| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Pathology (K.B.J.M.C., H.A.G.M.vdK., C.C.E.-vE.,
C.F., J.T.) Erasmus University 3000 DR Rotterdam The
Netherlands
Department of Urology (R.A.S., L.W.C.)
Molecular Urology and Therapeutics Program University of
Virginia Charlottesville, Virginia 22908
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In mice, the kallikrein gene family is composed of 24 members, half of which are probably pseudogenes (15). Although structurally related to the PSA gene, none of the mouse kallikreins can be considered as the mouse homolog of human PSA, because of the different tissue distribution (16). All functional mouse kallikrein genes are expressed in the submandibular gland. Individual genes show additional expression in pancreas, kidney, spleen, and/or testis. Mouse kallikrein expression in the prostate has not yet been demonstrated. Two members of the closely related rat kallikrein gene family have been found to be expressed in both prostate and submandibular gland (17). To compare PSA promoter specificity in transgenic mice with the promoter specificity of endogenous mouse kallikreins, we determined which, if any, of the mouse kallikrein genes was expressed in prostate.
| RESULTS |
|---|
|
|
|---|
|
|
To screen for the presence of low levels of transgene expression in the
different prostate lobes and submandibular gland, a known expression
site of mouse kallikreins, we performed RT-PCR with transgene
cDNA-specific primers, and GAPDH as a control (see Materials and
Methods). Again, transgene expression could only be detected in
the lateral prostate (lane 2, Fig. 2D
).
PSA-61-LACH Expression Is Restricted to the Luminal Epithelial
Cells of the Lateral Prostate
Whole mount ß-galactosidase staining, followed by sectioning of
the paraffin-embedded tissue, was performed to investigate the cell
type in the prostate expressing the LacZ gene. As demonstrated in Fig. 3B
, ß-galactosidase staining was restricted to the
luminal epithelial cells. Staining was concentrated at the basal site
of the cytoplasm. No staining was found in the lateral prostate from
age-matched control mice (Fig. 3A
). To further evaluate PSA-61-LACH
expression, sections of the paraffin-embedded lateral prostate of
PSA-61-LACH-positive and control mice were analyzed by in
situ hybridization using sense and antisense digoxygenin
(DIG)-labeled protamine riboprobes. Results obtained with the antisense
protamine probe revealed that transgene mRNA was localized within the
cytoplasm of the luminal epithelial cells of the lateral prostate (Fig. 4
, C and D). No hybridization signal was detected in
control mice or with a sense protamine riboprobe (Fig. 4
, A and B). The
restricted expression of the transgene to the luminal epithelial cells
is consistent with endogenous PSA expression in the human prostate
(18).
|
|
1500 relative
light units (RLU)/µg protein).
|
Mouse Kallikrein Expression
To investigate mouse kallikrein gene expression in the prostate,
RNA was isolated and RT-PCR was performed with primers overlapping
highly conserved regions in exon 3 (KALK-3-s) and exon 4 (KALK-4-as) of
all known mouse kallikrein genes (see GenBank data for mouse kallikrein
sequences). Thirty-four cloned, 146-bp PCR fragments were sequenced.
Thirty-two clones contained a mGK22 fragment (20), the two additional
cDNA fragments were 94% identical, and both contained novel kallikrein
sequences, with highest homology to mGK16 (91 and 92%, respectively)
(21). Previously, mGK22 was found to be expressed in both male and
female salivary glands, but absent in all other tissues tested (22).
RT-PCR with mGK22-specific primers confirmed the presence of mGK22 mRNA
in lateral prostate and submandibular gland. mGK22 was absent in
dorsal, ventral, and anterior prostate (Fig. 6
). The
expression level in submandibular gland was much higher than in lateral
prostate.
|
| DISCUSSION |
|---|
|
|
|---|
In the present study we demonstrate the in vivo prostate specificity of the PSA promoter. We showed that the 6-kb, and not the 632-bp, PSA promoter is able to direct reporter gene activity in transgenic mice. In three independent transgenic lines, carrying a LacZ reporter gene under control of the 6-kb PSA promoter, hormonally and developmentally regulated expression of the transgene was exclusively targeted to the luminal epithelial cells of the lateral prostate, which mimics the expression pattern of the endogenous PSA gene in the human prostate. This strongly suggests that the 6-kb PSA promoter contains most, if not all, information for prostate-specific activity. The specific expression of the transgene in the mouse lateral prostate is in agreement with the structural homology between the human prostate and the mouse lateral prostate, and the mouse kallikrein expression in the lateral prostate. The variable level of PSA expression in human breast cancer (23) and the activity of the 6-kb PSA promoter in transiently transfected T47D human mammary tumor cells (14) could not be confirmed in normal breast tissue of female PSA-61-LACH transgenic mice (data not shown).
Transgene expression was assessed in a liquid ß-galactosidase assay by RT-PCR and by RNA in situ hybridization. Additionally, X-gal staining of the different tissues was performed. X-Gal staining of adult mouse tissues is complicated due to high endogenous ß-galactosidase activity present in many tissues, including testis, epididymis, vas deferens, liver, intestine, and prostate. This problem was overcome by modification of the standard protocols (24, 25). Incubation at elevated temperature before staining (1 h at 50 C), and a raised pH (8.6) during the various incubation steps (see Materials and Methods) suppressed endogenous ß-galactosidase activity, without noticeable loss of activity of the E. coli-derived transgene. Only in epididymis, vas deferens, and anterior prostate could endogenous ß-galactosidase activity be found at a long (>16 h) staining period, which precludes detection of a low level of transgene expression in the X-gal assay (data not shown).
ß-Galactosidase expression was undetectable in the PSA-4-LACH mice,
despite the presence of 100 or more copies of the transgene in all
three transgenic lines. Transient transfection of LNCaP cells with
PSA-4-LACH (Fig. 1
) and also PSA-4-LUC constructs (12, 14) showed low
activity of this 632-bp promoter fragment, especially in the absence of
a cotransfected androgen receptor expression plasmid. The observation
by Schaffner et al. (26), that transgenic mice carrying a
Ha-rasT24 oncogene, driven by the 632-bp proximal PSA
promoter, developed salivary gland and gastrointestinal tract tumors
seems to be in contrast to our findings for this promoter. However,
mutant Ha-ras expression was only confirmed in salivary
gland tumors, and not in gastrointestinal tumors. Furthermore, the late
onset of tumorigenesis could indicate that Ha-ras expression was a
secondary event. This might be related to PSA expression in a subset of
salivary gland tumors in humans (27). An alternative hypothesis is that
Ha-ras intron or exon sequences affect the selectivity and
level of expression of the oncogenic transgene.
The three PSA-61-LACH transgenic lines show a comparable level of lateral prostate-specific, but copy number-independent, ß-galactosidase expression. This could indicate that the PSA-61-LACH transgene cassette lacks elements, such as matrix attachment regions or locus control regions, that might determine boundaries in chromatin structure, leading to copy number-dependent and position-independent activity of transgenes (see Ref. 28 and references therein). The 6-kb PSA promoter fragment contains all DNAseI-hypersenstive sites (which indicate important regulatory regions) in the 31 Kb region upstream of the PSA gene (see Ref. 14). However, it might lack putative, so far unidentified regulatory sequences within the PSA gene, or in the flanking region downstream of the PSA gene, or even downstream of the hGK-1(KLK-2) gene, which is also prostate specifically expressed, and which is at a distance of 12 kb in the human genome (7, 8). Alternative explanations for copy number-independent activity are also possible. Although difficult to compare, the RT-PCR and X-gal staining experiments suggest that the expression level of the transgene in PSA-61-LACH mice is not as high as that of the endogenous PSA gene in the human prostate. Although this might be due to the integration site and the properties of the LacZ and protamine part of the transgene cassette, it is a real possibility that one or more trans-acting factors that direct high level PSA expression in the human prostate are absent, or present in a much lower concentration in the mouse prostate. If this is indeed the case, these factors could limit expression of the transgene, which corresponds to a comparable activity of the 6-kb PSA promoter in the three independent transgenic lines. This might also explain the low expression level of the mouse kallikrein mGK22 in the prostate. On the other hand, the latter might be caused by differences in promoter make up. Further analysis of mGK22 mouse kallikrein promoter activity in human prostate cell lines should provide additional information. In this regard, it is also interesting that the 6-kb PSA promoter-driven transgene expression pattern was different from that of mGK22, which is expressed at a high level in submandibular glands. The PSA-61-LACH transgene follows the expression pattern of the endogenous PSA gene in humans, and not that of mouse kallikreins.
The 6-kb PSA promoter is the first human promoter that directs prostate-specific expression in transgenic mice. Previously, three rat promoters, rKLK8, C3(1), and probasin, have been studied with respect to prostate specificity and applicability in the development of rodent prostate cancer models (29, 30, 31, 32, 33, 34, 35). Transgenic rats carrying a 2.5-kb rKLK8 rat kallikrein promoter fragment did not show tissue specificity. Expression of the transgene was demonstrated in almost all tissues tested, including prostate, but was absent at the major sites of endogenous gene expression, the submandibular and sublingual salivary glands (29). Transgenic mice carrying a 6-kb 5'-flanking region of the rat C3(1) gene linked to the ß-galactosidase reporter gene (30) or a 9.5-kb fragment carrying the C3(1) gene with 4-kb upstream and 2-kb downstream flanking sequences (31) did not direct transgene activity strictly to the prostate. Depending on integration site, expression was also detected in testis, heart, lung, and skeletal muscle. Transgenic mice bearing a 5.7-kb C3(1) promoter linked to the SV40 large T antigen region developed at 7 months a prostate adenoma or adenocarcinoma (32). Female mice carrying this transgene acquired mammary adenocarcinomas. The mice also developed other phenotypic changes including several proliferative lesions and malignancies leading to premature death. Greenberg et al. (33) reported a 426-bp promoter fragment of the rat probasin gene directing chloramphenicol acetyltransferase (CAT) reporter gene expression to the prostate of transgenic mice. These transgenic mice showed CAT expression in dorsal, lateral, and ventral prostate. Low levels of transgene expression were observed in the anterior prostate and in the seminal vesicles. Although prostate specific, the expression level of the transgene was dependent on the integration site and did not strictly follow the expression pattern of the endogenous rat probasin gene, which is selectively expressed in the dorsolateral prostate. Cointegration of chicken lysozyme matrix attachment regions resulted in transgene expression in dorsolateral prostate of adult mice. Cointegration of matrix attachment sites was insufficient to facilitate high-level and copy number-dependent expression. Transgenic mice carrying the 426-bp probasin promoter-driven SV40 large T antigen oncoprotein developed progressive forms of prostatic cancer (34, 35).
Progress toward the understanding of the biology of prostate cancer benefits enormously from the availability of proper animal models displaying the whole range of clinical stages. The present study provides a baseline for the generation of such models, utilizing the 6-kb PSA promoter hooked to the appropriate oncogenes. Because of its tissue specificity and integration site-independent, constant activity it might even be preferred above the probasin and C3(1) promoter-driven prostate cancer models.
The observations presented in this study are not only relevant to the generation of mouse prostate cancer models, but also to gene therapy programs of human prostate cancer. The PSA gene is not only expressed in the luminal epithelial cells of the normal human prostate, but also in almost all prostate cancers. Therefore, the regulatory elements that determine PSA expression in prostate cancer are of potential interest for building a promoter to drive expression of therapeutic genes in prostate cancer cells. The strict prostate specificity of the 6-kb PSA promoter fragment strongly supports the applicability of this large promoter fragment, or derivatives, in gene therapy of human prostate cancer. Preliminary experiments, indicating prostate specificity of the 6-kb promoter-driven TK gene in an adenovirus construct, are in accordance with this view (A. Gotoh, A. S. C. Ko, C. Kao, L-J. Ho, K. B. J. M. Cleutjens, J. Trapman, F. L. Graham, and L. W. K. Chung, unpublished results).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of Plasmids
All plasmid constructs were prepared according to standard
procedures (37). The human androgen receptor expression plasmid pSVARo
and the LacZ-containing reporter plasmid pLACH were described
previously (38, 39). A mouse protamine gene fragment (mP1, +95 to +625,
see Ref. 24) provides the LacZ cassette with an intron and the
3'-untranslated region, including the polyadenylation signal.
PSA-61-LACH was generated by integration of the blunt ended
HindIII/HindIII (-6 kb/+12) fragment of the PSA
promoter into the SmaI site of the pLACH multiple cloning
site. PSA-4-LACH was generated by integration of the
EcoRI/HindIII (-632/+12 bp) PSA promoter
fragment into pLACH.
Transient Transfections
Cells were transfected according to the calcium phosphate
precipitation method, essentially as described (14).
Generation and Identification of Transgenic Mice
The 632-bp and 6-kb PSA promoter-driven LacZ genes were released
from vector sequences by restriction digestion, purified by gel
electrophoresis, and prepared for injection according to standard
methods (40). The appropriate fragments were microinjected into the
male pronuclei of fertilized eggs of C57BL6xDBA2C (F1) mice. The
presence of the transgene was established by PCR amplification on DNA
from tail biopsies (40), using oligonucleotide primers PSA-s:
5'-TTGTCCCCTAGATGAAGTCTCCATGA-3' and LacZ-as:
5'-CGCCAGGGTTTTCCCAGTCACGAC-3' (indicated in Fig. 1
).
Transgene copy numbers were quantitated by phosphoimage analyses of Southern blots of tail DNA. To this purpose, 10 µg DNA were digested with KpnI and SacI, electrophoresed on 0.8% agarose gel, and transferred to Hybond N+ membrane (Amersham, Cardiff, UK). Filters were hybridized at high stringency with a random primed 32P-labeled protamine probe (see RNA in Situ Hybridization). DNA transfer and filter hybridization were carried out according to the protocol of the manufacturer.
Liquid ß-Galactosidase Assay
ß-Galactosidase activity was measured in lysates of LNCaP
cells and mouse tissues using the Galacto-Light Plus chemiluminescent
reporter assay (Tropix Inc., Bedford, MA). Two to 5 mg of mouse tissue
were incubated in 100 µl lysis solution, and transfected LNCaP cells
were collected in 350 µl lysis solution. ß-Galactosidase activity
in 10 µl extract was corrected for variations in protein
concentrations (protein microassay, Bio-Rad, München,
Germany).
Whole Mount ß-Galactosidase Staining
Immediately after death, mouse tissues were fixed by perfusion
fixation in 2% paraformaldehyde in a 0.1 M piperazinebis
(ethane sulfonic acid) buffer (pH 6.9), containing 2 mM
MgCl2 and 1.25 mM EGTA. Tissues were dissected
and fixed for an additional 6090 min at room temperature. To
inactivate endogenous ß-galactosidase activity, tissues were washed
three times for 30 min in PBS (PBS, pH 8.6: 1.5 mM
KH2PO4/6.5 mM
Na2HPO4/2.7 mM KCl/135
mM NaCl). Subsequently, tissues were incubated in PBS for
60 min at 50 C. After cooling to room temperature, tissues were
incubated in prestaining solution (containing 2 mM
MgCl2, 5 mM K3Fe(CN)6,
5 mM K4Fe(CN)6, and 5
mM EGTA in PBS) for 60 min. After transfer to staining
solution (prestaining solution supplemented with 0.5 mg/ml X-Gal),
incubation was continued for 624 h at room temperature. The reaction
was stopped by extensive washing in PBS, and tissues were postfixed in
4% paraformaldehyde in PBS before paraffin embedding. Five-micrometer
sections were counterstained with neutral red.
RT-PCR
Isolation of total cellular RNA was carried out according to the
guanidinium isothiocyanate method (41). RT-PCR amplification of
LACZ-protamine (primers LACZ-s and PRO1/2-as), mouse kallikreins
(primers KALK- 3-s and KALK-4-as), mGK22 (mGK221/2-s and
mGK224/5-as), and GAPDH (GAPDH-s and GAPDH-as) were performed on 1
µg total RNA in the single tube Access RT-PCR* system
(Promega, Madison, WI), according to the protocol of the manufacturer.
Annealing steps were at 58 C, except for the kallikrein cDNAs expressed
in mouse prostate (primers KALK-3-s and KALK-4-as), which was at 50
C.
RT-PCR Primers
LACZ-s: 5'-AGCCATCGCCATCTG-3'
PRO1/2-as: 5'-GACGGCAGCATCTTCGCCTC-3' KALK-3-s:
5'-TGCGGATCCTCAGGCTGGGGCAGCA-3' KALK-4-as:
5'-TGTCAGATCTCCTGCACACAA/GCAT-3' mGK221/2-s:
5'-CTAGGAGGGATTGATGCTGC-3' mKG224/5-as:
5'-CCTCCTGAGTCTCCCTTACA-3' GAPDH-s:
5'-GGTCTACATGTTCCAGTATGACTCC-3' GAPDH-as:
5'-GAGACAACCTGGTCCTCAGTGTAGC-3'
The resulting PCR products were separated over a 2% agarose gel and, in indicated cases, transferred to Hybond N+ membrane. Filters were hybridized at high stringency with random primed 32P-labeled probes specific for the expected cDNA fragment. The PCR product obtained with primers KALK-3-s and KALK-4-as was cloned in PCR-II (Invitrogen, Leek, The Netherlands), and resulting clones were sequenced.
RNA in Situ Hybridization
Sense and antisense DIG-labeled protamine RNA probes were
generated on a 175-bp protamine cDNA fragment, obtained by RT-PCR on
mouse testis RNA with primers PRO-s (5' GAAGATGTCGCAGACGGAGG 3') and
PRO-as (5' GATGTGGCGAGATGCTCTTG 3'). The PCR fragment was first cloned
in pCR-II. After sequencing, the EcoRI-EcoRI cDNA
fragment was recloned in pTZ19 (Pharmacia, Uppsala, Sweden). After
linearization with HindIII, DIG-labeled RNA was transcribed
from the T7 promoter. Hybridization of 5-µm paraffin-embedded
sections and visualization with alkaline phosphatase-coupled anti-DIG
antibodies and indoxil-nitroblue tetrazolium substrate were done
essentially as described (42). Sections were counterstained with
neutral red.
Experimental Animals
In accordance with the NIH Guidelines for Care and Use of
Laboratory Animals, all experiments were conducted using the highest
standard for humane care.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This study was supported by a grant of the Dutch Cancer Society.
Received for publication March 20, 1997. Revision received May 2, 1997. Accepted for publication May 7, 1997.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. K. Ratnacaram, M. Teletin, M. Jiang, X. Meng, P. Chambon, and D. Metzger Temporally controlled ablation of PTEN in adult mouse prostate epithelium generates a model of invasive prostatic adenocarcinoma PNAS, February 19, 2008; 105(7): 2521 - 2526. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T. Tran, D. L. Segev, V. Gupta, H. Kawakubo, G. Yeo, P. K. Donahoe, and S. Maheswaran Mullerian Inhibiting Substance Regulates Androgen-Induced Gene Expression and Growth in Prostate Cancer Cells through a Nuclear Factor-{kappa}B-Dependent Smad-Independent Mechanism Mol. Endocrinol., October 1, 2006; 20(10): 2382 - 2391. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Y. Park, Y.-J. Kim, A. C. Gao, J. L. Mohler, S. A. Onate, A. A. Hidalgo, C. Ip, E.-M. Park, S. Y. Yoon, and Y.-M. Park Hypoxia increases androgen receptor activity in prostate cancer cells. Cancer Res., May 15, 2006; 66(10): 5121 - 5129. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Lyons, E. Lim, A. O. Clermont, J. Dusich, L. Zhu, K. D. Campbell, R. J. Coffee, D. S. Grass, J. Hunter, T. Purchio, et al. Noninvasive Bioluminescence Imaging of Normal and Spontaneously Transformed Prostate Tissue in Mice. Cancer Res., May 1, 2006; 66(9): 4701 - 4707. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Lamb and L. Zhang Challenges in Prostate Cancer Research: Animal Models for Nutritional Studies of Chemoprevention and Disease Progression J. Nutr., December 1, 2005; 135(12): 3009S - 3015S. [Abstract] [Full Text] [PDF] |
||||
![]() |
C-L Hsieh, Z Xie, Z-Y Liu, J E Green, W D Martin, M W Datta, F Yeung, D Pan, and L W K Chung A luciferase transgenic mouse model: visualization of prostate development and its androgen responsiveness in live animals J. Mol. Endocrinol., October 1, 2005; 35(2): 293 - 304. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Cengic, C. H. Baker, M. Schutz, B. Goke, J. C. Morris, and C. Spitzweg A Novel Therapeutic Strategy for Medullary Thyroid Cancer Based on Radioiodine Therapy following Tissue-Specific Sodium Iodide Symporter Gene Expression J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4457 - 4464. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Ma, A. C. Ziel-van der Made, B. Autar, H. A. van der Korput, M. Vermeij, P. van Duijn, K. B. Cleutjens, R. de Krijger, P. Krimpenfort, A. Berns, et al. Targeted Biallelic Inactivation of Pten in the Mouse Prostate Leads to Prostate Cancer Accompanied by Increased Epithelial Cell Proliferation but not by Reduced Apoptosis Cancer Res., July 1, 2005; 65(13): 5730 - 5739. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.E. Clark, T.M. Errington, J.A. Smith, H.F. Frierson Jr., M.J. Weber, and D.A. Lannigan The Serine/Threonine Protein Kinase, p90 Ribosomal S6 Kinase, Is an Important Regulator of Prostate Cancer Cell Proliferation Cancer Res., April 15, 2005; 65(8): 3108 - 3116. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Barnes-Ellerbe, K. E. Knudsen, and A. Puga 2,3,7,8-Tetrachlorodibenzo-p-dioxin Blocks Androgen-Dependent Cell Proliferation of LNCaP Cells through Modulation of pRB Phosphorylation Mol. Pharmacol., September 1, 2004; 66(3): 502 - 511. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Borgono, I. P. Michael, and E. P. Diamandis Human Tissue Kallikreins: Physiologic Roles and Applications in Cancer Mol. Cancer Res., May 1, 2004; 2(5): 257 - 280. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, N. Gao, S. Kasper, K. Reid, C. Nelson, and R. J. Matusik An Androgen-Dependent Upstream Enhancer Is Essential for High Levels of Probasin Gene Expression Endocrinology, January 1, 2004; 145(1): 134 - 148. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kakinuma, E. R. Bergert, C. Spitzweg, J. C. Cheville, M. M. Lieber, and J. C. Morris Probasin Promoter (ARR2PB)-Driven, Prostate-Specific Expression of the Human Sodium Iodide Symporter (h-NIS) for Targeted Radioiodine Therapy of Prostate Cancer Cancer Res., November 15, 2003; 63(22): 7840 - 7844. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wang, F. Yeung, P.-C. Liu, R. M. Attar, J. Geng, L. W. K. Chung, M. Gottardis, and C. Kao Identification of a Novel Transcription Factor, GAGATA-binding Protein, Involved in Androgen-mediated Expression of Prostate-specific Antigen J. Biol. Chem., August 22, 2003; 278(34): 32423 - 32430. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, M. Johnson, K. H. Le, M. Sato, R. Ilagan, M. Iyer, S. S. Gambhir, L. Wu, and M. Carey Interrogating Androgen Receptor Function in Recurrent Prostate Cancer Cancer Res., August 1, 2003; 63(15): 4552 - 4560. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Spitzweg, I. V. Scholz, E. R. Bergert, D. J. Tindall, C. Y. F. Young, B. Goke, and J. C. Morris Retinoic Acid-Induced Stimulation of Sodium Iodide Symporter Expression and Cytotoxicity of Radioiodine in Prostate Cancer Cells Endocrinology, August 1, 2003; 144(8): 3423 - 3432. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Louie, H. Q. Yang, A.-H. Ma, W. Xu, J. X. Zou, H.-J. Kung, and H.-W. Chen Androgen-induced recruitment of RNA polymerase II to a nuclear receptor-p160 coactivator complex PNAS, March 4, 2003; 100(5): 2226 - 2230. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Trofimova, A. Dimtchev, M. Jung, D. Rosenthal, M. Smulson, A. Dritschilo, and V. Soldatenkov Gene Therapy for Prostate Cancer by Targeting Poly(ADP-Ribose) Polymerase Cancer Res., December 1, 2002; 62(23): 6879 - 6883. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Val, A. Martinez, I. Sahut-Barnola, C. Jean, G. Veyssiere, and A.-M. Lefrancois-Martinez A 77-Base Pair LINE-Like Sequence Elicits Androgen-Dependent mvdp/akr1-b7 Expression in Mouse Vas Deferens, But Is Dispensable for Adrenal Expression in Rats Endocrinology, September 1, 2002; 143(9): 3435 - 3448. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. He, L. W. Lee, J. T. Minges, and E. M. Wilson Dependence of Selective Gene Activation on the Androgen Receptor NH2- and COOH-terminal Interaction J. Biol. Chem., July 5, 2002; 277(28): 25631 - 25639. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Chen and C. L. Sawyers NF-{kappa}B Activates Prostate-Specific Antigen Expression and Is Upregulated in Androgen-Independent Prostate Cancer Mol. Cell. Biol., April 15, 2002; 22(8): 2862 - 2870. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Abdulkadir, J. A. Magee, T. J. Peters, Z. Kaleem, C. K. Naughton, P. A. Humphrey, and J. Milbrandt Conditional Loss of Nkx3.1 in Adult Mice Induces Prostatic Intraepithelial Neoplasia Mol. Cell. Biol., March 1, 2002; 22(5): 1495 - 1503. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Cinar, K. S. Koeneman, M. Edlund, G. S. Prins, H. E. Zhau, and L. W. K. Chung Androgen Receptor Mediates the Reduced Tumor Growth, Enhanced Androgen Responsiveness, and Selected Target Gene Transactivation in a Human Prostate Cancer Cell Line Cancer Res., October 1, 2001; 61(19): 7310 - 7317. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Yousef and E. P. Diamandis The New Human Tissue Kallikrein Gene Family: Structure, Function, and Association to Disease Endocr. Rev., April 1, 2001; 22(2): 184 - 204. [Abstract] [Full Text] |
||||
![]() |
C. Spitzweg, M. K. OConnor, E. R. Bergert, D. J. Tindall, C. Y. F. Young, and J. C. Morris Treatment of Prostate Cancer by Radioiodine Therapy after Tissue-specific Expression of the Sodium Iodide Symporter Cancer Res., November 1, 2000; 60(22): 6526 - 6530. [Abstract] [Full Text] |
||||
![]() |
P. Oettgen, E. Finger, Z. Sun, Y. Akbarali, U. Thamrongsak, J. Boltax, F. Grall, A. Dube, A. Weiss, L. Brown, et al. PDEF, a Novel Prostate Epithelium-specific Ets Transcription Factor, Interacts with the Androgen Receptor and Activates Prostate-specific Antigen Gene Expression J. Biol. Chem., January 14, 2000; 275(2): 1216 - 1225. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Huang, Y. Shostak, P. Tarr, C. Sawyers, and M. Carey Cooperative Assembly of Androgen Receptor into a Nucleoprotein Complex That Regulates the Prostate-specific Antigen Enhancer J. Biol. Chem., September 3, 1999; 274(36): 25756 - 25768. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-A. Stephenson, K. Verity, L. K. Ashworth, and J. A. Clements Localization of a New Prostate-specific Antigen-related Serine Protease Gene, KLK4, Is Evidence for an Expanded Human Kallikrein Gene Family Cluster on Chromosome 19q13.3-13.4 J. Biol. Chem., August 13, 1999; 274(33): 23210 - 23214. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Spitzweg, S. Zhang, E. R. Bergert, M. R. Castro, B. McIver, A. E. Heufelder, D. J. Tindall, C. Y. F. Young, and J. C. Morris Prostate-specific Antigen (PSA) Promoter-driven Androgen-inducible Expression of Sodium Iodide Symporter in Prostate Cancer Cell Lines Cancer Res., May 1, 1999; 59(9): 2136 - 2141. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-J. Lareyre, T. Z. Thomas, W.-L. Zheng, S. Kasper, D. E. Ong, M.-C. Orgebin-Crist, and R. J. Matusik A 5-Kilobase Pair Promoter Fragment of the Murine Epididymal Retinoic Acid-binding Protein Gene Drives the Tissue-specific, Cell-specific, and Androgen-regulated Expression of a Foreign Gene in the Epididymis of Transgenic Mice J. Biol. Chem., March 19, 1999; 274(12): 8282 - 8290. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Martinez, A.-M. Lefrançois-Martinez, M. Manin, S. Guyot, C. Jean-Faucher, G. Veyssière, A. Kahn, and C. Jean 5'-Flanking and Intragenic Sequences Confer Androgenic and Developmental Regulation of Mouse Aldose Reductase-Like Gene in Vas Deferens and Adrenal in Transgenic Mice Endocrinology, March 1, 1999; 140(3): 1338 - 1348. [Abstract] [Full Text] |
||||
![]() |
G. W. Verhaegh, A. van Bokhoven, F. Smit, J. A. Schalken, and M. J. G. Bussemakers Isolation and Characterization of the Promoter of the Human Prostate Cancer-specific DD3 Gene J. Biol. Chem., November 22, 2000; 275(48): 37496 - 37503. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |