Molecular Endocrinology 11 (8): 1129-1144
Copyright © 1997 by The Endocrine Society
Fibroblast Growth Factor Receptor Signaling Activates the Human Interstitial Collagenase Promoter via the Bipartite Ets-AP1 Element
Elizabeth P. Newberry,
David Willis,
Tammy Latifi,
Jeanne M. Boudreaux and
Dwight A. Towler
Departments of Medicine (E.N., T.L., D.A.T.), Pediatrics (J.M.B.),
and Molecular Biology and Pharmacology (D.W., D.A.T.) Division of
Bone and Mineral Diseases Washington University School of
Medicine St. Louis, Missouri 63110
 |
ABSTRACT
|
|---|
Interstitial collagenases participate in the
remodeling of skeletal matrix and are regulated by fibroblast growth
factor (FGF). A 0.2-kb fragment of the proximal human interstitial
collagenase [matrix metalloproteinase (MMP1)] promoter conveys 4- to
8-fold induction of a luciferase reporter in response to FGF2 in
MC3T3-E1 osteoblasts. By 5'-deletion, this response maps to nucleotides
-100 to -50 relative to the transcription initiation site. The 63- bp
MMP1 promoter fragment -123 to -61 confers this FGF2 response on the
rous sarcoma virus minimal promoter. Intact Ets and AP1 cognates in
this element are both required for responsiveness. The AP1 site
supports basal and FGF-inducible promoter activity. The intact Ets
cognate represses basal transcriptional activity in both heterologous
and native promoter contexts and is also required for FGF activation.
FGF2 up-regulates a DNA-binding activity that recognizes the MMP1 AP1
cognate and contains immunoreactive Fra1 and c-Jun. Both constitutive
and FGF-inducible DNA-binding activities are present in MC3T3-E1
cells that recognize the MMP1 Ets cognate; prototypic Ets
transcriptional activators are not present in these complexes.
Inhibitors of protein kinase C, phosphatidyl inositol 3-OH kinase, and
calmodulin-dependent protein kinase do not attenuate MMP1 promoter
activation. FGF2 activates ERK1/ERK2 signaling in osteoblasts; however,
25 µM MAPK-ERK kinase (MEK) inhibitor PD98059
(inhibits by > 85% the phosphorylation of ERK1/ERK2) has no
effect on MMP1 promoter activation by FGF2. Ligand-activated and
constitutively active FGF receptors initiate MMP1 induction. Dominant
negative Ras abrogates MMP1 induction by constitutively active
FGFR2-ROS, but dominant negative Rho and Rac do not inhibit induction.
The mitogen-activated protein kinase (MAPK) phosphatase MKP2
[inactivates extracellular regulated kinase (ERK) = Jun N-terminal
kinase (JNK) > p38 MAPK] completely abrogates MMP1 activation,
whereas PAC1 (inactivates ERK = p38 > JNK) attenuates but
does not completely prevent induction. Thus, a Ras- and
MKP2-regulated MAPK pathway, independent of ERK1/ERK2 MAPK activity,
mediates FGF2 transcriptional activation of MMP1 in MC3T3-E1
osteoblasts, converging upon the bipartite Ets-AP1 element. The
DNA-protein interactions and signal cascades mediating FGF induction of
the MMP1 promoter are distinct from two other recently described
FGF response elements: the MMP1 promoter (-123 to -61) represents a
third FGF-activated transcriptional unit.
 |
INTRODUCTION
|
|---|
Interstitial collagenases are members of a large family of matrix
metalloproteinases (MMPs). These enzymes play important roles in the
physiology and pathophysiology of bone matrix degradation and turnover
(1, 2). Temporospatial coordination of bone resorption (by osteoclasts)
and formation (by osteoblasts) is necessary for normal bone growth.
Resorption is dependent upon a sequential admixture of secreted
proteinases (2, 3, 4). Interstitial collagenase activity secreted by
osteoblasts participates in the initiation of the bone resorption
mediated by cysteine proteinases secreted by osteoclasts (2, 3, 4). Net
bone synthesis or degradation reflects the balance between osteoblast
matrix protein biosynthesis, proteolytic activities secreted by
osteoclasts and osteoblasts, and natural proteinase inhibitor
concentrations parameters tightly regulated by polypeptide growth
factors and hormones (2, 5).
Interstitial collagenase promoter activity is inducible in many cell
types by oncogenes and phorbol esters (6, 7). However, during normal
murine development, interstitial collagenase expression is most readily
detected in hypertrophic chondrocytes and osteoblasts undergoing
mineralization (8), implicating a role for interstitial collagenase
enzyme activity in normal skeletal morphogenesis. In adult human
chondrocytes, two related interstitial collagenase genes, MMP1 and
MMP13, have been identified as being expressed (9). Intriguingly, like
interstitial collagenase, the fibroblast growth factor receptor-1
(FGFR1) gene is also most highly expressed in hypertrophic chondrocytes
and osteoblasts undergoing mineralization (10); moreover, basic
fibroblast growth factor (FGF2) up-regulates interstitial collagenase
expression in osteoblasts (11, 12). Elegant human and mouse genetic
studies have now firmly established that FGF receptor signaling
provides key regulatory cues in the temporospatial control of skeletal
morphogenesis and gene expression (13, 14, 15). FGF receptor-ligand
signaling can promote net decrements in matrix collagen accumulation by
inhibiting type I collagen expression, enhancing matrix degradation,
and inhibiting the activity of IGFs by down-regulation of important
coregulatory IGF-binding proteins (2, 5, 16). However, FGFs also
promote the proliferation of osteoprogenitors and neovascularization,
steps necessary for bone formation and mineralization (16, 17, 18, 19, 20).
In vivo, intravenous FGF2 promotes endosteal but not
periosteal bone formation (20). Thus, the complex net pharmacological
effects of FGF on bone accumulation probably reflect the summation of
osteoprogenitor pool recruitment and expansion, neovascularization,
down-regulation of type I collagen matrix formation, and stage-specific
action on osteoblast differentiation (16, 19).
Biochemical and genetic studies suggest that FGF receptor activation
provides physiologically unique signals not provided by other growth
factors (13, 14, 15, 21). Despite the important role of FGFs in connective
tissue biology, remarkably little is known concerning the
transcriptional mechanisms whereby FGF receptor signaling regulates
gene expression in any mesenchymal cell type, including osteoblasts.
FGF receptors activate multiple intracellular signaling systems (18),
including the mitogen-activated protein kinase (MAPK) signal cascades
(18). To date, five categories of MAPK cascades have been described
(Refs. 22, 23, 24, 25, 26 ; see Ref. 22 for complete review including nomenclature
and abbreviations): 1) The classic ERK1/ERK2 MAPK cascade (ERK;
extracellular regulated kinase), also known as p44/p42 MAPK pathway,
regulated by Ras, multiple Raf family members, MEK1/MEK2 (MEK; MAPK-ERK
kinase), protein kinase C (PKC) (via Raf), and mitogens, sensitive to
PD98059 inhibition of MEK1 and MEK2; 2) The JNK pathway (Jun N-terminal
kinase; a.k.a. stress-activated protein kinase), a family of
55-kDa
MAPKs regulated by Ras, Cdc42, Rac, SEK1/MKK4, ultraviolet light,
osmotic stress, and inflammatory cytokines; 3) The related p38 and
p38ß MAPK pathway, regulated by Ras, Cdc42, Rho, MKK3, MKK6, osmotic
stress, arsenite, and inflammatory cytokines, sensitive to SB203580
inhibition; 4) The approximately 110-kDa BMK1 pathway (Big MAPK; also
known as ERK5), regulated by hydrogen peroxide and hyperosmolar stress;
and 5) The FRK pathway (Fos regulating kinase; 88-kDa MAPK) that
activates AP1-dependent transcription via proline-directed
phosphorylation of c-Fos on Thr-232, initially described as regulated
by oncogenic H-ras and epidermal growth factor. Of the five MAPKs
described above, only FRK has yet to be isolated and cloned (24). As a
mitogen, FGF does activate the ERK1/ERK2 MAPK cascade (18); however,
Comb and co-workers (27) recently demonstrated that FGF activation of
cAMP-response element binding protein (CREB)- and ATF1-dependent
transcription occurs via the p38 MAPK cascade in neuroblastoma cells,
inhibited by SB203580 but not by PD98059. Moreover, FGF receptor
stimulation activates phosphoinositide turnover and increases
intracellular calcium, activating PKC-dependent and
calcium/calmodulin-dependent protein kinase signal transduction
cascades (18, 28). Thus, FGFR signaling likely proceeds via multiple
signaling pathways. Consistent with this notion, we recently
demonstrated that two pharmacologically distinct signals are elaborated
in FGF-stimulated MC3T3-E1 osteoblasts that up-regulate the osteocalcin
FGF response element (OCFRE) and human MMP1 interstitial collagenase
promoter activity (29, 30). The phosphoprotein phosphatase inhibitors,
okadaic acid and vanadate, inhibit activation of the OCFRE, but do not
inhibit activation of the MMP1 promoter in MC3T3-E1 cells (30). The
OCFRE and MMP1 promoter thus represent two models useful for studying
FGF-dependent transcriptional activation in osteoblasts.
In this study, we perform systematic analysis of FGF receptor-regulated
interstitial collagenase promoter activity, pharmacologically and
biochemically challenging the signal cascades that potentially mediate
FGF action in osteoblasts (vide supra). FGF2 activates the
proximal human MMP1 promoter 4- to 8-fold (luciferase reporter) in both
primary osteoblast cultures and the MC3T3-E1 osteoblast cell line. The
human interstitial collagenase promoter fragment -123 to -61
functions as a minimal FGF-responsive element, conferring induction on
the unresponsive heterologous rous sarcoma virus (RSV) minimal
promoter. Within this fragment, two conserved motifs are present that
were previously identified as mediating responses to H-ras, v-src, and
PKC activation (6, 7). FGF regulates DNA-protein interactions at both
of these motifs: 1) an AP1 DNA-binding activity that contains Fos and
Jun family members, including immunoreactive Fra1 and c-Jun; and 2) an
unidentified DNA-binding activity that recognizes the Ets DNA cognate.
A constitutive DNA-binding factor (i.e. not regulated at the
level of binding by FGF2) also recognizes the MMP1 Ets cognate. Point
mutation of the Ets cognate in the native MMP1 promoter context
indicates that both positive and negative regulation of transcriptional
activity is mediated via that cognate, suggesting that an ERF-like Ets
repressor (31) may participate in MMP1 regulation. FGFR1 is expressed
in MC3T3-E1 osteoblasts, and FGFR1 expression in receptor-deficient
myoblasts confers ligand-dependent activation of the MMP1 promoter.
Signaling depends upon FGFR1 tyrosine kinase activity, since the
naturally occurring kinase-deficient variant FGFR1' (32) cannot convey
MMP1 promoter induction. Conversely, the FGFR2-ROS osteosarcoma
oncoprotein that possesses constitutive tyrosine kinase activity (33)
up-regulates the MMP1 promoter in the absence of exogenous ligand.
Induction of promoter activity by FGFR2-ROS is inhibited by dominant
negative Ras, but not by dominant negative Rho or Rac. Pharmacological
manipulation of ERK1/ERK2 MAPK signaling, PKC, protein kinase A (PKA),
phosphatidyl inositol 3 hydroxyl kinase (PI3K), or
calcium-calmodulin-dependent protein kinase (CaMK) does not abrogate
induction. Importantly, the data show that this particular
Ras-dependent FGFR signal is independent of ERK1/ERK2 MAPK and PKC
activity. However, overexpression of the MAPK phosphatase MKP2
[inactivates ERK = JNK > p38 MAPK (34)] abrogates FGFR
activation of the MMP1 promoter, indicating that a MAPK pathway is
involved with this transcriptional response. The DNA-protein
interactions and signal cascades that activate the MMP1 FGF-responsive
element are distinct from those regulating the osteocalcin (29, 30) and
proenkephalin (35) FGF-responsive elements. The human interstitial
collagenase promoter region -123 to -61 thus represents a third
FGF-activated transcriptional response element.
 |
RESULTS
|
|---|
The Human MMP1 Promoter Fragment -123 to -61 Defines a Minimal
FGF-Responsive Element
Hurley and co-workers (11) recently described that FGF1 (acidic
FGF) up-regulates the 1.8-kb rabbit interstitial collagenase promoter
in MC3T3-E1 cells. In a similar fashion, the proximal human MMP1
interstitial collagenase promoter fragment (-179 to +63; 179 MMPLUC)
is sufficient to convey FGF2 transcriptional activation in MC3T3-E1
calvarial osteoblasts (30) and passage 3 primary rat calvarial
osteoblasts (D. Towler, unpublished). To identify structural features
of the MMP1 promoter conferring FGF2 responses in osteoblasts, we
analyzed the FGF2 responsiveness of a series of MMP1 promoter
5'-deletion constructs linked to the luciferase reporter. Like 179
MMPLUC, 100 MMPLUC (fragment -100 to +63) is also capable of
responding to FGF2 (Fig. 1
). Further 5'-deletion of the
region -100 to -76 in this context has little effect on basal
promoter activity, but significantly decreases FGF2 responsiveness by
approximately 50% (Fig. 1
, compare 100 MMPLUC with 75 MMPLUC). By
contrast, 5'-deletion of the region -75 to -51 markedly decreases
basal promoter activity (Fig. 1
; compare 50 MMPLUC to 75 MMPLUC and 100
MMPLUC). Moreover, the MMP1 promoter fragment -50 to +63 present in 50
MMPLUC is no longer inducible by FGF2. The SV40 promoter and the RSV
minimal promoter are not stimulated by FGF2 treatment (Fig. 1
). These
data indicate that the MMP1 promoter region -100 to -50 encodes
information important for conveying full FGF2 responsiveness.
Inspection of this region (Fig. 2
) reveals two motifs,
the AGGATG Ets cognate (-88 to -83) and TGAGTCA (-72 to -66), known
to convey responses to oncogenes and phorbol esters (6, 36). To
directly assess whether these motifs participate in FGF2 induction, the
MMP1 promoter fragment -123 to -61 was assessed for its capacity to
convey this FGF2 response on the unresponsive RSV minimal promoter. As
shown in Fig. 1
, MMP (-123 to -61)RSVLUC is inducible by FGF2.
Mutation of the AP1 cognate (TGAGTCA to
TGATTTA) completely destroys the activity of
this element and abrogates FGF2 responsiveness, noted upon comparison
of MMP (-123 to -61/APMUT1)RSVLUC with MMP (-123 to -61) RSVLUC.
Surprisingly, mutation of the Ets cognate as in MMP (-123 to
-61/ETSMUT)RSVLUC increases basal promoter activity, but also
abrogates FGF2 induction. Thus, the 63-bp region -123 to -61 of the
human MMP1 promoter defines a functional FGF-responsive element. Both
Ets and AP1 cognates in this region are necessary to confer FGF
responsiveness, but differentially regulate basal transcriptional
activity of the element.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 1. The MMP1 Promoter Region -123 to -61 Encodes a
Functional FGF Responsive Element, Dependent upon Intact Ets- and
AP1-Binding Motifs
A series of deleted and mutated MMP1 promoter fragments were generated
by PCR as described in Materials and Methods, then
ligated upstream of the promoterless luciferase reporter gene (MMPLUC
constructs) or the luciferase gene driven by the RSV minimal promoter
(RSVLUC constructs) as indicated. These constructs were then
transfected into MC3T3-E1 calvarial osteoblasts and subsequently
analyzed for the capacity to respond to FGF2 as described in the legend
to Fig. 1 and in the text. Data are presented as the mean luciferase
activity (± SD) of three independent transfections. Note
that serial 5'-deletion of the MMP promoter from -100 to -75 markedly
decreases FGF responsiveness (compare 100 MMPLUC and 75 MMPLUC),
whereas further deletion to -50 (50 MMPLUC) completely abrogates
responsiveness. The MMP1 promoter fragment -123 to -61 can convey FGF
induction on the unresponsive heterologous RSV minimal promoter
[compare responsiveness of MMPLUC (-123 to -61) RSVLUC with
RSVLUC]. Note also that the SV40 promoter is not activated by FGF2.
The constructs MMPLUC (-123 to -61; ETSMUT) RSVLUC and MMPLUC (-123
to -61; AP1MUT) RSVLUC are not inducible by FGF2, indicating that
intact Ets (AGGATG) and intact AP1 (TGAGTCA) motifs are necessary for
FGF regulation. Further note that mutation of the Ets cognate (to
TTTATG) increases basal activity in this heterologous
promoter context, whereas mutation of the AP1 cognate (to
TGATTTA) decreases transcriptional activity to
the level observed with the minimal RSV promoter. See text for
details.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
Figure 2. The Proximal Human Interstitial Collagenase
Promoter
Nucleotide sequence of the human interstitial collagenase MMP1 promoter
region -100 to -61 is shown; only the upper strand sequence is given
(6 ). Ets and AP1 cognates are in italics, and sequences
used in gel assays as duplex oligonucleotides are
underlined (Ets) or overlined (AP1). See
text for details.
|
|
The Ets Cognate of MMP1 Regulates Both Basal and FGF2-Inducible
Promoter Activity in the Native Promoter Context
Very recently, DNA-protein interactions at Ets cognates have
been described as mediating both positive and negative transcriptional
regulation (31). The effects of Ets sites mutation on transcriptional
activity in the heterologous context shown (Fig. 1
) suggest that both
positive and negative transcriptional regulation occurs via this
cognate. To confirm the importance of the Ets cognate in basal and
FGF2-induced MMP1 promoter activity, we introduced the Ets site
mutation (AGGATG to TTTATG; thymidine
substitutions at nucleotides -88 to -86) in the native MMP1 promoter
context, -120 to +63. As observed in the heterologous promoter context
(Fig. 1
), basal promoter activity is increased 2.5-fold by mutation of
the Ets cognate (Fig. 3
). As also observed in the
heterologous promoter, mutation of the Ets site in the MMP1 native
promoter context abrogates FGF2 induction (Fig. 3
). Thus, these data
confirm the importance of the Ets cognate in both suppression of basal
promoter activity and in FGF2 activation of the MMP1 promoter.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 3. The MMP1 Ets Cognate Confers Both Basal Promoter
Suppression and FGF2 Activation in the Homologous Promoter Context
To confirm the importance of the Ets cognate in MMP1 induction, the Ets
cognate mutation was introduced into the MMP1 promoter fragment, -120
to +63, as described in the text, then ligated upstream of the
luciferase reporter gene. The activity of this mutated MMP1 construct,
denoted 120 MMPLUC ETSMUT, was then compared with the wild type
promoter construct 120MMPLUC in transfected MC3T3-E1 cells under basal
and FGF-stimulated conditions, as described in the legend to Fig. 1 . As
observed in the heterologous RSV promoter context (Fig. 1 ), mutation of
the MMP1 Ets motif abrogates FGF induction. Note also that mutation of
the Ets cognate, as observed in the heterologous promoter context (Fig. 1 ), again increases basal MMP1 promoter activity. See text for
details.
|
|
FGF2 Rapidly Up-Regulates a DNA-Binding Activity that Recognizes
the MMP1 Promoter Fragment -79 to -63 and Contains Fra1 and c-Jun as
Constituents
We wished to assess whether FGF stimulation regulates DNA-protein
interactions at the MMP1 promoter AP1 element. Extracts were prepared
from MC3T3-E1 cells treated for the indicated times with 3
nM FGF2, then analyzed for DNA-binding activity recognizing
the MMP promoter fragments -79 to -63 (AP1 duplex oligo) and -93 to
-78 (Ets duplex oligo; see Fig. 2
). As shown in Fig. 4A
, FGF2 up-regulates DNA- binding activity recognizing
the AP1 motif, within 0.5 h of stimulation. Pretreatment of this
complex with anti-Fos antibody (recognizes c-Fos, Fra1, Fra2, and FosB)
almost completely destroys and partially supershifts this complex (Fig. 4B
, lane 2), indicating that Fos family members are major constituents
of this binding activity. This is a specific effect, since the
osteocalcin FGF response element-binding protein recognition of the
OCFRE is not affected by pretreatment with either anti-Fos antibody
(Fig. 4B
, lanes 46). By contrast, antibodies recognizing the leucine
zipper proteins Fra2 (Fig. 4B
, lane 3) and ATF1/CREB family members
(Fig. 4C
, lane 4) do not significantly affect or supershift factor
binding to the MMP1 AP1 site. The anti-ATF1 antibody (recognizes CREB
and ATF1) is competent in gel shift assays because it is capable of
supershifting MC3T3-E1 protein complexes that bind the authentic
CREB-binding cognate CRE (cAMP response element) (Fig. 4C
, see lanes 5
and 6).

View larger version (37K):
[in this window]
[in a new window]
|
Figure 4. FGF2 Rapidly Up-Regulates an MMP1 Promoter AP1
Cognate DNA-Binding Activity that Contains Immunoreactive Fos but not
ATF1/CREB Family Members
A, MC3T3-E1 cells were treated for the indicated times with 3
nM FGF2. Cell extracts were subsequently prepared and
analyzed by gel shift assay for DNA-binding activities that recognize
the MMP1 promoter fragment -79 to -63 (see Fig. 2 ), encompassing the
AP1 cognate. Lane 1, No extract; lanes 27, extracts from cells
treated for indicated times with 3 nM FGF2. (Note that FGF2
up-regulates within 0.5 h (lane 3) a DNA-binding activity that
recognizes the AP1 cognate of MMP1.) B, Extracts prepared from cells
treated with 3 nM FGF2 were analyzed for MMP1 AP1
DNA-binding activity and immunologically probed using gel supershift
assays. Lanes 13, gel shift assay using radiolabeled MMP1 AP1 duplex
oligo; lanes 46, gel shift assay using OCFRE cognate duplex oligo
(Ref. 30). Note that the anti-Fos antibody supershifts (SS) and
destroys the AP1-binding complex (lane 2), but not the OCFRE-binding
complex (lane 5). Further note that the Fra2 antibody does not affect
binding to either DNA cognate (lane 3, lane 6). C, Lanes 14, Gel
shift assays using radiolabeled MMP1 AP1 duplex oligo; lanes 56, gel
shift assays using authentic cAMP response element (CRE) cognate duplex
oligo. Lane 1, No extract added; lanes 26, with MC3T3-E1 extract.
Note that anti-Fos antibody destroys and supershifts (SS) the
DNA-protein complex binding the MMP1 AP1 cognate (lane 3). Note also
that anti-ATF1 antibody (against CREB, ATF1), does not significantly
supershift complexes binding the MMP1 AP1 cognate (lane 4), but does
supershift complexes recognizing the authentic CRE cognate (lane 6).
Unbound probe has been run to the very bottom of the gel to facilitate
visualization of supershifted complexes.
|
|
Upon immunological probing with antibodies specific for particular Fos
family members, only anti-Fra1 substantially supershifts the MMP1
promoter AP1-binding complex (Fig. 5
, lane 4);
antibodies specific for c-Fos, Fra2, and FosB have no effect (Fig. 5
, lanes 3, 5, and 6). Similarly, antibodies that recognize either c-Jun
specifically or all Jun family members partially supershift this
AP1-binding complex (Fig. 5
, see lanes 7 and 10). Antibodies specific
for JunD and JunB do not supershift this complex (Fig. 5
, lanes 8 and
9). Thus, in MC3T3-E1 osteoblasts, FGF2 up-regulates an AP1- binding
complex that recognizes the MMP1 promoter and contains immunoreactive
Fra1 and c-Jun as constituents. Unlike the interstitial collagenase
AP1-binding complexes induced by PTH (37), CREB/ATF1 is not a major
constituent of the FGF-regulated complex.

View larger version (84K):
[in this window]
[in a new window]
|
Figure 5. The FGF2-Induced MMP1 AP1 Binding Complex Contains
Immunoreactive Fra-1 and c-Jun as Constituents
Extracts prepared from MC3T3-E1 cells treated for 24 h with 3
nM FGF2 were analyzed for MMP1 AP1 DNA binding activity and
immunologically probed in gel supershift assays, as described in the
text. Note that the anti-Fos antibody (lane 2) recognizes all family
members and the anti-Fra1 antibody (lane 4) substantially supershift
this AP1-binding complex. By contrast, antibodies recognizing c-Fos
(lane 3), Fra-2 (lane 5), or Fos B (lane 6) are without effect. Further
note that antibodies recognizing either c-Jun specifically (lane 7) or
all Jun family members (lane 10) partially supershift this AP1 complex.
By contrast, antibodies specific for JunD or JunB do not supershift
this complex (lanes 8 and 9).
|
|
Both Constitutive and FGF2-Regulated DNA-Binding Activities
Recognize the MMP1 Promoter Fragment -93 to -78
In a similar fashion, FGF2 up-regulates DNA-binding activity
recognizing the MMP1 promoter fragment -93 to -78 encompassing the
Ets motif core at -88 to -83 (Fig. 6
). Three complexes
are visible in untreated control cells; complexes A and B are
up-regulated by FGF2, while complex C changes very little and is
essentially constitutive in this assay. However, the time course of
induction of complexes A and B is quite different from that observed
for AP1; binding activity is not up-regulated until after 5 h of
treatment, first noted at 24 h of treatment, and persists for up
to 30 h (Fig. 6
). The constituents of these DNA-protein complexes
are currently unknown; immunological probing with antibodies
recognizing Ets1, Ets2, Fli1, and Erg (anti-Ets1/Ets2 antibody) and
PU.1/Spi1 (anti-PU.1) do not affect DNA-binding activity or supershift
any of these complexes (data not shown). Thus, both FGF-regulated and
constitutive DNA-binding complexes recognize the MMP1 Ets cognate in
MC3T3-E1 cells.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 6. Constitutive and FGF2-Regulated DNA Binding
Activities Recognize the MMP1 Promoter Fragment -93 to -78
Encompassing the Ets Cognate
Cell extracts were prepared from independent duplicate MC3T3-E1 cell
cultures treated with 3 nM FGF2 for the indicated times.
Extracts were subsequently analyzed for DNA-binding activity
recognizing the MMP1 promoter fragment -93 to -78 encompassing the
Ets cognate (Fig. 2 ). Data are presented as gel shift assay results
obtained from independent duplicate cultures (all time points). Three
different DNA-binding complexes are observed; the major FGF-stimulated
DNA-binding activity is indicated by the arrow. Complex
C is relatively constitutive, while complexes B and A are both
up-regulated by FGF2 (lanes 710) sometime between 5 and 24 h of
treatment. Unbound radiolabeled oligo has been run off the bottom of
the gel to facilitate resolution of complexes C and B. The
anti-Ets1/Ets2 antibody (recognizes Ets1, Ets2, Fli1, and Erg) and
anti-PU.1 antibody do not supershift or destroy any of the three
complexes (data not shown).
|
|
Pharmacological Inhibition of PKA, PI3K, PKC, CaMK, and
MEK1/MEK2-ERK1/ERK2 Kinase Cascades Does not Disrupt FGF Activation of
the MMP1 Promoter
FGFR1 has been shown to activate multiple MAPK cascades, stimulate
phospholipid turnover and increase intracellular calcium levels, and
activate PI3K (16, 18, 28). We wished to pharmacologically assess
whether specific kinase-signaling cascades downstream of receptor
activation participate in the up-regulation of the human interstitial
collagenase promoter in response to FGF2. Unlike FGF2 activation of the
osteocalcin promoter (30), up-regulation of the human MMP1 promoter in
MC3T3-E1 calvarial osteoblasts is not potentiated by forskolin
treatment (Fig. 7
). Inhibitors of PKA (H-7, H-89,
KT-5720; Ref. 38) have no effect on induction (Fig. 7
). Wortmannin, an
inhibitor of the PI3K/protein kinase B pathway (39), also does not
hinder FGF activation of MMP1. Similarly, the CaMK inhibitor KN-62 does
not inhibit MMP1 induction by FGF2 (Fig. 7
). The phorbol ester
tetradecanoyl phorbol acetate (TPA), well known to activate PKC and
up-regulate MMP1 expression via an AP1 motif in a cell type-dependent
fashion (6), modestly stimulates 120 MMPLUC promoter activity in
MC3T3-E1 cells (Fig. 7
). This suggested that FGF activation may proceed
in part via one of the typical PKC isotypes; however, the broad
spectrum serine/threonine kinase inhibitors H-7 and staurosporine that
inhibit PKC-dependent signaling (38) do not inhibit FGF2 action
(actually enhance induction; Fig. 8
). The observation
that 50 nM staurosporine augments FGF induction of the MMP1
promoter suggests that another Ser/Thr kinase cascade may inhibit FGF
activation of MMP1 promoter. Thus, although potentially mediating FGFR
signals (18, 28), PKC, PI3K, and CaMK activities are not required for
transcriptional up-regulation of the MMP1 promoter by FGF2.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 7. Pharmacological Inhibition of PKC, Phosphatidyl
Inositol 3 Hydroxyl Kinase, PKA, Calcium-Calmodulin-Dependent Protein
Kinase, and MEK-ERK Kinase Pathways Does not Disrupt FGF Activation of
the MMP1 Promoter
MC3T3-E1 cells were transfected with 120 MMPLUC and allowed to recover
for 40 h. Cells were then pretreated for 0.5 h with complete
media containing 2-fold concentrated kinase inhibitor or modulator (see
Materials and Methods for details), followed by the
addition of an equal volume of media containing either vehicle or 6
nM FGF2. The final concentration of inhibitor or modulator
is given on the left side of the figure; the final FGF2
concentration is 3 nM. Data are presented as the mean (±
SD) induction of 120 MMPLUC from basal activity
(i.e. vehicles alone) for each of the indicated
treatments. Note that, unlike the osteocalcin promoter (30 ), the MMP
promoter is not synergistically induced by FGF2 and forskolin. The PKA
inhibitors H-89 and KT-5720 do not inhibit induction. Similarly,
treatment with PKC inhibitors staurosporine and H-7 do not inhibit FGF2
induction, and TPA treatment cannot mimic FGF2 action. Staurosporine
markedly and specifically (see Ref. 29) potentiates MMP1 induction by
FGF2, suggesting that a Ser/Thr kinase cascade antagonizes the
MMP-inductive pathway, but not the OCFRE pathway. Induction is not
attenuated by the PI3K inhibitor wortmannin or by the CaMK inhibitor
KN-62. Finally, note that 25 µM PD98059, which inhibits
by >85% the FGF2-induced phosphorylation of ERK1/ERK2 in
MC3T3-E1 osteoblasts (Fig. 8 below), also has no effect on 120 MMPLUC
induction by FGF2. See text for details.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
Figure 8. FGF2 Induction of ERK1/ERK2 (p44/p42 MAPK)
Phosphorylation Is Inhibited by 25 µM PD98059
MC3T3-E1 cells were pretreated for 0.5 h with complete media
containing 50 µM PD98059, followed by the addition of an
equal volume of media containing either BSA vehicle or 6 nM
FGF2. The final concentration of PD98059 is 25 µM, and
the final FGF2 concentration is 3 nM (as in the
transfection experiments described in the legend to Fig. 7 ). After
1 h of treatment with FGF2, cellular extracts were analyzed by
Western blot with phospho-ERK1/ERK2 antibody (upper
panel; recognizes only Tyr-phosphorylated p44/42 MAPKs, denoted
pp42 MAPK) and anti-ERK antibody (lower panel;
recognizes total ERK protein, denoted p42 MAPK; p42 is predominantly
MC3T3-E1 osteoblasts). Results are shown for two independently treated
samples. Note that FGF2 treatment up-regulates ERK phosphorylation
(lanes 3 and 4, vs. lanes 1 and 2; upper
panel), but has no effect on total ERK protein (lower
panel, lanes 14). Similar changes in ERK1/ERK2 enzyme
activity are observed in these same extracts as determined by in-gel
kinase assay using myelin basic protein as a substrate (data not
shown). Also note that 25 µM PD98059 decreases by >
85% the induction of ERK phosphorylation (upper panel,
lanes 7 and 8 vs. lanes 3 and 4), but has no effect on
total ERK protein (lower panel, lanes 58). Recall that
25 µM PD98059 has no effect on 3 nM FGF2
induction of 120 MMPLUC (Fig. 7 ), even though it inhibits FGF2
activation of this MEK-ERK cascade (lanes 7 and 8).
|
|
FGF2 stimulation activates multiple MAPK cascades in cells (18). The
compound PD98059 is known to inhibit the ERK1/ERK2 MAPK pathway by
inhibiting MEK1/MEK2 activity (25, 26). For example, 10
µM to 20 µM PD98059 completely inhibits the
mitogenic actions of PDGF in fibroblasts (25, 26). To test whether
ERK1/ERK2 MAPK pathways participate in FGF2 transcriptional regulation
in osteoblasts, we examined the effect of PD98059 treatment on basal
and FGF2-induced MMP1 promoter activity in MC3T3-E1 osteoblasts. As
shown in Fig. 7
, 25 µM PD98059 does not inhibit either
basal or FGF2-induced MMP1 promoter activity. This concentration of
PD98059 is sufficient to inhibit by >85% the FGF2-induced activation
of ERK phosphorylation in MC3T3-E1 cells (Fig. 8
). At concentrations
exceeding 25 µM, PD98059 begins to inhibit the basal
activity of multiple promoters (i.e. SV40LUC, RSVLUC, and
MMPLUC); however, FGF2 still stimulates 120 MMPLUC activity 7-fold in
the presence of 75 µM PD98059 (data not shown). Thus,
FGF2 up-regulation of the MMP1 promoter in MC3T3-E1 calvarial
osteoblasts proceeds via pathways independent of ERK1/ERK2 MAPK
activity.
FGF2 Induction of the MMP1 Promoter Can Be Mediated via FGFR1 or
Constitutively Active FGFR2-ROS
Pharmacological studies suggested that a signal cascade other than
the ERK1/ERK2 MAPK, PKC, or PI3K pathways mediate FGF2 induction of the
MMP1 promoter. We wished to begin systematic characterization of the
signaling pathways conferring transcriptional activation of MMP1 in
response to FGFR activity. MC3T3-E1 cells express mRNA for FGF
receptors 1 and 2 (Ref. 40 and D. Towler, unpublished) and contain
immunoreactive FGFR1 protein (E. Newberry and D. Towler, unpublished).
To verify that FGFR1 can mediate induction of the MMP promoter, A7r5
myoblasts were cotransfected with the MMPLUC reporter construct and
either pcDNA3 control plasmid or pcDNA3-FGFR1 expression plasmid (29).
Results obtained with the FGF-responsive OCFRE reporter construct (29)
were also monitored as an independent positive control. Expression of
FGFR1 in A7r5 myoblasts permits 2.5- to 3-fold stimulation of MMP1
promoter activity in response to 3 nM FGF2; little if any
induction is observed in the absence of FGFR1 coexpression (Fig. 9
). FGF2 induction of the MMP1 promoter in muscle cell
backgrounds (A7r5 and L6 myoblasts) is not as great as that observed in
osteoblasts (Fig. 9
and our unpublished observations). Intact FGFR1
tyrosine kinase activity is required for signaling in A7r5 cells, since
coexpression of the kinase-deficient FGFR1 variant pcDNA3-FGFR1' (32)
cannot convey inductive signals to either reporter construct (Fig. 9
).
Conversely, a form of FGFR2 that possesses constitutive tyrosine kinase
activity, FGFR2-ROS (33), can up-regulate MMP1 promoter activity in the
absence of exogenous ligand in MC3T3-E1 cells (see Fig. 10
below). Thus, ligand-activated FGFR1 and
constitutively active FGFR2-ROS can convey transcriptional activation
signals to the MMP1 promoter, dependent upon the FGFR tyrosine kinase
activity.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 9. FGF2 Induction of MMP1 Promoter Activity Can be
Mediated via FGFR1
A7r5 vascular smooth muscle cells were transfected with 120MMPLUC
(reporter), CMV ß-galactosidase (control for transfection
efficiency), and either empty expression vector, FGFR1 expression
vector, or FGFR1' expression vector (lacks tyrosine kinase activity) as
described in the text. Two days after transfection, cells were treated
either with vehicle (control) or with FGF2 (3 nM) plus
heparin (3 µg/ml). Twenty hours after treatment, cell extracts were
prepared and analyzed for luciferase and ß-galactosidase activities
as described in the legend to Fig. 1 and in the text. Note that in
cells transfected with empty vector or kinase-deficient FGFR1', FGF2
does not up-regulate MMP1 promoter activity. Note also that in A7r5
cells transfected with the FGFR1 expression vector, FGF2 stimulates 120
MMPLUC activity 2- to 3-fold. Results obtained with the osteocalcin
FGF-responsive element (OCFRE x3) 92 OCLUC, previously shown to respond
to FGFR1-dependent signals (29 ), are provided for comparison.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Figure 10. The Constitutively Active FGFR2-ROS Oncoprotein
Up-Regulates the MMP1 Promoter in MC3T3-E1 Osteoblasts via a
Ras-Dependent Pathway
A constitutively active form of FGFR2, FGFR2-ROS (0.5 µg FGFR2-ROS
expression plasmid per 7 x 105 MC3T3-E1 cells), was
expressed by transient cotransfection with 120 MMPLUC (0.8 µg), CMV
ß-galactosidase (control for transfection efficiency; 0.25 µg), and
the dominant negative Rho, Rac, and Ras expression constructs (0.5
µg) as indicated and detailed in Materials and
Methods. Total input DNA was kept constant in every
transfection with empty expression vector. Data are presented as the
mean luciferase reporter activity observed (± SD) of three
independent transfections. Note that FGFR2-ROS coexpression activates
120 MMPLUC activity 3-fold, in the absence of added FGF2. Note also
that coexpression of dominant negative Ras, but not dominant negative
Rho or Rac, completely abrogates induction of the MMP1 promoter by
FGFR2-ROS. See text for details.
|
|
Dominant Negative Ras, but not Dominant Negative Rac or Rho,
Inhibits FGFR2-ROS Activation of the MMP1 Promoter
Monomeric GTP-binding proteins such as Ras, Cdc42, Rho, and Rac
have overlapping yet distinct roles in the various MAPK-signaling
pathways (22, 41). For example, Ras has been demonstrated to
participate in signaling via ERK1/ERK2, JNK, and FRK MAPK pathways,
while Cdc42, Rho, and Rac convey signals to the JNK and p38 MAPK
pathways (22, 41). To examine the potential roles of various G proteins
in FGF signaling, we tested the capacity of the dominant negative
proteins Rho T19N, Rac T17N, and Ras N17 to inhibit FGFR activation of
the MMP1 promoter (41, 42). For these studies, we used transient
coexpression of a constitutively active FGF receptor, FGFR2-ROS (33),
to stimulate MMP1 promoter activity (coexpression of FGFR2-ROS
empirically permits precise titration of FGFR signal intensity as
assayed by transcriptional up-regulation; not shown). As shown in Fig. 10
, expression of FGFR2-ROS up-regulates activity of 120 MMPLUC.
Coexpression of the dominant negative forms of Rho or Rac does not
inhibit up-regulation, and Rho T19N increases basal MMP1 promoter
activity. By contrast, expression of dominant negative Ras N17
completely abrogates FGFR2-ROS activation of the MMP1 promoter. Thus,
FGFR activity up-regulates MMP1 promoter activity via a Ras-dependent
pathway.
Expression of the MAPK Kinase Phosphatase MKP2 Abrogates FGFR2-ROS
Activation of the MMP1 Promoter
Recently, a Ras-activated atypical PKC isoform, PKC-
, has been
shown to convey integrin-dependent activation of MMP1 expression in
fibroblasts (43). Our pharmacological studies demonstrate that PKC and
ERK1/ERK2 are not mediating FGFR activation of the MMP1 promoter in
osteoblasts. However, we wished to provide direct evidence that MMP1
promoter up-regulation by activated FGFR was indeed proceeding via a
MAPK cascade. The activities of MAPKs are down-regulated by a diverse
family of mixed function MAPK phosphatases (MKPs) that exhibit
overlapping yet somewhat distinct specificities for MAPK substrates
(34). For example, while MKP1 inactivates ERK = JNK = p38
MAPKs, MKP2 inactivates ERK = JNK > p38MAPK, and PAC1
inactivates ERK = p38 MAPK > JNK (34). As a functional test
of the effects of MAPK inactivation on FGFR signaling in osteoblasts,
we coexpressed PAC1 or MKP2 with FGFR2-ROS in MC3T3-E1 cells and
examined the effects of phosphatase expression on the MMP1 promoter. As
shown in Fig. 11
, expression of PAC1 and MKP2 have
little, if any, effect on basal MMP1 promoter activity. By contrast,
expression of PAC1 partially decreases but does not completely inhibit
MMP1 promoter activation by FGFR2-ROS, and expression of MKP2
completely abrogates MMP1 promoter induction. Thus, although
independent of ERK1/ERK2 activity, transcriptional activation of MMP1
by activated FGFR does proceed via a MAPK cascade in MC3T3-E1
osteoblasts, as demonstrated by the sensitivity to expression of MAPK
phosphatases.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 11. Expression of MAPK Kinase Phosphatase MKP2
Abrogates FGFR2-ROS Activation of the MMP1 Promoter
A constitutively active form of FGFR2, FGFR2-ROS (0.5 µg expression
plasmid per 7 x 105 MC3T3-E1 cells), was expressed by
transient cotransfection with 120 MMPLUC (0.8 µg), CMV
ß-galactosidase (0.25 µg), and the PAC1 and MPK2 expression
constructs (0.5 µg) as indicated and described in Materials
and Methods. Total input DNA was kept constant by transfection
with empty expression vector. Data are presented as the mean luciferase
activity observed (± SD) in three independent
transfections. Note that expression of phosphatases does not
significantly affect basal MMP1 promoter activity. Finally, note
whereas coexpression of PAC1 partially decreases 120 MMPLUC activation,
coexpression of MKP2 completely abrogates induction of the MMP1
promoter by FGFR2-ROS. See text for details.
|
|
 |
DISCUSSION
|
|---|
FGF receptor-ligand signaling plays an important role in matrix
biology. Both mesodermal and neural crest-derived skeletal tissues are
patterned in response to developmental cues provided by FGF receptor
signaling (13, 14, 15, 16). Moreover, FGF receptor signaling contributes to
neovascularization and matrix turnover observed during osteotropic
tumor metastasis and pathological fracture (5, 18). Although the
mechanisms whereby FGFs activate matrix turnover have yet to be fully
elucidated, regulation of metalloproteinase gene expression is likely
to be central to both physiological and pathophysiological bone
remodeling and skeletal morphogenesis (1, 2, 3, 4, 5, 18). In this work, we
define a functional FGF response element in the human interstitial
collagenase promoter. This FGF response maps to a previously described
bipartite element denoted by the acronymn TORU, a TPA and
oncogene-regulated unit activated by v-src, Ha-ras, and TPA
(7). This element is functionally promiscuous, activated by multiple
extracellular signals (1, 6, 7, 43). However, as outlined below,
characterization of MMP1 regulation by FGF2 provides additional insight
into the nature of the signal cascades activated by FGFRs in
osteoblasts.
Both FGF2 and PTH activate bone matrix turnover, and both up-regulate
expression of interstitial collagenase genes (2, 5, 12, 37). Ets and
AP1 motifs are present in roughly equivalent positions in the proximal
human, rabbit, mouse, and rat interstitial collagenase promoters (37, 44). Weve recently established that the mouse interstitial
collagenase promoter and mRNA accumulation are both up-regulated by
FGF2 in MC3T3-E1 osteoblasts (D. Towler and T. Latifi, unpublished).
Whether the rodent interstitial collagenase genes represent homologs of
the MMP1 human interstitial collagenase as initially suggested (44) or
homologs of the related interstitial collagenase human MMP13 remains to
be unambiguously determined. Nevertheless, it is intriguing that the
signal cascades activated by FGF2 and by PTH both converge on the AP1
cognate TGAGTCA present in all interstitial collagenase promoters, yet
utilize distinct combinations of protein-DNA interactions to mediate
induction. Rajakumar and Quinn (37) demonstrated that PTH activates the
rat interstitial collagenase promoter in osteoblasts via an
unconventional interaction of CREB with the AP1 cognate. Unlike FGF2
activation of the human interstitial collagenase promoter, activation
of the rat interstitial collagenase promoter by PTH does not require
the nearby Ets cognate (37). Furthermore, our supershift analyses
reveal very little, if any, CREB or ATF1 DNA-binding activity in the
FGF-regulated AP1 complex recognizing the human interstitial
collagenase promoter AP1 cognate. This was very important to exclude
directly because in one report FGF activates CREB and ATF1-dependent
transcription via a p38 MAPK-dependent pathway (27). Finally, agonists
and antagonists of PKA signaling do not influence FGF induction of the
MMP1 promoter in MC3T3-E1 cells. FGF2 induction of the human
interstitial collagenase promoter requires both Ets and AP1 cognates,
and the factor binding to the AP1 cognate contains Fos/Jun family
members, as previously described for induction by PKC (6, 45). As
strong support for the notion that AP1 participates in FGF2-regulated
interstitial collagenase expression, transgenic mice concomitantly
over-expressing c-Fos and c-Jun exhibit accelerated but disordered bone
turnover and increased expression of interstitial collagenase (45).
However, PKC activity does not seem to be necessary for this particular
FGF2 signal in MC3T3-E1 osteoblasts because the broad specificity PKC
inhibitors H-7 and staurosporine do not inhibit human MMP1 promoter
induction by FGF2.
We demonstrate that dominant negative Ras N17 inhibits FGFR2-ROS
activation of the MMP1 promoter, whereas dominant negative Rho and Rac
do not inhibit. Furthermore, we show that in the presence of 25
µM PD98059 (MEK inhibitor; Refs. 25, 26),
FGF-activated ERK phosphorylation is decreased by >85%,
whereas FGF activation of the MMP1 promoter is unaffected. The data
demonstrate that FGF activation of the MMP1 promoter in MC3T3-E1 cells
is independent of ERK1/ERK2 activity, indicating that a pathway other
than the ERK1/ERK2 MAPK mediates activation. The sensitivity of this
signal to MKP2 > PAC1 suggests that JNK or a JNK-like MAPK (22, 23) mediates MMP promoter up-regulation in response to FGFR activation,
consistent with the presence of c-Jun in the FGF2-regulated AP1
complex. However, osmotic stress does not activate the MMP1 promoter,
and MMP1 promoter activation by FGF or FGFR2-ROS is not inhibited by
expression of dominant negative SEK1/MKK4 (E. Newberry and D. Towler,
unpublished observations). Rho has been placed upstream of p38 MAPK in
cytokine and stress-activated signal transduction cascades (22).
Because coexpression of Rho T19N increases basal MMP1 promoter
activity, constitutive activation of the Rho-p38 MAPK signaling cascade
in osteoblasts may antagonize MMP1 regulation by FGF2; this remains to
be tested directly.
Of note, Fos constituents in AP1 complexes are also phosphorylated in
response to extracellular signals (23, 46). For example,
phosphorylation of c-Fos on Thr-232 by a novel 88-kDa proline-directed
kinase known as FRK activates transcription in response to epidermal
growth factor or H-Ras expression (23); its sensitivity to MKP
inactivation is unknown. Fra1 is a specific constituent identified in
the MMP1-AP1-DNA binding complex regulated by FGF2. Like c-Fos, the
carboxy terminus of Fra1 possesses multiple Thr-Pro residues, including
two extended Pro-Xaa-Thr-Pro motifs characteristic of the
proline-directed kinase consensus, and is a substrate for multiple
kinases (46). We are now characterizing the role and regulation of Fra1
and c-Fos phosphorylation in FGF-treated osteoblasts. Moreover, as
outlined below, it has become apparent that Ras-dependent kinase
cascades regulate the activity of both Ets repressors and activators
(31). Because activation of the MMP1 promoter requires both the Ets and
AP1 sites for FGF responsiveness, the FGFR signal cascade is also
likely to regulate the transcriptional activity of factors present at
both of these cognates. Ultimately, it will be important to identify
which kinase cascades mediate FGF action (16, 18, 28) and whether the
same cascade regulates both MMP1 Ets and AP1 DNA-binding factors.
Cooperation between Ets and AP1 factors, first characterized in detail
for regulation of the polyoma virus enhancer by Ets1, Ets2, and
c-Fos/c-Jun in cotransfection studies (47, 48, 49), is well described. Most
Ets domain factors are inactive or very poorly active as
transcriptional activators in the absence of cooperative, permissive
partners (reviewed in Ref. 36). The endogenous Ets factors conveying
transcriptional responses to defined stimuli in vertebrate systems have
been characterized in detail for only a few vertebrate promoters (23, 49, 50). In Drosophila, an FGF homolog (Branchless) signals
via an FGFR homolog (Breathless) to control branching morphogenesis of
the fruit fly respiratory system (51). Genetic analysis of this
developmental process has identified a specific Ets domain protein,
Pointed, as being downstream in the Branchless/Breathless-dependent
signal cascade that controls branching morphogenesis (Ref. 51 and
references therein). It is intriguing that our functional analysis of
the human MMP1 promoter identifies DNA-protein interactions at a
conserved Ets cognate as being important for FGF-dependent
transcription control in osteoblasts. The vertebrate Ets family is
extremely large; >20 vertebrate family members are currently known
(31, 36, 52), several of which have been shown to mediate
transcriptional responses to growth factor signals (vide infra). Ets1,
Ets2, and Erg are expressed in the developing vertebrate skeleton, the
latter two members primarily presaging endochondral bone (53, 54).
Transgenic overexpression of Ets2 has recently implicated this family
member in the regulation of endochondral bone formation (55); whether
this skeletal phenotype is related to increased Ets2 activity or to a
dominant-negative effect of Ets overexpression (36) is currently
unknown. In transient cotransfection assays, Ets1, Ets2, PEA3/E1AF, and
ERM Ets family members all demonstrate the capacity to activate
interstitial collagenase expression (36, 47, 48). However, specific
endogenous Ets family member have yet to be unambiguously identified as
regulating osteoblast gene expression or mediating signals in response
to FGF stimulation. RT-PCR analysis of polyA+ RNA using
degenerate Ets domain amplimers reveals that at least five different
Ets domain activators and one putative Ets domain repressor are
expressed in MC3T3-E1 cells (D. Towler, unpublished). Our immunological
probing of the MC3T3-E1 cellular proteins recognizing the human MMP1
promoter Ets cognate suggests that the prototypic activators Ets1,
Ets2, Fli1, Erg, and PU.1 are not major constituents of these specific
DNA-protein complexes, even though Ets2 is expressed in MC3T3-E1 cells
(D. Towler, unpublished). It will be important to identify which
endogenous Ets factors, known or novel, mediate FGF action in
osteoblasts and whether Ets family members differ in their capacity to
cooperate with the different AP1 heterodimeric transcription complexes
that form during osteoblast differentiation (56).
In the Drosophila photoreceptor cell precursors, reciprocal
positive and negative regulation have been described to occur at the
same Ets cognate via competitive binding of stimulatory (Pointed) and
inhibitory (Yan) Ets domain proteins that cooperate with
Drosophila Jun to mediate receptor tyrosine kinase signals
(57). A similar system may regulate the human interstitial collagenase
promoter in osteoblasts. Mutation of the MMP1 Ets cognate in both
homologous and heterologous promoter contexts increases basal
transcriptional activity and abrogates FGF2 induction, suggesting that
both a repressor and an activator recognize this motif. Two widely
expressed vertebrate Ets repressors, Elk3 (a.k.a. NET, ERP, SAP2) and
ERF have recently been identified (31, 58). The Elk3/SAP2 Ets
DNA-binding domain does not bind the AGGATG-type Ets motif (59) found
in the MMP1 promoter (6) and thus is not likely to directly participate
in MMP1 regulation by FGF2. However, the ERF protein Ets domain is most
closely related to Ets1 (which does bind this motif) and in fact
inhibits Ets1-dependent transcription (31), introducing the notion that
an ERF-like repressor could recognize and regulate the MMP1 promoter.
Moreover, proline-directed threonine phosphorylation of ERF in response
to activated Ras decreases ERF repressor function (Ref. 31 ; DNA binding
not assessed). The identity of this Ras-regulated threonine kinase is
currently unknown. Based upon our results providing evidence for both
positive and negative regulation of the MMP1 via the Ets cognate and
the paradigms being established in Drosophila, it is
tempting to speculate that FGF activation of a Ras-dependent MAPK
cascade down-regulates the suppressor activity of an ERF-like Ets
protein and up-regulates AP1 and an Ets domain transcriptional
activator, the latter two acting in concert to support interstitial
collagenase promoter activity in osteoblasts. MC3T3-E1 cells do express
mRNA for an ERF-like repressor (our unpublished observations); future
experiments will test whether ERF-like repressors expressed in MC3T3-E1
cells regulate the MMP1 promoter in an AP1- and FGF-dependent
fashion.
Characteristics of the MMP1 promoter FGF response differ in several
important ways from the two other FGF-activated elements recently
characterized, the osteocalcin FGF response element (29, 30) and the
proenkephalin FGF response element (27, 35). The proenkephalin FGF
response element is a CRE cognate (TGACGTCA) that is up-regulated by
members of the ATF/CREB leucine zipper family via an FGF-regulated p38
MAPK cascade (27, 35). The OCFRE (GCAGTCA) resembles a CRE, yet is not
activated by FGF2 via known ATF/CREB, Fos, or Fra family members (30);
suppression can be achieved by expression of ATF3 in MC3T3-E1
osteoblasts (30). The FGF-regulated factor recognizing and regulating
the OCFRE in osteoblasts is unknown, but contains an
80-kDa protein
as a major constituent (J. Boudreaux and D. Towler, unpublished). In
ROS17/2.8 osteosarcoma cells the OCFRE is suppressed by TGFß via
regulation of endogenously expressed Fos gene family members (60). We
extend and confirm our recent studies (29) demonstrating that unique
signaling systems mediate FGF2 activation of the OCFRE and the human
MMP1 promoter in MC3T3-E1 osteoblasts: 1) FGF2 induction of the OCFRE
is augmented with forskolin or 8-bromo-cAMP treatment (29, 30), whereas
MMP1 induction is not increased; 2) FGF2 induction of the OCFRE is
inhibited by the phosphoprotein phosphatase inhibitors okadaic acid and
vanadate (29); by contrast, these agents potentiate FGF2 induction of
the human MMP1 promoter; 3) 50 nM staurosporine markedly
potentiates induction of the MMP1 promoter, but has no effect on the
OCFRE (29); 4) induction of the MMP1 gene occurs in part via a c-Fos
containing AP1 factor complex, whereas FGF2 induction of OCFRE occurs
independent of any known Fos family members (30); 5) an Ets DNA cognate
is required for FGF2 induction of the MMP1 gene. FGFR1 can elaborate
both signals, as indicated by the capacity of FGFR1 to confer induction
in receptor-deficient myoblast backgrounds. Moreover, like MMP1
promoter induction, OCFRE induction is also up-regulated by FGFR2-ROS
and inhibited by dominant negative Ras or MKP2, but is insensitive to
PAC1 expression (D. Towler, unpublished observations). This suggests
that the FGF receptor signaling pathways that activate these two
distinct response elements diverge downstream of Ras. It may be
possible to identify selective, pharmacologically useful modulators of
these pathways to regulate bone matrix turnover and formation, as a
novel approach to the treatment of metabolic and metastatic bone
disease.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture and Reagents
Tissue culture reagents were obtained from GIBCO/BRL Life
Technologies (Grand Island, NY) and JRH Biochemicals (Lenexa, KS).
Corning plastic tissue culture dishes were obtained via Fisher
Scientific (St. Louis, MO). MC3T3-E1 murine calvarial osteoblasts were
cultured as previously detailed (30, 61) at 37 C and 5%
CO2 in
-MEM with 10% FCS, 2 mM glutamine,
100 U/ml penicillin, and 100 µg/ml of streptomycin. A7r5 rat vascular
smooth muscle cells obtained from the American Type Culture Collection
(Rockville, MD) were grown in DMEM (high glucose) with 10% FCS, 2
mM glutamine, 100 U/ml penicillin, and 100 µg/ml of
streptomycin. Biochemicals were obtained from Fisher Scientific (St.
Louis, MO) or Sigma (St. Louis, MO). Molecular biology reagents were
obtained from Promega (Madison, WI) and Perkin-Elmer (Foster City, CA).
All custom synthetic oligodeoxynucleotides were obtained from GIBCO/BRL
Life Technologies. Radionuclides were obtained from Amersham (Arlington
Heights, IL). Protein kinase inhibitors and activators were obtained
from BioMol (Plymouth Meeting, PA). FGF2 was purchased from
Collaborative Biomedical Products (Bedford, MA). Protein was determined
using the Pierce BCA protein assay kit (Pierce Chemical, Rockford, IL)
after precipitation and resolubilization as previously described
(29).
DNA Plasmid Constructs
The human collagenase gene promoter (MMP1; Genbank Accession No.
M16567; Ref. 6) was the kind gift of Dr. R. Pierce and Dr. H. Welgus
(Washington University School of Medicine, St. Louis, MO). Using this
DNA as a template, PCR was used to generate the MMP1 fragment -179 to
+63 flanked by 5'-KpnI and 3'-Mlu restriction
sites, as previously described (30). This fragment was ligated into the
KpnI/MluI sites of the promoterless plasmid
pGL2-Basic (Promega), immediately upstream of the luciferase reporter
gene. This same strategy was also used to generate a series of
5'-deletion constructs (-120 to +63; -100 to +63, -75 to +63, -50
to +63). For heterologous promoter experiments, PCR was used to
generate the MMP1 promoter fragments -120 to -61 or -100 to -61
flanked by 5'-KpnI and 3'-Mlu restriction sites.
Fragments were ligated into the KpnI/MluI sites
upstream of RSVLUC (contains minimal RSV promoter -51 to +35 in
pGL2-basic; Ref. 30). Site-directed mutagenesis of Ets and AP1 motifs
was achieved by PCR using mutagenic amplimers as indicated. All
constructs were sequenced (ABI Prism Dye Terminator Cycle Sequencing
Kit; Perkin Elmer, Foster City, CA) to verify the insert sequence.
Construction of the pcDNA3-murine FGFR1 eukaryotic expression vector
has been previously described (29). Expression vectors for FGFR1 (29),
FGFR1' (32), FGFR2-ROS and FGFR2 (33), dominant negative Rho T19N and
Rac T17N (41), and dominant negative RasN17 (42) have been previously
described.
Transient Transfection Assays and Pharmacological Inhibition of
Signaling
All plasmids were prepared by column chromatography (Qiagen,
Chatsworth, CA) for sequencing and transfections. MC3T3-E1 cells were
transfected either by diethylamino-ethyl-dextran/dimethylsulfoxide
shock technique or by calcium phosphate (30, 61). For calcium phosphate
transfections, MC3T3-E1 cells, A7r5 vascular smooth muscle cells, or
passage 3 primary rat calvarial cells were plated into Costar six-well
cluster dishes (35-mm diameter wells, 7 x 105 cells
per well) and then were transfected the next day with 1.52.5
µg/well of calcium phosphate-precipitated DNA punctuated after 618
h by a 60-sec glycerin shock (15% glycerol in HEPES-buffered saline,
pH 7.05) and recovery into growth medium. CMV-ß-galactosidase
expression plasmid (0.1 µg/well) was used to monitor transfection
efficiency. Two days after transfection, cells were treated either with
vehicle (BSA in PBS) or vehicle containing FGF2 (final concentration, 3
nM) for 20 h in media containing 3% FCS. For the A7r5
muscle cell line, heparin (final concentration 3 µg/ml) was added
with FGF2. Cell extracts were subsequently prepared for assay of
luciferase activity (Promega Technical Bulletin 101) and
ß-galactosidase activity (Promega Technical Bulletin 097). Data are
presented as the mean (± SD) luciferase activity for a
minimum of three independent transfections. For studies of
pharmacological inhibitors and promoter activation, MC3T3-E1 cells were
transfected using the diethylaminoethyl-dextran protocol. After 2
days, transfected cells were refed with complete culture medium
containing either vehicles or pharmacological treatments.
Dimethylsulfoxide was the vehicle for all inhibitors, diluted 1:1000
from stocks. Note that cultures were preincubated with either vehicles
or inhibitors (2-fold concentrated) for 0.5 h in complete media
(0.5 ml/well) before the addition of 0.5 ml of complete media
containing either BSA vehicle or 6 nM FGF2. The final
concentrations of inhibitors chosen decrease signaling by
50%
in MC3T3-E1 cell cultures (62, 63, 64) or in 3T3-L1 cell cultures (Ref. 65 ;
for KN-62). After treatment for an additional 18 h, cell lysates
were analyzed for luciferase activity as detailed above and previously
(29).
Electrophoretic Mobility Gel Shift Assays
MC3T3-E1 cells were plated at a density of 150,000 cells per
cm2 in 35-mm plastic tissue culture dishes and treated the
next day with 3 nM FGF for the times indicated in 3% FCS.
Cell extracts were then prepared and DNA-protein interactions were
assessed by gel shift assay as detailed previously (29, 61).
Approximately 15 µg of protein extract were used for each gel shift.
Synthetic oligodeoxynucleotide pairs used for gel shift analysis were:
CCTCAAGAGGATGTTATA and GGTATAACATCCTCTTGA
(duplex encodes human MMP1 promoter fragment -93 to -78; Ets domain
binding cognate underlined at -88 to -83);
CCAAAGCATGAGTCAGAC and GGGTCTGACTCATGCTTT
(duplex encodes human MMP1 promoter fragment -79 to -63; AP1 binding
cognate underlined at -72 to -66);
GGTTGCCTGACGTCAGAGA and CCTCTCTGACGTCAGGCCAA
(duplex encodes the cAMP response element or CRE; CREB and ATF1 binding
cognate underlined). The OCFRE oligonucleotide has been
previously described (36). Oligonucleotide pairs were annealed,
end-labeled with [
-32P]dCTP and the Klenow fragment of
DNA polymerase I, blunt-ended with nonradioactive dCTP and dGTP, and
then separated from unincorporated label by gel filtration (NucTrap
Push Columns, Stratagene, La Jolla, CA). In a standard 20-µl
DNA-binding reaction (30), 0.1 pmol (30,000 cpm) of radiolabeled duplex
oligonucleotide was routinely used for gel shift analysis. For
supershift assays, extracts were preincubated with 1.5 µl of rabbit
polyclonal antibodies to Fos family members, Jun family members,
ATF1/CREB family members, and the indicated Ets family members for
16 h at 4 C before DNA-binding analysis, as previously described
(30). All antibodies for transcription factor supershift analysis were
obtained from Santa Cruz Biotechnology (San Diego, CA). The anti-Fos
family antibodies used were sc-253X (
-Fos), sc-052X (
-cFos),
sc-183X (
-Fra1), sc-171X (
-Fra2), and sc-048X (
-FosB). The
anti-Jun family antibodies used were sc-045x (c-Jun), sc-046x (Jun D),
sc-074x (Jun B), and sc-044x (
-Jun). The
-ATF1 antibody used was
sc-270X (recognizes ATF1, CREB, and cAMP response element modulator).
The Ets antibodies tested were sc-112X (
-Ets1/Ets2; recognizes Ets1,
Ets2, Fli1, Erg1, and Erg2) and sc-352X (
-PU.1; a.k.a. Spi-1).
Western Blot Analyses of ERK Phosphorylation
MC3T3-E1 cells were plated in 35-mm diameter cluster well dishes
(7 x 105 cells per well). The following day, cell
cultures were pretreated either with dimethylsulfoxide vehicle or 2x
concentrated PD98059 for 30 min. Subsequently, cultures were treated
with either an equal volume of 2x concentrated vehicle or FGF2 for an
additional 1 h. The final concentration of PD98059 was 25
µM, and the final concentration of FGF2 was 3
nM. At the end of the treatment period, cells were rinsed
with ice-cold PBS, then scraped into 210 µl/well of phosphoprotein
extraction buffer (25 mM HEPES, pH 7.9; 300 mM
NaCl, 5 mM EDTA, 0.1% Triton X-100; 0.5 mM
dithiothreitol; 100 µM sodium vanadate; 50 mM
sodium fluoride; 50 mM ß-glycerolphosphate; 0.5
mM phenylmethylsulfonylfluoride; 5 µg/ml soybean trypsin
inhibitor; 1 µg/ml leupeptin). After extraction on ice for 10 min,
insoluble debris was pelleted by brief centrifugation, and
phosphorylation of ERK1/ERK2 (p44/p42 MAPKs) was assessed by Western
Blot analysis as follows. Equal amounts (30 µg) of cellular protein
extracts were fractionated by denaturing SDS-PAGE, then
electrotransferred to polyvinylidene difluoride membrane (Tropix,
Bedford, MA) as per the manufacturers instructions (Novex Blot
Module; Novex, San Diego, CA). Tyr-204-phosphorylated forms of
ERK1/ERK2 were specifically immunovisualized using the PhosphoPlus
p44/42 MAPK Antibody Kit (phospho-specific MAPK primary antibody; New
England Biolabs; Beverly, MA). Total p44/p42 MAPK protein was
immunovisualized with pan-ERK monoclonal antibody (1:1000 dilution;
Transduction Laboratories, Lexington, KY) as the primary antibody;
alkaline phosphatase-conjugated goat anti-mouse antibody (1:5000
dilution) as the secondary antibody. ERK immune complexes were
visualized by chemiluminescent detection with the Tropix Western Light
System (Tropix, Bedford, MA) and exposure to Fuji medical x-ray film
(Fisher Scientific). In MC3T3-E1 cells, p42 MAPK is the predominant
ERK. Data are presented as the mean of independent duplicate samples
and are representative of results obtained in two independent
experiments. Relative signal intensity was determined by densitometry
(LKB Ultroscan XL Laser Densitometer, LKB Instruments, Rockville, MD).
In-gel kinase assays were performed on aliquots of these same extracts
with myelin basic protein as the substrate using methods previously
described (34).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. H. Welgus and R. Pierce for the human MMP1 genomic
DNA fragment, Dr. D. Ornitz for the FGFR1 cDNA, Dr. C. Turck for the
kinase-deficient FGFR1' expression construct, Dr. T. Miki for the
FGFR2-ROS expression construct, Dr. G. Bokoch for the dominant negative
Rho and Rac expression constructs, Dr. K. Mulder for the dominant
negative Ras expression construct, and Dr. K. Kelly for the PAC1 and
MKP2 expression constructs. We also thank Dr. D. Creedon for his advise
on assays of MAPK activity and Dr. R. Cagan for helpful comments on
Drosophila eye development.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Dr. Dwight A. Towler, M.D., Ph.D., Washington University School of Medicine, Department of Molecular Biology and Pharmacology-Box 8103, 660 South Euclid, St. Louis, Missouri 63110.
This work was supported in part by NIH Grant AR-43731 (to D.A.T) and by
the Barnes-Jewish Hospital Research Foundation. D.A.T. is also a 1996
Charles E. Culpeper Foundation Medical Science Scholar. E.P.N. and D.W.
were supported by institutional training grants. J.M.B. was supported
in part by a mentored research fellowship from the Childrens Brittle
Bone Foundation.
Received for publication February 12, 1997.
Revision received April 4, 1997.
Accepted for publication April 16, 1997.
 |
REFERENCES
|
|---|
-
Crawford HC, Matrisian LM 1994 Tumor and stromal
expression of matrix metallproteinases and their role in tumor
progression. Invasion Metastasis 14:234245[Medline]
-
Partridge NC, Winchester SK 1996 Osteoblast Proteinases. In:
Bilizikian JP, Raisz LG, Rodan GA (eds) Principles of Bone Biology.
Academic Press, San Diego, pp 207216
-
Blavier L, Delaisse JM 1995 Matrix metalloproteinases are
obligatory for the migration of preosteoclasts to the developing marrow
cavity of primitive long bones. J Cell Sci 108:36493659[Abstract]
-
Holliday LS, Welgus HG, Fliszar CJ, Veith GM, Jeffrey JJ,
Gluck SL 1996 Initiation of osteoclast bone resorption by interstitial
collagenase. J Bone Miner Res 11[Suppl 1]:S182 (Abstract)
-
Mundy GR 1996 Role of cytokines, parathyroid hormone, and
growth factors in malignancy. In: Bilezikian JP, Raisz LG, Rodan GA
(eds) Principles of Bone Biology. Academic Press, San Diego, pp
827836
-
Angel P, Baumann I, Stein B, Delius J, Rahmsdorf HJ, Herrlich
P 1987 12-O-Tetradecanoyl-phorbol-13-acetate induction of the human
collagenase gene is mediated by an inducible enhancer element located
in the 5'-flanking region. Mol Cell Biol 7:22562266[Abstract/Free Full Text]
-
Gutman A, Wasylyk B 1990 The collagenase gene promoter
contains a TPA and oncogene-responsive unit encompassing the PEA3 and
AP-1 binding sites. EMBO J 9:22412246[Medline]
-
Gack S, Vallon R, Schmidt J, Grigoriadis A, Tuckermann J,
Schenkel J, Weiher H, Wagner EF, Angel P 1995 Expression of
interstitial collagenase during skeletal development of the mouse is
restricted to osteoblast-like cells and hypertrophic chondrocytes. Cell
Growth Differ 6:759767[Abstract]
-
Mitchell PG, Magna HA, Reeves LM, Loprestimorrow LL, Yocum
SA, Rosner PJ, Geoghegan KF, Hambor JE 1996 Cloning, expression, and
type II collagenolytic activity of matrix metalloproteinase-13 from
human osteoarthritic cartilage. J Clin Invest 97:761768[Medline]
-
Peters KG, Werner S, Chen G, Williams LT 1992 Two FGF receptor
genes are differentially expressed in epithelial and mesenchymal
tissues during limb formation and organogenesis in the mouse.
Development 114:233243[Abstract]
-
Hurley MM, Marcello K, Abreu C, Brinckerhoff CE, Bowik CC,
Hibbs MS 1995 Transcriptional regulation of the collagenase gene by
basic fibroblast growth factor in osteoblastic MC3T3E1 cells. Biochem
Biophys Res Commun 214:331339[CrossRef][Medline]
-
Varghese S, Ramsby ML, Jeffrey JJ, Canalis E 1995 Basic
fibroblast growth factor stimulates expression of interstitial
collagenase and inhibitors of metalloproteinases in rat bone cells.
Endocrinology 136:21562162[Abstract]
-
Muenke M, Schell U, Hehr A, Robin NH, Losken HW, Schinzel A,
Pulleyn LJ, Rutland P, Reardon W, Malcolm S, Winter RM 1994 A common
mutations in the fibroblast growth factor receptor 1 gene in Pfeiffer
syndrome. Nat Genet 8:269274[CrossRef][Medline]
-
Reardon W, Winter RM, Rutland P, Pulleyn LJ, Jones BM, Malcolm
S 1994 Mutations in the fibroblast growth factor receptor 2 gene cause
Crouzon syndrome. Nat Genet 8:98103[CrossRef][Medline]
-
Colvin JS, Bohne BA, Harding GW, McEwen DG, Ornitz DM 1996 Skeletal overgrowth and deafness in mice lacking fibroblast growth
factor receptor 3. Nat Genet 12:390397[CrossRef][Medline]
-
Hurley HM, Florkiewicz RA 1996 Fibroblast growth factor and
vascular endothelial cell growth factor families. In: Bilezikian JP,
Raisz LG, Rodan GA (eds) Principles of Bone Biology. Academic Press,
San Diego, pp 627645
-
Tang K-T, Cappareelli C, Stein JL, Stein GS, Lian JB, Huber
AC, Braverman LE, DeVito WJ 1996 Acidic fibroblast growth factor
inhibits osteoblast differentiation in vitro: altered
expression of collagenase, cell growth-related, and
mineralization-associated genes. J Cell Biochem 61:152166[CrossRef][Medline]
-
Friesel RE, Maciag T 1995 Molecular mechanisms of
angiogenesis: fibroblast growth factor signal transduction. FASEB J 9:919925[Abstract]
-
Long MW, Robin JA, Ashcraft EA, Mann KG 1995 Regulation of
human bone marrow-derived osteoprogenitor cells by osteogenic growth
factors. J Clin Invest 95:881887
<