| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Periodontics, Prevention, and Geriatrics (G.X., Y.C., R.T.F) School of Dentistry and Department of Biological Chemistry School of Medicine University of Michigan Ann Arbor, Michigan 48109-1078, and Department of Molecular Genetics (P.D., G.K.) University of Texas/MD Anderson Cancer Research Institute Houston, Texas 77030
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
To begin exploring mechanisms involved in AA/collagen matrix-dependent
regulation of osteoblast-specific gene expression, we have focused on
the gene for osteocalcin, a
-carboxylated calcium-binding protein
whose expression is largely restricted to the osteoblasts of bone and
the odontoblasts and cementoblasts of teeth (10). Osteocalcin
expression is regulated by a number of calcitropic hormones, including
calcitriol and glucocorticoids (11, 12, 13). In the mouse, two osteocalcin
genes (mOG1, mOG2) and a third osteocalcin-related gene (ORG) form a
contiguous 23-kb gene cluster (14). mOG1 and mOG2 are highly homologous
and expressed only in bone whereas ORG is expressed only in kidney.
Like the osteocalcin gene in human (15) and rat (12), mOG1 and mOG2
each contain four exons and a proximal promoter region containing
canonical TATA and CCAAT box sequences. Two additional regions,
designated OSE1 and OSE2, that are required for the selective
expression of this gene in osteoblast-like osteosarcoma cells have been
identified in the promoter region of mOG2 (16). Both regions bind
nuclear factors from osteosarcoma and primary osteoblast cultures that
are not detected in other tissues. OSF2, the nuclear factor that binds
to OSE2, was recently shown to be immunologically and functionally
related to the polyomavirus enhancer core binding protein
/acute
myeloid leukemia (PEBP
/AML) family of transcription factors (17, 18). In the present study, we show that mOG2 promoter activity is
up-regulated by AA and that this response requires collagen matrix
synthesis and the presence in the mOG2 promoter of an intact OSE2
sequence.
| RESULTS |
|---|
|
|
|---|
|
18 h; results not shown). Neither result can explain the 15- to
20-fold induction of luciferase activity seen with AA
treatment.
|
|
A Na+-dependent AA transporter is required for MC3T3-E1
cells to respond to vitamin C (5). This transporter is stereospecific
in that it allows cells to preferentially accumulate L-AA
vs. D-isoascorbic acid (D-IAA),
thereby explaining known differences in the biological activity of
these two isomers both in vivo and in cell culture (5, 20).
Marked stereoselectivity for extracellular L-AA relative to
D-IAA was also seen when AA-dependent OG2 promoter activity
was measured after 5 days in culture. As shown in Fig. 2C
, half-maximal
stimulation of the OG2 promoter was achieved with 6 µM
L-AA vs. 30 µM for
D-IAA, a 5-fold difference. This stereoselectivity is
similar to that previously reported for AA transport in the same cell
line (5).
A Specific Collagen Matrix Synthesis Inhibitor, 3,4-Dehydroproline,
Blocks AA-Dependent Induction of Promoter Activity
In an earlier study, we showed that 3,4-dehydroproline
(3,4-DHP) blocked AA-dependent induction of endogenous osteocalcin mRNA
(7, 8). Effects of this and other inhibitors were reversible and could
not be explained by nonspecific toxicity. As shown in Fig. 4
, 3
, 4
-DHP (500 µM) used under identical
conditions to those of our earlier work almost completely blocked
AA-dependent induction of the mOG2 promoter if the inhibitor was added
to cells at the beginning of the experiment (compare 5AA with 5AA +
DHP). In contrast, if cells were treated with AA for 2 days before
addition of inhibitor and promoter activity was measured after 3 more
days, only partial inhibition was seen (compare 5AA + DHP with 2AA/3AA
+ DHP). As a further control to eliminate the possibility that 3,4-DHP
was toxic to cells, one group of cultures was pretreated with inhibitor
in the absence of AA for 2 days. AA was then added for an additional 5
days. OG2 activity was induced to the same extent as the 5-day AA
sample that had not been previously exposed to inhibitor (compare
2DHP/5AA with 5AA).
|
Localization of AA-Responsive Regions in the mOG2 Promoter
Because important cis-acting elements have been
described in the promoter of the mOG2 gene, we focused the remainder of
our analysis on the role of this promoter in AA-inducible osteocalcin
expression. Several deletion mutants of the mOG2 promoter have been
described and shown to be active in osteoblastic cell lines (16). These
constructs were transiently transfected into subclone 4 MC3T3-E1 cells
and assayed after 5 days in culture (Fig. 5
). AA
stimulated promoter activity in -1.3, -0.657, and -0.147 kb
constructs, but did not affect the -34 to +13 basal promoter. Although
the magnitude of AA stimulation declined between -0.657 and -0.147
kb, it is clear from these results that an AA-responsive element is
present in the -0.147 mOG2 promoter, a region shown earlier to contain
two osteoblast-specific cis-acting elements (16). For this
reason, subsequent analysis focused on the -0.147 promoter region.
|
Results of gel retardation assays using OSE1, OSE2, and OCE1-specific
double-stranded oligonucleotides and increasing amounts of nuclear
extracts from control or AA-treated subclone 4 cells are shown in Fig. 6
. As shown in panel B, AA treatment had virtually no
effect on the binding of nuclear proteins to OSE1 and OCE1. In
contrast, AA treatment of cells dramatically increased binding of
nuclear proteins to OSE2 (panel A). Imaging of several gel retardation
experiments indicated a mean increase of 5-fold with AA treatment. To
demonstrate the specificity of the OSE2 binding observed, competition
experiments were performed. The shifted species generated by AA-treated
nuclear extracts were the result of sequence-specific interactions in
that they were disrupted by a 25- to 100-fold molar excess of OSE2
oligonucleotide, but not affected by the same oligonucleotide
containing two point mutations in the OSE2 core sequence. Similar
results (not shown) were obtained with control nuclear extracts.
Thus, these results show that AA treatment of cells increases binding
of nuclear factors to OSE2.
|
|
Taken together, our results demonstrate that AA acts through an OSE2 sequence located in the first 147 bp of the mOG2 promoter. This is consistent with the known osteoblast-specific activity of OSE2 and ability of AA to stimulate osteoblast-specific gene expression.
| DISCUSSION |
|---|
|
|
|---|
Our initial attempts to show induction of the mOG2 promoter in MC3T3-E1 cells produced inconsistent results. Because these cells, like other osteoblast-related cell lines, are phenotypically heterogeneous (i.e. only a fraction of cells exhibit osteoblast characteristics), subclones were isolated with high and low osteoblast differentiation potential. AA most dramatically stimulated OG2-luc activity in subclones exhibiting high induction of the endogenous osteocalcin gene. The parent MC3T3-E1 cell population used for subcloning showed only a modest induction of OG2-luc, which explains our initial difficulty in detecting activation of this promoter before subclones were examined. Similarly, strong AA induction of the OG2 promoter was only observed in stably transfected subclones having high endogenous osteoblast-specific gene expression (result not shown). Inducible and uninducible subclones of MC3T3-E1 cells may prove to be powerful experimental tools for the study of transcriptional regulation of osteoblast differentiation and bone formation.
Nontransformed bone cells, such as MC3T3-E1 preosteoblasts and primary osteoblasts, differ significantly from other osteoblast cell culture models, such as ROS17/2.8 osteosarcoma cells, in that the former require AA and collagen matrix synthesis before they will express osteoblast marker proteins such as osteocalcin. In contrast, ROS17/2.8 cells appear to be terminally differentiated, expressing high levels of osteocalcin in the absence of AA (21). Interestingly, in preliminary studies (G. Xiao and R. T. Franceschi, unpublished) we observed that ROS17/2.8 cells do not assemble substantial amounts of ECM after AA treatment. Furthermore, AA does not increase osteocalcin mRNA or stimulate p1.3OG2-luc in ROS17/2.8 cells. This suggests either that an important level of regulation has been lost in this osteosarcoma cell line or that ROS17/2.8 cells have progressed beyond the point in the osteoblast lineage where ECM synthesis is required for phenotypic expression.
Production of type I collagen is one of the earliest events associated
with osteoblastic differentiation. Studies examining effects of AA on
this process generally concluded that actions of this vitamin require
collagen matrix formation (7, 8, 9, 22). Induction of osteoblast markers
by AA can be blocked by collagen synthesis inhibitors or digestion of
the ECM with purified collagenase (8). The present data indicate that a
specific inhibitor of collagen matrix synthesis, 3,4-DHP, also blocks
AA-dependent induction of promoter activity. As was found for AA
induction of endogenous osteocalcin expression, this inhibitor was
fully effective only if added simultaneously with AA; pretreatment of
cells with AA for 2 days before inhibitor addition led to partial
induction of mOG2 promoter activity as would be expected if some
minimal amount of collagenous ECM had to accumulate around cells before
induction of the promoter could commence. The marked time interval of 4
to 5 days between AA addition to cells and the earliest induction of
mOG2 activity is also consistent with a model in which ECM accumulation
was a prerequisite for promoter induction. Thus, transcriptional
regulation of the osteocalcin gene promoter requires synthesis of a
collagenous ECM. One interpretation of these results is that the ECM
produced by osteoblasts interacts with cells possibly via integrins or
other cell-surface receptors to initiate signaling cascades that
ultimately up-regulate and/or activate transcription factors necessary
for osteoblast-specific gene expression and differentiation. Of
interest in this regard is the recent report by Takeuchi and co-workers
showing that a collagen synthesis inhibitor
(L-azetidine-2-carboxylic acid) and an anti-
2ß1
integrin antibody could block AA-induced alkaline phosphatase activity
in MC3T3-E1 cells and that a Asp-Glu-Gly-Ala peptide that interferes
with the binding of collagen to an
2ß1 integrin also inhibits
alkaline phosphatase induction and the differentiation-dependent
down-regulation of the transforming growth factor-ß receptor (23).
Further studies will be required to test this model, although there are
many examples of matrix-integrin interactions being required for
tissue-specific gene expression (24). The present results emphasize the
importance of ECM synthesis to the overall tissue-specific expression
of the osteocalcin gene. Our finding that AA induces promoter activity
approximately 20-fold indicates that at least 95% of total promoter
activity is ECM-dependent.
Experiments described in this report show that an OSE2 sequence
contained in the first 147 bp of the mOG2 promoter is necessary for AA
induction. Mutation or deletion of this element abolished activity.
Furthermore, OSE2 oligomers in the absence of other mOG2 promoter
elements were able to confer AA responsiveness to a -34 minimal mOG2
promoter construct. The stronger effect of AA when using longer mOG2
promoter constructs may be explained by the presence of cryptic
AA-responsive elements elsewhere in the promoter. However, these
upstream sequences clearly require the downstream OSE2 because a point
mutation in this element abolished the AA responsiveness of a -657
promoter construct. Gel retardation assays using an OSE2-containing
oligonucleotide and nuclear extracts from control and AA-treated cells
detected a sequence-specific shifted species in MC3T3-E1 subclone 4
cells. Furthermore, this component was dramatically increased in
AA-treated cell nuclear extracts. OSF2, the osteoblast-related nuclear
protein(s) binding to OSE2 has not yet been isolated. However, OSE2
contains a consensus sequence for the PEBP
/AML family of
transcription factors, and one member of this family, AML-1B, can
specifically bind OSE2 and activate plasmids containing this element.
Furthermore, OSF2 is immunologically related to, but distinct from, the
known AML proteins (17, 18). Once a cDNA and antibodies for OSF2 become
available, it will be important to determine whether its expression and
activity are regulated by AA. The general applicability of our findings
to the control of osteoblast-specific gene expression by AA and ECM
will require analysis of other promoters showing a bone-selective
pattern of expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-[32P[]-dCTP (3000 Ci/mmol) were
purchased from Amersham (Arlington Heights, IL). Chloramphenicol,
2,6,10,14-tetramethylpentadecane, n-butyryl coenzyme A,
3,4-dehydro-L-proline, AA, and D-isoascorbic
acid were obtained from Sigma Chemical Co. (St. Louis. MO). All other
chemicals were of analytic grade.
RNA Analysis
Total RNA was isolated from cell layers as described by
Chomczynski and Sacchi (25). Aliquots of total RNA were fractionated on
0.8% agarose-formaldehyde gels and blotted onto nitrocellulose paper
as described by Thomas (26). The mouse cDNA probes used for
hybridization were obtained from the following sources: osteocalcin
from Dr. John Wozney (Genetics Institute, Boston, MA) (15) and bone
sialoprotein (27) from Dr. Marion Young (National Institute of Dental
Research, Bethesda, MD). All cDNA inserts were excised from plasmid DNA
with the appropriate restriction enzymes and purified by agarose gel
electrophoresis before labeling with
-[32P[]dCTP
using a random primer kit (Boehringer-Mannheim, Indianapolis, IN).
Hybridizations were performed as previously described using an Autoblot
hybridization oven (Bellco Glass, Vineland, NJ) (8) and quantitatively
scanned using an InstantImager (model A2024, Packard Instrument Co,
Downers Grove, IL). All values were normalized for RNA loading by
probing blots with cDNA to 18S rRNA (28).
DNA Constructions
All inserts containing mOG2 promoter regions were cloned in the
p4Luc promoterless luciferase expression vector as previously described
(16). p147mut-luc and p657mut-luc, which both contain a 2-bp
substitution mutation in OSE2 at positions -134 and -133
(CCAAGAACA), were generated from p147-luc and p657-luc by
PCR amplification (29). pCMV-luc, a generous gift from Dr. Jeffrey
Bonadio (University of Michigan Medical School, Ann Arbor, MI), was
constructed by inserting 1.9 kb of firefly luciferase cDNA into pcDNA3
(Invitrogen, San Diego, CA). pSV2CAT was obtained from Promega
(Madison, WI).
Cell Cultures
MC3T3-E1 cells, a generous gift from Dr. M. Kumegawa (Josai
Dental University, Sakado, Japan), were cultured in AA-free
-modified Eagles medium containing 10% FCS as previously
described (7). MC3T3-E1 subclones were obtained by limiting dilution
and evaluated for differentiation potential by growing for 10 days in
AA-containing medium and measuring mRNA levels for osteocalcin and bone
sialoprotein by Northern blot hybridization. Three highly responsive
clones (nos. 4, 14, and 26) and two poorly responsive clones (nos. 17
and 24) were selected for the studies described.
Transfections
MC3T3-E1 cells were transfected using LipofectAMINE reagent
according to the manufactures protocol (GIBCO BRL, Gaithersburg, MD).
Briefly, cells were plated on 35 mm-diameter dishes at a density of
25,000 cells/cm2 and fed 24 h later. After an
additional 24 h, cells were transfected with 0.5 µg each of
p1.3OG2-luc and pSV2CAT. Four hours later, DNA was removed and cells
were fed with 10% FBS-
-modified Eagles medium containing the
indicated additions. Cells were then fed daily until harvest.
Luciferase activity was measured using a Monolight 2010 luminometer
(Analytical Luminescence Laboratory, Ann Arbor, MI) and reagents and
protocols provided by Promega (Madison, WI). After luciferase assays,
cell extracts were heated at 65 C for 15 min for chloramphenicol
acetyltransferase (CAT) assays (30). All transfections were conducted
in triplicate and values are reported as means ± SD.
Cellular plasmid levels were determined by dot blot hybridization of
total cellular DNA using 32P-labeled luciferase and CAT
cDNAs as probes (31). To measure the stability of luciferase protein,
cells previously transfected with p1.3OG2-luc and pSV2CAT were grown in
the presence or absence of AA for 5 days, washed, and treated with
cyclohexamide (2.5 µg/ml). Luciferase and CAT activities were
measured after culturing with cyclohexamide for increasing times (0,
12, 24, and 72 h). Stable transfectants of MC3T3-E1 cells were
established as follows: p1.3OG2-luc was linearized with
BamHI and cotransfected with pcDNA3 at a DNA ratio of 5:1.
After 24 h, cells were transferred to medium containing 400
µg/ml G418 and selected for 14 days. Single cell clones were then
isolated by limiting dilution and tested for AA induction of both
luciferase activity and endogenous osteoblast marker mRNAs.
Preparation of Nuclear Extracts and Gel Retardation Assays
To ensure that clean nuclei were obtained from AA-treated cells,
which contain large amount of collagenous matrix, nuclei were pelleted
through 2 M sucrose two times (30,000 x g,
45 min) before preparation of nuclear extracts according to the method
of Dignam et al. (32). The DNA remaining in the pelleted
fraction after preparation of extracts was measured using the method of
Schneider (33). Amounts of nuclear extract added to each gel
retardation assay are expressed in DNA equivalents. For gel retardation
assays, double-stranded oligonucleotides containing wild type OSE1,
OCE1, or OSE2 sequence (16) were labeled with
[
-32P]ATP and T4 polynucleotide kinase, filled in with
the Klenow fragment of DNA polymerase I, and purified on an acrylamide
gel. Approximately 5 fmol of probe were added to the indicated amounts
of nuclear extracts in 15 µl of a buffer containing 10% glycerol, 50
mM Tris-HCl (pH 7.5), 50 mM NaCl, 2
mM EDTA, 1 mM dithiothreitol, and 2.5 µg each
of leupeptin and pepstatin per ml.
Poly(deoxyinosinic-deoxycytidylic)acid·poly(deoxyinosinic-deoxycytidylic)acid
(1.0 µg) was used as nonspecific competitor. After incubation at 4 C
for 30 min, samples were subjected to electrophoresis on a 4%
polyacrylamide gel in Tris/Glycine buffer [50 mM Tris-HCl
(pH 8.5), 380 mM glycine, 2 mM EDTA, 0.2
mM ß-mercaptoethanol] at 160 V for 100 min in a 4 C cold
room. The gels were dried and autoradiographed. Competition studies to
assess the specificity of nuclear factor binding used unlabeled wild
type OSE2 oligonucleotide and the following mutant (16):
GATCCGCTGCAATCACCAAGAACAGCA
GCGACGTTAGTGGTTCTTGTCGTCTAG
Statistical Analysis
All transfection data are reported as means ±
SD based on triplicate independent cell cultures from a
representative experiment. All experiments were repeated at least
twice, and qualitatively identical results were obtained. Tukey-Kramer
multiple comparisons test was used to assess statistical significance
between samples.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by NIH Grants DK-35317 and DE-11723 (to R.T.F.) and DE-AR11290 (to G.K.), Basic Research Award IFY920871 from the March of Dimes Foundation (to G.K.), GCRC Grant M01-RR00042, and the Michigan Multipurpose Arthritis Center Grant AR20557.
Received for publication February 3, 1997. Accepted for publication April 10, 1997.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Iwasaki, M. Komaki, K. Mimori, E. Leon, Y. Izumi, and I. Ishikawa IL-6 Induces Osteoblastic Differentiation of Periodontal Ligament Cells Journal of Dental Research, October 1, 2008; 87(10): 937 - 942. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Kim and T. Kirsch Collagen/Annexin V Interactions Regulate Chondrocyte Mineralization J. Biol. Chem., April 18, 2008; 283(16): 10310 - 10317. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yu, R. T. Franceschi, M. Luo, X. Zhang, D. Jiang, Y. Lai, Y. Jiang, J. Zhang, and G. Xiao Parathyroid Hormone Increases Activating Transcription Factor 4 Expression and Activity in Osteoblasts: Requirement for Osteocalcin Gene Expression Endocrinology, April 1, 2008; 149(4): 1960 - 1968. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Roca and R. T. Franceschi Analysis of transcription factor interactions in osteoblasts using competitive chromatin immunoprecipitation Nucleic Acids Res., March 1, 2008; 36(5): 1723 - 1730. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yu, Y. Jiang, D. L. Galson, M. Luo, Y. Lai, Y. Lu, H.-J. Ouyang, J. Zhang, and G. Xiao General Transcription Factor IIA-{gamma} Increases Osteoblast-specific Osteocalcin Gene Expression via Activating Transcription Factor 4 and Runt-related Transcription Factor 2 J. Biol. Chem., February 29, 2008; 283(9): 5542 - 5553. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wu, T. Iguchi, N. Itoh, K. Okamoto, T. Takagi, K. Tanaka, and T. Nakanishi Ascorbic Acid Transported by Sodium-Dependent Vitamin C Transporter 2 Stimulates Steroidogenesis in Human Choriocarcinoma Cells Endocrinology, January 1, 2008; 149(1): 73 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Phillippi, E. Miller, L. Weiss, J. Huard, A. Waggoner, and P. Campbell Microenvironments Engineered by Inkjet Bioprinting Spatially Direct Adult Stem Cells Toward Muscle- and Bone-Like Subpopulations Stem Cells, January 1, 2008; 26(1): 127 - 134. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhu, X. Jia, G. Xiao, Y. Kang, N. C. Partridge, and L. Qin IMPLICATIONS FOR OSTEOLYTIC BONE METASTASES J. Biol. Chem., September 14, 2007; 282(37): 26656 - 26664. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Feng, G. Anderson, G. Xiao, G. Elliott, L. Leoni, M. Y. Mapara, G. D. Roodman, and S. Lentzsch SDX-308, a nonsteroidal anti-inflammatory agent, inhibits NF-{kappa}B activity, resulting in strong inhibition of osteoclast formation/activity and multiple myeloma cell growth Blood, March 1, 2007; 109(5): 2130 - 2138. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ge, G. Xiao, D. Jiang, and R. T. Franceschi Critical role of the extracellular signal-regulated kinase-MAPK pathway in osteoblast differentiation and skeletal development J. Cell Biol., February 26, 2007; 176(5): 709 - 718. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Xiao, D. Jiang, C. Ge, Z. Zhao, Y. Lai, H. Boules, M. Phimphilai, X. Yang, G. Karsenty, and R. T. Franceschi Cooperative Interactions between Activating Transcription Factor 4 and Runx2/Cbfa1 Stimulate Osteoblast-specific Osteocalcin Gene Expression J. Biol. Chem., September 2, 2005; 280(35): 30689 - 30696. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Roca, M. Phimphilai, R. Gopalakrishnan, G. Xiao, and R. T. Franceschi Cooperative Interactions between RUNX2 and Homeodomain Protein-binding Sites Are Critical for the Osteoblast-specific Expression of the Bone Sialoprotein Gene J. Biol. Chem., September 2, 2005; 280(35): 30845 - 30855. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Akhouayri, I. Quelo, and R. St-Arnaud Sequence-Specific DNA Binding by the {alpha}NAC Coactivator Is Required for Potentiation of c-Jun-Dependent Transcription of the Osteocalcin Gene Mol. Cell. Biol., May 1, 2005; 25(9): 3452 - 3460. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Qiao, P. Shapiro, R. Kumar, and A. Passaniti Insulin-like Growth Factor-1 Regulates Endogenous RUNX2 Activity in Endothelial Cells through a Phosphatidylinositol 3-Kinase/ERK-dependent and Akt-independent Signaling Pathway J. Biol. Chem., October 8, 2004; 279(41): 42709 - 42718. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-S. Xiao, A. B. Hjelmeland, and L. D. Quarles Selective Deficiency of the "Bone-related" Runx2-II Unexpectedly Preserves Osteoblast-mediated Skeletogenesis J. Biol. Chem., May 7, 2004; 279(19): 20307 - 20313. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Jiang, R. T. Franceschi, H. Boules, and G. Xiao Parathyroid Hormone Induction of the Osteocalcin Gene: REQUIREMENT FOR AN OSTEOBLAST-SPECIFIC ELEMENT 1 SEQUENCE IN THE PROMOTER AND INVOLVEMENT OF MULTIPLE SIGNALING PATHWAYS J. Biol. Chem., February 13, 2004; 279(7): 5329 - 5337. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stock, H. Schafer, S. Stricker, G. Gross, S. Mundlos, and F. Otto Expression of Galectin-3 in Skeletal Tissues Is Controlled by Runx2 J. Biol. Chem., May 2, 2003; 278(19): 17360 - 17367. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Willis, A. P. Loewy, N. Charlton-Kachigian, J.-S. Shao, D. M. Ornitz, and D. A. Towler Regulation of Osteocalcin Gene Expression by a Novel Ku Antigen Transcription Factor Complex J. Biol. Chem., September 27, 2002; 277(40): 37280 - 37291. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Xiao, D. Jiang, R. Gopalakrishnan, and R. T. Franceschi Fibroblast Growth Factor 2 Induction of the Osteocalcin Gene Requires MAPK Activity and Phosphorylation of the Osteoblast Transcription Factor, Cbfa1/Runx2 J. Biol. Chem., September 20, 2002; 277(39): 36181 - 36187. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. D'Alonzo, A. J. Kowalski, D. T. Denhardt, G. A. Nickols, and N. C. Partridge Regulation of Collagenase-3 and Osteocalcin Gene Expression by Collagen and Osteopontin in Differentiating MC3T3-E1 Cells J. Biol. Chem., June 28, 2002; 277(27): 24788 - 24798. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Otsuka, Y. Kato, S. Hirose, and H. Hagiwara Role of Ascorbic Acid in the Osteoclast Formation: Induction of Osteoclast Differentiation Factor with Formation of the Extracellular Collagen Matrix Endocrinology, August 1, 2000; 141(8): 3006 - 3011. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Benson, J. L. Bargeon, G. Xiao, P. E. Thomas, A. Kim, Y. Cui, and R. T. Franceschi Identification of a Homeodomain Binding Element in the Bone Sialoprotein Gene Promoter That Is Required for Its Osteoblast-selective Expression J. Biol. Chem., April 28, 2000; 275(18): 13907 - 13917. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Xiao, D. Jiang, P. Thomas, M. D. Benson, K. Guan, G. Karsenty, and R. T. Franceschi MAPK Pathways Activate and Phosphorylate the Osteoblast-specific Transcription Factor, Cbfa1 J. Biol. Chem., February 11, 2000; 275(6): 4453 - 4459. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Otsuka, A. Yamaguchi, S. Hirose, and H. Hagiwara Characterization of osteoblastic differentiation of stromal cell line ST2 that is induced by ascorbic acid Am J Physiol Cell Physiol, July 1, 1999; 277(1): C132 - C138. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.T. Franceschi The Developmental Control of Osteoblast-Specific Gene Expression: Role of Specific Transcription Factors and the Extracellular Matrix Environment Critical Reviews in Oral Biology & Medicine, January 1, 1999; 10(1): 40 - 57. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Xiao, D. Wang, M. D. Benson, G. Karsenty, and R. T. Franceschi Role of the alpha 2-Integrin in Osteoblast-specific Gene Expression and Activation of the Osf2 Transcription Factor J. Biol. Chem., December 4, 1998; 273(49): 32988 - 32994. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Frendo, G. Xiao, S. Fuchs, R. T. Franceschi, G. Karsenty, and P. Ducy Functional Hierarchy between Two OSE2 Elements in the Control of Osteocalcin Gene Expression in Vivo J. Biol. Chem., November 13, 1998; 273(46): 30509 - 30516. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Winchester, N. Selvamurugan, R. C. D'Alonzo, and N. C. Partridge Developmental Regulation of Collagenase-3 mRNA in Normal, Differentiating Osteoblasts through the Activator Protein-1 and the runt Domain Binding Sites J. Biol. Chem., July 21, 2000; 275(30): 23310 - 23318. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |