help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Newberry, E. P.
Right arrow Articles by Towler, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Newberry, E. P.
Right arrow Articles by Towler, D. A.
Molecular Endocrinology 11 (8): 1129-1144
Copyright © 1997 by The Endocrine Society

Fibroblast Growth Factor Receptor Signaling Activates the Human Interstitial Collagenase Promoter via the Bipartite Ets-AP1 Element

Elizabeth P. Newberry, David Willis, Tammy Latifi, Jeanne M. Boudreaux and Dwight A. Towler

Departments of Medicine (E.N., T.L., D.A.T.), Pediatrics (J.M.B.), and Molecular Biology and Pharmacology (D.W., D.A.T.) Division of Bone and Mineral Diseases Washington University School of Medicine St. Louis, Missouri 63110


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Interstitial collagenases participate in the remodeling of skeletal matrix and are regulated by fibroblast growth factor (FGF). A 0.2-kb fragment of the proximal human interstitial collagenase [matrix metalloproteinase (MMP1)] promoter conveys 4- to 8-fold induction of a luciferase reporter in response to FGF2 in MC3T3-E1 osteoblasts. By 5'-deletion, this response maps to nucleotides -100 to -50 relative to the transcription initiation site. The 63- bp MMP1 promoter fragment -123 to -61 confers this FGF2 response on the rous sarcoma virus minimal promoter. Intact Ets and AP1 cognates in this element are both required for responsiveness. The AP1 site supports basal and FGF-inducible promoter activity. The intact Ets cognate represses basal transcriptional activity in both heterologous and native promoter contexts and is also required for FGF activation. FGF2 up-regulates a DNA-binding activity that recognizes the MMP1 AP1 cognate and contains immunoreactive Fra1 and c-Jun. Both constitutive and FGF-inducible DNA-binding activities are present in MC3T3-E1 cells that recognize the MMP1 Ets cognate; prototypic Ets transcriptional activators are not present in these complexes. Inhibitors of protein kinase C, phosphatidyl inositol 3-OH kinase, and calmodulin-dependent protein kinase do not attenuate MMP1 promoter activation. FGF2 activates ERK1/ERK2 signaling in osteoblasts; however, 25 µM MAPK-ERK kinase (MEK) inhibitor PD98059 (inhibits by > 85% the phosphorylation of ERK1/ERK2) has no effect on MMP1 promoter activation by FGF2. Ligand-activated and constitutively active FGF receptors initiate MMP1 induction. Dominant negative Ras abrogates MMP1 induction by constitutively active FGFR2-ROS, but dominant negative Rho and Rac do not inhibit induction. The mitogen-activated protein kinase (MAPK) phosphatase MKP2 [inactivates extracellular regulated kinase (ERK) = Jun N-terminal kinase (JNK) > p38 MAPK] completely abrogates MMP1 activation, whereas PAC1 (inactivates ERK = p38 > JNK) attenuates but does not completely prevent induction. Thus, a Ras- and MKP2-regulated MAPK pathway, independent of ERK1/ERK2 MAPK activity, mediates FGF2 transcriptional activation of MMP1 in MC3T3-E1 osteoblasts, converging upon the bipartite Ets-AP1 element. The DNA-protein interactions and signal cascades mediating FGF induction of the MMP1 promoter are distinct from two other recently described FGF response elements: the MMP1 promoter (-123 to -61) represents a third FGF-activated transcriptional unit.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Interstitial collagenases are members of a large family of matrix metalloproteinases (MMPs). These enzymes play important roles in the physiology and pathophysiology of bone matrix degradation and turnover (1, 2). Temporospatial coordination of bone resorption (by osteoclasts) and formation (by osteoblasts) is necessary for normal bone growth. Resorption is dependent upon a sequential admixture of secreted proteinases (2, 3, 4). Interstitial collagenase activity secreted by osteoblasts participates in the initiation of the bone resorption mediated by cysteine proteinases secreted by osteoclasts (2, 3, 4). Net bone synthesis or degradation reflects the balance between osteoblast matrix protein biosynthesis, proteolytic activities secreted by osteoclasts and osteoblasts, and natural proteinase inhibitor concentrations — parameters tightly regulated by polypeptide growth factors and hormones (2, 5).

Interstitial collagenase promoter activity is inducible in many cell types by oncogenes and phorbol esters (6, 7). However, during normal murine development, interstitial collagenase expression is most readily detected in hypertrophic chondrocytes and osteoblasts undergoing mineralization (8), implicating a role for interstitial collagenase enzyme activity in normal skeletal morphogenesis. In adult human chondrocytes, two related interstitial collagenase genes, MMP1 and MMP13, have been identified as being expressed (9). Intriguingly, like interstitial collagenase, the fibroblast growth factor receptor-1 (FGFR1) gene is also most highly expressed in hypertrophic chondrocytes and osteoblasts undergoing mineralization (10); moreover, basic fibroblast growth factor (FGF2) up-regulates interstitial collagenase expression in osteoblasts (11, 12). Elegant human and mouse genetic studies have now firmly established that FGF receptor signaling provides key regulatory cues in the temporospatial control of skeletal morphogenesis and gene expression (13, 14, 15). FGF receptor-ligand signaling can promote net decrements in matrix collagen accumulation by inhibiting type I collagen expression, enhancing matrix degradation, and inhibiting the activity of IGFs by down-regulation of important coregulatory IGF-binding proteins (2, 5, 16). However, FGFs also promote the proliferation of osteoprogenitors and neovascularization, steps necessary for bone formation and mineralization (16, 17, 18, 19, 20). In vivo, intravenous FGF2 promotes endosteal but not periosteal bone formation (20). Thus, the complex net pharmacological effects of FGF on bone accumulation probably reflect the summation of osteoprogenitor pool recruitment and expansion, neovascularization, down-regulation of type I collagen matrix formation, and stage-specific action on osteoblast differentiation (16, 19).

Biochemical and genetic studies suggest that FGF receptor activation provides physiologically unique signals not provided by other growth factors (13, 14, 15, 21). Despite the important role of FGFs in connective tissue biology, remarkably little is known concerning the transcriptional mechanisms whereby FGF receptor signaling regulates gene expression in any mesenchymal cell type, including osteoblasts. FGF receptors activate multiple intracellular signaling systems (18), including the mitogen-activated protein kinase (MAPK) signal cascades (18). To date, five categories of MAPK cascades have been described (Refs. 22, 23, 24, 25, 26 ; see Ref. 22 for complete review including nomenclature and abbreviations): 1) The classic ERK1/ERK2 MAPK cascade (ERK; extracellular regulated kinase), also known as p44/p42 MAPK pathway, regulated by Ras, multiple Raf family members, MEK1/MEK2 (MEK; MAPK-ERK kinase), protein kinase C (PKC) (via Raf), and mitogens, sensitive to PD98059 inhibition of MEK1 and MEK2; 2) The JNK pathway (Jun N-terminal kinase; a.k.a. stress-activated protein kinase), a family of~ 55-kDa MAPKs regulated by Ras, Cdc42, Rac, SEK1/MKK4, ultraviolet light, osmotic stress, and inflammatory cytokines; 3) The related p38 and p38ß MAPK pathway, regulated by Ras, Cdc42, Rho, MKK3, MKK6, osmotic stress, arsenite, and inflammatory cytokines, sensitive to SB203580 inhibition; 4) The approximately 110-kDa BMK1 pathway (Big MAPK; also known as ERK5), regulated by hydrogen peroxide and hyperosmolar stress; and 5) The FRK pathway (Fos regulating kinase; 88-kDa MAPK) that activates AP1-dependent transcription via proline-directed phosphorylation of c-Fos on Thr-232, initially described as regulated by oncogenic H-ras and epidermal growth factor. Of the five MAPKs described above, only FRK has yet to be isolated and cloned (24). As a mitogen, FGF does activate the ERK1/ERK2 MAPK cascade (18); however, Comb and co-workers (27) recently demonstrated that FGF activation of cAMP-response element binding protein (CREB)- and ATF1-dependent transcription occurs via the p38 MAPK cascade in neuroblastoma cells, inhibited by SB203580 but not by PD98059. Moreover, FGF receptor stimulation activates phosphoinositide turnover and increases intracellular calcium, activating PKC-dependent and calcium/calmodulin-dependent protein kinase signal transduction cascades (18, 28). Thus, FGFR signaling likely proceeds via multiple signaling pathways. Consistent with this notion, we recently demonstrated that two pharmacologically distinct signals are elaborated in FGF-stimulated MC3T3-E1 osteoblasts that up-regulate the osteocalcin FGF response element (OCFRE) and human MMP1 interstitial collagenase promoter activity (29, 30). The phosphoprotein phosphatase inhibitors, okadaic acid and vanadate, inhibit activation of the OCFRE, but do not inhibit activation of the MMP1 promoter in MC3T3-E1 cells (30). The OCFRE and MMP1 promoter thus represent two models useful for studying FGF-dependent transcriptional activation in osteoblasts.

In this study, we perform systematic analysis of FGF receptor-regulated interstitial collagenase promoter activity, pharmacologically and biochemically challenging the signal cascades that potentially mediate FGF action in osteoblasts (vide supra). FGF2 activates the proximal human MMP1 promoter 4- to 8-fold (luciferase reporter) in both primary osteoblast cultures and the MC3T3-E1 osteoblast cell line. The human interstitial collagenase promoter fragment -123 to -61 functions as a minimal FGF-responsive element, conferring induction on the unresponsive heterologous rous sarcoma virus (RSV) minimal promoter. Within this fragment, two conserved motifs are present that were previously identified as mediating responses to H-ras, v-src, and PKC activation (6, 7). FGF regulates DNA-protein interactions at both of these motifs: 1) an AP1 DNA-binding activity that contains Fos and Jun family members, including immunoreactive Fra1 and c-Jun; and 2) an unidentified DNA-binding activity that recognizes the Ets DNA cognate. A constitutive DNA-binding factor (i.e. not regulated at the level of binding by FGF2) also recognizes the MMP1 Ets cognate. Point mutation of the Ets cognate in the native MMP1 promoter context indicates that both positive and negative regulation of transcriptional activity is mediated via that cognate, suggesting that an ERF-like Ets repressor (31) may participate in MMP1 regulation. FGFR1 is expressed in MC3T3-E1 osteoblasts, and FGFR1 expression in receptor-deficient myoblasts confers ligand-dependent activation of the MMP1 promoter. Signaling depends upon FGFR1 tyrosine kinase activity, since the naturally occurring kinase-deficient variant FGFR1' (32) cannot convey MMP1 promoter induction. Conversely, the FGFR2-ROS osteosarcoma oncoprotein that possesses constitutive tyrosine kinase activity (33) up-regulates the MMP1 promoter in the absence of exogenous ligand. Induction of promoter activity by FGFR2-ROS is inhibited by dominant negative Ras, but not by dominant negative Rho or Rac. Pharmacological manipulation of ERK1/ERK2 MAPK signaling, PKC, protein kinase A (PKA), phosphatidyl inositol 3 hydroxyl kinase (PI3K), or calcium-calmodulin-dependent protein kinase (CaMK) does not abrogate induction. Importantly, the data show that this particular Ras-dependent FGFR signal is independent of ERK1/ERK2 MAPK and PKC activity. However, overexpression of the MAPK phosphatase MKP2 [inactivates ERK = JNK > p38 MAPK (34)] abrogates FGFR activation of the MMP1 promoter, indicating that a MAPK pathway is involved with this transcriptional response. The DNA-protein interactions and signal cascades that activate the MMP1 FGF-responsive element are distinct from those regulating the osteocalcin (29, 30) and proenkephalin (35) FGF-responsive elements. The human interstitial collagenase promoter region -123 to -61 thus represents a third FGF-activated transcriptional response element.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Human MMP1 Promoter Fragment -123 to -61 Defines a Minimal FGF-Responsive Element
Hurley and co-workers (11) recently described that FGF1 (acidic FGF) up-regulates the 1.8-kb rabbit interstitial collagenase promoter in MC3T3-E1 cells. In a similar fashion, the proximal human MMP1 interstitial collagenase promoter fragment (-179 to +63; 179 MMPLUC) is sufficient to convey FGF2 transcriptional activation in MC3T3-E1 calvarial osteoblasts (30) and passage 3 primary rat calvarial osteoblasts (D. Towler, unpublished). To identify structural features of the MMP1 promoter conferring FGF2 responses in osteoblasts, we analyzed the FGF2 responsiveness of a series of MMP1 promoter 5'-deletion constructs linked to the luciferase reporter. Like 179 MMPLUC, 100 MMPLUC (fragment -100 to +63) is also capable of responding to FGF2 (Fig. 1Go). Further 5'-deletion of the region -100 to -76 in this context has little effect on basal promoter activity, but significantly decreases FGF2 responsiveness by approximately 50% (Fig. 1Go, compare 100 MMPLUC with 75 MMPLUC). By contrast, 5'-deletion of the region -75 to -51 markedly decreases basal promoter activity (Fig. 1Go; compare 50 MMPLUC to 75 MMPLUC and 100 MMPLUC). Moreover, the MMP1 promoter fragment -50 to +63 present in 50 MMPLUC is no longer inducible by FGF2. The SV40 promoter and the RSV minimal promoter are not stimulated by FGF2 treatment (Fig. 1Go). These data indicate that the MMP1 promoter region -100 to -50 encodes information important for conveying full FGF2 responsiveness. Inspection of this region (Fig. 2Go) reveals two motifs, the AGGATG Ets cognate (-88 to -83) and TGAGTCA (-72 to -66), known to convey responses to oncogenes and phorbol esters (6, 36). To directly assess whether these motifs participate in FGF2 induction, the MMP1 promoter fragment -123 to -61 was assessed for its capacity to convey this FGF2 response on the unresponsive RSV minimal promoter. As shown in Fig. 1Go, MMP (-123 to -61)RSVLUC is inducible by FGF2. Mutation of the AP1 cognate (TGAGTCA to TGATTTA) completely destroys the activity of this element and abrogates FGF2 responsiveness, noted upon comparison of MMP (-123 to -61/APMUT1)RSVLUC with MMP (-123 to -61) RSVLUC. Surprisingly, mutation of the Ets cognate as in MMP (-123 to -61/ETSMUT)RSVLUC increases basal promoter activity, but also abrogates FGF2 induction. Thus, the 63-bp region -123 to -61 of the human MMP1 promoter defines a functional FGF-responsive element. Both Ets and AP1 cognates in this region are necessary to confer FGF responsiveness, but differentially regulate basal transcriptional activity of the element.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. The MMP1 Promoter Region -123 to -61 Encodes a Functional FGF Responsive Element, Dependent upon Intact Ets- and AP1-Binding Motifs

A series of deleted and mutated MMP1 promoter fragments were generated by PCR as described in Materials and Methods, then ligated upstream of the promoterless luciferase reporter gene (MMPLUC constructs) or the luciferase gene driven by the RSV minimal promoter (RSVLUC constructs) as indicated. These constructs were then transfected into MC3T3-E1 calvarial osteoblasts and subsequently analyzed for the capacity to respond to FGF2 as described in the legend to Fig. 1Go and in the text. Data are presented as the mean luciferase activity (± SD) of three independent transfections. Note that serial 5'-deletion of the MMP promoter from -100 to -75 markedly decreases FGF responsiveness (compare 100 MMPLUC and 75 MMPLUC), whereas further deletion to -50 (50 MMPLUC) completely abrogates responsiveness. The MMP1 promoter fragment -123 to -61 can convey FGF induction on the unresponsive heterologous RSV minimal promoter [compare responsiveness of MMPLUC (-123 to -61) RSVLUC with RSVLUC]. Note also that the SV40 promoter is not activated by FGF2. The constructs MMPLUC (-123 to -61; ETSMUT) RSVLUC and MMPLUC (-123 to -61; AP1MUT) RSVLUC are not inducible by FGF2, indicating that intact Ets (AGGATG) and intact AP1 (TGAGTCA) motifs are necessary for FGF regulation. Further note that mutation of the Ets cognate (to TTTATG) increases basal activity in this heterologous promoter context, whereas mutation of the AP1 cognate (to TGATTTA) decreases transcriptional activity to the level observed with the minimal RSV promoter. See text for details.

 


View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. The Proximal Human Interstitial Collagenase Promoter

Nucleotide sequence of the human interstitial collagenase MMP1 promoter region -100 to -61 is shown; only the upper strand sequence is given (6 ). Ets and AP1 cognates are in italics, and sequences used in gel assays as duplex oligonucleotides are underlined (Ets) or overlined (AP1). See text for details.

 
The Ets Cognate of MMP1 Regulates Both Basal and FGF2-Inducible Promoter Activity in the Native Promoter Context
Very recently, DNA-protein interactions at Ets cognates have been described as mediating both positive and negative transcriptional regulation (31). The effects of Ets sites mutation on transcriptional activity in the heterologous context shown (Fig. 1Go) suggest that both positive and negative transcriptional regulation occurs via this cognate. To confirm the importance of the Ets cognate in basal and FGF2-induced MMP1 promoter activity, we introduced the Ets site mutation (AGGATG to TTTATG; thymidine substitutions at nucleotides -88 to -86) in the native MMP1 promoter context, -120 to +63. As observed in the heterologous promoter context (Fig. 1Go), basal promoter activity is increased 2.5-fold by mutation of the Ets cognate (Fig. 3Go). As also observed in the heterologous promoter, mutation of the Ets site in the MMP1 native promoter context abrogates FGF2 induction (Fig. 3Go). Thus, these data confirm the importance of the Ets cognate in both suppression of basal promoter activity and in FGF2 activation of the MMP1 promoter.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. The MMP1 Ets Cognate Confers Both Basal Promoter Suppression and FGF2 Activation in the Homologous Promoter Context

To confirm the importance of the Ets cognate in MMP1 induction, the Ets cognate mutation was introduced into the MMP1 promoter fragment, -120 to +63, as described in the text, then ligated upstream of the luciferase reporter gene. The activity of this mutated MMP1 construct, denoted 120 MMPLUC ETSMUT, was then compared with the wild type promoter construct 120MMPLUC in transfected MC3T3-E1 cells under basal and FGF-stimulated conditions, as described in the legend to Fig. 1Go. As observed in the heterologous RSV promoter context (Fig. 1Go), mutation of the MMP1 Ets motif abrogates FGF induction. Note also that mutation of the Ets cognate, as observed in the heterologous promoter context (Fig. 1Go), again increases basal MMP1 promoter activity. See text for details.

 
FGF2 Rapidly Up-Regulates a DNA-Binding Activity that Recognizes the MMP1 Promoter Fragment -79 to -63 and Contains Fra1 and c-Jun as Constituents
We wished to assess whether FGF stimulation regulates DNA-protein interactions at the MMP1 promoter AP1 element. Extracts were prepared from MC3T3-E1 cells treated for the indicated times with 3 nM FGF2, then analyzed for DNA-binding activity recognizing the MMP promoter fragments -79 to -63 (AP1 duplex oligo) and -93 to -78 (Ets duplex oligo; see Fig. 2Go). As shown in Fig. 4AGo, FGF2 up-regulates DNA- binding activity recognizing the AP1 motif, within 0.5 h of stimulation. Pretreatment of this complex with anti-Fos antibody (recognizes c-Fos, Fra1, Fra2, and FosB) almost completely destroys and partially supershifts this complex (Fig. 4BGo, lane 2), indicating that Fos family members are major constituents of this binding activity. This is a specific effect, since the osteocalcin FGF response element-binding protein recognition of the OCFRE is not affected by pretreatment with either anti-Fos antibody (Fig. 4BGo, lanes 4–6). By contrast, antibodies recognizing the leucine zipper proteins Fra2 (Fig. 4BGo, lane 3) and ATF1/CREB family members (Fig. 4CGo, lane 4) do not significantly affect or supershift factor binding to the MMP1 AP1 site. The anti-ATF1 antibody (recognizes CREB and ATF1) is competent in gel shift assays because it is capable of supershifting MC3T3-E1 protein complexes that bind the authentic CREB-binding cognate CRE (cAMP response element) (Fig. 4CGo, see lanes 5 and 6).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 4. FGF2 Rapidly Up-Regulates an MMP1 Promoter AP1 Cognate DNA-Binding Activity that Contains Immunoreactive Fos but not ATF1/CREB Family Members

A, MC3T3-E1 cells were treated for the indicated times with 3 nM FGF2. Cell extracts were subsequently prepared and analyzed by gel shift assay for DNA-binding activities that recognize the MMP1 promoter fragment -79 to -63 (see Fig. 2Go), encompassing the AP1 cognate. Lane 1, No extract; lanes 2–7, extracts from cells treated for indicated times with 3 nM FGF2. (Note that FGF2 up-regulates within 0.5 h (lane 3) a DNA-binding activity that recognizes the AP1 cognate of MMP1.) B, Extracts prepared from cells treated with 3 nM FGF2 were analyzed for MMP1 AP1 DNA-binding activity and immunologically probed using gel supershift assays. Lanes 1–3, gel shift assay using radiolabeled MMP1 AP1 duplex oligo; lanes 4–6, gel shift assay using OCFRE cognate duplex oligo (Ref. 30). Note that the anti-Fos antibody supershifts (SS) and destroys the AP1-binding complex (lane 2), but not the OCFRE-binding complex (lane 5). Further note that the Fra2 antibody does not affect binding to either DNA cognate (lane 3, lane 6). C, Lanes 1–4, Gel shift assays using radiolabeled MMP1 AP1 duplex oligo; lanes 5–6, gel shift assays using authentic cAMP response element (CRE) cognate duplex oligo. Lane 1, No extract added; lanes 2–6, with MC3T3-E1 extract. Note that anti-Fos antibody destroys and supershifts (SS) the DNA-protein complex binding the MMP1 AP1 cognate (lane 3). Note also that anti-ATF1 antibody (against CREB, ATF1), does not significantly supershift complexes binding the MMP1 AP1 cognate (lane 4), but does supershift complexes recognizing the authentic CRE cognate (lane 6). Unbound probe has been run to the very bottom of the gel to facilitate visualization of supershifted complexes.

 
Upon immunological probing with antibodies specific for particular Fos family members, only anti-Fra1 substantially supershifts the MMP1 promoter AP1-binding complex (Fig. 5Go, lane 4); antibodies specific for c-Fos, Fra2, and FosB have no effect (Fig. 5Go, lanes 3, 5, and 6). Similarly, antibodies that recognize either c-Jun specifically or all Jun family members partially supershift this AP1-binding complex (Fig. 5Go, see lanes 7 and 10). Antibodies specific for JunD and JunB do not supershift this complex (Fig. 5Go, lanes 8 and 9). Thus, in MC3T3-E1 osteoblasts, FGF2 up-regulates an AP1- binding complex that recognizes the MMP1 promoter and contains immunoreactive Fra1 and c-Jun as constituents. Unlike the interstitial collagenase AP1-binding complexes induced by PTH (37), CREB/ATF1 is not a major constituent of the FGF-regulated complex.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 5. The FGF2-Induced MMP1 AP1 Binding Complex Contains Immunoreactive Fra-1 and c-Jun as Constituents

Extracts prepared from MC3T3-E1 cells treated for 24 h with 3 nM FGF2 were analyzed for MMP1 AP1 DNA binding activity and immunologically probed in gel supershift assays, as described in the text. Note that the anti-Fos antibody (lane 2) recognizes all family members and the anti-Fra1 antibody (lane 4) substantially supershift this AP1-binding complex. By contrast, antibodies recognizing c-Fos (lane 3), Fra-2 (lane 5), or Fos B (lane 6) are without effect. Further note that antibodies recognizing either c-Jun specifically (lane 7) or all Jun family members (lane 10) partially supershift this AP1 complex. By contrast, antibodies specific for JunD or JunB do not supershift this complex (lanes 8 and 9).

 
Both Constitutive and FGF2-Regulated DNA-Binding Activities Recognize the MMP1 Promoter Fragment -93 to -78
In a similar fashion, FGF2 up-regulates DNA-binding activity recognizing the MMP1 promoter fragment -93 to -78 encompassing the Ets motif core at -88 to -83 (Fig. 6Go). Three complexes are visible in untreated control cells; complexes A and B are up-regulated by FGF2, while complex C changes very little and is essentially constitutive in this assay. However, the time course of induction of complexes A and B is quite different from that observed for AP1; binding activity is not up-regulated until after 5 h of treatment, first noted at 24 h of treatment, and persists for up to 30 h (Fig. 6Go). The constituents of these DNA-protein complexes are currently unknown; immunological probing with antibodies recognizing Ets1, Ets2, Fli1, and Erg (anti-Ets1/Ets2 antibody) and PU.1/Spi1 (anti-PU.1) do not affect DNA-binding activity or supershift any of these complexes (data not shown). Thus, both FGF-regulated and constitutive DNA-binding complexes recognize the MMP1 Ets cognate in MC3T3-E1 cells.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 6. Constitutive and FGF2-Regulated DNA Binding Activities Recognize the MMP1 Promoter Fragment -93 to -78 Encompassing the Ets Cognate

Cell extracts were prepared from independent duplicate MC3T3-E1 cell cultures treated with 3 nM FGF2 for the indicated times. Extracts were subsequently analyzed for DNA-binding activity recognizing the MMP1 promoter fragment -93 to -78 encompassing the Ets cognate (Fig. 2Go). Data are presented as gel shift assay results obtained from independent duplicate cultures (all time points). Three different DNA-binding complexes are observed; the major FGF-stimulated DNA-binding activity is indicated by the arrow. Complex C is relatively constitutive, while complexes B and A are both up-regulated by FGF2 (lanes 7–10) sometime between 5 and 24 h of treatment. Unbound radiolabeled oligo has been run off the bottom of the gel to facilitate resolution of complexes C and B. The anti-Ets1/Ets2 antibody (recognizes Ets1, Ets2, Fli1, and Erg) and anti-PU.1 antibody do not supershift or destroy any of the three complexes (data not shown).

 
Pharmacological Inhibition of PKA, PI3K, PKC, CaMK, and MEK1/MEK2-ERK1/ERK2 Kinase Cascades Does not Disrupt FGF Activation of the MMP1 Promoter
FGFR1 has been shown to activate multiple MAPK cascades, stimulate phospholipid turnover and increase intracellular calcium levels, and activate PI3K (16, 18, 28). We wished to pharmacologically assess whether specific kinase-signaling cascades downstream of receptor activation participate in the up-regulation of the human interstitial collagenase promoter in response to FGF2. Unlike FGF2 activation of the osteocalcin promoter (30), up-regulation of the human MMP1 promoter in MC3T3-E1 calvarial osteoblasts is not potentiated by forskolin treatment (Fig. 7Go). Inhibitors of PKA (H-7, H-89, KT-5720; Ref. 38) have no effect on induction (Fig. 7Go). Wortmannin, an inhibitor of the PI3K/protein kinase B pathway (39), also does not hinder FGF activation of MMP1. Similarly, the CaMK inhibitor KN-62 does not inhibit MMP1 induction by FGF2 (Fig. 7Go). The phorbol ester tetradecanoyl phorbol acetate (TPA), well known to activate PKC and up-regulate MMP1 expression via an AP1 motif in a cell type-dependent fashion (6), modestly stimulates 120 MMPLUC promoter activity in MC3T3-E1 cells (Fig. 7Go). This suggested that FGF activation may proceed in part via one of the typical PKC isotypes; however, the broad spectrum serine/threonine kinase inhibitors H-7 and staurosporine that inhibit PKC-dependent signaling (38) do not inhibit FGF2 action (actually enhance induction; Fig. 8Go). The observation that 50 nM staurosporine augments FGF induction of the MMP1 promoter suggests that another Ser/Thr kinase cascade may inhibit FGF activation of MMP1 promoter. Thus, although potentially mediating FGFR signals (18, 28), PKC, PI3K, and CaMK activities are not required for transcriptional up-regulation of the MMP1 promoter by FGF2.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 7. Pharmacological Inhibition of PKC, Phosphatidyl Inositol 3 Hydroxyl Kinase, PKA, Calcium-Calmodulin-Dependent Protein Kinase, and MEK-ERK Kinase Pathways Does not Disrupt FGF Activation of the MMP1 Promoter

MC3T3-E1 cells were transfected with 120 MMPLUC and allowed to recover for 40 h. Cells were then pretreated for 0.5 h with complete media containing 2-fold concentrated kinase inhibitor or modulator (see Materials and Methods for details), followed by the addition of an equal volume of media containing either vehicle or 6 nM FGF2. The final concentration of inhibitor or modulator is given on the left side of the figure; the final FGF2 concentration is 3 nM. Data are presented as the mean (± SD) induction of 120 MMPLUC from basal activity (i.e. vehicles alone) for each of the indicated treatments. Note that, unlike the osteocalcin promoter (30 ), the MMP promoter is not synergistically induced by FGF2 and forskolin. The PKA inhibitors H-89 and KT-5720 do not inhibit induction. Similarly, treatment with PKC inhibitors staurosporine and H-7 do not inhibit FGF2 induction, and TPA treatment cannot mimic FGF2 action. Staurosporine markedly and specifically (see Ref. 29) potentiates MMP1 induction by FGF2, suggesting that a Ser/Thr kinase cascade antagonizes the MMP-inductive pathway, but not the OCFRE pathway. Induction is not attenuated by the PI3K inhibitor wortmannin or by the CaMK inhibitor KN-62. Finally, note that 25 µM PD98059, which inhibits by >85% the FGF2-induced phosphorylation of ERK1/ERK2 in MC3T3-E1 osteoblasts (Fig. 8Go below), also has no effect on 120 MMPLUC induction by FGF2. See text for details.

 


View larger version (17K):
[in this window]
[in a new window]
 
Figure 8. FGF2 Induction of ERK1/ERK2 (p44/p42 MAPK) Phosphorylation Is Inhibited by 25 µM PD98059

MC3T3-E1 cells were pretreated for 0.5 h with complete media containing 50 µM PD98059, followed by the addition of an equal volume of media containing either BSA vehicle or 6 nM FGF2. The final concentration of PD98059 is 25 µM, and the final FGF2 concentration is 3 nM (as in the transfection experiments described in the legend to Fig. 7Go). After 1 h of treatment with FGF2, cellular extracts were analyzed by Western blot with phospho-ERK1/ERK2 antibody (upper panel; recognizes only Tyr-phosphorylated p44/42 MAPKs, denoted pp42 MAPK) and anti-ERK antibody (lower panel; recognizes total ERK protein, denoted p42 MAPK; p42 is predominantly MC3T3-E1 osteoblasts). Results are shown for two independently treated samples. Note that FGF2 treatment up-regulates ERK phosphorylation (lanes 3 and 4, vs. lanes 1 and 2; upper panel), but has no effect on total ERK protein (lower panel, lanes 1–4). Similar changes in ERK1/ERK2 enzyme activity are observed in these same extracts as determined by in-gel kinase assay using myelin basic protein as a substrate (data not shown). Also note that 25 µM PD98059 decreases by > 85% the induction of ERK phosphorylation (upper panel, lanes 7 and 8 vs. lanes 3 and 4), but has no effect on total ERK protein (lower panel, lanes 5–8). Recall that 25 µM PD98059 has no effect on 3 nM FGF2 induction of 120 MMPLUC (Fig. 7Go), even though it inhibits FGF2 activation of this MEK-ERK cascade (lanes 7 and 8).

 
FGF2 stimulation activates multiple MAPK cascades in cells (18). The compound PD98059 is known to inhibit the ERK1/ERK2 MAPK pathway by inhibiting MEK1/MEK2 activity (25, 26). For example, 10 µM to 20 µM PD98059 completely inhibits the mitogenic actions of PDGF in fibroblasts (25, 26). To test whether ERK1/ERK2 MAPK pathways participate in FGF2 transcriptional regulation in osteoblasts, we examined the effect of PD98059 treatment on basal and FGF2-induced MMP1 promoter activity in MC3T3-E1 osteoblasts. As shown in Fig. 7Go, 25 µM PD98059 does not inhibit either basal or FGF2-induced MMP1 promoter activity. This concentration of PD98059 is sufficient to inhibit by >85% the FGF2-induced activation of ERK phosphorylation in MC3T3-E1 cells (Fig. 8Go). At concentrations exceeding 25 µM, PD98059 begins to inhibit the basal activity of multiple promoters (i.e. SV40LUC, RSVLUC, and MMPLUC); however, FGF2 still stimulates 120 MMPLUC activity 7-fold in the presence of 75 µM PD98059 (data not shown). Thus, FGF2 up-regulation of the MMP1 promoter in MC3T3-E1 calvarial osteoblasts proceeds via pathways independent of ERK1/ERK2 MAPK activity.

FGF2 Induction of the MMP1 Promoter Can Be Mediated via FGFR1 or Constitutively Active FGFR2-ROS
Pharmacological studies suggested that a signal cascade other than the ERK1/ERK2 MAPK, PKC, or PI3K pathways mediate FGF2 induction of the MMP1 promoter. We wished to begin systematic characterization of the signaling pathways conferring transcriptional activation of MMP1 in response to FGFR activity. MC3T3-E1 cells express mRNA for FGF receptors 1 and 2 (Ref. 40 and D. Towler, unpublished) and contain immunoreactive FGFR1 protein (E. Newberry and D. Towler, unpublished). To verify that FGFR1 can mediate induction of the MMP promoter, A7r5 myoblasts were cotransfected with the MMPLUC reporter construct and either pcDNA3 control plasmid or pcDNA3-FGFR1 expression plasmid (29). Results obtained with the FGF-responsive OCFRE reporter construct (29) were also monitored as an independent positive control. Expression of FGFR1 in A7r5 myoblasts permits 2.5- to 3-fold stimulation of MMP1 promoter activity in response to 3 nM FGF2; little if any induction is observed in the absence of FGFR1 coexpression (Fig. 9Go). FGF2 induction of the MMP1 promoter in muscle cell backgrounds (A7r5 and L6 myoblasts) is not as great as that observed in osteoblasts (Fig. 9Go and our unpublished observations). Intact FGFR1 tyrosine kinase activity is required for signaling in A7r5 cells, since coexpression of the kinase-deficient FGFR1 variant pcDNA3-FGFR1' (32) cannot convey inductive signals to either reporter construct (Fig. 9Go). Conversely, a form of FGFR2 that possesses constitutive tyrosine kinase activity, FGFR2-ROS (33), can up-regulate MMP1 promoter activity in the absence of exogenous ligand in MC3T3-E1 cells (see Fig. 10Go below). Thus, ligand-activated FGFR1 and constitutively active FGFR2-ROS can convey transcriptional activation signals to the MMP1 promoter, dependent upon the FGFR tyrosine kinase activity.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 9. FGF2 Induction of MMP1 Promoter Activity Can be Mediated via FGFR1

A7r5 vascular smooth muscle cells were transfected with 120MMPLUC (reporter), CMV ß-galactosidase (control for transfection efficiency), and either empty expression vector, FGFR1 expression vector, or FGFR1' expression vector (lacks tyrosine kinase activity) as described in the text. Two days after transfection, cells were treated either with vehicle (control) or with FGF2 (3 nM) plus heparin (3 µg/ml). Twenty hours after treatment, cell extracts were prepared and analyzed for luciferase and ß-galactosidase activities as described in the legend to Fig. 1Go and in the text. Note that in cells transfected with empty vector or kinase-deficient FGFR1', FGF2 does not up-regulate MMP1 promoter activity. Note also that in A7r5 cells transfected with the FGFR1 expression vector, FGF2 stimulates 120 MMPLUC activity 2- to 3-fold. Results obtained with the osteocalcin FGF-responsive element (OCFRE x3) 92 OCLUC, previously shown to respond to FGFR1-dependent signals (29 ), are provided for comparison.

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 10. The Constitutively Active FGFR2-ROS Oncoprotein Up-Regulates the MMP1 Promoter in MC3T3-E1 Osteoblasts via a Ras-Dependent Pathway

A constitutively active form of FGFR2, FGFR2-ROS (0.5 µg FGFR2-ROS expression plasmid per 7 x 105 MC3T3-E1 cells), was expressed by transient cotransfection with 120 MMPLUC (0.8 µg), CMV ß-galactosidase (control for transfection efficiency; 0.25 µg), and the dominant negative Rho, Rac, and Ras expression constructs (0.5 µg) as indicated and detailed in Materials and Methods. Total input DNA was kept constant in every transfection with empty expression vector. Data are presented as the mean luciferase reporter activity observed (± SD) of three independent transfections. Note that FGFR2-ROS coexpression activates 120 MMPLUC activity 3-fold, in the absence of added FGF2. Note also that coexpression of dominant negative Ras, but not dominant negative Rho or Rac, completely abrogates induction of the MMP1 promoter by FGFR2-ROS. See text for details.

 
Dominant Negative Ras, but not Dominant Negative Rac or Rho, Inhibits FGFR2-ROS Activation of the MMP1 Promoter
Monomeric GTP-binding proteins such as Ras, Cdc42, Rho, and Rac have overlapping yet distinct roles in the various MAPK-signaling pathways (22, 41). For example, Ras has been demonstrated to participate in signaling via ERK1/ERK2, JNK, and FRK MAPK pathways, while Cdc42, Rho, and Rac convey signals to the JNK and p38 MAPK pathways (22, 41). To examine the potential roles of various G proteins in FGF signaling, we tested the capacity of the dominant negative proteins Rho T19N, Rac T17N, and Ras N17 to inhibit FGFR activation of the MMP1 promoter (41, 42). For these studies, we used transient coexpression of a constitutively active FGF receptor, FGFR2-ROS (33), to stimulate MMP1 promoter activity (coexpression of FGFR2-ROS empirically permits precise titration of FGFR signal intensity as assayed by transcriptional up-regulation; not shown). As shown in Fig. 10Go, expression of FGFR2-ROS up-regulates activity of 120 MMPLUC. Coexpression of the dominant negative forms of Rho or Rac does not inhibit up-regulation, and Rho T19N increases basal MMP1 promoter activity. By contrast, expression of dominant negative Ras N17 completely abrogates FGFR2-ROS activation of the MMP1 promoter. Thus, FGFR activity up-regulates MMP1 promoter activity via a Ras-dependent pathway.

Expression of the MAPK Kinase Phosphatase MKP2 Abrogates FGFR2-ROS Activation of the MMP1 Promoter
Recently, a Ras-activated atypical PKC isoform, PKC-{zeta}, has been shown to convey integrin-dependent activation of MMP1 expression in fibroblasts (43). Our pharmacological studies demonstrate that PKC and ERK1/ERK2 are not mediating FGFR activation of the MMP1 promoter in osteoblasts. However, we wished to provide direct evidence that MMP1 promoter up-regulation by activated FGFR was indeed proceeding via a MAPK cascade. The activities of MAPKs are down-regulated by a diverse family of mixed function MAPK phosphatases (MKPs) that exhibit overlapping yet somewhat distinct specificities for MAPK substrates (34). For example, while MKP1 inactivates ERK = JNK = p38 MAPKs, MKP2 inactivates ERK = JNK > p38MAPK, and PAC1 inactivates ERK = p38 MAPK > JNK (34). As a functional test of the effects of MAPK inactivation on FGFR signaling in osteoblasts, we coexpressed PAC1 or MKP2 with FGFR2-ROS in MC3T3-E1 cells and examined the effects of phosphatase expression on the MMP1 promoter. As shown in Fig. 11Go, expression of PAC1 and MKP2 have little, if any, effect on basal MMP1 promoter activity. By contrast, expression of PAC1 partially decreases but does not completely inhibit MMP1 promoter activation by FGFR2-ROS, and expression of MKP2 completely abrogates MMP1 promoter induction. Thus, although independent of ERK1/ERK2 activity, transcriptional activation of MMP1 by activated FGFR does proceed via a MAPK cascade in MC3T3-E1 osteoblasts, as demonstrated by the sensitivity to expression of MAPK phosphatases.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 11. Expression of MAPK Kinase Phosphatase MKP2 Abrogates FGFR2-ROS Activation of the MMP1 Promoter

A constitutively active form of FGFR2, FGFR2-ROS (0.5 µg expression plasmid per 7 x 105 MC3T3-E1 cells), was expressed by transient cotransfection with 120 MMPLUC (0.8 µg), CMV ß-galactosidase (0.25 µg), and the PAC1 and MPK2 expression constructs (0.5 µg) as indicated and described in Materials and Methods. Total input DNA was kept constant by transfection with empty expression vector. Data are presented as the mean luciferase activity observed (± SD) in three independent transfections. Note that expression of phosphatases does not significantly affect basal MMP1 promoter activity. Finally, note whereas coexpression of PAC1 partially decreases 120 MMPLUC activation, coexpression of MKP2 completely abrogates induction of the MMP1 promoter by FGFR2-ROS. See text for details.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
FGF receptor-ligand signaling plays an important role in matrix biology. Both mesodermal and neural crest-derived skeletal tissues are patterned in response to developmental cues provided by FGF receptor signaling (13, 14, 15, 16). Moreover, FGF receptor signaling contributes to neovascularization and matrix turnover observed during osteotropic tumor metastasis and pathological fracture (5, 18). Although the mechanisms whereby FGFs activate matrix turnover have yet to be fully elucidated, regulation of metalloproteinase gene expression is likely to be central to both physiological and pathophysiological bone remodeling and skeletal morphogenesis (1, 2, 3, 4, 5, 18). In this work, we define a functional FGF response element in the human interstitial collagenase promoter. This FGF response maps to a previously described bipartite element denoted by the acronymn TORU, a TPA and oncogene-regulated unit activated by v-src, Ha-ras, and TPA (7). This element is functionally promiscuous, activated by multiple extracellular signals (1, 6, 7, 43). However, as outlined below, characterization of MMP1 regulation by FGF2 provides additional insight into the nature of the signal cascades activated by FGFRs in osteoblasts.

Both FGF2 and PTH activate bone matrix turnover, and both up-regulate expression of interstitial collagenase genes (2, 5, 12, 37). Ets and AP1 motifs are present in roughly equivalent positions in the proximal human, rabbit, mouse, and rat interstitial collagenase promoters (37, 44). We’ve recently established that the mouse interstitial collagenase promoter and mRNA accumulation are both up-regulated by FGF2 in MC3T3-E1 osteoblasts (D. Towler and T. Latifi, unpublished). Whether the rodent interstitial collagenase genes represent homologs of the MMP1 human interstitial collagenase as initially suggested (44) or homologs of the related interstitial collagenase human MMP13 remains to be unambiguously determined. Nevertheless, it is intriguing that the signal cascades activated by FGF2 and by PTH both converge on the AP1 cognate TGAGTCA present in all interstitial collagenase promoters, yet utilize distinct combinations of protein-DNA interactions to mediate induction. Rajakumar and Quinn (37) demonstrated that PTH activates the rat interstitial collagenase promoter in osteoblasts via an unconventional interaction of CREB with the AP1 cognate. Unlike FGF2 activation of the human interstitial collagenase promoter, activation of the rat interstitial collagenase promoter by PTH does not require the nearby Ets cognate (37). Furthermore, our supershift analyses reveal very little, if any, CREB or ATF1 DNA-binding activity in the FGF-regulated AP1 complex recognizing the human interstitial collagenase promoter AP1 cognate. This was very important to exclude directly because in one report FGF activates CREB and ATF1-dependent transcription via a p38 MAPK-dependent pathway (27). Finally, agonists and antagonists of PKA signaling do not influence FGF induction of the MMP1 promoter in MC3T3-E1 cells. FGF2 induction of the human interstitial collagenase promoter requires both Ets and AP1 cognates, and the factor binding to the AP1 cognate contains Fos/Jun family members, as previously described for induction by PKC (6, 45). As strong support for the notion that AP1 participates in FGF2-regulated interstitial collagenase expression, transgenic mice concomitantly over-expressing c-Fos and c-Jun exhibit accelerated but disordered bone turnover and increased expression of interstitial collagenase (45). However, PKC activity does not seem to be necessary for this particular FGF2 signal in MC3T3-E1 osteoblasts because the broad specificity PKC inhibitors H-7 and staurosporine do not inhibit human MMP1 promoter induction by FGF2.

We demonstrate that dominant negative Ras N17 inhibits FGFR2-ROS activation of the MMP1 promoter, whereas dominant negative Rho and Rac do not inhibit. Furthermore, we show that in the presence of 25 µM PD98059 (MEK inhibitor; Refs. 25, 26), FGF-activated ERK phosphorylation is decreased by >85%, whereas FGF activation of the MMP1 promoter is unaffected. The data demonstrate that FGF activation of the MMP1 promoter in MC3T3-E1 cells is independent of ERK1/ERK2 activity, indicating that a pathway other than the ERK1/ERK2 MAPK mediates activation. The sensitivity of this signal to MKP2 > PAC1 suggests that JNK or a JNK-like MAPK (22, 23) mediates MMP promoter up-regulation in response to FGFR activation, consistent with the presence of c-Jun in the FGF2-regulated AP1 complex. However, osmotic stress does not activate the MMP1 promoter, and MMP1 promoter activation by FGF or FGFR2-ROS is not inhibited by expression of dominant negative SEK1/MKK4 (E. Newberry and D. Towler, unpublished observations). Rho has been placed upstream of p38 MAPK in cytokine and stress-activated signal transduction cascades (22). Because coexpression of Rho T19N increases basal MMP1 promoter activity, constitutive activation of the Rho-p38 MAPK signaling cascade in osteoblasts may antagonize MMP1 regulation by FGF2; this remains to be tested directly.

Of note, Fos constituents in AP1 complexes are also phosphorylated in response to extracellular signals (23, 46). For example, phosphorylation of c-Fos on Thr-232 by a novel 88-kDa proline-directed kinase known as FRK activates transcription in response to epidermal growth factor or H-Ras expression (23); its sensitivity to MKP inactivation is unknown. Fra1 is a specific constituent identified in the MMP1-AP1-DNA binding complex regulated by FGF2. Like c-Fos, the carboxy terminus of Fra1 possesses multiple Thr-Pro residues, including two extended Pro-Xaa-Thr-Pro motifs characteristic of the proline-directed kinase consensus, and is a substrate for multiple kinases (46). We are now characterizing the role and regulation of Fra1 and c-Fos phosphorylation in FGF-treated osteoblasts. Moreover, as outlined below, it has become apparent that Ras-dependent kinase cascades regulate the activity of both Ets repressors and activators (31). Because activation of the MMP1 promoter requires both the Ets and AP1 sites for FGF responsiveness, the FGFR signal cascade is also likely to regulate the transcriptional activity of factors present at both of these cognates. Ultimately, it will be important to identify which kinase cascades mediate FGF action (16, 18, 28) and whether the same cascade regulates both MMP1 Ets and AP1 DNA-binding factors.

Cooperation between Ets and AP1 factors, first characterized in detail for regulation of the polyoma virus enhancer by Ets1, Ets2, and c-Fos/c-Jun in cotransfection studies (47, 48, 49), is well described. Most Ets domain factors are inactive or very poorly active as transcriptional activators in the absence of cooperative, permissive partners (reviewed in Ref. 36). The endogenous Ets factors conveying transcriptional responses to defined stimuli in vertebrate systems have been characterized in detail for only a few vertebrate promoters (23, 49, 50). In Drosophila, an FGF homolog (Branchless) signals via an FGFR homolog (Breathless) to control branching morphogenesis of the fruit fly respiratory system (51). Genetic analysis of this developmental process has identified a specific Ets domain protein, Pointed, as being downstream in the Branchless/Breathless-dependent signal cascade that controls branching morphogenesis (Ref. 51 and references therein). It is intriguing that our functional analysis of the human MMP1 promoter identifies DNA-protein interactions at a conserved Ets cognate as being important for FGF-dependent transcription control in osteoblasts. The vertebrate Ets family is extremely large; >20 vertebrate family members are currently known (31, 36, 52), several of which have been shown to mediate transcriptional responses to growth factor signals (vide infra). Ets1, Ets2, and Erg are expressed in the developing vertebrate skeleton, the latter two members primarily presaging endochondral bone (53, 54). Transgenic overexpression of Ets2 has recently implicated this family member in the regulation of endochondral bone formation (55); whether this skeletal phenotype is related to increased Ets2 activity or to a dominant-negative effect of Ets overexpression (36) is currently unknown. In transient cotransfection assays, Ets1, Ets2, PEA3/E1AF, and ERM Ets family members all demonstrate the capacity to activate interstitial collagenase expression (36, 47, 48). However, specific endogenous Ets family member have yet to be unambiguously identified as regulating osteoblast gene expression or mediating signals in response to FGF stimulation. RT-PCR analysis of polyA+ RNA using degenerate Ets domain amplimers reveals that at least five different Ets domain activators and one putative Ets domain repressor are expressed in MC3T3-E1 cells (D. Towler, unpublished). Our immunological probing of the MC3T3-E1 cellular proteins recognizing the human MMP1 promoter Ets cognate suggests that the prototypic activators Ets1, Ets2, Fli1, Erg, and PU.1 are not major constituents of these specific DNA-protein complexes, even though Ets2 is expressed in MC3T3-E1 cells (D. Towler, unpublished). It will be important to identify which endogenous Ets factors, known or novel, mediate FGF action in osteoblasts and whether Ets family members differ in their capacity to cooperate with the different AP1 heterodimeric transcription complexes that form during osteoblast differentiation (56).

In the Drosophila photoreceptor cell precursors, reciprocal positive and negative regulation have been described to occur at the same Ets cognate via competitive binding of stimulatory (Pointed) and inhibitory (Yan) Ets domain proteins that cooperate with Drosophila Jun to mediate receptor tyrosine kinase signals (57). A similar system may regulate the human interstitial collagenase promoter in osteoblasts. Mutation of the MMP1 Ets cognate in both homologous and heterologous promoter contexts increases basal transcriptional activity and abrogates FGF2 induction, suggesting that both a repressor and an activator recognize this motif. Two widely expressed vertebrate Ets repressors, Elk3 (a.k.a. NET, ERP, SAP2) and ERF have recently been identified (31, 58). The Elk3/SAP2 Ets DNA-binding domain does not bind the AGGATG-type Ets motif (59) found in the MMP1 promoter (6) and thus is not likely to directly participate in MMP1 regulation by FGF2. However, the ERF protein Ets domain is most closely related to Ets1 (which does bind this motif) and in fact inhibits Ets1-dependent transcription (31), introducing the notion that an ERF-like repressor could recognize and regulate the MMP1 promoter. Moreover, proline-directed threonine phosphorylation of ERF in response to activated Ras decreases ERF repressor function (Ref. 31 ; DNA binding not assessed). The identity of this Ras-regulated threonine kinase is currently unknown. Based upon our results providing evidence for both positive and negative regulation of the MMP1 via the Ets cognate and the paradigms being established in Drosophila, it is tempting to speculate that FGF activation of a Ras-dependent MAPK cascade down-regulates the suppressor activity of an ERF-like Ets protein and up-regulates AP1 and an Ets domain transcriptional activator, the latter two acting in concert to support interstitial collagenase promoter activity in osteoblasts. MC3T3-E1 cells do express mRNA for an ERF-like repressor (our unpublished observations); future experiments will test whether ERF-like repressors expressed in MC3T3-E1 cells regulate the MMP1 promoter in an AP1- and FGF-dependent fashion.

Characteristics of the MMP1 promoter FGF response differ in several important ways from the two other FGF-activated elements recently characterized, the osteocalcin FGF response element (29, 30) and the proenkephalin FGF response element (27, 35). The proenkephalin FGF response element is a CRE cognate (TGACGTCA) that is up-regulated by members of the ATF/CREB leucine zipper family via an FGF-regulated p38 MAPK cascade (27, 35). The OCFRE (GCAGTCA) resembles a CRE, yet is not activated by FGF2 via known ATF/CREB, Fos, or Fra family members (30); suppression can be achieved by expression of ATF3 in MC3T3-E1 osteoblasts (30). The FGF-regulated factor recognizing and regulating the OCFRE in osteoblasts is unknown, but contains an ~80-kDa protein as a major constituent (J. Boudreaux and D. Towler, unpublished). In ROS17/2.8 osteosarcoma cells the OCFRE is suppressed by TGFß via regulation of endogenously expressed Fos gene family members (60). We extend and confirm our recent studies (29) demonstrating that unique signaling systems mediate FGF2 activation of the OCFRE and the human MMP1 promoter in MC3T3-E1 osteoblasts: 1) FGF2 induction of the OCFRE is augmented with forskolin or 8-bromo-cAMP treatment (29, 30), whereas MMP1 induction is not increased; 2) FGF2 induction of the OCFRE is inhibited by the phosphoprotein phosphatase inhibitors okadaic acid and vanadate (29); by contrast, these agents potentiate FGF2 induction of the human MMP1 promoter; 3) 50 nM staurosporine markedly potentiates induction of the MMP1 promoter, but has no effect on the OCFRE (29); 4) induction of the MMP1 gene occurs in part via a c-Fos containing AP1 factor complex, whereas FGF2 induction of OCFRE occurs independent of any known Fos family members (30); 5) an Ets DNA cognate is required for FGF2 induction of the MMP1 gene. FGFR1 can elaborate both signals, as indicated by the capacity of FGFR1 to confer induction in receptor-deficient myoblast backgrounds. Moreover, like MMP1 promoter induction, OCFRE induction is also up-regulated by FGFR2-ROS and inhibited by dominant negative Ras or MKP2, but is insensitive to PAC1 expression (D. Towler, unpublished observations). This suggests that the FGF receptor signaling pathways that activate these two distinct response elements diverge downstream of Ras. It may be possible to identify selective, pharmacologically useful modulators of these pathways to regulate bone matrix turnover and formation, as a novel approach to the treatment of metabolic and metastatic bone disease.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture and Reagents
Tissue culture reagents were obtained from GIBCO/BRL Life Technologies (Grand Island, NY) and JRH Biochemicals (Lenexa, KS). Corning plastic tissue culture dishes were obtained via Fisher Scientific (St. Louis, MO). MC3T3-E1 murine calvarial osteoblasts were cultured as previously detailed (30, 61) at 37 C and 5% CO2 in {alpha}-MEM with 10% FCS, 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml of streptomycin. A7r5 rat vascular smooth muscle cells obtained from the American Type Culture Collection (Rockville, MD) were grown in DMEM (high glucose) with 10% FCS, 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml of streptomycin. Biochemicals were obtained from Fisher Scientific (St. Louis, MO) or Sigma (St. Louis, MO). Molecular biology reagents were obtained from Promega (Madison, WI) and Perkin-Elmer (Foster City, CA). All custom synthetic oligodeoxynucleotides were obtained from GIBCO/BRL Life Technologies. Radionuclides were obtained from Amersham (Arlington Heights, IL). Protein kinase inhibitors and activators were obtained from BioMol (Plymouth Meeting, PA). FGF2 was purchased from Collaborative Biomedical Products (Bedford, MA). Protein was determined using the Pierce BCA protein assay kit (Pierce Chemical, Rockford, IL) after precipitation and resolubilization as previously described (29).

DNA Plasmid Constructs
The human collagenase gene promoter (MMP1; Genbank Accession No. M16567; Ref. 6) was the kind gift of Dr. R. Pierce and Dr. H. Welgus (Washington University School of Medicine, St. Louis, MO). Using this DNA as a template, PCR was used to generate the MMP1 fragment -179 to +63 flanked by 5'-KpnI and 3'-Mlu restriction sites, as previously described (30). This fragment was ligated into the KpnI/MluI sites of the promoterless plasmid pGL2-Basic (Promega), immediately upstream of the luciferase reporter gene. This same strategy was also used to generate a series of 5'-deletion constructs (-120 to +63; -100 to +63, -75 to +63, -50 to +63). For heterologous promoter experiments, PCR was used to generate the MMP1 promoter fragments -120 to -61 or -100 to -61 flanked by 5'-KpnI and 3'-Mlu restriction sites. Fragments were ligated into the KpnI/MluI sites upstream of RSVLUC (contains minimal RSV promoter -51 to +35 in pGL2-basic; Ref. 30). Site-directed mutagenesis of Ets and AP1 motifs was achieved by PCR using mutagenic amplimers as indicated. All constructs were sequenced (ABI Prism Dye Terminator Cycle Sequencing Kit; Perkin Elmer, Foster City, CA) to verify the insert sequence. Construction of the pcDNA3-murine FGFR1 eukaryotic expression vector has been previously described (29). Expression vectors for FGFR1 (29), FGFR1' (32), FGFR2-ROS and FGFR2 (33), dominant negative Rho T19N and Rac T17N (41), and dominant negative RasN17 (42) have been previously described.

Transient Transfection Assays and Pharmacological Inhibition of Signaling
All plasmids were prepared by column chromatography (Qiagen, Chatsworth, CA) for sequencing and transfections. MC3T3-E1 cells were transfected either by diethylamino-ethyl-dextran/dimethylsulfoxide shock technique or by calcium phosphate (30, 61). For calcium phosphate transfections, MC3T3-E1 cells, A7r5 vascular smooth muscle cells, or passage 3 primary rat calvarial cells were plated into Costar six-well cluster dishes (35-mm diameter wells, 7 x 105 cells per well) and then were transfected the next day with 1.5–2.5 µg/well of calcium phosphate-precipitated DNA punctuated after 6–18 h by a 60-sec glycerin shock (15% glycerol in HEPES-buffered saline, pH 7.05) and recovery into growth medium. CMV-ß-galactosidase expression plasmid (0.1 µg/well) was used to monitor transfection efficiency. Two days after transfection, cells were treated either with vehicle (BSA in PBS) or vehicle containing FGF2 (final concentration, 3 nM) for 20 h in media containing 3% FCS. For the A7r5 muscle cell line, heparin (final concentration 3 µg/ml) was added with FGF2. Cell extracts were subsequently prepared for assay of luciferase activity (Promega Technical Bulletin 101) and ß-galactosidase activity (Promega Technical Bulletin 097). Data are presented as the mean (± SD) luciferase activity for a minimum of three independent transfections. For studies of pharmacological inhibitors and promoter activation, MC3T3-E1 cells were transfected using the diethylaminoethyl-dextran protocol. After 2 days, transfected cells were refed with complete culture medium containing either vehicles or pharmacological treatments. Dimethylsulfoxide was the vehicle for all inhibitors, diluted 1:1000 from stocks. Note that cultures were preincubated with either vehicles or inhibitors (2-fold concentrated) for 0.5 h in complete media (0.5 ml/well) before the addition of 0.5 ml of complete media containing either BSA vehicle or 6 nM FGF2. The final concentrations of inhibitors chosen decrease signaling by >=50% in MC3T3-E1 cell cultures (62, 63, 64) or in 3T3-L1 cell cultures (Ref. 65 ; for KN-62). After treatment for an additional 18 h, cell lysates were analyzed for luciferase activity as detailed above and previously (29).

Electrophoretic Mobility Gel Shift Assays
MC3T3-E1 cells were plated at a density of 150,000 cells per cm2 in 35-mm plastic tissue culture dishes and treated the next day with 3 nM FGF for the times indicated in 3% FCS. Cell extracts were then prepared and DNA-protein interactions were assessed by gel shift assay as detailed previously (29, 61). Approximately 15 µg of protein extract were used for each gel shift. Synthetic oligodeoxynucleotide pairs used for gel shift analysis were: CCTCAAGAGGATGTTATA and GGTATAACATCCTCTTGA (duplex encodes human MMP1 promoter fragment -93 to -78; Ets domain binding cognate underlined at -88 to -83); CCAAAGCATGAGTCAGAC and GGGTCTGACTCATGCTTT (duplex encodes human MMP1 promoter fragment -79 to -63; AP1 binding cognate underlined at -72 to -66); GGTTGCCTGACGTCAGAGA and CCTCTCTGACGTCAGGCCAA (duplex encodes the cAMP response element or CRE; CREB and ATF1 binding cognate underlined). The OCFRE oligonucleotide has been previously described (36). Oligonucleotide pairs were annealed, end-labeled with [{alpha}-32P]dCTP and the Klenow fragment of DNA polymerase I, blunt-ended with nonradioactive dCTP and dGTP, and then separated from unincorporated label by gel filtration (NucTrap Push Columns, Stratagene, La Jolla, CA). In a standard 20-µl DNA-binding reaction (30), 0.1 pmol (30,000 cpm) of radiolabeled duplex oligonucleotide was routinely used for gel shift analysis. For supershift assays, extracts were preincubated with 1.5 µl of rabbit polyclonal antibodies to Fos family members, Jun family members, ATF1/CREB family members, and the indicated Ets family members for 16 h at 4 C before DNA-binding analysis, as previously described (30). All antibodies for transcription factor supershift analysis were obtained from Santa Cruz Biotechnology (San Diego, CA). The anti-Fos family antibodies used were sc-253X ({alpha}-Fos), sc-052X ({alpha}-cFos), sc-183X ({alpha}-Fra1), sc-171X ({alpha}-Fra2), and sc-048X ({alpha}-FosB). The anti-Jun family antibodies used were sc-045x (c-Jun), sc-046x (Jun D), sc-074x (Jun B), and sc-044x ({alpha}-Jun). The {alpha}-ATF1 antibody used was sc-270X (recognizes ATF1, CREB, and cAMP response element modulator). The Ets antibodies tested were sc-112X ({alpha}-Ets1/Ets2; recognizes Ets1, Ets2, Fli1, Erg1, and Erg2) and sc-352X ({alpha}-PU.1; a.k.a. Spi-1).

Western Blot Analyses of ERK Phosphorylation
MC3T3-E1 cells were plated in 35-mm diameter cluster well dishes (7 x 105 cells per well). The following day, cell cultures were pretreated either with dimethylsulfoxide vehicle or 2x concentrated PD98059 for 30 min. Subsequently, cultures were treated with either an equal volume of 2x concentrated vehicle or FGF2 for an additional 1 h. The final concentration of PD98059 was 25 µM, and the final concentration of FGF2 was 3 nM. At the end of the treatment period, cells were rinsed with ice-cold PBS, then scraped into 210 µl/well of phosphoprotein extraction buffer (25 mM HEPES, pH 7.9; 300 mM NaCl, 5 mM EDTA, 0.1% Triton X-100; 0.5 mM dithiothreitol; 100 µM sodium vanadate; 50 mM sodium fluoride; 50 mM ß-glycerolphosphate; 0.5 mM phenylmethylsulfonylfluoride; 5 µg/ml soybean trypsin inhibitor; 1 µg/ml leupeptin). After extraction on ice for 10 min, insoluble debris was pelleted by brief centrifugation, and phosphorylation of ERK1/ERK2 (p44/p42 MAPKs) was assessed by Western Blot analysis as follows. Equal amounts (30 µg) of cellular protein extracts were fractionated by denaturing SDS-PAGE, then electrotransferred to polyvinylidene difluoride membrane (Tropix, Bedford, MA) as per the manufacturer’s instructions (Novex Blot Module; Novex, San Diego, CA). Tyr-204-phosphorylated forms of ERK1/ERK2 were specifically immunovisualized using the PhosphoPlus p44/42 MAPK Antibody Kit (phospho-specific MAPK primary antibody; New England Biolabs; Beverly, MA). Total p44/p42 MAPK protein was immunovisualized with pan-ERK monoclonal antibody (1:1000 dilution; Transduction Laboratories, Lexington, KY) as the primary antibody; alkaline phosphatase-conjugated goat anti-mouse antibody (1:5000 dilution) as the secondary antibody. ERK immune complexes were visualized by chemiluminescent detection with the Tropix Western Light System (Tropix, Bedford, MA) and exposure to Fuji medical x-ray film (Fisher Scientific). In MC3T3-E1 cells, p42 MAPK is the predominant ERK. Data are presented as the mean of independent duplicate samples and are representative of results obtained in two independent experiments. Relative signal intensity was determined by densitometry (LKB Ultroscan XL Laser Densitometer, LKB Instruments, Rockville, MD). In-gel kinase assays were performed on aliquots of these same extracts with myelin basic protein as the substrate using methods previously described (34).


    ACKNOWLEDGMENTS
 
We thank Dr. H. Welgus and R. Pierce for the human MMP1 genomic DNA fragment, Dr. D. Ornitz for the FGFR1 cDNA, Dr. C. Turck for the kinase-deficient FGFR1' expression construct, Dr. T. Miki for the FGFR2-ROS expression construct, Dr. G. Bokoch for the dominant negative Rho and Rac expression constructs, Dr. K. Mulder for the dominant negative Ras expression construct, and Dr. K. Kelly for the PAC1 and MKP2 expression constructs. We also thank Dr. D. Creedon for his advise on assays of MAPK activity and Dr. R. Cagan for helpful comments on Drosophila eye development.


    FOOTNOTES
 
Address requests for reprints to: Dr. Dwight A. Towler, M.D., Ph.D., Washington University School of Medicine, Department of Molecular Biology and Pharmacology-Box 8103, 660 South Euclid, St. Louis, Missouri 63110.

This work was supported in part by NIH Grant AR-43731 (to D.A.T) and by the Barnes-Jewish Hospital Research Foundation. D.A.T. is also a 1996 Charles E. Culpeper Foundation Medical Science Scholar. E.P.N. and D.W. were supported by institutional training grants. J.M.B. was supported in part by a mentored research fellowship from the Children’s Brittle Bone Foundation.

Received for publication February 12, 1997. Revision received April 4, 1997. Accepted for publication April 16, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Crawford HC, Matrisian LM 1994 Tumor and stromal expression of matrix metallproteinases and their role in tumor progression. Invasion Metastasis 14:234–245[Medline]
  2. Partridge NC, Winchester SK 1996 Osteoblast Proteinases. In: Bilizikian JP, Raisz LG, Rodan GA (eds) Principles of Bone Biology. Academic Press, San Diego, pp 207–216
  3. Blavier L, Delaisse JM 1995 Matrix metalloproteinases are obligatory for the migration of preosteoclasts to the developing marrow cavity of primitive long bones. J Cell Sci 108:3649–3659[Abstract]
  4. Holliday LS, Welgus HG, Fliszar CJ, Veith GM, Jeffrey JJ, Gluck SL 1996 Initiation of osteoclast bone resorption by interstitial collagenase. J Bone Miner Res 11[Suppl 1]:S182 (Abstract)
  5. Mundy GR 1996 Role of cytokines, parathyroid hormone, and growth factors in malignancy. In: Bilezikian JP, Raisz LG, Rodan GA (eds) Principles of Bone Biology. Academic Press, San Diego, pp 827–836
  6. Angel P, Baumann I, Stein B, Delius J, Rahmsdorf HJ, Herrlich P 1987 12-O-Tetradecanoyl-phorbol-13-acetate induction of the human collagenase gene is mediated by an inducible enhancer element located in the 5'-flanking region. Mol Cell Biol 7:2256–2266[Abstract/Free Full Text]
  7. Gutman A, Wasylyk B 1990 The collagenase gene promoter contains a TPA and oncogene-responsive unit encompassing the PEA3 and AP-1 binding sites. EMBO J 9:2241–2246[Medline]
  8. Gack S, Vallon R, Schmidt J, Grigoriadis A, Tuckermann J, Schenkel J, Weiher H, Wagner EF, Angel P 1995 Expression of interstitial collagenase during skeletal development of the mouse is restricted to osteoblast-like cells and hypertrophic chondrocytes. Cell Growth Differ 6:759–767[Abstract]
  9. Mitchell PG, Magna HA, Reeves LM, Loprestimorrow LL, Yocum SA, Rosner PJ, Geoghegan KF, Hambor JE 1996 Cloning, expression, and type II collagenolytic activity of matrix metalloproteinase-13 from human osteoarthritic cartilage. J Clin Invest 97:761–768[Medline]
  10. Peters KG, Werner S, Chen G, Williams LT 1992 Two FGF receptor genes are differentially expressed in epithelial and mesenchymal tissues during limb formation and organogenesis in the mouse. Development 114:233–243[Abstract]
  11. Hurley MM, Marcello K, Abreu C, Brinckerhoff CE, Bowik CC, Hibbs MS 1995 Transcriptional regulation of the collagenase gene by basic fibroblast growth factor in osteoblastic MC3T3–E1 cells. Biochem Biophys Res Commun 214:331–339[CrossRef][Medline]
  12. Varghese S, Ramsby ML, Jeffrey JJ, Canalis E 1995 Basic fibroblast growth factor stimulates expression of interstitial collagenase and inhibitors of metalloproteinases in rat bone cells. Endocrinology 136:2156–2162[Abstract]
  13. Muenke M, Schell U, Hehr A, Robin NH, Losken HW, Schinzel A, Pulleyn LJ, Rutland P, Reardon W, Malcolm S, Winter RM 1994 A common mutations in the fibroblast growth factor receptor 1 gene in Pfeiffer syndrome. Nat Genet 8:269–274[CrossRef][Medline]
  14. Reardon W, Winter RM, Rutland P, Pulleyn LJ, Jones BM, Malcolm S 1994 Mutations in the fibroblast growth factor receptor 2 gene cause Crouzon syndrome. Nat Genet 8:98–103[CrossRef][Medline]
  15. Colvin JS, Bohne BA, Harding GW, McEwen DG, Ornitz DM 1996 Skeletal overgrowth and deafness in mice lacking fibroblast growth factor receptor 3. Nat Genet 12:390–397[CrossRef][Medline]
  16. Hurley HM, Florkiewicz RA 1996 Fibroblast growth factor and vascular endothelial cell growth factor families. In: Bilezikian JP, Raisz LG, Rodan GA (eds) Principles of Bone Biology. Academic Press, San Diego, pp 627–645
  17. Tang K-T, Cappareelli C, Stein JL, Stein GS, Lian JB, Huber AC, Braverman LE, DeVito WJ 1996 Acidic fibroblast growth factor inhibits osteoblast differentiation in vitro: altered expression of collagenase, cell growth-related, and mineralization-associated genes. J Cell Biochem 61:152–166[CrossRef][Medline]
  18. Friesel RE, Maciag T 1995 Molecular mechanisms of angiogenesis: fibroblast growth factor signal transduction. FASEB J 9:919–925[Abstract]
  19. Long MW, Robin JA, Ashcraft EA, Mann KG 1995 Regulation of human bone marrow-derived osteoprogenitor cells by osteogenic growth factors. J Clin Invest 95:881–887 <