help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xiao, G.
Right arrow Articles by Franceschi, R. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xiao, G.
Right arrow Articles by Franceschi, R. T.
Molecular Endocrinology 11 (8): 1103-1113
Copyright © 1997 by The Endocrine Society

Ascorbic Acid-Dependent Activation of the Osteocalcin Promoter in MC3T3-E1 Preosteoblasts: Requirement for Collagen Matrix Synthesis and the Presence of an Intact OSE2 Sequence

Guozhi Xiao, Yingqi Cui, Patricia Ducy, Gerard Karsenty and Renny T. Franceschi

Department of Periodontics, Prevention, and Geriatrics (G.X., Y.C., R.T.F) School of Dentistry and Department of Biological Chemistry School of Medicine University of Michigan Ann Arbor, Michigan 48109-1078, and Department of Molecular Genetics (P.D., G.K.) University of Texas/MD Anderson Cancer Research Institute Houston, Texas 77030


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Osteocalcin is a hormonally regulated calcium-binding protein made almost exclusively by osteoblasts. In normal cells, osteocalcin expression requires ascorbic acid (AA), an essential cofactor for osteoblast differentiation both in vivo and in vitro. To determine the mechanism of this regulation, subclones of MC3T3-E1 preosteoblasts were transiently transfected with 1.3 kb of the mouse osteocalcin gene 2 promoter driving expression of firefly luciferase. AA stimulated luciferase activity 20-fold after 4–5 days. This response was stereospecific to L-ascorbic acid and was only detected in MC3T3-E1 subclones showing strong AA induction of the endogenous osteocalcin gene. Similar results were also obtained in MC3T3-E1 cells stably transfected with the osteocalcin promoter. A specific inhibitor of collagen synthesis, 3,4-dehydroproline, blocked AA-dependent induction of promoter activity, indicating that regulation of the osteocalcin gene requires collagen matrix synthesis. Deletion analysis of the mOG2 promoter identified an essential region for AA responsiveness between -147 and -116 bp. This region contains a single copy of the previously described osteoblast-specific element, OSE2. Deletion and mutation of OSE2 in DNA transfection assays established the requirement for this element in the AA response. Furthermore, DNA-binding assays revealed that MC3T3-E1 cells contain OSF2, the nuclear factor binding to OSE2, and that binding of OSF2 to OSE2 is up-regulated by AA treatment. Taken collectively, our results indicate that an intact OSE2 sequence is required for the induction of osteocalcin expression by AA.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Ascorbic acid (AA, reduced vitamin C) is essential for the formation of bone (1) and other connective tissues and necessary for the in vitro differentiation of osteoblasts and other mesenchyme-derived cell types including adipocytes, myoblasts, chondrocytes, and odontoblasts [for review, see Franceschi, 1992 (2)]. In vivo autoradiographic studies demonstrated that radiolabeled vitamin C, when injected systemically, accumulates at sites of active bone formation (3). To facilitate this process, osteoblasts contain a specific Na+-dependent AA transport system that is essential for the intracellular accumulation of vitamin C and cellular responsiveness (4, 5). In primary cultures of osteoblast-like cells (6) or nontransformed osteoblast-like cell lines such as murine MC3T3-E1 cells (7, 8, 9), AA stimulates procollagen hydroxylation, processing, and fibril assembly followed by a dramatic induction of specific genes associated with the osteoblast phenotype including those encoding osteocalcin, alkaline phosphatase, bone sialoprotein, and the PTH/PTH-related protein receptor. Actions of AA on bone require collagen matrix synthesis. Identical dose-response relationships are obtained for the stimulation of collagen matrix formation by AA and induction of osteoblast markers. Furthermore, induction of gene expression by AA is specifically and reversibly blocked by inhibitors of collagen matrix formation or purified bacterial collagenase (7, 8). Thus, studies with AA strongly support a model in which expression of the osteoblast phenotype is profoundly affected by the extracellular matrix (ECM).

To begin exploring mechanisms involved in AA/collagen matrix-dependent regulation of osteoblast-specific gene expression, we have focused on the gene for osteocalcin, a {gamma}-carboxylated calcium-binding protein whose expression is largely restricted to the osteoblasts of bone and the odontoblasts and cementoblasts of teeth (10). Osteocalcin expression is regulated by a number of calcitropic hormones, including calcitriol and glucocorticoids (11, 12, 13). In the mouse, two osteocalcin genes (mOG1, mOG2) and a third osteocalcin-related gene (ORG) form a contiguous 23-kb gene cluster (14). mOG1 and mOG2 are highly homologous and expressed only in bone whereas ORG is expressed only in kidney. Like the osteocalcin gene in human (15) and rat (12), mOG1 and mOG2 each contain four exons and a proximal promoter region containing canonical TATA and CCAAT box sequences. Two additional regions, designated OSE1 and OSE2, that are required for the selective expression of this gene in osteoblast-like osteosarcoma cells have been identified in the promoter region of mOG2 (16). Both regions bind nuclear factors from osteosarcoma and primary osteoblast cultures that are not detected in other tissues. OSF2, the nuclear factor that binds to OSE2, was recently shown to be immunologically and functionally related to the polyomavirus enhancer core binding protein {alpha}/acute myeloid leukemia (PEBP{alpha}/AML) family of transcription factors (17, 18). In the present study, we show that mOG2 promoter activity is up-regulated by AA and that this response requires collagen matrix synthesis and the presence in the mOG2 promoter of an intact OSE2 sequence.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Analysis of MC3T3-E1 Subclones for AA Responsiveness and OG2 Promoter Induction
MC3T3-E1 cells, like other osteoblast cells lines (19), are phenotypically heterogeneous (i.e. only a fraction of cells exhibit osteoblast characteristics). To obtain a highly responsive cell population, MC3T3-E1 cells were subcloned by limiting dilution, and approximately 50 clones were isolated. RNA was prepared from individual clonal lines that were grown for 12 days in the presence or absence of AA. Northern blots were probed for two osteoblast-related mRNAs, osteocalcin and bone sialoprotein. Representative clones with high and low responsiveness to AA are shown in Fig. 1Go, A and B. Clones 4, 14, and 26 expressed osteocalcin and bone sialoprotein mRNAs at high levels whereas clones 17 and 24 had low to undetectable levels of message. Lipofectamine was used to transiently transfect each clone with p1.3OG2-luc, a plasmid containing 1.3 kb of the proximal OG2 promoter driving expression of firefly luciferase, and pSV2CAT. As shown in Fig. 1CGo, AA most dramatically stimulated luciferase activity in clones exhibiting high induction of the endogenous osteocalcin gene. The parent MC3T3-E1 cell population used for cloning showed only a modest induction, which may explain our initial difficulty in detecting AA stimulation of this promoter before subclones were examined. The unrelated cytomegalovirus (CMV) promoter was not induced by AA treatment nor was the pSV2CAT used for normalization of transfections (result not shown). Highly responsive clone 4 cells were used in all subsequent transient transfection experiments. Because important cis-acting elements have been described in the promoter of the mOG2 gene, we focused the remainder of our analysis on the role of AA in osteocalcin expression.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 1. AA Induction of p1.3OG2-luc Expression in MC3T3-E1 Subclones

A and B, Expression of endogenous osteoblast-related mRNAs. MC3T3-E1 subclones isolated as described in Materials and Methods or the parent cell line were cultured for 5 days in the presence (+) or absence (-) of 50 µg/ml AA. For each group, total RNA was extracted for Northern blot hybridization using cDNA probes for osteocalcin mRNA (OCN), bone sialoprotein mRNA (BSP), and 18S rRNA (for normalization). Panel B shows normalized values for osteocalcin mRNA as determined by imaging of hybridized blots. C, Normalized luciferase activity. MC3T3-E1 cells or subclones were cotransfected with p1.3OG2-luc reporter plasmid (0.5 µg) and pSV2CAT (0.5 µg) and treated as described in panel A. A separate group of subclone 4 cells was transfected with pcDNA3-luc, which uses the CMV promoter to drive luciferase expression (4/CMVluc). After 5 days, cells were harvested and assayed for luciferase and CAT activities. In all cases, luciferase was normalized to CAT activity, which did not vary by more than 50% between samples. Experiments were repeated a minimum of two times. Error bars indicate SD of the mean of three separate transfections.

 
Time Course and Specificity of mOG2 Induction by AA
Several days of AA treatment are required for induction of endogenous osteocalcin (7). Consistent with this observation, 4 to 5 days were required for AA to increase luciferase activity in cells either transiently or stably transfected with OG2-luc (Figs. 2AGo and 3CGo). Endogenous osteocalcin mRNA was also induced in both transient and stable clones (Fig. 2AGo, inset, and Fig. 3Go, A and B). Because the 5-day period required for detection of the AA response is relatively long for a transient transfection experiment, two control studies were carried out to exclude differences in plasmid retention or luciferase stability between control and AA-treated cells as possible explanations for results. Plasmid DNAs were measured by slot blot hybridization using aliquots of total cellular DNA isolated 5 days after transfection (Fig. 2BGo). For both p1.3OG2-luc and pSV2CAT, the relative level of plasmid in AA vs. control cells was approximately 1.3. The half-life of luciferase enzyme activity in AA and control cells was nearly the same (~18 h; results not shown). Neither result can explain the 15- to 20-fold induction of luciferase activity seen with AA treatment.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 2. Characterization of AA Induction of p1.3OG2-luc in Transient Transfections

A, Time course. MC3T3-E1 subclone 4 cells were cotransfected with p1.3OG2-luc/pSV2CAT (2.0 µg each) for 4 h. After transfection, the cells are cultured for different times (1, 2, 3, 4, and 5 days) in the presence (closed circles) or absence (open circles) of AA. Inset, Endogenous osteocalcin mRNA. A separate set of identically transfected cells were used to measure endogenous osteocalcin mRNA by Northern blot hybridization after 5 days with (5AA) or without (5C) AA. B, Measurement of transfected plasmid levels. Cells were transfected as in panel A and cultured with or without AA for 5 days. Total cellular DNA was isolated, and DNA equivalent to the amount of cell extract used for luciferase assays was either blotted directly or diluted as indicated before being probed for p1.3OG2-luc (Luciferase) or pSV2CAT (CAT). Imaging of blots gave the following ratios for each plasmid in AA-treated/control cells: p1.3OG2-luc, 1.3; pSV2CAT, 1.33. C, Stereospecificity of AA induction. MC3T3-E1 subclone 4 cells were transfected as described in Fig. 1CGo. Cells were then grown for 5 more days in control medium containing increasing concentrations of L-AA (open circles) or D-isoascorbic acid (closed circles). Values are mean ± SD of triplicate transfections.

 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. AA Induction of p1.3OG2-luc in Stably Transfected Cells

MC3T3-E1 cells were stably transfected with pOG2-luc and pcDNA3 as described in Materials and Methods. Single cell clones were picked and screened for AA-dependent activation of endogenous osteoblast markers and luciferase. Results with a highly responsive clone are shown. Cells were grown for the indicated times in the presence (+, closed symbols) or absence (-, open symbols) of AA and assayed for endogenous bone-related mRNAs (A,B) or luciferase (C). Luciferase activity was normalized to DNA. Symbols (panel B): osteocalcin mRNA ({circ},•); bone sialoprotein (BSP) mRNA ({triangleup}, {blacktriangleup})

 
The use of a cell line containing stably integrated p1.3OG2-luc allowed a more detailed analysis of the relationship between activation of the transfected promoter and endogenous osteocalcin and bone sialoprotein mRNAs during a long-term (21-day) culture period (Fig. 3Go). In control cultures, luciferase activity and levels of both mRNAs remained low at all times. As was seen with transient transfections, AA consistently stimulated luciferase activity after 4–6 days. Activity continued to increase to day 21. Endogenous osteocalcin mRNA was first detected after 6–8 days and generally paralleled luciferase activity for the duration of the experiment. Bone sialoprotein mRNA followed a similar time course.

A Na+-dependent AA transporter is required for MC3T3-E1 cells to respond to vitamin C (5). This transporter is stereospecific in that it allows cells to preferentially accumulate L-AA vs. D-isoascorbic acid (D-IAA), thereby explaining known differences in the biological activity of these two isomers both in vivo and in cell culture (5, 20). Marked stereoselectivity for extracellular L-AA relative to D-IAA was also seen when AA-dependent OG2 promoter activity was measured after 5 days in culture. As shown in Fig. 2CGo, half-maximal stimulation of the OG2 promoter was achieved with 6 µM L-AA vs. 30 µM for D-IAA, a 5-fold difference. This stereoselectivity is similar to that previously reported for AA transport in the same cell line (5).

A Specific Collagen Matrix Synthesis Inhibitor, 3,4-Dehydroproline, Blocks AA-Dependent Induction of Promoter Activity
In an earlier study, we showed that 3,4-dehydroproline (3,4-DHP) blocked AA-dependent induction of endogenous osteocalcin mRNA (7, 8). Effects of this and other inhibitors were reversible and could not be explained by nonspecific toxicity. As shown in Fig. 4Go, 3Go, 4Go-DHP (500 µM) used under identical conditions to those of our earlier work almost completely blocked AA-dependent induction of the mOG2 promoter if the inhibitor was added to cells at the beginning of the experiment (compare 5AA with 5AA + DHP). In contrast, if cells were treated with AA for 2 days before addition of inhibitor and promoter activity was measured after 3 more days, only partial inhibition was seen (compare 5AA + DHP with 2AA/3AA + DHP). As a further control to eliminate the possibility that 3,4-DHP was toxic to cells, one group of cultures was pretreated with inhibitor in the absence of AA for 2 days. AA was then added for an additional 5 days. OG2 activity was induced to the same extent as the 5-day AA sample that had not been previously exposed to inhibitor (compare 2DHP/5AA with 5AA).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 4. Effect of a Collagen Synthesis Inhibitor on Induction of p1.3OG2-luc by AA

After transient transfections, MC3T3-E1 subclone 4 cells were grown for 5 days under the following conditions: control medium (5C), control medium containing 500 µM 3,4-DHP (5DHP), AA-containing medium (5AA), AA-containing medium plus 3,4-DHP (5AA+DHP), 2 days in control medium followed by 3 days in control medium plus 3,4-DHP (2C/3DHP), or 2 days in AA-containing medium followed by 3 days in AA medium plus 3,4-DHP (2AA/3AA+DHP). A separate group of cells was pretreated with 3,4-DHP for 2 days, washed twice to remove inhibitor, transfected, and then grown for 5 more days in AA-containing medium (2DHP/5AA).

 
Taken together, the above results establish that AA increases osteocalcin expression by stimulating the 1.3-kb mOG2 promoter, that this response is preferentially stimulated by the L-isomer of AA, and that the AA response requires collagen matrix synthesis.

Localization of AA-Responsive Regions in the mOG2 Promoter
Because important cis-acting elements have been described in the promoter of the mOG2 gene, we focused the remainder of our analysis on the role of this promoter in AA-inducible osteocalcin expression. Several deletion mutants of the mOG2 promoter have been described and shown to be active in osteoblastic cell lines (16). These constructs were transiently transfected into subclone 4 MC3T3-E1 cells and assayed after 5 days in culture (Fig. 5Go). AA stimulated promoter activity in -1.3, -0.657, and -0.147 kb constructs, but did not affect the -34 to +13 basal promoter. Although the magnitude of AA stimulation declined between -0.657 and -0.147 kb, it is clear from these results that an AA-responsive element is present in the -0.147 mOG2 promoter, a region shown earlier to contain two osteoblast-specific cis-acting elements (16). For this reason, subsequent analysis focused on the -0.147 promoter region.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 5. AA Responsiveness of mOG2 Promoter Deletion Mutants

MC3T3-E1 subclone 4 cells were transiently transfected with p1.3OG2-luc or the indicated deletions plus pSV2CAT and grown for 5 days in the presence (+) or absence (-) of AA. For each construct, mean luciferase activity for control samples was set at unity and the fold-stimulation in AA-treated samples was determined. *, Ratio (AA/C) is significantly different from unity at P < 0.001

 
AA Treatment Increases Binding of Nuclear Proteins to OSE2
The above described functional analysis of the OG2 promoter indicates that the -147 to -34 bp promoter region contains sufficient sequence information for AA responsiveness. Methylation protection assays (not shown) indicated that subclone 4 MC3T3-E1 cell nuclear extracts contain factors capable of binding to the three sequence elements previously described in ROS17/2.8 cells (16); the OSE1 region (-74 to -47 bp), the OCE1 region (-111 to -83 bp), which contains an E box, and the OSE2 region (-146 to -132 bp). OSE1 and OSE2 elements are both required for osteoblast-specific promoter activity.

Results of gel retardation assays using OSE1, OSE2, and OCE1-specific double-stranded oligonucleotides and increasing amounts of nuclear extracts from control or AA-treated subclone 4 cells are shown in Fig. 6Go. As shown in panel B, AA treatment had virtually no effect on the binding of nuclear proteins to OSE1 and OCE1. In contrast, AA treatment of cells dramatically increased binding of nuclear proteins to OSE2 (panel A). Imaging of several gel retardation experiments indicated a mean increase of 5-fold with AA treatment. To demonstrate the specificity of the OSE2 binding observed, competition experiments were performed. The shifted species generated by AA-treated nuclear extracts were the result of sequence-specific interactions in that they were disrupted by a 25- to 100-fold molar excess of OSE2 oligonucleotide, but not affected by the same oligonucleotide containing two point mutations in the OSE2 core sequence. Similar results (not shown) were obtained with control nuclear extracts. Thus, these results show that AA treatment of cells increases binding of nuclear factors to OSE2.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 6. Effect of AA Treatment on the Binding of Nuclear Extracts to Osteoblast-Specific Promoter Elements

A, Gel retardation assays using an OSE2 oligonucleotide. Nuclear extracts were prepared from MC3T3-E1 subclone 4 cells grown for 6 days in control or AA-containing medium. The indicated amounts of extracts (expressed as DNA equivalents) were incubated with end-labeled OSE2 double-stranded oligonucleotide alone or in the presence of competitors and analyzed by electrophoresis on 4% polyacrylamide gels as described in Materials and Methods. Lane 1, labeled OSE2 without nuclear extract; lanes 2 and 4, OSE2 with nuclear extract from control cells; lanes 3 and 5, OSE2 with nuclear extract from AA-treated cells; lanes 6–12, labeled OSE2 incubated with 2 µg nuclear extract from AA-treated cells alone (lane 6) or with the indicated molar excess of unlabeled wild type (OSE2 Wt) or mutated OSE2 (OSE2 Mut). B, Gel retardation assays using OSE1 and OCE1 oligonucleotides. Gel retardation assays were performed as in panel A except that labeled OSE1 (lanes 1–5) or OCE1 (lanes 6–10) double-stranded oligonucleotides were used. Lanes 1 and 6, Labeled oligonucleotide in the absence of nuclear extract; lanes 2, 3, 7, and 8, labeled oligonucleotides incubated with control nuclear extracts; lanes 4, 5, 9, and 10, labeled oligonucleotides incubated with nuclear extracts from AA-treated cells.

 
A Wild Type OSE2 Is Required for AA Action
If OSE2 is indeed required for the activation of mOG2 by AA, mutation or deletion of this element should abolish the AA response. Furthermore, OSE2 fused to a minimal promoter should also respond to vitamin. As predicted, a two-nucleotide substitution in the OSE2 core element of the -147 to +13 promoter region abolished the AA response (Fig. 7Go). In addition, deletion analysis revealed a major loss in AA responsiveness between -147 and -116, the region of the proximal promoter containing OSE2. Finally, fusion of six copies of OSE2 to the -34 to +13 minimal promoter, which by itself is not induced by AA, restored responsiveness while a similar construct containing mutated OSE2 was inactive.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 7. Functional Analysis of the Role of OSE2 in AA Responsiveness

MC3T3-E1 subclone 4 cells were transfected with the following plasmids: p147-luc, p147-luc containing two-point mutations in OSE2 (p147mut-luc), p116-luc, the -34/+13 minimal promoter (p34-luc), minimal promoter to which six copies of either wild type OSE2 (OSE2/34-luc) or mutated OSE2 (OSE2mt/34-luc) sequence had been fused in sense orientation, p657-luc, or p657-luc containing two-point mutations in OSE2 (p657mut-luc). Cells were grown for 6 days in the presence (+) or absence (-) of AA. The fold increase in luciferase activity with AA treatment is indicated for each group. *, Ratio (AA/C) is significantly different from unity at P < 0.001. All other groups were not significantly different at P < 0.05.

 
To examine the degree to which the OSE2 sequence is responsible for AA responsiveness in the context of a larger promoter fragment that may contain other 5'-regulatory sequences, an OSE2 mutation was introduced into p657-luc. This construct and the largest promoter construct examined, p1316-luc, have equivalent activity (Fig. 5Go). Mutation of OSE2 in p657-luc also abolished AA induction (Fig. 7Go).

Taken together, our results demonstrate that AA acts through an OSE2 sequence located in the first 147 bp of the mOG2 promoter. This is consistent with the known osteoblast-specific activity of OSE2 and ability of AA to stimulate osteoblast-specific gene expression.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Treatment of mouse MC3T3-E1 preosteoblast cells or primary osteoblasts with AA initiates the formation of a collagenous ECM and synthesis of several osteoblast-related proteins including osteocalcin, alkaline phosphatase, bone sialoprotein, and the PTH/PTH-related protein receptor. In scurvy, bone formation and levels of osteoblast-related proteins are greatly reduced relative to vitamin C-sufficient animals (1), suggesting that similar defects in osteoblast differentiation are associated with AA deficiency in vivo. With the long-term goal of understanding the molecular mechanism of osteoblast differentiation and bone formation as well as the specific roles of AA and the ECM in this process, we have examined the osteocalcin gene that contains the best-characterized osteoblast-related promoter activity. Our studies demonstrate: 1) that the mOG2 promoter is induced by AA and that this induction requires collagen matrix synthesis, 2) that this effect can be reproduced with a short 147-bp promoter, and 3) that an OSE2 sequence in the 147-bp promoter appears to be the target of AA action. Our results do not exclude the possibility that other sequences elsewhere in the promoter may be responsive to AA, although such sequences clearly require OSE2 for activity. This study represents the first demonstration of vitamin C having stimulatory actions on a specific gene promoter through a defined cis-acting element.

Our initial attempts to show induction of the mOG2 promoter in MC3T3-E1 cells produced inconsistent results. Because these cells, like other osteoblast-related cell lines, are phenotypically heterogeneous (i.e. only a fraction of cells exhibit osteoblast characteristics), subclones were isolated with high and low osteoblast differentiation potential. AA most dramatically stimulated OG2-luc activity in subclones exhibiting high induction of the endogenous osteocalcin gene. The parent MC3T3-E1 cell population used for subcloning showed only a modest induction of OG2-luc, which explains our initial difficulty in detecting activation of this promoter before subclones were examined. Similarly, strong AA induction of the OG2 promoter was only observed in stably transfected subclones having high endogenous osteoblast-specific gene expression (result not shown). Inducible and uninducible subclones of MC3T3-E1 cells may prove to be powerful experimental tools for the study of transcriptional regulation of osteoblast differentiation and bone formation.

Nontransformed bone cells, such as MC3T3-E1 preosteoblasts and primary osteoblasts, differ significantly from other osteoblast cell culture models, such as ROS17/2.8 osteosarcoma cells, in that the former require AA and collagen matrix synthesis before they will express osteoblast marker proteins such as osteocalcin. In contrast, ROS17/2.8 cells appear to be terminally differentiated, expressing high levels of osteocalcin in the absence of AA (21). Interestingly, in preliminary studies (G. Xiao and R. T. Franceschi, unpublished) we observed that ROS17/2.8 cells do not assemble substantial amounts of ECM after AA treatment. Furthermore, AA does not increase osteocalcin mRNA or stimulate p1.3OG2-luc in ROS17/2.8 cells. This suggests either that an important level of regulation has been lost in this osteosarcoma cell line or that ROS17/2.8 cells have progressed beyond the point in the osteoblast lineage where ECM synthesis is required for phenotypic expression.

Production of type I collagen is one of the earliest events associated with osteoblastic differentiation. Studies examining effects of AA on this process generally concluded that actions of this vitamin require collagen matrix formation (7, 8, 9, 22). Induction of osteoblast markers by AA can be blocked by collagen synthesis inhibitors or digestion of the ECM with purified collagenase (8). The present data indicate that a specific inhibitor of collagen matrix synthesis, 3,4-DHP, also blocks AA-dependent induction of promoter activity. As was found for AA induction of endogenous osteocalcin expression, this inhibitor was fully effective only if added simultaneously with AA; pretreatment of cells with AA for 2 days before inhibitor addition led to partial induction of mOG2 promoter activity as would be expected if some minimal amount of collagenous ECM had to accumulate around cells before induction of the promoter could commence. The marked time interval of 4 to 5 days between AA addition to cells and the earliest induction of mOG2 activity is also consistent with a model in which ECM accumulation was a prerequisite for promoter induction. Thus, transcriptional regulation of the osteocalcin gene promoter requires synthesis of a collagenous ECM. One interpretation of these results is that the ECM produced by osteoblasts interacts with cells possibly via integrins or other cell-surface receptors to initiate signaling cascades that ultimately up-regulate and/or activate transcription factors necessary for osteoblast-specific gene expression and differentiation. Of interest in this regard is the recent report by Takeuchi and co-workers showing that a collagen synthesis inhibitor (L-azetidine-2-carboxylic acid) and an anti-{alpha}2ß1 integrin antibody could block AA-induced alkaline phosphatase activity in MC3T3-E1 cells and that a Asp-Glu-Gly-Ala peptide that interferes with the binding of collagen to an {alpha}2ß1 integrin also inhibits alkaline phosphatase induction and the differentiation-dependent down-regulation of the transforming growth factor-ß receptor (23). Further studies will be required to test this model, although there are many examples of matrix-integrin interactions being required for tissue-specific gene expression (24). The present results emphasize the importance of ECM synthesis to the overall tissue-specific expression of the osteocalcin gene. Our finding that AA induces promoter activity approximately 20-fold indicates that at least 95% of total promoter activity is ECM-dependent.

Experiments described in this report show that an OSE2 sequence contained in the first 147 bp of the mOG2 promoter is necessary for AA induction. Mutation or deletion of this element abolished activity. Furthermore, OSE2 oligomers in the absence of other mOG2 promoter elements were able to confer AA responsiveness to a -34 minimal mOG2 promoter construct. The stronger effect of AA when using longer mOG2 promoter constructs may be explained by the presence of cryptic AA-responsive elements elsewhere in the promoter. However, these upstream sequences clearly require the downstream OSE2 because a point mutation in this element abolished the AA responsiveness of a -657 promoter construct. Gel retardation assays using an OSE2-containing oligonucleotide and nuclear extracts from control and AA-treated cells detected a sequence-specific shifted species in MC3T3-E1 subclone 4 cells. Furthermore, this component was dramatically increased in AA-treated cell nuclear extracts. OSF2, the osteoblast-related nuclear protein(s) binding to OSE2 has not yet been isolated. However, OSE2 contains a consensus sequence for the PEBP{alpha}/AML family of transcription factors, and one member of this family, AML-1B, can specifically bind OSE2 and activate plasmids containing this element. Furthermore, OSF2 is immunologically related to, but distinct from, the known AML proteins (17, 18). Once a cDNA and antibodies for OSF2 become available, it will be important to determine whether its expression and activity are regulated by AA. The general applicability of our findings to the control of osteoblast-specific gene expression by AA and ECM will require analysis of other promoters showing a bone-selective pattern of expression.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents
Tissue culture medium and FBS were obtained from HyClone (Logan, UT). D-Threo[dichloroacetyl-1-14C[] chloramphenicol and {alpha}-[32P[]-dCTP (3000 Ci/mmol) were purchased from Amersham (Arlington Heights, IL). Chloramphenicol, 2,6,10,14-tetramethylpentadecane, n-butyryl coenzyme A, 3,4-dehydro-L-proline, AA, and D-isoascorbic acid were obtained from Sigma Chemical Co. (St. Louis. MO). All other chemicals were of analytic grade.

RNA Analysis
Total RNA was isolated from cell layers as described by Chomczynski and Sacchi (25). Aliquots of total RNA were fractionated on 0.8% agarose-formaldehyde gels and blotted onto nitrocellulose paper as described by Thomas (26). The mouse cDNA probes used for hybridization were obtained from the following sources: osteocalcin from Dr. John Wozney (Genetics Institute, Boston, MA) (15) and bone sialoprotein (27) from Dr. Marion Young (National Institute of Dental Research, Bethesda, MD). All cDNA inserts were excised from plasmid DNA with the appropriate restriction enzymes and purified by agarose gel electrophoresis before labeling with {alpha}-[32P[]dCTP using a random primer kit (Boehringer-Mannheim, Indianapolis, IN). Hybridizations were performed as previously described using an Autoblot hybridization oven (Bellco Glass, Vineland, NJ) (8) and quantitatively scanned using an InstantImager (model A2024, Packard Instrument Co, Downers Grove, IL). All values were normalized for RNA loading by probing blots with cDNA to 18S rRNA (28).

DNA Constructions
All inserts containing mOG2 promoter regions were cloned in the p4Luc promoterless luciferase expression vector as previously described (16). p147mut-luc and p657mut-luc, which both contain a 2-bp substitution mutation in OSE2 at positions -134 and -133 (CCAAGAACA), were generated from p147-luc and p657-luc by PCR amplification (29). pCMV-luc, a generous gift from Dr. Jeffrey Bonadio (University of Michigan Medical School, Ann Arbor, MI), was constructed by inserting 1.9 kb of firefly luciferase cDNA into pcDNA3 (Invitrogen, San Diego, CA). pSV2CAT was obtained from Promega (Madison, WI).

Cell Cultures
MC3T3-E1 cells, a generous gift from Dr. M. Kumegawa (Josai Dental University, Sakado, Japan), were cultured in AA-free {alpha}-modified Eagle’s medium containing 10% FCS as previously described (7). MC3T3-E1 subclones were obtained by limiting dilution and evaluated for differentiation potential by growing for 10 days in AA-containing medium and measuring mRNA levels for osteocalcin and bone sialoprotein by Northern blot hybridization. Three highly responsive clones (nos. 4, 14, and 26) and two poorly responsive clones (nos. 17 and 24) were selected for the studies described.

Transfections
MC3T3-E1 cells were transfected using LipofectAMINE reagent according to the manufacture’s protocol (GIBCO BRL, Gaithersburg, MD). Briefly, cells were plated on 35 mm-diameter dishes at a density of 25,000 cells/cm2 and fed 24 h later. After an additional 24 h, cells were transfected with 0.5 µg each of p1.3OG2-luc and pSV2CAT. Four hours later, DNA was removed and cells were fed with 10% FBS-{alpha}-modified Eagle’s medium containing the indicated additions. Cells were then fed daily until harvest. Luciferase activity was measured using a Monolight 2010 luminometer (Analytical Luminescence Laboratory, Ann Arbor, MI) and reagents and protocols provided by Promega (Madison, WI). After luciferase assays, cell extracts were heated at 65 C for 15 min for chloramphenicol acetyltransferase (CAT) assays (30). All transfections were conducted in triplicate and values are reported as means ± SD. Cellular plasmid levels were determined by dot blot hybridization of total cellular DNA using 32P-labeled luciferase and CAT cDNAs as probes (31). To measure the stability of luciferase protein, cells previously transfected with p1.3OG2-luc and pSV2CAT were grown in the presence or absence of AA for 5 days, washed, and treated with cyclohexamide (2.5 µg/ml). Luciferase and CAT activities were measured after culturing with cyclohexamide for increasing times (0, 12, 24, and 72 h). Stable transfectants of MC3T3-E1 cells were established as follows: p1.3OG2-luc was linearized with BamHI and cotransfected with pcDNA3 at a DNA ratio of 5:1. After 24 h, cells were transferred to medium containing 400 µg/ml G418 and selected for 14 days. Single cell clones were then isolated by limiting dilution and tested for AA induction of both luciferase activity and endogenous osteoblast marker mRNAs.

Preparation of Nuclear Extracts and Gel Retardation Assays
To ensure that clean nuclei were obtained from AA-treated cells, which contain large amount of collagenous matrix, nuclei were pelleted through 2 M sucrose two times (30,000 x g, 45 min) before preparation of nuclear extracts according to the method of Dignam et al. (32). The DNA remaining in the pelleted fraction after preparation of extracts was measured using the method of Schneider (33). Amounts of nuclear extract added to each gel retardation assay are expressed in DNA equivalents. For gel retardation assays, double-stranded oligonucleotides containing wild type OSE1, OCE1, or OSE2 sequence (16) were labeled with [{gamma}-32P]ATP and T4 polynucleotide kinase, filled in with the Klenow fragment of DNA polymerase I, and purified on an acrylamide gel. Approximately 5 fmol of probe were added to the indicated amounts of nuclear extracts in 15 µl of a buffer containing 10% glycerol, 50 mM Tris-HCl (pH 7.5), 50 mM NaCl, 2 mM EDTA, 1 mM dithiothreitol, and 2.5 µg each of leupeptin and pepstatin per ml. Poly(deoxyinosinic-deoxycytidylic)acid·poly(deoxyinosinic-deoxycytidylic)acid (1.0 µg) was used as nonspecific competitor. After incubation at 4 C for 30 min, samples were subjected to electrophoresis on a 4% polyacrylamide gel in Tris/Glycine buffer [50 mM Tris-HCl (pH 8.5), 380 mM glycine, 2 mM EDTA, 0.2 mM ß-mercaptoethanol] at 160 V for 100 min in a 4 C cold room. The gels were dried and autoradiographed. Competition studies to assess the specificity of nuclear factor binding used unlabeled wild type OSE2 oligonucleotide and the following mutant (16): GATCCGCTGCAATCACCAAGAACAGCA GCGACGTTAGTGGTTCTTGTCGTCTAG

Statistical Analysis
All transfection data are reported as means ± SD based on triplicate independent cell cultures from a representative experiment. All experiments were repeated at least twice, and qualitatively identical results were obtained. Tukey-Kramer multiple comparisons test was used to assess statistical significance between samples.


    ACKNOWLEDGMENTS
 
The authors wish to thank Mr. M. Douglas Benson for figure preparation and helpful discussions.


    FOOTNOTES
 
Address requests for reprints to: Dr. Renny T. Franceschi, Department of Periodontics, Prevention, and Geriatrics, School of Dentistry, University of Michigan, 1011 North University Avenue, Ann Arbor, Michigan 48109-1078.

This work was supported by NIH Grants DK-35317 and DE-11723 (to R.T.F.) and DE-AR11290 (to G.K.), Basic Research Award IFY92–0871 from the March of Dimes Foundation (to G.K.), GCRC Grant M01-RR00042, and the Michigan Multipurpose Arthritis Center Grant AR20557.

Received for publication February 3, 1997. Accepted for publication April 10, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Togari A, Arai M, Nakagawa S, Banno A, Aoki M, Matsumoto S 1995 Alteration of bone status with ascorbic acid deficiency in ODS (osteogenic disorder Shionogi) rats. Jpn J Pharmacol 68:255–261[Medline]
  2. Franceschi RT 1992 The role of ascorbic acid in mesenchymal differentiation. Nutr Rev 50:65–70[Medline]
  3. Hammarstrom L 1966 Autoradiographic studies on the distribution of 14C-labeled ascorbic acid and dehydroascorbic acid. Acta Physiol Scand 70:1–84
  4. Wilson JX, Dixon SJ 1989 High-affinity sodium-dependent uptake of ascorbic acid by rat osteoblasts. J Membr Biol 111:83–91[CrossRef][Medline]
  5. Franceschi RT, Wilson JX, Dixon SJ 1995 Requirement for Na+-dependent ascorbic acid transport in osteoblast function. Am J Physiol 268:C1430–C1439
  6. Owen TA, Aronow M, Shalhoub V, Barone LM, Wilming L, Tassinari MS, Kennedy MB, Pockwinse S, Lian JB, Stein GS 1990 Progressive development of the rat osteoblast phenotype in vitro: reciprocal relationships in expression of genes associated with osteoblast proliferation and differentiation during formation of the bone extracellular matrix. J Cell Physiol 143:420–430[CrossRef][Medline]
  7. Franceschi RT, Iyer BS 1992 Relationship between collagen synthesis and expression of the osteoblast phenotype in MC3T3–E1 cells. J Bone Miner Res 7:235–246[Medline]
  8. Franceschi RT, Iyer BS, Cui Y 1994 Effects of ascorbic acid on collagen matrix formation and osteoblast differentiation in murine MC3T3–E1 cells. J Bone Miner Res 9:843–854[Medline]
  9. McCauley LK, Koh AJ, Beecher CA, Cui Y, Rosol TJ, Franceschi RT 1996 The PTH/PTHrP receptor is temporally regulated during osteoblast differentiation and is associated with collagen synthesis. J Cell Biochem 61:638–647[CrossRef][Medline]
  10. McKee M, Glimcher M, Nanci A 1992 High-resolution immunolocalization of osteopontin and osteocalcin in bone and cartilage during endochondral ossification in the chicken tibia. Anat Rec 234:479–492[CrossRef][Medline]
  11. Kerner SA, Scott RA, Pike JW 1989 Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D3. Proc Natl Acad Sci USA 86:4455–4459[Abstract/Free Full Text]
  12. Lian J, Stewart C, Puchacz E, Mackowiak S, Shalhoub V, Collart D, Zambetti G, Stein G 1989 Structure of the rat osteocalcin gene and regulation of vitamin D-dependent expression. Proc Natl Acad Sci USA 86:1143–1147[Abstract/Free Full Text]
  13. Morrison NA, Shine J, Fragonas JC, Verkest V, McMenemy ML, Eisman JA 1989 1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene. Science 246:1158–1161[Abstract/Free Full Text]
  14. Desbois C, Hogue DA, Karsenty G 1994 The mouse osteocalcin gene cluster contains three genes with two separate spatial and temporal patterns of expression. J Biol Chem 269:1183–1190[Abstract/Free Full Text]
  15. Celeste AJ, Rosen V, Bueker JL, Kriz R, Wang EA, Wozney JM 1986 Isolation of the human gene for bone gla protein utilizing mouse and rat cDNA clones. EMBO J 5:1885–1890[Medline]
  16. Ducy P, Karsenty G 1995 Two distinct osteoblast-specific cis-acting elements control expression of a mouse osteocalcin gene. Mol Cell Biol 15:1858–1869[Abstract]
  17. Geoffroy V, Ducy P, Karsenty G 1995 A PEBP2/AML-1-related factor increases osteocalcin promoter activity through its binding to an osteoblast-specific cis-acting element. J Biol Chem 270:30973–30979[Abstract/Free Full Text]
  18. Banerjee C, Hiebert SW, Stein JL, Lian JB, Stein GS 1996 An AML-1 consensus sequence binds an osteoblast-specific complex and transcriptionally activates the osteocalcin gene. Proc Natl Acad Sci USA 93:4968–4973[Abstract/Free Full Text]
  19. Grigoriadis AE, Petkovich PM, Ber R, Aubin JE, Heersche JNM 1985 Subclone heterogeneity in a clonally-derived osteoblast-like cell line. Bone 6:249–256[Medline]
  20. Goldman HM, Gould BS, Munro HN 1981 The antiscorbutic action of L-ascorbic acid and D-isoascorbic acid (erythorbic acid) in guinea pig. Am J Clin Nutr 34:24–33[Abstract/Free Full Text]
  21. Bortell R, Owen TA, Shalhoub V, Heinrichs A, Aronow MA, Rochette-Egly C, Lutz Y, Stein JL, Lian JB, Stein GS 1993 Constitutive transcription of the osteocalcin gene in osteosarcoma cells is reflected by altered protein-DNA interactions at promoter regulatory elements. Proc Natl Acad Sci USA 90:2300–2304[Abstract/Free Full Text]
  22. Aronow MA, Gerstenfeld LC, Owen TA, Tassinari MS, Stein GS, Lian JB 1990 Factors that promote progressive development of the osteoblast phenotype in cultured fetal rat calvaria cells. J Cell Physiol 143:213–221[CrossRef][Medline]
  23. Takeuchi Y, Nakayama K, Matsumoto T 1996 Differentiation and cell surface expression of transforming growth factor-ß receptors are regulated by interaction with matrix collagen in murine osteoblastic cells. J Biol Chem 271:3938–3944[Abstract/Free Full Text]
  24. Roskelley CD, Srebrow A, Bissell MJ 1995 A heirarchy of ECM-mediated signalling regulates tissue-specific gene expression. Curr Opin Cell Biol 7:736–747[CrossRef][Medline]
  25. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  26. Thomas PS 1980 Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc Natl Acad Sci USA 77:5201–5205[Abstract/Free Full Text]
  27. Young MF, Ibaraki K, Kerr JM, Lyu MS, Kozak CA 1994 Murine bone sialoprotein (BSP): cDNA cloning, mRNA expression, and genetic mapping. Mamm Genome 5:108–111[CrossRef][Medline]
  28. Renkawitz R, Gerbi SA, Glatzer KH 1979 Ribosomal DNA of fly Sciara coprophila has a very small and homogeneous repeat unit. Mol Gen Genet 173:1–13[CrossRef][Medline]
  29. Zhang R, Ducy P, Karsenty G 1997 1,25(OH)2D3 inhibits osteocalcin expression in mouse through an indirect mechanism. J Biol Chem 272:110–116[Abstract/Free Full Text]
  30. Kingston RE, Sheen J 1995 Isotopic methods for assaying chloramphenicol acetyltransferase. In: Ausubel F, Brent R, Kingston R, Moore D, Seidman J, Smith J, Struhl K (eds) Current Protocols in Molecular Biology, vol 1. Wiley, New York, pp 9.7.1–9.7.5
  31. Murphy JM, Chrysogelos SA 1995 Direct measurement of transfection efficiency in transient transfection assays. BioTechniques 18:967–969[Medline]
  32. Dignam JD, Martin PL, Shastry S, Roeder RG 1983 Eucaryotic gene transcription with purified components. Methods Enzymol 101:582–598[Medline]
  33. Schneider WC 1957 Determination of nucleic acids in tissues by pentose analysis. Methods Enzymol 3:680–684



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
C. Ge, G. Xiao, D. Jiang, Q. Yang, N. E. Hatch, H. Roca, and R. T. Franceschi
Identification and Functional Characterization of ERK/MAPK Phosphorylation Sites in the Runx2 Transcription Factor
J. Biol. Chem., November 20, 2009; 284(47): 32533 - 32543.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
K. Iwasaki, M. Komaki, K. Mimori, E. Leon, Y. Izumi, and I. Ishikawa
IL-6 Induces Osteoblastic Differentiation of Periodontal Ligament Cells
Journal of Dental Research, October 1, 2008; 87(10): 937 - 942.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. J. Kim and T. Kirsch
Collagen/Annexin V Interactions Regulate Chondrocyte Mineralization
J. Biol. Chem., April 18, 2008; 283(16): 10310 - 10317.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Yu, R. T. Franceschi, M. Luo, X. Zhang, D. Jiang, Y. Lai, Y. Jiang, J. Zhang, and G. Xiao
Parathyroid Hormone Increases Activating Transcription Factor 4 Expression and Activity in Osteoblasts: Requirement for Osteocalcin Gene Expression
Endocrinology, April 1, 2008; 149(4): 1960 - 1968.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. Roca and R. T. Franceschi
Analysis of transcription factor interactions in osteoblasts using competitive chromatin immunoprecipitation
Nucleic Acids Res., March 1, 2008; 36(5): 1723 - 1730.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Yu, Y. Jiang, D. L. Galson, M. Luo, Y. Lai, Y. Lu, H.-J. Ouyang, J. Zhang, and G. Xiao
General Transcription Factor IIA-{gamma} Increases Osteoblast-specific Osteocalcin Gene Expression via Activating Transcription Factor 4 and Runt-related Transcription Factor 2
J. Biol. Chem., February 29, 2008; 283(9): 5542 - 5553.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Wu, T. Iguchi, N. Itoh, K. Okamoto, T. Takagi, K. Tanaka, and T. Nakanishi
Ascorbic Acid Transported by Sodium-Dependent Vitamin C Transporter 2 Stimulates Steroidogenesis in Human Choriocarcinoma Cells
Endocrinology, January 1, 2008; 149(1): 73 - 83.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Zhu, X. Jia, G. Xiao, Y. Kang, N. C. Partridge, and L. Qin
IMPLICATIONS FOR OSTEOLYTIC BONE METASTASES
J. Biol. Chem., September 14, 2007; 282(37): 26656 - 26664.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Feng, G. Anderson, G. Xiao, G. Elliott, L. Leoni, M. Y. Mapara, G. D. Roodman, and S. Lentzsch
SDX-308, a nonsteroidal anti-inflammatory agent, inhibits NF-{kappa}B activity, resulting in strong inhibition of osteoclast formation/activity and multiple myeloma cell growth
Blood, March 1, 2007; 109(5): 2130 - 2138.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
C. Ge, G. Xiao, D. Jiang, and R. T. Franceschi
Critical role of the extracellular signal-regulated kinase-MAPK pathway in osteoblast differentiation and skeletal development
J. Cell Biol., February 26, 2007; 176(5): 709 - 718.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Xiao, D. Jiang, C. Ge, Z. Zhao, Y. Lai, H. Boules, M. Phimphilai, X. Yang, G. Karsenty, and R. T. Franceschi
Cooperative Interactions between Activating Transcription Factor 4 and Runx2/Cbfa1 Stimulate Osteoblast-specific Osteocalcin Gene Expression
J. Biol. Chem., September 2, 2005; 280(35): 30689 - 30696.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Roca, M. Phimphilai, R. Gopalakrishnan, G. Xiao, and R. T. Franceschi
Cooperative Interactions between RUNX2 and Homeodomain Protein-binding Sites Are Critical for the Osteoblast-specific Expression of the Bone Sialoprotein Gene
J. Biol. Chem., September 2, 2005; 280(35): 30845 - 30855.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
O. Akhouayri, I. Quelo, and R. St-Arnaud
Sequence-Specific DNA Binding by the {alpha}NAC Coactivator Is Required for Potentiation of c-Jun-Dependent Transcription of the Osteocalcin Gene
Mol. Cell. Biol., May 1, 2005; 25(9): 3452 - 3460.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Qiao, P. Shapiro, R. Kumar, and A. Passaniti
Insulin-like Growth Factor-1 Regulates Endogenous RUNX2 Activity in Endothelial Cells through a Phosphatidylinositol 3-Kinase/ERK-dependent and Akt-independent Signaling Pathway
J. Biol. Chem., October 8, 2004; 279(41): 42709 - 42718.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z.-S. Xiao, A. B. Hjelmeland, and L. D. Quarles
Selective Deficiency of the "Bone-related" Runx2-II Unexpectedly Preserves Osteoblast-mediated Skeletogenesis
J. Biol. Chem., May 7, 2004; 279(19): 20307 - 20313.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Jiang, R. T. Franceschi, H. Boules, and G. Xiao
Parathyroid Hormone Induction of the Osteocalcin Gene: REQUIREMENT FOR AN OSTEOBLAST-SPECIFIC ELEMENT 1 SEQUENCE IN THE PROMOTER AND INVOLVEMENT OF MULTIPLE SIGNALING PATHWAYS
J. Biol. Chem., February 13, 2004; 279(7): 5329 - 5337.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Stock, H. Schafer, S. Stricker, G. Gross, S. Mundlos, and F. Otto
Expression of Galectin-3 in Skeletal Tissues Is Controlled by Runx2
J. Biol. Chem., May 2, 2003; 278(19): 17360 - 17367.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. M. Willis, A. P. Loewy, N. Charlton-Kachigian, J.-S. Shao, D. M. Ornitz, and D. A. Towler
Regulation of Osteocalcin Gene Expression by a Novel Ku Antigen Transcription Factor Complex
J. Biol. Chem., September 27, 2002; 277(40): 37280 - 37291.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Xiao, D. Jiang, R. Gopalakrishnan, and R. T. Franceschi
Fibroblast Growth Factor 2 Induction of the Osteocalcin Gene Requires MAPK Activity and Phosphorylation of the Osteoblast Transcription Factor, Cbfa1/Runx2
J. Biol. Chem., September 20, 2002; 277(39): 36181 - 36187.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. C. D'Alonzo, A. J. Kowalski, D. T. Denhardt, G. A. Nickols, and N. C. Partridge
Regulation of Collagenase-3 and Osteocalcin Gene Expression by Collagen and Osteopontin in Differentiating MC3T3-E1 Cells
J. Biol. Chem., June 28, 2002; 277(27): 24788 - 24798.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Otsuka, Y. Kato, S. Hirose, and H. Hagiwara
Role of Ascorbic Acid in the Osteoclast Formation: Induction of Osteoclast Differentiation Factor with Formation of the Extracellular Collagen Matrix
Endocrinology, August 1, 2000; 141(8): 3006 - 3011.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. D. Benson, J. L. Bargeon, G. Xiao, P. E. Thomas, A. Kim, Y. Cui, and R. T. Franceschi
Identification of a Homeodomain Binding Element in the Bone Sialoprotein Gene Promoter That Is Required for Its Osteoblast-selective Expression
J. Biol. Chem., April 28, 2000; 275(18): 13907 - 13917.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Xiao, D. Jiang, P. Thomas, M. D. Benson, K. Guan, G. Karsenty, and R. T. Franceschi
MAPK Pathways Activate and Phosphorylate the Osteoblast-specific Transcription Factor, Cbfa1
J. Biol. Chem., February 11, 2000; 275(6): 4453 - 4459.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
E. Otsuka, A. Yamaguchi, S. Hirose, and H. Hagiwara
Characterization of osteoblastic differentiation of stromal cell line ST2 that is induced by ascorbic acid
Am J Physiol Cell Physiol, July 1, 1999; 277(1): C132 - C138.
[Abstract] [Full Text] [PDF]


Home page
CROBMHome page
R.T. Franceschi
The Developmental Control of Osteoblast-Specific Gene Expression: Role of Specific Transcription Factors and the Extracellular Matrix Environment
Critical Reviews in Oral Biology & Medicine, January 1, 1999; 10(1): 40 - 57.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Xiao, D. Wang, M. D. Benson, G. Karsenty, and R. T. Franceschi
Role of the alpha 2-Integrin in Osteoblast-specific Gene Expression and Activation of the Osf2 Transcription Factor
J. Biol. Chem., December 4, 1998; 273(49): 32988 - 32994.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-L. Frendo, G. Xiao, S. Fuchs, R. T. Franceschi, G. Karsenty, and P. Ducy
Functional Hierarchy between Two OSE2 Elements in the Control of Osteocalcin Gene Expression in Vivo
J. Biol. Chem., November 13, 1998; 273(46): 30509 - 30516.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. K. Winchester, N. Selvamurugan, R. C. D'Alonzo, and N. C. Partridge
Developmental Regulation of Collagenase-3 mRNA in Normal, Differentiating Osteoblasts through the Activator Protein-1 and the runt Domain Binding Sites
J. Biol. Chem., July 21, 2000; 275(30): 23310 - 23318.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xiao, G.
Right arrow Articles by Franceschi, R. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xiao, G.
Right arrow Articles by Franceschi, R. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals