-
Bohinski RJ, DiLauro R, Whitsett JA 1994 The lung specific
surfactant protein B gene promoter is a target for thyroid
transcription factor 1 and hepatocyte nuclear factor 3, indicating
common factors for organ specific gene expression along the foregut
axis. Mol Cell Biol 14:56715681[Abstract/Free Full Text]
-
Kouretas D, Karinch AM, Rishi A, Melcheris K, Floros J 1993 Conservation analysis of rat and human SP-A gene: identifies
5'-flanking sequences of rat SP-A that bind rat lung nuclear proteins.
Exp Lung Res 19:485503[Medline]
-
Chen Q, Boggaram V, Mendelson CR 1992 Rabbit lung surfactant
protein A gene: identification of a lung-specific DNase I
hypersensitive site. Am J Physiol 262:L662L671
-
Lacaze-Masmonteil T, Fraslon C, Bourbon J, Raymondjean M, Kahn
A 1992 Characterization of the rat pulmonary surfactant protein A
promoter. Eur J Biochem 206:613623[Medline]
-
Korfhagen TR, Bruno MD, Glasser SW, Ciraolo PJ, Whitsett
JA, Lattier DL, Wikenheiser KA, Clark JC 1992 Murine pulmonary
surfactant SP-A gene: cloning, sequence, and transcriptional activity.
Am J Physiol 263:L546L554
-
Philipsen S, Talbot D, Fraser P, Grosveld F 1990 The
ß-globin dominant control region: hypersensitive site 2. EMBO J 9:21592167[Medline]
-
Kingsley C, Winoto A 1992 Cloning of GT Box-binding proteins:
a novel Sp1 multigene family regulating T-cell receptor gene
expression. Mol Cell Biol 12:42514261[Abstract/Free Full Text]
-
Briggs MR, Kadonaga JT, Bell SP, Tjian R 1986 Purification and
biochemical characterization of the promoter-specific transcription
factor Sp1. Science 234:4752[Abstract/Free Full Text]
-
Williams T, Tjian R 1991 Analysis of the DNA-binding and
activation properties of the human transcription factor AP-2. Genes Dev 4:670682
-
Postel EH, Berberich SJ, Flint SJ, Ferrone CA 1993 Human
c-myc transcription factor PuF identified as nm23H2
nucleoside diphosphate kinase, a candidate suppressor of tumor
metastasis. Science 261:478480[Abstract/Free Full Text]
-
Shelley SA, Balis JV, Paciga JE, Knuppel RA, Ruffolo EH, Bouis
PJ 1982 Surfactant apoproteins in human amniotic fluid: an
enzyme-linked immunosorbent assay for the prenatal assessment of lung
maturity. Am J Obstet Gynecol 144:224228[Medline]
-
Odom MJ, Snyder JM, Mendelson CR 1987 Adenosine
3',5'-monophosphate analogs and ß-adrenergic agonists induce the
synthesis of the major surfactant apoprotein in human fetal lung
in vitro. Endocrinology 121:11551163[Abstract]
-
Roesler WJ, Graham JG, Kolen R, Klemm DJ, McFie PJ 1995 The
cAMP response element binding protein synergizes with other
transcription factors to mediate cAMP responsiveness. J Biol Chem 270:82258232[Abstract/Free Full Text]
-
Pilot-Matias TJ, Kister SE, Fox JL, Kropp K, Glasser SW,
Whitsett JA 1989 Structure and organization of the gene encoding human
pulmonary surfactant proteolipid SP-B. DNA 8:7586[Medline]
-
Glasser SW, Korfhagen TR, Bruno MD, Dey C, Whitsett JA 1990 Structure and expression of the pulmonary surfactant protein SP-C gene
in the mouse. J Biol Chem 265:2198621991[Abstract/Free Full Text]
-
Tsai-Morris C, Geng Y, Buczko E, Dufau ML 1995 Characterization of diverse functional elements in the upstream Sp1
domain of the rat luteinizing hormone receptor gene promoter. J
Biol Chem 270:74877494[Abstract/Free Full Text]
-
Xiao JH, Davidson I, Macchi M, Rosales R, Vigneron R, Staub A,
Chambon P 1987 In vitro binding of several cell-specific and
ubiquitous nuclear proteins to the GT-I motif of the SV40 enhancer.
Genes Dev 1:794807[Abstract/Free Full Text]
-
Yu CY, Motamed K, Chen J, Bailey AD, Shen CK 1991 The CACCC
box upstream of human embryonic
globin gene binds Sp1 and is a
functional promoter element in vitro and in vivo.
J Biol Chem 266:89078915[Abstract/Free Full Text]
-
Spanopoulou E, Giguere V, Grosveld F 1991 The functional
domain of the murine Thy-1 gene promoter. Mol Cell Biol 11:22162228[Abstract/Free Full Text]
-
Zhang D, Hetherington CJ, Tan S, Dziennis SE, Gonzalez DA,
Chen H, Tenen DG 1994 Sp1 is a critical factor for the monocyte
specific expression of human CD14. J Biol Chem 269:1142511434[Abstract/Free Full Text]
-
Venepally P, Waterman MR 1995 Two Sp1 binding sites mediate
cAMP-induced transcription of the bovine CYP11A gene through the
protein kinase A signalling pathway. J Biol Chem 270:2540225410[Abstract/Free Full Text]
-
Darrow AL, Rickles RJ, Pecorino LT, Strickland S 1990 Transcription factor Sp1 is important for retinoic acid induced
expression of the tissue plasminogen activator gene during
F9-teratocarcinoma cell differentiation. Mol Cell Biol 10:58835893[Abstract/Free Full Text]
-
Jane SM, Gumucio DL, Ney PA, Cunningham JM, Nienhuis AW 1993 Methylation-enhanced binding of Sp1 to the stage selector element
of the human
globin gene promoter may regulate developmental
specificity of expression. Mol Cell Biol 13:32723281[Abstract/Free Full Text]
-
Persengiev SP, Saffer JD, Kilpatrick DL 1995 An alternatively
spliced form of the transcription factor Sp1 containing only a single
glutamine-rich transactivation domain. Proc Natl Acad Sci USA 92:91079111[Abstract/Free Full Text]
-
Persengiev SP, Ravel PJ, Rabinovitch S, Millelle CF,
Kilpatrick DL 1996 Transcription factor Sp1 is expressed by three
different developmentally regulated messenger ribonucleic acids in
mouse spermatogenic cells. Endocrinology 137:638646[Abstract]
-
Leggett RW, Armstrong SA, Barry D, Mueller CR 1995 Sp1 is
phosphorylated and its DNA binding activity down regulated upon
terminal differentiation of the liver. J Biol Chem 270:2587925884[Abstract/Free Full Text]
-
Perkins ND, Agranoff AB, Pascal E, Nabel GJ 1994 An
interaction between the DNA-binding domains of Rel A (p65) and Sp1
mediates human immunodeficiency virus gene activation. Mol Cell Biol 14:65706583[Abstract/Free Full Text]
-
Dittmer J, Gegonne A, Gitlin SD, Ghysdael J, Brady JN 1994 Regulation of parathyroid hormone-related protein (PTHrP) gene
expression. J Biol Chem 269:2142821434[Abstract/Free Full Text]
-
Schüle R, Muller M, Kaltschmidt C, Renkawitz R 1988 Many
transcription factors interact synergistically with steroid receptors.
Science 242:14181420[Abstract/Free Full Text]
-
Muller M, Baniahmad C, Kaltschmidt C, Renkawitz R 1991 Multiple domains of the glucocorticoid receptor involved in synergism
with the CACC box factor(s). Mol Endocrinol 5:14981503[Abstract]
-
Noti JD, Reinemann BC, Petrus MN 1996 Sp1 binds two sites in
the CD11c promoter in vivo specifically in myeloid cells and
cooperates with AP1 to activate transcription. Mol Cell Biol 16:29402950[Abstract]
-
Imataka H, Sogawa K, Yasumoto K, Kikuchi Y, Sasano K,
Kobayashi A, Hayami M, Fujiii-Kuriyama Y 1992 Two regulatory proteins
that bind to the basic transcription element (BTE), a GC box sequence
in the promoter region of the rat P-4501A1 gene. EMBO J 11:36633671[Medline]
-
Russo MW, Sevetson BR, Milbrandt J 1995 Identification of
NAB1, a repressor of NGFI-A- and Krox20-mediated transcription. Proc
Natl Acad Sci USA 92:68736877[Abstract/Free Full Text]
-
Sogawa K, Imataka H, Yamasaki Y, Kusume H, Abe H,
Fujii-Kuriyama Y 1993 cDNA cloning and transcriptional properties of a
novel GC box-binding protein, BTEB2. Nucleic Acids Res 21:15271532[Abstract/Free Full Text]
-
Crossley M, Whitelaw E, Perkins A, Williams G, Fujiwara Y,
Orkin SH 1996 Isolation and characterization of the cDNA encoding
BKLF/TEF-2, a major CACCC-box-binding protein in erythroid cells and
selected other cells. Mol Cell Biol 16:16951705[Abstract]
-
Chavier P, Vesque C, Galliot B, Vigneron M, Dolle P, Duboule
D, Charnay P 1990 The segment specific gene KROX-20 encodes a
transcription factor with binding sites in the promoter region of the
Hox-1.4 gene. EMBO J 9:12091218[Medline]
-
Miller I, Bieker JJ 1993 A novel, erythroid cell-specific
murine transcription factor that binds to the CACCC element and is
related to the krüppel family of nuclear proteins. Mol Cell Biol 13:27762786[Abstract/Free Full Text]
-
Anderson KP, Kern CB, Crable SC, Lingrel JB 1995 Isolation of
a gene encoding a functional zinc finger protein homologous to
erythroid krüppel-like factor: identification of a new multigene
family. Mol Cell Biol 15:59575965[Abstract]
-
Ogle KF, Lee KK, Krause DC 1992 Nucleotide sequence analysis
reveals novel features of the phase variable cytadherence accessory
protein HMLUS of Mycoplasma pneumoniae. Infect Immun 60:16331641[Abstract/Free Full Text]
-
Snyder JM, Mendelson CR, Johnston JM 1981 The effect of
cortisol on rabbit fetal lung maturation in vitro. Dev Biol 85:129140[CrossRef][Medline]
-
Gazdar AF, Linnoila RI, Kurita Y, Oie HK, Mulshine JL, Clark
JC, Whitsett JA 1990 Peripheral airway cell differentiation in human
lung cancer cell lines. Cancer Res 50:54815487[Abstract/Free Full Text]
-
Gluzman Y, Herwig R, Solnick D 1982 Helper-free adenovirus
type-5 vectors. In: Gluzman Y (ed) Eukaryotic Viral Vectors. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 187192
-
McGrory WJ, Baytustam DS, Graham FL 1988 A simple technique
for the rescue of early region 1 mutations into infectious human
adenovirus type 5. Virology 163:614617[CrossRef][Medline]
-
Dignam JD, Lebovitz RM, Roeder R 1983 Accurate transcription
initiation by RNA polymerase II in a soluble extract from isolated
mammalian nuclei. Nucleic Acids Res 11:14751489[Abstract/Free Full Text]
-
Henninghausen L, Lubon H 1987 Interaction of protein with DNA
in vitro. Methods Enzymol 152:721735[Medline]
-
Ossipow V, Laemmli UK, Schibler U 1993 Simple method to
renature DNA-binding proteins separated by SDS-polyacrylamide gel
electrophoresis. Nucleic Acids Res 21:60406041[Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
D. Liu, M. Yi, M. Smith, and C. R. Mendelson
TTF-1 response element is critical for temporal and spatial regulation and necessary for hormonal regulation of human surfactant protein-A2 promoter activity
Am J Physiol Lung Cell Mol Physiol,
August 1, 2008;
295(2):
L264 - L271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Liu, M. M. Hinshelwood, V. Giguere, and C. R. Mendelson
Estrogen Related Receptor-{alpha} Enhances Surfactant Protein-A Gene Expression in Fetal Lung Type II Cells
Endocrinology,
November 1, 2006;
147(11):
5187 - 5195.
[Abstract]
[Full Text]
[PDF]
|
 |
|