help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Young, P. P.
Right arrow Articles by Mendelson, C. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Young, P. P.
Right arrow Articles by Mendelson, C. R.
Molecular Endocrinology 11 (8): 1082-1093
Copyright © 1997 by The Endocrine Society

A GT Box Element Is Essential for Basal and Cyclic Adenosine 3',5'-Monophosphate Regulation of the Human Surfactant Protein A2 Gene in Alveolar Type II Cells: Evidence for the Binding of Lung Nuclear Factors Distinct from Sp1

Pampee Paul Young and Carole R. Mendelson

Departments of Biochemistry and Obstetrics-Gynecology The Cecil H. and Ida Green Center for Reproductive Biology Sciences University of Texas Southwestern Medical Center at Dallas Dallas, Texas 75235-9038


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The gene encoding surfactant protein-A (SP-A) is developmentally regulated in type II cells of the fetal lung. In humans there are two SP-A genes, SP-A1 and SP-A2. The SP-A2 gene is more highly regulated by cAMP and during fetal development than SP-A1. In earlier studies we determined that 296 bp of sequence flanking the 5'-end of the SP-A2 gene is sufficient to mediate high basal and cAMP-inducible reporter gene expression in primary cultures of transfected type II cells, suggesting that this region contains important cis-acting elements involved in tissue-specific and hormonal regulation of SP-A2 promoter activity. We also observed that mutagenesis of a cAMP response element (CRE)-like sequence at -242 bp (CRESP-A2) greatly reduced basal and cAMP-stimulated expression in transfected type II cells. In the present study, we identified a GT box (GGGGTGGGG) at -61 bp of SP-A2 5'-flanking sequence that is highly conserved among the SP-A genes of different species. In type II cell transfection studies, we found that mutagenesis of the GT box of SP-A2 markedly reduced basal and abolished cAMP-induced reporter gene expression. Thus, CRESP-A2 and the GT box cooperatively interact to mediate basal and cAMP induction of SP-A2 promoter activity in type II cells. By electrophoretic mobility shift assays (EMSA), it was observed that nuclear proteins isolated from primary cultures of type II cells bound the GT box as five specific complexes. By contrast, nuclear proteins isolated from lung fibroblasts displayed notably reduced binding activity. Competition and supershift EMSA indicate that the ubiquitously expressed transcription factor Sp1, a GC box-binding protein of ~100 kDa, is a component of the complex of proteins that bind the GT box of SP-A2. The finding that only two of the five GT box-binding complexes were supershifted by incubation with Sp1 antibody suggests that a factor(s) in type II cell nuclear extracts that is distinct from Sp1 also interacts with the GT box. By UV cross-linking and SDS-PAGE/EMSA analysis, we have identified a ~55-kDa GT box-binding factor in type II cell nuclear proteins that preferentially binds the GT box of SP-A2 over the consensus Sp1 GC box sequence. This 55-kDa factor was able to bind the GT box independently of Sp1.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Premature infants born with a deficiency of pulmonary surfactant suffer from respiratory distress syndrome, a condition associated with alveolar collapse and severely impaired lung compliance (1). Pulmonary surfactant, a lipoprotein produced by lung type II cells, is developmentally and hormonally regulated in fetal lung (see Ref. 2 for review). To define the molecular mechanisms involved in type II cell differentiation and the developmental regulation of surfactant synthesis in the human fetal lung, we have studied regulation of the gene encoding surfactant protein A (SP-A), the major surfactant protein. SP-A provides a useful model because its expression is lung specific and developmentally and hormonally regulated in fetal lung in association with surfactant phospholipid synthesis (3, 4). Elevated levels of SP-A are detectable in amniotic fluid only after ~75% of gestation is complete. Hormones and agents that increase intracellular cAMP enhance the rate of type II cell differentiation in human fetal lung tissue in culture and concomitantly increase transcriptional activity of the SP-A gene (5, 6). The mechanisms whereby cAMP regulates SP-A gene transcription in human fetal lung have not been defined.

The human has two genes encoding SP-A, SP-A1 and SP-A2 (7, 8). The gene encoding SP-A2 is more highly regulated during development and is more sensitive to the inductive effects of cAMP than that encoding SP-A1 (9). We, therefore, have focused our efforts on identifying essential cis-acting elements and the corresponding trans-acting factors that mediate expression of the SP-A2 gene in a type II cell-specific and cAMP-regulated manner in human fetal lung.

Functional analysis of putative regulatory sequences upstream of the human SP-A2 gene in transfected type II cells has revealed that as little as -296 bp of 5'-flanking region directs type II cell-specific and cAMP-stimulated expression of SP-A2 promoter activity (10). By mutational analysis, a cAMP response element (CRE)-like sequence located at -242 bp (TGACCTTA), which we have termed CRESP-A2, was found to be essential for high basal and cAMP-inducible expression (10). A similar element located at -261 bp upstream of the rabbit SP-A gene also was found to be essential for cAMP-mediated induction of the rabbit SP-A promoter activity (11). Although the transcription factor(s) that binds this region has not yet been identified, studies to characterize this factor indicate that it is distinct from the cAMP-response element binding protein (CREB) and may be a member of the nuclear receptor family (12, 10). Additionally, putative binding sites for thyroid transcription factor-1 (TTF-1), which appears to be important for lung morphogenesis and expression of SP-A as well as other surfactant protein genes (13, 14), are also located within this -296 bp upstream region (J. Li, E. Gao, and C. R. Mendelson, unpublished observations).

In the present study, we have characterized a novel G-rich sequence (GT box), located at -61 bp upstream of the SP-A2 structural gene, that is crucial both for cAMP-inducible and basal expression of SP-A2 fusion genes in type II cells. Our studies indicate that the GT box-binding factors are enriched in type II cells as compared with lung fibroblasts, and that the ubiquitous transcription factor Sp1 is a component of a complex of type II cell nuclear proteins that interacts with this sequence. Furthermore, we provide evidence for the existence of an additional GT box-binding activity that clearly is distinct from Sp1 and may work together with Sp1 to regulate SP-A2 gene expression in type II cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The GT Box Located at -61 bp Is Necessary for Basal and cAMP-Inducible Expression of SP-A2-296:Human (h)GH Fusion Genes in Type II Cells
In previous studies we found that the -296 bp SP-A2 5'-flanking region is sufficient to direct type II cell-specific and cAMP-inducible expression of SP-A2 fusion genes, suggesting that important cis-acting elements reside within this region (10). Sequence comparison of human (15), rabbit (16), baboon (E. Gao, J. Li, and C. R. Mendelson, unpublished observations), rat (17), and mouse (18) SP-A gene 5'-flanking regions indicates the presence of several highly conserved sequences within 300 bp upstream of the transcription start site (Fig. 1Go). One conserved region located at -242 bp contains a CRE-like sequence termed CRESP-A2. (TGACCTTA) (Fig. 1Go). In previous studies we observed that mutagenesis of the CRE-like sequence in the 5'-flanking region of the human (10) and rabbit (12) SP-A genes markedly reduced basal and cAMP-induced expression of SP-A:hGH fusion genes in transfected type II cells. Four potential binding sites for the transcription factor TTF-1 were identified in the murine SP-A promoter within a region corresponding to -175 to -125 bp upstream of the human SP-A2 gene (13); however, the consensus TTF-1 site at -172 bp in the 5'-flanking sequence of the human SP-A2 gene appears to be the most highly conserved among the promoters of the various species (Fig. 1Go). Another conserved region located near the TATA box at -61 bp contains a core sequence of GGGGTGGGG that we have termed the GT box; homologous regulatory sequences (CA boxes) have recently been characterized in the bovine papilloma virus promoter and in the locus control region of the ß-globin gene (19, 20). The GT box sequence of the SP-A promoter has not been previously studied.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Schematic Diagram of the Human SP-A2 Structural Gene and 300 bp of 5'-Flanking Region

Transcription start site is indicated by a bent arrow. The location of regions that are highly conserved with respect to location and sequence among the SP-A genes of a number of species is noted.

 
To examine the role of the GT box of SP-A2 in regulating promoter activity and in mediating the response to cAMP, we used site-directed mutagenesis to alter five bases of the core sequence within the context of the SP-A2-296:hGH fusion gene (depicted in schematic in Fig. 2AGo). SP-A2-296:hGH fusion genes containing the wild type and mutated GT box were incorporated into replication-defective human adenoviruses and introduced into primary cultures of human type II cells by infection. Mutagenesis of the GT box within the -296 bp fusion gene dramatically reduced basal (by >90%) and abolished cAMP-induced expression. Expression of SP-A2-296GTmut:hGH was similar to that of the minimal promoter construct, SP-A2-47:hGH, which lacks the GT box sequence and includes only the TATA motif (Fig. 2AGo). Basal expression of the SP-A2-62:hGH construct, which just includes the GT box, was >3-fold higher than the -47 bp minimal promoter construct (Fig. 2AGo). These data indicate that the GT box is essential for elevated levels of basal and cAMP induction of SP-A2 promoter activity. In previous studies, we observed that mutagenesis of the CRESP-A2 sequence within the context of -296 bp fusion gene reduced basal and abolished cAMP-inducible expression of the fusion gene construct (10). In the present study, this construct was transfected into type II cells for comparison with the GT box mutant. As can be seen, expression of the SP-A2-296CREmut:hGH fusion gene was decreased to levels comparable to those of the SP-A2-62:hGH fusion gene, which includes only the GT and TATA boxes. These findings suggest that both CRESP-A2 and the GT box are necessary for basal and cAMP-inducible SP-A2 gene expression and that the GT box plays a more crucial role in the regulation of the SP-A2 promoter than does CRESP-A2.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Cyclic AMP Induction of Expression of the SP-A2-296:hGH Fusion Gene Requires Both CRESP-A2 and GT Box Sequences

A, Primary cultures of human fetal type II cells were infected with recombinant adenoviruses containing the SP-A2-296:hGH fusion gene construct containing the wild type sequence or containing mutations in the GT box or CRESP-A2 as shown in schematic on left. The infected cells were incubated in the absence (control) or presence of dibutyryl cAMP (Bt2cAMP). Expression of these constructs is compared with that of an SP-A2-62:hGH fusion gene or one containing the minimal promoter (SP-A2-47:hGH). B, GT box is necessary for elevated expression of SP-A2 fusion genes in lung epithelial cells. Primary cultures of human fetal type II cells, as well as A549 and NCI-H441 cell lines, were infected with recombinant adenoviruses containing the SP-A2-296:hGH, SP-A2-296GTmut:hGH, and SP-A2-47:hGH fusion gene constructs. After infection with recombinant adenoviruses, the cells were incubated in serum-free medium for 5 days. Shown are levels of hGH secreted by these cells over a 24-h period between days 4 and 5 of incubation. Values are the mean ± SEM of data from two independent experiments, each conducted in triplicate (n = 6).

 
We next examined the role of the GT box in expression of SP-A2:hGH fusion genes in lung epithelial cell lines. It should be noted that although basal expression of SP-A2-296:hGH fusion genes is detectable in both H441 and A549 cells, in contrast to primary cultures of human fetal type II cells, neither cell line supports cAMP induction of SP-A:hGH fusion gene expression (10). As can be seen, mutagenesis of the GT box in the context of the SP-A2-296:hGH fusion gene (SP-A2-296GTmut:hGH) resulted in a similar fold reduction of basal expression (>90%), as compared with the wild type SP-A2-296:hGH construct, in the lung adenocarcinoma cell lines A549 and H441, as observed in primary cultures of type II cells (Fig. 2BGo). In each cell line, expression of SP-A2-296GTmut:hGH was reduced to levels comparable to those of the minimal promoter construct. These findings indicate that the GT box contributes significantly to basal expression and cAMP induction of SP-A2 promoter activity in primary cultures of type II cells and to basal levels of SP-A2 promoter activity in pulmonary epithelial cell lines H441 and A549.

GT Box of SP-A2 Binds Lung Nuclear Proteins; Protein Binding Is Enriched in Type II Cells as Compared with Lung Fibroblasts
To investigate the interactions of putative trans-acting factors with the GT box-regulatory sequence, we performed electrophoretic mobility shift assays (EMSAs) using nuclear proteins prepared from primary cultures of human lung type II cells, primary cultures of human lung fibroblasts, and the two lung cell lines, A549 and H441. Nuclear extracts isolated from each cell type were incubated with a 32P-labeled oligonucleotide containing the core sequence of the GT box of SP-A2 plus flanking nucleotides. The DNA-protein complexes subsequently were resolved on a nondenaturing acrylamide gel. The radiolabeled probe containing the GT box of SP-A2 bound nuclear proteins isolated from type II cells as five distinct complexes (lane 2, Fig. 3AGo). Each complex was effectively competed with 100-fold excess of self but not with 100-fold excess of an oligonucleotide containing the same five mutated residues tested in transfection experiments (-296GTmut) (Fig. 3AGo, lanes 3 and 4, respectively). Because the GT box was found to be functionally important for basal expression of SP-A2 promoter activity in lung cell lines, we also examined the interaction of nuclear proteins isolated from A549 (lane 4) and H441 (data not shown) cells with the radiolabeled GT box. The binding pattern and activity of A549 and H441 nuclear proteins for the GT box were very similar to proteins isolated from primary cultures of human fetal type II cells (Fig. 3BGo, lanes 3 and 4, and data not shown). By contrast, the protein binding activity of the GT box was markedly reduced in nuclear extracts prepared from primary cultures of human fetal lung fibroblasts as compared with type II cells isolated from the same preparation of cultured fetal lung tissue (Fig. 3BGo, lane 2). To assess the integrity of the nuclear extracts prepared from the different cell types, we also analyzed their binding activity for an oligonucleotide containing a consensus CRE (TGACGTCA) sequence present in the rat somatostatin gene (known to bind the ubiquitously expressed transcription factor CREB). As can be seen, binding to the oligonucleotide containing the consensus CRE was similar in type II cells, A549 cells, and lung fibroblasts (Fig. 3CGo). These results indicate that factors that bind the GT box element of SP-A2 are enriched in type II cells as compared with lung fibroblasts and suggest that they may play an important role in activating genes of pulmonary epithelial cells.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 3. The GT Box of SP-A2 Specifically Binds Type II Cell Nuclear Proteins: Protein-Binding Activity Is Higher in Lung Epithelial Cells than in Lung Fibroblasts

A, EMSA of nuclear proteins isolated from primary cultures of human fetal lung type II cells with a radiolabeled probe spanning -66 to -48 bp of SP-A2 5'-flanking DNA that contains the core sequence GGGGTGGGG, termed GT box of SP-A2. Lane 1: (-), free probe; i.e. nuclear proteins were not added to the binding reaction. Lane 2, Probe incubated with type II cell nuclear proteins. Five complexes are observed and labeled with arrows. Lane 3, A 100-fold molar excess of the nonradiolabeled GT box containing oligonucleotide (self) was added to the binding reaction. Lane 4, A 100-fold excess of an oligonucleotide containing a mutated GT box (mut) (see Materials and Methods) was added to the binding reaction. B, EMSA of the binding of nuclear proteins (5 µg) isolated from primary cultures of human fetal lung fibroblasts (lane 2), primary cultures of human fetal type II cells (lane 3), or the lung adenocarcinoma cell line A549 (lane 4) to the 32P-labeled GT box oligonucleotide as probe. Lane 1, - indicates free probe. C, The same preparations of nuclear proteins isolated from type II cells, fibroblasts, and A549 cells used in panel A were incubated with radiolabeled oligonucleotide containing the canonical CRE (TGACGTCA) and analyzed by EMSA. Lane 1, - indicates free probe.

 
Sp1 Is a Component of a Complex of Proteins that Interact with the GT Box of SP-A2
The GT box in SP-A2 resembles the binding sequence recognized by the Cys2-His2 zinc finger-containing transcription factor Sp1 (GGGCGG, GC box) (21). To determine whether the GT box of SP-A2 binds Sp1 in type II cell nuclear proteins, we performed EMSA using the GT box as probe and a consensus Sp1 site as competitor. Again, the radiolabeled GT box of SP-A2 bound nuclear proteins isolated from type II cells as five distinct complexes (Fig. 4AGo, lane 2); each complex was effectively competed with 200-fold excess of self (lane 3) but not with up to 200-fold excess of an oligonucleotide containing a mutated GT box (lane 5) or with one containing a consensus-binding site for transcription factor AP2 (lane 6), a protein also known to bind a GC-rich sequence (22). This provides additional evidence that factors that comprise complexes 1–5 are specific for the GT box of SP-A2. Interestingly, we observed that excess nonradiolabeled Sp1 consensus oligonucleotide effectively competed for the two lowest mobility complexes (complex 1 and 2) but not the higher mobility complexes, 3, 4, or 5 (Fig. 4AGo, lane 4). In parallel, we performed studies using an oligonucleotide containing the Sp1 consensus site as the radiolabeled probe (Fig. 5AGo). The radiolabeled GC box bound type II cell nuclear protein as only three specific bands labeled a, b, and c (Fig. 5AGo, lane 2,); each protein-DNA complex was competed by 200-fold excess of nonradiolabeled GC box oligonucleotide (lane 3). Whereas the GT box oligonucleotide effectively competed with the radiolabeled GC box for binding to complexes b and c, it competed less well for binding to complex a (lane 4). On the other hand, an oligonucleotide containing the AP2 consensus site failed to compete for binding (lane 5). It is unlikely that the highest mobility GC box-binding complex, complex c, represents complex 3 observed in experiments using the GT box as probe because complex c was effectively competed both by nonradiolabeled GC box and GT box, whereas complex 3 was competed only by the GT box. These studies suggest that the type II cell nuclear proteins that comprise complexes 3, 4, and 5 observed in EMSA using the radiolabeled GT box of SP-A2 failed to bind to the GC box under the conditions used.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 4. The GT Box of SP-A2 Interacts with Sp1 and One or More Other Factor(s) in Type II Cell Nuclear Extracts that Is Distinct from Sp1

A, Nuclear extracts isolated from primary cultures of type II cells were incubated with a radiolabeled GT box probe in the absence of nonradiolabeled competitor (+) (complexes 1–5 are detectable) or in the presence of a 200-fold excess of nonradiolabeled oligonucleotides containing the GT box (Self, lane 3), an Sp1 consensus sequence, GC box (Sp1, lane 4), mutated GT box (Self Mut, lane 5), or an AP2 consensus sequence (AP2, lane 6). B, Supershift EMSA using an oligonucleotide containing the GT box as radiolabeled probe and nuclear proteins isolated from type II cells (lane 3). Lane 2, The radiolabeled probe was incubated with the Sp1 antibody in the absence of nuclear proteins. Lane 4, Type II cell nuclear proteins were incubated with Sp1 antibody for 1 h prior to the addition of the radiolabeled GT box probe. A supershifted complex was apparent; however, only complexes 1 and 2 appeared to be diminished in intensity. Lane 1, - indicates free probe.

 


View larger version (44K):
[in this window]
[in a new window]
 
Figure 5. The Sp1 Consensus GC Box Interacts Specifically with Sp1 in Type II Cell Nuclear Extracts

A, EMSA of type II cell nuclear proteins incubated with a radiolabeled GC box as probe in the absence (+, lane 2) or presence of a 200-fold excess of nonradiolabeled GC box (lane 3), nonradiolabeled GT box of SP-A2 (lane 4), or of an oligonucleotide containing the AP2 consensus sequence (lane 5). Lane 1, - indicates free probe. B, Supershift EMSA using the radiolabeled consensus GC box and Sp1 antibody. Lane 1, Free probe. Lane 2, The antibody was incubated with the probe in the absence of nuclear proteins. Lane 3, Radiolabeled GC box was incubated with type II cell nuclear proteins. Lane 4, Sp1 antibody was incubated with nuclear proteins and the radiolabeled GC box probe.

 
The results of competitive EMSA using the radiolabeled GT box and the consensus GC box as nonradiolabeled competitor suggest that Sp1 is a component of the complex of proteins that bind the GT Box of SP-A2. To substantiate this hypothesis, we further analyzed the binding complexes by supershift EMSA using a polyclonal antibody directed against Sp1 (Santa Cruz, Biotech, Santa Cruz, CA) and radiolabeled GT and GC boxes as probes. The antibody used in this study recognizes both the phosphorylated and nonphosphorylated forms of Sp1 and does not cross-react with the highly related proteins Sp2, Sp3, or Sp4. As can be seen, the addition of 0.1 µg Sp1 antibody to the binding reaction containing the radiolabeled GT box as probe supershifted complexes 1 and 2; however, complexes 3, 4, and 5 were not affected (Fig. 4BGo, lane 4). By contrast, in experiments using the canonical GC box as the labeled probe, the addition of an equivalent amount of antibody (0.1 µg) altered the mobility of complexes a and c, but had no detectable effect on complex b (Fig. 5BGo, lane 4). The antibody itself did not interact with either the radiolabeled GT box or GC box probes in the absence of nuclear proteins (Figs. 4BGo and 5BGo, lane 2 of each). In studies to directly analyze the interaction of Sp1 and the GT box, we found that recombinant Sp1 bound both to the GT and the GC box as a single complex; however, binding activity of Sp1 at low concentrations, as determined by intensity of the shifted complex, was higher for the GC box than for the GT box (data not shown). As a control, the binding of purified AP2 protein to the radiolabeled GT box was also tested; no interaction of AP2 and the GT box of SP-A2 could be detected (data not shown). Additionally, as shown in Fig. 4Go, an AP2 consensus sequence failed to compete for binding to any of the five GT box-nuclear protein complexes in EMSA. Together, these studies suggest that Sp1 is a component of a complex of proteins that interact with the GT box. Furthermore, unlike the canonical Sp1 sequence, the GT box of SP-A2 also interacted specifically with another factor(s) in type II cell nuclear proteins that is distinct from Sp1.

The GT Box of SP-A2 Interacts with a Factor(s) Distinct from Sp1
In an attempt to further characterize the lung nuclear protein(s) that comprises complexes 3, 4, and 5 and to begin to understand the relationship between this factor(s) and Sp1, we performed UV cross-linking. The GT box of SP-A2 was uniformly labeled and incubated with type II cell nuclear proteins. The reaction was subjected to long wave UV irradiation to covalently cross-link the proteins in contact with the radiolabeled DNA, and the products were analyzed by SDS-PAGE. Results of these experiments demonstrate that a protein of ~55 kDa in type II cell nuclear extracts specifically bound the radiolabeled GT box probe (Fig. 6AGo, lane 2). This band was effectively competed by 1000-fold excess of self (lane 4) but was more modestly diminished by 1000-fold excess of the canonical GC box (Fig. 6AGo, lanes 7 and 8). The intensity of the 55-kDa band was unaffected by 1000-fold excess of an oligonucleotide containing a mutated GT box (Fig. 6AGo, lanes 5 and 6). These findings suggest that the ~55-kDa protein that interacts with the GT box of SP-A2 has reduced binding activity for the consensus Sp1-binding site, the GC box. A high molecular mass band corresponding in size to Sp1 was not detected as a cross-linked product using either the GT box or the canonical GC box as labeled probe. This may be due to the low sensitivity of the UV cross-linking assay or, alternatively, the amino acids in the DNA-binding domain of Sp1 may not cross-link effectively to DNA. In the autoradiogram shown in Fig. 6AGo, specific binding of a number of proteins of <35 kDa also was apparent. This was not a consistent finding from one experiment to another, and we considered that they may be degradation products of the 55-kDa GT box-binding protein. However, it should be noted that binding of low molecular mass proteins distinct from Sp1 to the GT box of the human c-myc gene promoter has been described; one of these is the 17-kDa PuF (nm23-H2 nucleoside diphosphate kinase) (23).



View larger version (48K):
[in this window]
[in a new window]
 
Figure 6. A Nuclear Factor of 55 kDa Interacts with the GT Box in UV Cross-Linking Studies

A, Type II cell nuclear extracts were incubated with a body-labeled GT box oligonucleotide in the absence (lane 2) or presence of various nonradiolabeled competitors. Lanes 3–4 also contain 500- and 1000-fold molar excess of nonradiolabeled GT box oligonucleotide, respectively; lanes 5–6 also contain 500- and 1000-fold molar excess of nonradiolabeled mutated GT box oligonucleotide, respectively; lanes 7–8 also contain contain 500- and 1000-fold molar excess of nonradiolabeled GC box, respectively, as competitor. B, UV cross-linking was performed using nuclear proteins isolated from primary cultures of fetal type II cells (lane 2), primary cultures of fetal lung fibroblasts (lane 3), and lung adenocarcinoma cell line A549 (lane 4). In lane 1 of panels A and B, type II cell nuclear proteins were incubated with radiolabeled probe in the absence of UV light.

 
Based on EMSA studies in which we found that nuclear protein-binding activity to the GT box in lung fibroblasts was low as compared with type II cells and A549 cells, we expected the levels of the 55-kDa GT box binding protein to be reduced in lung fibroblasts. We performed UV cross-linking using the radiolabeled GT box and nuclear proteins isolated from primary cultures of type II cells, and primary cultures of lung fibroblasts as well as from lung adenocarcinoma A549 cells (Fig. 6BGo). Binding of the 55-kDa factor was barely detectable in lung fibroblasts (Fig. 6BGo, lane 3); by contrast, binding activity in A549 cells was comparable to that in primary cultures of human fetal type II cells (Fig. 6BGo, lanes 2 and 4).

To confirm that a 55-kDa nuclear factor did indeed interact with the GT box of SP-A2, we size fractionated type II cell nuclear proteins by SDS-PAGE and analyzed binding activity of the eluted proteins by EMSA. Type II cell nuclear proteins were heated at 100 C in SDS-containing sample buffer and resolved by SDS-PAGE. The gel was then cut into slices, each slice spanning a molecular mass range as shown in Fig. 7Go. The proteins from each fragment were eluted in a buffer containing Triton X-100, which serves to renature the proteins by extracting the SDS. An aliquot of eluted proteins from each fraction, which represented a distinct molecular mass range, was used in two EMSAs, one using the GT box and the second using the consensus GC box as radiolabeled probes. The GT box was found to bind strongly to a factor in the molecular mass range 50–60 kDa as a single band on EMSA (Fig. 7AGo). Intriguingly, in three of four independent experiments, this factor failed to bind the radiolabeled GC box as determined by EMSA (Fig. 7BGo). Very weak binding of a 50–60 kDa protein to the GC box was detected in a fourth experiment (data not shown). On the other hand, the GC box bound a factor in the size range of 90–150 kDa, which is within the appropriate size range for Sp1 (~100 kDa) (Fig. 7BGo). No binding activity within this size range for the GT box was evident in the experiment shown. In other experiments, we were able to detect some binding activity of a high molecular mass factor(s); however, binding activity of a 90–150 kDa protein(s) for the GT box was markedly reduced as compared with the GC box (data not shown). Low levels of binding activity for the GC box also were detected in the fraction containing proteins of >150 kDa; however, this was not consistently observed in all experiments. Neither of the radiolabeled probes was found to bind nuclear proteins below 35 kDa (data not shown). These findings support those of the UV cross-linking studies, which indicated that a factor of ~55 kDa in type II cell nuclear extracts interacts with the GT box of SP-A2. By contrast, the ~55 kDa protein has dramatically reduced binding activity for the GC box. The SDS-PAGE/EMSA experiments also indicate that this factor is able to interact directly with the GT box, independent of Sp1.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 7. A Type II Cell Nuclear Factor of ~55 kDa Molecular Mass Preferentially Binds to the GT Box of SP-A2, Whereas a Protein of 90–150 kDa Binds to a GC Box

Heat-treated type II cell nuclear proteins were separated by SDS-PAGE. Gel slices (~40 µg) spanning the size range indicated were excised, and the proteins from each slice were eluted and renatured as described in Materials and Methods. The eluates from each gel slice were analyzed by EMSA using a radiolabeled GT box (A) or radiolabeled GC box (B) as probe.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
SP-A gene expression is highly restricted to lung epithelial cells, specifically type II cells and to a lesser extent bronchioalveolar epithelial cells (6). SP-A gene expression is also regulated developmentally; mRNA first becomes detectable in human fetal lung at ~22 weeks and increased levels of SP-A protein are detected in amniotic fluid after 30 weeks of gestation (24). Cyclic AMP treatment of human fetal lung in culture increases the rate of differentiation of type II cells and SP-A gene expression (25). In previous studies, we observed that the human SP-A2 gene is more highly regulated during development and by cAMP than that encoding SP-A1 (9).

In previous studies to map important cis-acting regulatory elements of the human SP-A2 gene, we found that the sequences between -47 and -296 bp are required for cAMP-induced transcription of SP-A2:hGH fusion genes in primary cultures of type II cells. We found that mutagenesis of a CRE-like element at -242 bp markedly reduced basal levels of expression and abolished cAMP-induction of SP-A2 promoter activity (10). In the present study, we found that a 9-bp G-rich sequence (GGGGTGGGG) present between -61 and -53 bp also acts as an essential regulatory element. This element is conserved in the promoter regions of the SP-A genes of a number of species thus far studied. The functional significance of the GT box element in SP-A2 gene transcription was clearly demonstrated by the finding that mutagenesis of this element within the context of the SP-A2-296:hGH fusion gene reduced basal promoter activity by >90% and abolished cAMP responsiveness in primary cultures of human type II cells. A similar reduction of basal expression of SP-A2 promoter activity was observed in lung epithelial cell lines A549 and H441. Furthermore, the SP-A2-62:hGH fusion gene construct, which contains the TATA box and the GT box, was expressed at levels that were ~3-fold greater than those of the SP-A2-47:hGH fusion gene, which lacks the GT box sequence. In previous studies, we observed that fusion genes containing the wild type GT box but a mutated CRESP-A2 sequence also lacked cAMP inducibility (10). These findings suggest that basal and cAMP induction of SP-A promoter activity is mediated by the concerted actions of transcription factors bound to the GT box and at least one upstream sequence, CRESP-A2, within the 296-bp 5'-flanking region. Cyclic AMP stimulation of a number of eukaryotic genes has been found to be mediated by cooperative interactions of transcription factors bound to their respective cis-acting elements. For example, cAMP responsiveness of the promoter for phosphoenolpyruvate carboxykinase appears to be dependent upon the synergistic interaction of CREB bound to a CRE with liver-enriched transcription factors, including CCAAT/enhancer binding protein (C/EBP) family members and AP-1, bound to their response elements (26).

Nuclear proteins isolated from primary cultures of type II cells bound the radiolabeled GT box probe as five specific complexes. Competitive and supershift EMSA analysis of the five complexes that comprise the GT box-binding activity in type II cell nuclear extracts indicates that the transcription factor Sp1 is a component of the lowest mobility complexes 1 and 2. Binding activity was similar in the lung epithelial cell lines A549 and H441 but was dramatically reduced in lung fibroblasts, suggesting that within the lung, specific binding is restricted to pulmonary epithelial cells. Mutagenesis of the same five GT box residues that were found to dramatically reduce fusion gene expression in functional assays also abolished the ability of the mutated oligonucleotide to compete with the radiolabeled wild type GT box probe for protein binding in EMSA. Interestingly, a GT box (or a homologous CA box)-like sequence is located at -51 bp upstream of the transcription initiation site of the human SP-B gene (27) and at -61 and -272 bp within the 5'-flanking sequence of the murine SP-C gene (28). The role of the GT/CA box sequences in the SP-B and SP-C genes has not yet been studied.

Sp1 was originally identified as a ubiquitously expressed protein that binds to the hexanucleotide consensus GC box (GGGCGG). More recently, Sp1 has also been found to bind GT box motifs, such as those found in the rat LH receptor (29), SV40 (30), and T cell receptor (20) genes. Although Sp1 is known to regulate basal expression of a variety of housekeeping genes, its role in directing tissue-specific, developmental, and hormonal regulation of gene expression has also recently been explored. Thus far, Sp1 has been found to regulate expression of erythroid- (31), lymphocyte- (32), and monocyte- (33) specific genes. Additionally, Sp1 is also believed to serve a role in the regulation of expression of the CYP11A gene through binding to an element required for cAMP responsiveness (34). Sp1 is also implicated as a modulator of the retinoic acid/cAMP-dependent transcription of the tissue plasminogen activator gene (35). The mechanism by which Sp1 regulates expression of these genes is not yet defined. However, modulation of Sp1 activity has been found to be mediated by changes in binding activity (36), alternative splicing of its mRNA (37, 38), and posttranslational modification, including phosphorylation (39). Sp1 may also regulate gene expression through interactions with transcription factors bound to other cis-acting elements. Sp1 has been found to interact with NF-{kappa}B (40), Ets (41), and steroid receptors (42, 43). Our findings that cAMP induction of SP-A2-296:hGH expression in transfected type II cells requires the presence of both an intact GT box and CRESP-A2 sequences (Fig. 2Go and Ref. 10) suggest that cAMP induction of SP-A2 gene promoter activity is dependent upon the cooperative interaction of Sp1 and the 55-kDa protein bound to the GT box with transcription factors bound to CRESP-A2. Studies of the leukocyte integrin gene CD11c suggest that myeloid-specific expression and phorbol ester induction are facilitated by the cooperative interaction of Sp1 and AP-1 transcription factors bound to their respective response elements (44).

Analysis of the GT box-binding activity by competition and supershift EMSA revealed that whereas Sp1 is a component of complexes 1 and 2, a protein(s) distinct from Sp1 is a component of complexes 3, 4, and 5. The finding, that similar complexes were not detected by EMSA using the radiolabeled GC box as probe, supports our hypothesis that this factor(s) differs from Sp1 in its binding activity. By UV cross-linking analysis using a body-labeled GT box oligonucleotide as probe, we consistently detected a single binding protein that migrated at ~55 kDa. The finding that binding of the 55-kDa factor was reduced in lung fibroblasts as compared with type II cells supports those of EMSA, which indicated that the GT box-binding activity is enriched in lung epithelial cells. Our inability to detect a binding protein of the apparent size of Sp1 by UV cross-linking may be due to the relatively poor ability of Sp1 to cross-link to DNA. To further characterize the GT box factors, we resolved type II cell nuclear proteins by SDS-PAGE and analyzed binding of the eluted proteins by EMSA. Our findings confirmed that a factor of a molecular mass between 50–60 kDa does indeed interact with the GT box and that this factor manifested significantly higher binding activity for the GT box of SP-A2 as compared with the GC box. By contrast, a higher molecular mass protein, corresponding in size to Sp1, manifested increased binding activity toward the consensus GC box as compared with the GT box. Our finding that the 50–60 kDa factor can bind the GT box in the absence of Sp1 suggests that the binding of Sp1 and the ~55-kDa factor to the GT box can occur independently in vitro. This is further supported by the findings of competitive EMSA, in which a nonradiolabeled GC box specifically competed for complexes 1 and 2 without altering the intensity or pattern of migration of complexes 3, 4, and 5 (Fig. 4AGo).

We considered the possibility that this 55-kDa band could represent an Sp1 degradation product. However, this is unlikely because the same size protein was consistently observed in all type II cell nuclear extracts as well as in nuclear extracts from A549 and H441 cells (data not shown). On the other hand, the 55-kDa protein could be an alternatively spliced form of Sp1. Each of the previously characterized alternatively spliced Sp1 mRNAs encode proteins that exhibit varying degrees of amino-terminal truncation and contain an intact Sp1 DNA-binding domain. Consequently, these isoforms exhibit very similar DNA- binding activity to that of full-length Sp1 (38). However, we observed that a 1000-fold excess of consensus Sp1 oligonucleotide competed only weakly with the radiolabeled GT box for binding to the 55-kDa protein in UV cross-linking assays, whereas a 1000-fold excess of nonradiolabeled GT box oligonucleotide effectively competed for binding to this protein. This finding indicates that the 55-kDa protein binds the GT box preferentially over the GC box sequence and suggests that the 55-kDa protein is distinct from Sp1. Furthermore, a 55- kDa alternatively spliced Sp1 isoform has not as yet been reported (37, 38).

Utilizing EMSA, supershift analysis, UV cross-linking, and SDS-PAGE combined with EMSA, we have demonstrated clearly that both Sp1 and a factor(s) distinct from Sp1 in molecular mass, binding activity, and antigenicity interact with the GT box of SP-A2. Although Sp1 has long been thought to be a unique GC box- and GT/CA box-binding protein, several groups have recently cloned cDNAs for novel GT/CA box-binding proteins. Like Sp1, these proteins contain three zinc fingers in their DNA-binding domains, but exhibit varying degrees of similarity within their transactivation domains (20, 45, 46, 47). On the basis of homology of Sp1 and the GT box-binding proteins to that of a Drosophila body pattern-determining gap gene, Krüppel, these factors constitute a new family of Krüppel-like proteins. Sp1, basic transcription element binding protein-1 (BTEB1), basic Krüppel-like factor (BKLF/TEF-2), and Krox20 represent members of this family that are widely expressed (21, 45, 48, 49). By contrast, basic transcription element binding protein-2 (BTEB2) appears to be restricted to the testis and placenta (46), while expression of erythroid Krüppel-like factor (EKLF) is limited to erythroid cells, suggesting that these proteins may be involved in the regulation of tissue-specific gene expression (50). Analysis of the DNA-binding activity of EKLF and BKLF indicate that they bind to CACCC sequence more avidly than to the GC consensus sequence (48).

Recently, a new member of this family of transcription factors, termed lung Krüppel-like factor (LKLF), has been identified. Expression of LKLF occurs predominantly in lung and spleen. Reduced levels of LKLF expression can also be detected in heart, skeletal muscle, and testis (51). Within the zinc finger DNA-binding domain, LKLF shares a high degree of amino acid identity with the other GT box-binding proteins, EKLF and BTEB2, and somewhat lower similarity with Sp1. In a cotransfection assay of mouse NIH 3T3 cells, LKLF transactivated the human ß-globin promoter through a GT (CA) box. This suggests that a GT box may be the in vivo binding site for LKLF (51). The calculated size of LKLF deduced from the amino acid sequence is ~38 kDa; however, the apparent molecular mass estimated from SDS-PAGE of LKLF has not been reported. Intriguingly, LKLF contains a highly proline-rich transactivation domain (23% proline-rich excluding zinc finger region); high proline content has been found to contribute to slower migration in SDS-PAGE than expected based on the amino acid sequence (52). Thus, we must consider the possibility that the apparent molecular mass of LKLF on SDS/PAGE may be somewhat higher than the calculated value, and that LKLF could be the factor that transactivates SP-A2 promoter activity through the GT box at -61 bp. Currently, we are investigating whether the 55-kDa factor represents LKLF or is a new member of the Krüppel family. Isolation and characterization of this 55-kDa factor and further study of its interaction with Sp1 will provide insight into the regulatory mechanisms involved in SP-A gene transcription in pulmonary type II cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Primary Cell Culture
Lung tissues of midtrimester human abortuses were obtained in accordance with the Donors Anatomical Gift Act of the State of Texas. Consent forms and protocols were approved by the Human Research Review Committee of the University of Texas Southwestern Medical Center at Dallas. The fetal lung tissues were maintained in organ culture for up to 6 days in serum-free Waymouth’s MB752/1 medium in the absence or presence of the cAMP analog, (Bu)2cAMP (1 mM) (53). Primary cultures of type II cells or fibroblasts were prepared from cultured fetal lung tissue after incubation with collagenase (0.5 mg/ml), and type II cells were separated from fibroblasts by differential adhesion (11). The enriched type II cell or fibroblast suspensions were plated onto culture dishes that were coated with extracellular matrix from Madin-Darby canine kidney (MDCK) cells (11) and cultured overnight in Waymouth’s MB752/1 medium containing FCS (10% vol/vol).

Preparation and Maintenance of Cell Lines
The lung adenocarcinoma cell line A549 (ATCC CCL 185) of presumed type II cell origin was maintained in Waymouth’s MB752/1 medium (GIBCO, Grand Island, NY) supplemented with FCS (10%, vol/vol), 100 U/ml penicillin, and 100 µg/ml streptomycin. The human lung adenocarcinoma-derived cell line of presumed Clara cell origin, NCI-H441 (54), was maintained in RPMI 1640 medium (GIBCO) containing FCS (10%, vol/vol). Cells were grown to approximately 75% confluence on 60-mm dishes and infected with 1 x 106 recombinant infectious adenoviral particles containing various SP-A2:hGH fusion genes. Alternatively, the cultured cells were used to prepare nuclear extracts.

Construction of SP-A2:Human GH (hGH) Fusion Genes and Preparation of Recombinant Adenoviruses
Fusion genes containing various amounts of the human SP-A2 5'-flanking DNA linked to the human GH (hGH) structural gene, as reporter, were constructed as described previously (10). Briefly, SP-A2 genomic sequences were subcloned into the BamHI site of the plasmid pACOGH, which contains the promoterless hGH structural gene subcloned into the BamHI and EcoRI sites in the polylinker of plasmid pAC1RR.5 (11). In this manner, the first 20-bp segment of exon I of the SP-A2 gene was fused to the first exon of the hGH structural gene. pAC1RR.5 contains sequences corresponding to the left end of the adenovirus 5 genome from 0 to 1.4 and 9.1–17 map units.

To construct the fusion gene containing mutations in the GT box of SP-A2, -1500 bp of SP-A2 5'-flanking sequence was subcloned into pBluescript KS. CJ236 Escherichia coli strain deficient in dUTPase and uracyl-N-glycosylase was transformed with pBluescript:SP-A2-1500 and M13K07 helper phage; single-stranded uracil containing phage DNA was isolated. This DNA template was used for site-directed mutagenesis that was performed according to the method outlined in Bio-Rad Mutagene Kit (Bio-Rad Laboratories, Richmond, CA) using the following oligonucleotide as primer (5'... GTAGAGCTCTCAGAATTCAGGAA GAAGCCTG... 3' [mutated nucleotides in italics and underlined]). The resulting plasmid, pBluescript:SP-A2-1500GTmut, was used to derive the SP-A2-296GTmut:hGH fusion gene. The accuracy of each construct was verified by double-stranded sequencing using the dideoxy chain termination method and a Sequenase kit (US Biochemical, Cleveland, OH).

To obtain recombinant viruses, 293 cells, a permissive human embryonic kidney cell line that has the capacity to produce E1a, were cotransfected with the recombinant pAC1RR.5 plasmids containing the fusion genes and with pJM17. The pJM17 plasmid, which contains the entire adenovirus genome plus insertion of a 4.3-kb pBR322 plasmid, is too large to be packaged into viral particles. Homologous recombination in vivo of the plasmids results in the formation of a recombinant viral genome that lacks the inserted pBR322 sequence and thus can be packaged into infectious viral particles (55, 56). Viral DNA was analyzed for the presence of the fusion genes by restriction endonuclease digestion followed by Southern analysis; the sequence was further verified by PCR sequencing (New England Biolabs, Beverly, MA). The recombinant viruses were titered to determine the concentration of infectious particles.

Expression of SP-A Fusion Genes in Transfected Cells
Type II cells in primary monolayer culture and lung cell lines were incubated for 1 h with 1 x 106 recombinant infectious viral particles; these were limiting with respect to the number of plated cells, to achieve a multiplicity of infection of 0.2. In this manner, the same number of cells (1 x 106) were infected in each experiment, and fusion gene expression remained consistent from experiment to experiment. After incubation with recombinant adenoviruses, the medium was aspirated and replaced with fresh medium with or without (Bu)2cAMP (1 mM). Media from transfected cells were collected at 24-h intervals and assayed for hGH by RIA using an hGH kit (Nichols Institute, San Juan Capistrano, CA). The levels of hGH in the culture medium have been shown to be proportional to the levels of hGH mRNA transcripts in the cultured cells as determined by Northern blotting (11).

Synthetic Oligonucleotides for EMSAs and for UV Cross-Linking
Oligonucleotides were purchased from the custom primer synthesis laboratory of GIBCO BRL (Gaithersburg, MD). Complementary strands were annealed and chromatographed on Biospin 6 columns (Bio-Rad). The following sequences were synthesized: the region from -66 to -48 bp upstream of the SP-A2 gene transcription initiation site that contains the GT box (5'..TCTCAGGGGTGGGGAAGAA..3') and a GT box in which the nucleotides in italics have been mutated (5'..TCTCAGAATTCAGGAAGAA. 3'). Oligonucleotides were also synthesized containing the consensus binding sites of: Sp1, (5'..ATTCGATCGGGGCGGGGCGAG..3'), AP2 (5'..GATCGAACTGACCGCCCGGCCCGT..3'); the CRE (in italics) of the somatostatin gene (5'..AGCTCTCTCTGACGTCAGCCAAGG..3'). Purified double stranded oligonucleotides were used both as radiolabeled probe and nonradiolabeled competitor.

EMSA
Nuclear extracts were prepared using a procedure described by Dignam et al. (57) except that protease inhibitors (0.5 mM phenylmethylsulfonyl fluoride, 50 µg/ml aprotinin, 200 µg/ml leupeptin, and 10 µM pepstatin) were added to all extraction solutions. Recombinant Sp1 and AP2 protein were purchased from Promega (Madison, WI). Synthetic oligonucleotides were end-labeled with T4 polynucleotide kinase and {gamma}[32P]ATP, incubated with nuclear proteins (5 µg) at room temperature for 30 min in binding buffer (20 mM HEPES, pH 7.6, 12% glycerol, 70 mM KCl, 1 mM EDTA, 1 mM dithiothreitol) and 0.5 µg of poly(deoxyinosinic-deoxycytidylic)-poly(deoxyinosinic-deoxycytidylic) acid as nonspecific competitor and resolved on a 6% polyacrylamide gel (10, 58). The DNA-protein complexes were visualized by autoradiography.

UV Cross-Linking
Double-stranded oligonucleotides containing the GT box of SP-A2 were phosphorylated with T4 kinase and subcloned into the SmaI site of pUC 19 followed by body labeling using strand synthesis as follows. The recombinant plasmids were denatured with 0.2 M NaOH and hybridized to a 5-fold molar excess of pUC/M13 universal primer (-40) and used as template for Sequenase (US Biochemical Corp.) in the presence of dATP (60 µM), dTTP (60 µM), dGTP (5 µM), dCTP (5 µM), [{alpha}-32P]dCTP (0.5 µM), and [{alpha}-32P]dGTP (0.5 µM). The labeled DNAs were digested with BamHI and EcoRI to produce a 52-bp fragment containing a portion of pUC19 polylinker plus the sequences between -65 and -47 bp of the SP-A2 gene 5'-flanking region. The resulting fragments were purified by microcon 100 (Amicon, Beverly, MA) and bio-spin 6 (Bio-Rad), incubated with nuclear proteins isolated from human fetal lung type II cells before and after culture in the presence of (Bu)2cAMP using conditions described above for EMSA, and subjected to UV irradiation for 60 min. After digestion with DNase I and micrococcal nuclease, the DNA protein complexes were resolved on an 11% SDS-polyacrylamide gel and visualized by autoradiography.

Renaturation of Gel-Purified Type II Cell Nuclear Proteins Followed by EMSA
Renaturation of lung nuclear proteins was performed as described by Ossipow et al. (59) with minor modifications. Briefly, type II cell nuclear proteins were boiled for 5 min in SDS-PAGE loading buffer and separated in a SDS 11% polyacrylamide mini gel in parallel with molecular mass standards (Amersham). The gel lane containing type II cell nuclear proteins that had been separated by molecular mass was subsequently cut into 13 slices of ~30 mg, and each piece was homogenized in 3 volumes of elution-renaturation buffer (1% Triton X-100, 20 mM HEPES, pH 7.6, 1 mM EDTA, 100 mM NaCl, 5 mg/ml BSA, 2 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 50 µg/ml aprotinin, 200 µg/ml leupeptin, and 10 µM pepstatin) to remove SDS from protein-SDS complexes. This process sequesters SDS into micelles so that SDS no longer interferes with DNA binding. Microcentrifuge tubes containing the various homogenized gel fragments were incubated for 3 h at 37 C and the polyacrylamide gel pieces were removed by spinning at 56,000 rpm for 20 min using TLA 100.3 rotor (Beckman, Fullerton, CA). Aliquots (14 ml) of supernatant from each fraction were used in an EMSA using the radiolabeled GT box or GC box as probe.


    ACKNOWLEDGMENTS
 
The authors are grateful to Margaret Smith and Jo Smith for their expert help with tissue and cell culture and to Drs. Erwei Gao and Joseph Alcorn for their helpful discussions regarding this work.


    FOOTNOTES
 
Address requests for reprints to: Carole R. Mendelson, Ph.D., Department of Biochemistry, University of Texas Southwestern Medical Center at Dallas, 5323 Harry Hines Boulevard, Dallas, Texas 75235-9038.

This research was supported in part by Basic Research Grant 1-FY94–0879 from the March of Dimes Birth Defects Foundation and by NIH Grant HL-50022. Pampee P. Young was supported in part by NIH Training Grant 5-T32-GM08014, a grant from the Perot Family Foundation, and by a predoctoral fellowship from The Chilton Foundation, Dallas, Texas.

Received for publication January 8, 1997. Revision received March 17, 1997. Accepted for publication April 2, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Avery ME, Mead J 1959 Surface properties in relation to atelectasis and hyaline membrane disease. Am J Dis Child 97:517–523[Abstract/Free Full Text]
  2. Mendelson CR, Boggaram V 1991 Hormonal control of the surfactant system in fetal lung. Annu Rev Physiol 53:415–440[CrossRef][Medline]
  3. Auten RL, Watkins RH, Shapiro DL, Horowitz S 1990 Surfactant apoprotein A (SP-A) is synthesized in airway cells. Am J Respir Cell Mol Biol 3:491–496
  4. Wohlford-Lenane CL, Snyder JM 1992 Localization of the surfactant associated proteins SP-A and SP-B mRNA in fetal rabbit lung tissue by in situ hybridization. Am J Respir Cell Mol Biol 7:335–342
  5. Ballard PL, Hawgood S, Liley H, Wellenstein G, Gonzales LW, Benson B, Cordell B, White RT 1986 Regulation of pulmonary surfactant apoprotein SP-A 28–36 gene in fetal human lung. Proc Natl Acad Sci USA 83:9527–9531[Abstract/Free Full Text]
  6. Snyder JM, Mendelson CR 1987 Induction and characterization of the major surfactant apoprotein during rabbit fetal lung development. Biochim Biophys Acta 920:226–236[Medline]
  7. Katyal SL, Singh G, Locker J 1992 Characterization of a second human pulmonary surfactant associated protein SP-A gene. Am J Respir Cell Mol Biol 6:446–452
  8. McCormick SM, Boggaram V, Mendelson CR 1994 Characterization of mRNA transcripts and organization of human SP-A1 and SP-A2 genes. Am J Physiol 266:L354–L366
  9. McCormick SM, Mendelson CR 1994 Human SP-A1 and SP-A2 genes are differentially regulated during development and by cAMP and glucocorticoids. Am J Physiol 266:L367–L373
  10. Young PP, Mendelson CR 1996 A CRE-like element plays an essential role in cAMP regulation of human SP-A2 gene in alveolar type II cells. Am J Physiol 271:L287–L299
  11. Alcorn JL, Gao E, Chen Q, Smith ME, Gerard RD, Mendelson CR 1993 Genomic elements involved in transcriptional regulation of the rabbit surfactant protein A (SP-A) gene. Mol Endocrinol 7:1072–1085[Abstract/Free Full Text]
  12. Michael LF, Alcorn JL, Gao E, Mendelson CR 1996 Characterization of the cyclic AMP response element of the rabbit surfactant protein-A gene: evidence for transactivators distinct from CREB/ATF family members. Mol Endocrinol 10:159–170[Abstract/Free Full Text]
  13. Bruno MD, Bohinski RJ, Huelsman KM, Whitsett JA, Korfhagen TR 1995 Lung cell-specific expression of the murine surfactant protein A (SP-A) gene is mediated by interactions between the SP-A promoter and thyroid transcription factor-1. J Biol Chem 270:6531–6536[Abstract/Free Full Text]
  14. Bohinski RJ, DiLauro R, Whitsett JA 1994 The lung specific surfactant protein B gene promoter is a target for thyroid transcription factor 1 and hepatocyte nuclear factor 3, indicating common factors for organ specific gene expression along the foregut axis. Mol Cell Biol 14:5671–5681[Abstract/Free Full Text]
  15. Kouretas D, Karinch AM, Rishi A, Melcheris K, Floros J 1993 Conservation analysis of rat and human SP-A gene: identifies 5'-flanking sequences of rat SP-A that bind rat lung nuclear proteins. Exp Lung Res 19:485–503[Medline]
  16. Chen Q, Boggaram V, Mendelson CR 1992 Rabbit lung surfactant protein A gene: identification of a lung-specific DNase I hypersensitive site. Am J Physiol 262:L662–L671
  17. Lacaze-Masmonteil T, Fraslon C, Bourbon J, Raymondjean M, Kahn A 1992 Characterization of the rat pulmonary surfactant protein A promoter. Eur J Biochem 206:613–623[Medline]
  18. Korfhagen TR, Bruno MD, Glasser SW, Ciraolo PJ, Whitsett JA, Lattier DL, Wikenheiser KA, Clark JC 1992 Murine pulmonary surfactant SP-A gene: cloning, sequence, and transcriptional activity. Am J Physiol 263:L546–L554
  19. Philipsen S, Talbot D, Fraser P, Grosveld F 1990 The ß-globin dominant control region: hypersensitive site 2. EMBO J 9:2159–2167[Medline]
  20. Kingsley C, Winoto A 1992 Cloning of GT Box-binding proteins: a novel Sp1 multigene family regulating T-cell receptor gene expression. Mol Cell Biol 12:4251–4261[Abstract/Free Full Text]
  21. Briggs MR, Kadonaga JT, Bell SP, Tjian R 1986 Purification and biochemical characterization of the promoter-specific transcription factor Sp1. Science 234:47–52[Abstract/Free Full Text]
  22. Williams T, Tjian R 1991 Analysis of the DNA-binding and activation properties of the human transcription factor AP-2. Genes Dev 4:670–682
  23. Postel EH, Berberich SJ, Flint SJ, Ferrone CA 1993 Human c-myc transcription factor PuF identified as nm23–H2 nucleoside diphosphate kinase, a candidate suppressor of tumor metastasis. Science 261:478–480[Abstract/Free Full Text]
  24. Shelley SA, Balis JV, Paciga JE, Knuppel RA, Ruffolo EH, Bouis PJ 1982 Surfactant apoproteins in human amniotic fluid: an enzyme-linked immunosorbent assay for the prenatal assessment of lung maturity. Am J Obstet Gynecol 144:224–228[Medline]
  25. Odom MJ, Snyder JM, Mendelson CR 1987 Adenosine 3',5'-monophosphate analogs and ß-adrenergic agonists induce the synthesis of the major surfactant apoprotein in human fetal lung in vitro. Endocrinology 121:1155–1163[Abstract/Free Full Text]
  26. Roesler WJ, Graham JG, Kolen R, Klemm DJ, McFie PJ 1995 The cAMP response element binding protein synergizes with other transcription factors to mediate cAMP responsiveness. J Biol Chem 270:8225–8232[Abstract/Free Full Text]
  27. Pilot-Matias TJ, Kister SE, Fox JL, Kropp K, Glasser SW, Whitsett JA 1989 Structure and organization of the gene encoding human pulmonary surfactant proteolipid SP-B. DNA 8:75–86[Medline]
  28. Glasser SW, Korfhagen TR, Bruno MD, Dey C, Whitsett JA 1990 Structure and expression of the pulmonary surfactant protein SP-C gene in the mouse. J Biol Chem 265:21986–21991[Abstract/Free Full Text]
  29. Tsai-Morris C, Geng Y, Buczko E, Dufau ML 1995 Characterization of diverse functional elements in the upstream Sp1 domain of the rat luteinizing hormone receptor gene promoter. J Biol Chem 270:7487–7494[Abstract/Free Full Text]
  30. Xiao JH, Davidson I, Macchi M, Rosales R, Vigneron R, Staub A, Chambon P 1987 In vitro binding of several cell-specific and ubiquitous nuclear proteins to the GT-I motif of the SV40 enhancer. Genes Dev 1:794–807[Abstract/Free Full Text]
  31. Yu CY, Motamed K, Chen J, Bailey AD, Shen CK 1991 The CACCC box upstream of human embryonic {epsilon} globin gene binds Sp1 and is a functional promoter element in vitro and in vivo. J Biol Chem 266:8907–8915[Abstract/Free Full Text]
  32. Spanopoulou E, Giguere V, Grosveld F 1991 The functional domain of the murine Thy-1 gene promoter. Mol Cell Biol 11:2216–2228[Abstract/Free Full Text]
  33. Zhang D, Hetherington CJ, Tan S, Dziennis SE, Gonzalez DA, Chen H, Tenen DG 1994 Sp1 is a critical factor for the monocyte specific expression of human CD14. J Biol Chem 269:11425–11434[Abstract/Free Full Text]
  34. Venepally P, Waterman MR 1995 Two Sp1 binding sites mediate cAMP-induced transcription of the bovine CYP11A gene through the protein kinase A signalling pathway. J Biol Chem 270:25402–25410[Abstract/Free Full Text]
  35. Darrow AL, Rickles RJ, Pecorino LT, Strickland S 1990 Transcription factor Sp1 is important for retinoic acid induced expression of the tissue plasminogen activator gene during F9-teratocarcinoma cell differentiation. Mol Cell Biol 10:5883–5893[Abstract/Free Full Text]
  36. Jane SM, Gumucio DL, Ney PA, Cunningham JM, Nienhuis AW 1993 Methylation-enhanced binding of Sp1 to the stage selector element of the human {gamma} globin gene promoter may regulate developmental specificity of expression. Mol Cell Biol 13:3272–3281[Abstract/Free Full Text]
  37. Persengiev SP, Saffer JD, Kilpatrick DL 1995 An alternatively spliced form of the transcription factor Sp1 containing only a single glutamine-rich transactivation domain. Proc Natl Acad Sci USA 92:9107–9111[Abstract/Free Full Text]
  38. Persengiev SP, Ravel PJ, Rabinovitch S, Millelle CF, Kilpatrick DL 1996 Transcription factor Sp1 is expressed by three different developmentally regulated messenger ribonucleic acids in mouse spermatogenic cells. Endocrinology 137:638–646[Abstract]
  39. Leggett RW, Armstrong SA, Barry D, Mueller CR 1995 Sp1 is phosphorylated and its DNA binding activity down regulated upon terminal differentiation of the liver. J Biol Chem 270:25879–25884[Abstract/Free Full Text]
  40. Perkins ND, Agranoff AB, Pascal E, Nabel GJ 1994 An interaction between the DNA-binding domains of Rel A (p65) and Sp1 mediates human immunodeficiency virus gene activation. Mol Cell Biol 14:6570–6583[Abstract/Free Full Text]
  41. Dittmer J, Gegonne A, Gitlin SD, Ghysdael J, Brady JN 1994 Regulation of parathyroid hormone-related protein (PTHrP) gene expression. J Biol Chem 269:21428–21434[Abstract/Free Full Text]
  42. Schüle R, Muller M, Kaltschmidt C, Renkawitz R 1988 Many transcription factors interact synergistically with steroid receptors. Science 242:1418–1420[Abstract/Free Full Text]
  43. Muller M, Baniahmad C, Kaltschmidt C, Renkawitz R 1991 Multiple domains of the glucocorticoid receptor involved in synergism with the CACC box factor(s). Mol Endocrinol 5:1498–1503[Abstract/Free Full Text]
  44. Noti JD, Reinemann BC, Petrus MN 1996 Sp1 binds two sites in the CD11c promoter in vivo specifically in myeloid cells and cooperates with AP1 to activate transcription. Mol Cell Biol 16:2940–2950[Abstract]
  45. Imataka H, Sogawa K, Yasumoto K, Kikuchi Y, Sasano K, Kobayashi A, Hayami M, Fujiii-Kuriyama Y 1992 Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene. EMBO J 11:3663–3671[Medline]
  46. Russo MW, Sevetson BR, Milbrandt J 1995 Identification of NAB1, a repressor of NGFI-A- and Krox20-mediated transcription. Proc Natl Acad Sci USA 92:6873–6877[Abstract/Free Full Text]
  47. Sogawa K, Imataka H, Yamasaki Y, Kusume H, Abe H, Fujii-Kuriyama Y 1993 cDNA cloning and transcriptional properties of a novel GC box-binding protein, BTEB2. Nucleic Acids Res 21:1527–1532[Abstract/Free Full Text]
  48. Crossley M, Whitelaw E, Perkins A, Williams G, Fujiwara Y, Orkin SH 1996 Isolation and characterization of the cDNA encoding BKLF/TEF-2, a major CACCC-box-binding protein in erythroid cells and selected other cells. Mol Cell Biol 16:1695–1705[Abstract]
  49. Chavier P, Vesque C, Galliot B, Vigneron M, Dolle P, Duboule D, Charnay P 1990 The segment specific gene KROX-20 encodes a transcription factor with binding sites in the promoter region of the Hox-1.4 gene. EMBO J 9:1209–1218[Medline]
  50. Miller I, Bieker JJ 1993 A novel, erythroid cell-specific murine transcription factor that binds to the CACCC element and is related to the krüppel family of nuclear proteins. Mol Cell Biol 13:2776–2786[Abstract/Free Full Text]
  51. Anderson KP, Kern CB, Crable SC, Lingrel JB 1995 Isolation of a gene encoding a functional zinc finger protein homologous to erythroid krüppel-like factor: identification of a new multigene family. Mol Cell Biol 15:5957–5965[Abstract]
  52. Ogle KF, Lee KK, Krause DC 1992 Nucleotide sequence analysis reveals novel features of the phase variable cytadherence accessory protein HMLUS of Mycoplasma pneumoniae. Infect Immun 60:1633–1641[Abstract/Free Full Text]
  53. Snyder JM, Mendelson CR, Johnston JM 1981 The effect of cortisol on rabbit fetal lung maturation in vitro. Dev Biol 85:129–140[CrossRef][Medline]
  54. Gazdar AF, Linnoila RI, Kurita Y, Oie HK, Mulshine JL, Clark JC, Whitsett JA 1990 Peripheral airway cell differentiation in human lung cancer cell lines. Cancer Res 50:5481–5487[Abstract/Free Full Text]
  55. Gluzman Y, Herwig R, Solnick D 1982 Helper-free adenovirus type-5 vectors. In: Gluzman Y (ed) Eukaryotic Viral Vectors. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp 187–192
  56. McGrory WJ, Baytustam DS, Graham FL 1988 A simple technique for the rescue of early region 1 mutations into infectious human adenovirus type 5. Virology 163:614–617[CrossRef][Medline]
  57. Dignam JD, Lebovitz RM, Roeder R 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  58. Henninghausen L, Lubon H 1987 Interaction of protein with DNA in vitro. Methods Enzymol 152:721–735[Medline]
  59. Ossipow V, Laemmli UK, Schibler U 1993 Simple method to renature DNA-binding proteins separated by SDS-polyacrylamide gel electrophoresis. Nucleic Acids Res 21:6040–6041[Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
D. Liu, H. Benlhabib, and C. R. Mendelson
cAMP Enhances Estrogen-Related Receptor {alpha} (ERR{alpha}) Transcriptional Activity at the SP-A Promoter by Increasing Its Interaction with Protein Kinase A and Steroid Receptor Coactivator 2 (SRC-2)
Mol. Endocrinol., June 1, 2009; 23(6): 772 - 783.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. Liu, M. Yi, M. Smith, and C. R. Mendelson
TTF-1 response element is critical for temporal and spatial regulation and necessary for hormonal regulation of human surfactant protein-A2 promoter activity
Am J Physiol Lung Cell Mol Physiol, August 1, 2008; 295(2): L264 - L271.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. Liu, M. M. Hinshelwood, V. Giguere, and C. R. Mendelson
Estrogen Related Receptor-{alpha} Enhances Surfactant Protein-A Gene Expression in Fetal Lung Type II Cells
Endocrinology, November 1, 2006; 147(11): 5187 - 5195.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
N. Nakano, K. Fukuhara-Takaki, T. Jono, K. Nakajou, N. Eto, S. Horiuchi, M. Takeya, and R. Nagai
Association of Advanced Glycation End Products with A549 Cells, a Human Pulmonary Epithelial Cell Line, Is Mediated by a Receptor Distinct from the Scavenger Receptor Family and RAGE.
J. Biochem., May 1, 2006; 139(5): 821 - 829.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. N. Islam and C. R. Mendelson
Permissive Effects of Oxygen on Cyclic AMP and Interleukin-1 Stimulation of Surfactant Protein A Gene Expression Are Mediated by Epigenetic Mechanisms
Mol. Cell. Biol., April 15, 2006; 26(8): 2901 - 2912.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-Y. Park, H. D. Jang, S. Y. Lee, K.-J. Lee, and E. Kim
Fas-associated Factor-1 Inhibits Nuclear Factor-{kappa}B (NF-{kappa}B) Activity by Interfering with Nuclear Translocation of the RelA (p65) Subunit of NF-{kappa}B
J. Biol. Chem., January 23, 2004; 279(4): 2544 - 2549.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E. Gao, Y. Wang, J. L. Alcorn, and C. R. Mendelson
Transcription factor USF2 is developmentally regulated in fetal lung and acts together with USF1 to induce SP-A gene expression
Am J Physiol Lung Cell Mol Physiol, June 1, 2003; 284(6): L1027 - L1036.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. J. Phillips, J. Bailey, S. C. Robson, and G. N. Europe-Finner
Differential Expression of the Adenylyl Cyclase-Stimulatory Guanosine Triphosphate-Binding Protein Gs{alpha} in the Human Myometrium during Pregnancy and Labor Involves Transcriptional Regulation by Cyclic Adenosine 3',5'-Monophosphate and Binding of Phosphorylated Nuclear Proteins to Multiple GC Boxes within the Promoter
J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5675 - 5685.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. N. Islam and C. R. Mendelson
Potential Role of Nuclear Factor {kappa}B and Reactive Oxygen Species in cAMP and Cytokine Regulation of Surfactant Protein-A Gene Expression in Lung Type II Cells
Mol. Endocrinol., June 1, 2002; 16(6): 1428 - 1440.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Y.-S. Yang, M.-C. W. Yang, B. Wang, and J. C. Weissler
BR22, a Novel Protein, Interacts with Thyroid Transcription Factor-1 and Activates the Human Surfactant Protein B Promoter
Am. J. Respir. Cell Mol. Biol., January 1, 2001; 24(1): 30 - 37.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
P. R. Provost, C. H. Blomquist, C. Godin, X.-F. Huang, N. Flamand, V. Luu-The, D. Nadeau, and Y. Tremblay
Androgen Formation and Metabolism in the Pulmonary Epithelial Cell Line A549: Expression of 17{beta}-Hydroxysteroid Dehydrogenase Type 5 and 3{alpha}-Hydroxysteroid Dehydrogenase Type 3
Endocrinology, August 1, 2000; 141(8): 2786 - 2794.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
T. Suga, M. Kurabayashi, Y. Sando, Y. Ohyama, T. Maeno, Y. Maeno, H. Aizawa, Y. Matsumura, T. Kuwaki, M. Kuro-o, et al.
Disruption of the klotho Gene Causes Pulmonary Emphysema in Mice . Defect in Maintenance of Pulmonary Integrity during Postnatal Life
Am. J. Respir. Cell Mol. Biol., January 1, 2000; 22(1): 26 - 33.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M. D. Bruno, J. A. Whitsett, G. F. Ross, and T. R. Korfhagen
Transcriptional Regulation of the Murine Surfactant Protein-A Gene by B-Myb
J. Biol. Chem., September 24, 1999; 274(39): 27523 - 27528.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. L. Alcorn, R. E. Hammer, K. R. Graves, M. E. Smith, S. D. Maika, L. F. Michael, E. Gao, Y. Wang, and C. R. Mendelson
Analysis of genomic regions involved in regulation of the rabbit surfactant protein A gene in transgenic mice
Am J Physiol Lung Cell Mol Physiol, August 1, 1999; 277(2): L349 - L361.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Ahlgren, G. Suske, M. R. Waterman, and J. Lund
Role of Sp1 in cAMP-dependent Transcriptional Regulation of the Bovine CYP11A Gene
J. Biol. Chem., July 2, 1999; 274(27): 19422 - 19428.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
A. R. Farina, A. Tacconelli, A. Vacca, M. Maroder, A. Gulino, and A. R. Mackay
Transcriptional Up-Regulation of Matrix Metalloproteinase-9 Expression during Spontaneous Epithelial to Neuroblast Phenotype Conversion by SK-N-SH Neuroblastoma Cells, Involved in Enhanced Invasivity, Depends upon GT-Box and Nuclear Factor {{kappa}}B Elements
Cell Growth Differ., May 1, 1999; 10(5): 353 - 367.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
D. R. Breed, L. R. Margraf, J. L. Alcorn, and C. R. Mendelson
Transcription Factor C/EBP{delta} in Fetal Lung: Developmental Regulation and Effects of Cyclic Adenosine 3',5'-Monophosphate and Glucocorticoids
Endocrinology, December 1, 1997; 138(12): 5527 - 5534.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Gao, Y. Wang, J. L. Alcorn, and C. R. Mendelson
The Basic Helix-Loop-Helix-Zipper Transcription Factor USF1 Regulates Expression of the Surfactant Protein-A Gene
J. Biol. Chem., September 12, 1997; 272(37): 23398 - 23406.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. He, E. C. Crouch, K. Rust, E. Spaite, and S. L. Brody
Proximal Promoter of the Surfactant Protein D Gene. REGULATORY ROLES OF AP-1, FORKHEAD BOX, AND GT BOX BINDING PROTEINS
J. Biol. Chem., September 29, 2000; 275(40): 31051 - 31060.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Yi, G.-X. Tong, B. Murry, and C. R. Mendelson
Role of CBP/p300 and SRC-1 in Transcriptional Regulation of the Pulmonary Surfactant Protein-A (SP-A) Gene by Thyroid Transcription Factor-1 (TTF-1)
J. Biol. Chem., January 18, 2002; 277(4): 2997 - 3005.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Young, P. P.
Right arrow Articles by Mendelson, C. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Young, P. P.
Right arrow Articles by Mendelson, C. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals