help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, Y.-f.
Right arrow Articles by Yu-Lee, L.-y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, Y.-f.
Right arrow Articles by Yu-Lee, L.-y.
Molecular Endocrinology 11 (9): 1353-1364
Copyright © 1997 by The Endocrine Society

Multiple Prolactin (PRL) Receptor Cytoplasmic Residues and Stat1 Mediate PRL Signaling to the Interferon Regulatory Factor-1 Promoter

Yu-fen Wang, Kevin D. O’Neal and Li-yuan Yu-Lee

Department of Medicine (Y.-f.W., L.-y.Y.-L.) Department of Microbiology and Immunology (K.D.O., L.-y.Y.-L.) Department of Cell Biology (L.-y.Y.-L.) Baylor College of Medicine Houston, Texas 77030


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Nb2 PRL receptor (PRL-R) is known to mediate PRL signaling to the interferon (IFN) regulatory factor-1 (IRF-1) gene via the family of signal transducers and activators of transcription or Stats. To analyze the components of the PRL-R/Stat/IRF-1 signaling pathway, various PRL-R, Stat, and IRF-1-CAT reporter constructs were transiently cotransfected into COS cells. First, mutations in the IFN{gamma}-activated sequence (GAS), either multimerized or in the context of the 1.7-kb IRF-1 promoter, failed to mediate a PRL response, showing that the IRF-1 GAS is a target of PRL signaling. Next, pairwise alanine substitutions into conserved residues in the proline-rich motif or Box 1 region and two tyrosine mutations, Y308F and Y382F, in the PRL-R intracellular domain all impaired PRL signaling to multimerized GAS or to the 1.7-kb IRF-1 promoter. Furthermore, these PRL-R mutants mediated reduced Stat1 binding to the IRF-1 GAS. Transfection of Stat1 further enhanced PRL signaling to the IRF-1 promoter, suggesting that Stat1 is a positive mediator of PRL action. These studies show that both membrane proximal and distal residues of the PRL-R are involved in signaling to the IRF-1 gene. Further, Stat1 and the GAS element are important for PRL activation of the IRF-1 gene.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PRL is a pituitary peptide hormone and a cytokine that exerts pleiotropic actions on a wide range of cell types and tissues (1, 2, 3). PRL stimulates the growth and differentiation of cells within the mammary gland (4), ovary (5), uterus (6), and prostate (7). PRL also modulates the proliferative potential of T lymphocytes in the immune system (2), exerts antiapoptotic effects on glucocorticoid-induced cell death in lymphocytes (8), and may be involved in adipocyte differentiation in the bone marrow stroma (9). Thus, PRL action depends on the cell type and its stage of differentiation in the target tissue. These pleiotropic actions of PRL are mediated by the PRL receptor (PRL-R), which is a member of the hematopoietin/cytokine receptor superfamily (10, 11). Three PRL-R forms have been identified, the short, Nb2, and long PRL-R, which differ in the length and sequence of the intracellular cytoplasmic domain. This is a result of either alternative splicing of 3'-end exons to generate the short PRL-R (12) or an in-frame truncation relative to the long PRL-R to generate the Nb2 T cell PRL-R (13, 14). Interestingly, both the Nb2 and long PRL-R are capable of mediating lactogenic and mitogenic signals (14, 15, 16), whereas the function of the short PRL-R is less clear (14, 15, 17).

PRL-R signal transduction follows the JAK/Stat signaling pathway that is generally used by all of the hematopoietin/cytokine receptors (18). PRL binding to PRL-R leads to receptor dimerization or oligomerization (19, 20, 21), which activates PRL-R-associated JAK2 protein tyrosine kinases (reviewed in Refs. 2, 19). Activated JAK2 further phosphorylates downstream target proteins, which include the PRL-R intracellular domain (22). Phosphorylated tyrosine residues within the PRL-R intracellular domain are thought to provide docking sites for the recruitment of signaling proteins containing Src homology 2 (SH2) domains (23). These include a family of preexisting cytoplasmic factors collectively called signal transducers and activators of transcription, or Stats (18). Tyrosine-phosphorylated Stats form homo- or heterocomplexes, translocate into the nucleus, bind to cognate DNA elements, and turn on target genes (2, 18). PRL stimulates the activation of Stat1, Stat3, Stat5a, and Stat5b (24, 25, 26, 27), and various Stat combinations are used to activate PRL-inducible target promoters, including those for the differentiation-specific genes ß-casein (25, 28), ß-lactoglobulin (29), whey acidic protein (30), and {alpha}2-macroglobulin (31), and a growth-related gene interferon-regulatory factor-1 (IRF-1) (32, 33). Interestingly, the initial PRL-R/JAK/Stat signaling pathway involves many of the same molecules, but the final biological outcome of PRL-R signaling depends on the presence of various cytoplasmic as well as nuclear factors, the promoter context of the target gene, and the stage of development of the responding cell.

Details of PRL-R signal transduction have been elucidated by mutagenesis of the PRL-R. The cytoplasmic membrane-proximal proline-rich motif (PRM) (34) or Box 1 region of the PRL-R consists of a highly conserved eight-amino acid sequence, aliphatic-aromatic-proline-X-aliphatic-proline-x-proline (Ile-Phe-Pro-Pro-Val-Pro-Gly-Pro), which is critical for receptor signaling as it mediates interaction with the JAK2 kinase (35, 36). PRM/Box 1 mutations prevent phosphorylation of the PRL-R as well as activation of the ß-casein promoter (36). Mutations or deletions of various tyrosine residues in the context of the Nb2 PRL-R showed that a single carboxy-terminal tyrosine residue Y382 is important for activating the ß-casein promoter (22). However, in promyeloid cells, PRL-R Y382 does not appear to be necessary for activating Stat1, Stat3, and Stat5 (24) or for mediating cell proliferation (35). Thus, in addition to the PRM/Box 1 region, which is critical for PRL-R activation, the carboxy terminus of the PRL-R appears to be important for mediating a differentiation signal, whereas a different region is needed for mediating a proliferative signal.

To address PRL-inducible signaling mechanisms, the IRF-1 gene has been analyzed extensively, as it is an immediate early gene that is transcriptionally regulated by PRL stimulation in a PRL-dependent T cell line, Nb2 (37, 38, 39, 40). Furthermore, both IRF-1 promoter-proximal and -distal elements are involved in cooperative interactions in responding to PRL stimulation (32, 40). In particular, the promoter-proximal interferon{gamma}-activated sequence (GAS) element has been shown to be a PRL-inducible enhancer when placed in reverse orientation upstream of the heterologous thymidine kinase (TK) promoter (32). However, a role of GAS in mediating a PRL response in the context of the native 1.7-kb IRF-1 promoter has not been examined. Electrophoretic mobility shift assays (EMSA) have shown that both Stat1 (32, 33, 41, 42) and Stat5 (27, 42, 43) interact with the IRF-1 GAS in a PRL-inducible manner. Surprisingly, overexpression of transfected Stat5a or Stat5b, two closely related but distinct Stat5 genes (25, 26, 27, 44), inhibits PRL induction of the IRF-1 promoter when cotransfected with the PRL-R and 1.7-kb IRF-1-CAT reporter constructs into COS cells (27). The functional significance of exogenous expression of Stat1 at the IRF-1 promoter has not been examined. In this manuscript, the relative importance of PRL-R intracellular domains, Stat1, and IRF-1 GAS element in mediating PRL signaling to the IRF-1 gene was examined by mutational analysis. Our results show that the PRM/Box 1 and two tyrosine residues in the Nb2 PRL-R are involved in PRL signaling to the IRF-1 gene. Further, Stat1 is an important positive mediator of PRL signaling to the GAS element in the IRF-1 promoter.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
IRF-1 GAS is a PRL-Responsive Element
Previous studies have shown that the 1.7-kb IRF-1 promoter is responsive to PRL stimulation (40), and deletion analyses have localized a minimal PRL-responsive region from -136 bp to -112 bp (32). Within this region lies a 11-bp GAS core element, TTTCCCCGAAA, which when placed in reverse orientation in front of a heterologous TK promoter mediated PRL induction (32), demonstrating that GAS alone mediates a PRL response. Mutations were introduced three at a time across the GAS sequence and tested for their ability to inhibit PRL-inducible nuclear factor binding (see Materials and Methods). The results suggest that the 5'-half of the GAS palindrome (TTT) is critical but that the rest of the GAS element is also involved in PRL-inducible protein/DNA interactions (data not shown). Based on the mutagenesis results, mutations were introduced into the entire 11-bp GAS element. Three copies of either wild type GAS (3C WT GAS) or mutant GAS (3C MT GAS) were synthesized and cloned in the sense orientation into the heterologous TK promoter pBLCAT3 reporter (45). These constructs were transiently cotransfected with the Nb2 PRL-R into COS cells and stimulated with PRL for 24 h (Fig. 1AGo). The COS cell system has been successfully used to analyze PRL signaling to both the IRF-1 and milk protein gene promoters (26, 27, 46). 3C WT GAS mediated a 25-fold induction of the chloramphenicol acetyltransferase (CAT) reporter gene in response to PRL stimulation, whereas the mutant GAS construct failed to respond to PRL stimulation.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. IRF-1 GAS Is a PRL-Responsive Element

A, 3C GAS-TK-CAT. Multimerized (three copies) of the WT GAS or MT GAS (see Materials and Methods) were cloned in the sense orientation into the TK-CAT vector (0.3 µg) which was transiently cotransfected into COS cells along with the Nb2 PRL-R construct (1.0 µg). PRL-inducible CAT enzyme activity was measured after 24 h of PRL treatment. Error bar, SEM of three independent experiments. B, 1.7-kb IRF-1-CAT. The single GAS element in the 1.7-kb IRF-1 promoter was mutated by PCR-based mutagenesis (see Materials and Methods). WT and MT 1.7-kb IRF-1-CAT were tested for their ability to respond to PRL stimulation as described in panel A. Error bar, average of two experiments. Inset, one representative set of CAT data showing the 1-, and 3-acetylated [14C]chloramphenicol levels in the corresponding WT and MT 1.7-kb IRF-1-CAT-transfected cells. Open bar, -PRL; closed bar, +PRL.

 
To further define whether the GAS element plays an important role in mediating the PRL response in the context of the 1.7-kb IRF-1 promoter, the same mutations as above were introduced into the GAS core by overlap-extension PCR mutagenesis (47) (see Materials and Methods). The ability of the 1.7-kb IRF-1 promoter vs. the mutant 1.7-kb IRF-1 promoter that contains a mutated GAS core to respond to PRL stimulation was examined (Fig. 1BGo). As previously observed, PRL stimulated a 3-fold induction in 1.7-kb IRF-1-CAT expression, with significant levels of basal CAT expression in unstimulated cells (27). In contrast, the 1.7-kb IRF-1 promoter that contains a mutant GAS was no longer responsive to PRL stimulation, and the basal activity of the mutant promoter was also reduced. These results confirm that GAS element alone is not only a PRL-responsive element but that it is also a critical element for mediating the PRL responsiveness of the native 1.7-kb IRF-1 promoter.

PRM/Box 1 of the PRL-R Is Required for PRL Induction of the IRF-1 Gene
Our data show that both the 3C GAS-TK-CAT and the 1.7-kb IRF-1-CAT mediated a response to PRL stimulation; therefore, both CAT constructs are useful as targets for assessing PRL-R-mediated signaling events. Previously, a membrane-proximal PRM/Box 1 motif, a highly conserved domain in the hematopoietin/cytokine receptors (34), has been shown to be important for signaling from the PRL-R to various milk protein gene promoters (36, 48). However, its importance for signaling to the growth-related IRF-1 promoter has not been examined. Based on the conserved residues, Ile-Phe-Pro-Pro-Val-Pro-Gly-Pro (IFP1PVP2GP3), pair-wise double alanine substitutions were introduced into the eight amino acids (a.a.) PRM/Box 1 by overlap-extension PCR mutagenesis (47). Three PRM/Box 1 mutants, containing alanine replacements of the FV, P1P2, or P2P3 residues in the context of the Nb2 PRL-R, were generated (Fig. 2AGo). COS cells were transiently transfected with the wild type and mutant PRM/Box 1 PRL-R constructs, stimulated with PRL for 24 h, and examined for PRL-R expression. Western blot analysis employing a polyclonal rabbit anti-PRL-R peptide antibody (Ab) was performed to show that all of the mutant PRL-R transfectants expressed the 62-kDa Nb2 PRL-R protein to similar levels as the wild type PRL-R (Fig. 2BGo, lanes 3–8 vs. lanes 1 and 2). No PRL-R was detected in parental COS cells or cells transfected with empty pECE expression vector (data not shown).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Mutations in the PRM/Box 1 Inhibit PRL-R Signaling to the IRF-1 Promoter

A, Diagram of the PRM/Box 1 and tyrosine mutations in the Nb2 PRL-R. Double alanine substitutions were introduced into the highly-conserved FV and P residues as indicated (see Materials and Methods), generating FV, P1P2, and P2P3 Nb2 PRL-R mutants. The three tyrosine residues in the cytoplasmic domain of the Nb2 PRL-R are as indicated. Y309 and Y382 were mutated to phenylalanine, generating a Y309F and a Y382F Nb2 PRL-R mutant. TM, Transmembrane domain; N, amino terminus; C, carboxy terminus of the Nb2 PRL-R. B, Expression of mutant Nb2 PRL-Rs. Membrane fractions of PRL-R cDNA-transfected COS cells were solubilized for Western blot analysis using anti-PRL-R peptide polyclonal antibodies (R123) followed by ECL. A single band corresponding to the 62-kDa Nb2 PRL-R (arrow) was observed in each PRL-R transfectant. C, 1.7 kb IRF-1-CAT. Wt or PRM/Box 1 mutant Nb2 PRL-R constructs were cotransfected with 1.7 kb IRF-1-CAT into COS cells and assayed for PRL inducibility as described in Fig. 1Go. D, 3C GAS-TK-CAT. Same protocol was used as in panel C except that 3C GAS-TK-CAT was used as the read out. Open bar, -PRL; closed bar, +PRL. Error bar, SEM of three independent experiments.

 
Next, the ability of the PRM mutant PRL-Rs to signal to the IRF-1 promoter was examined by cotransfection with either the 1.7-kb IRF-1-CAT or 3C GAS-TK-CAT into COS cells. Wild type PRL-R mediated a 3-fold PRL induction of the 1.7-kb IRF-1 promoter as expected (see also Fig. 1BGo), but all three PRM mutant PRL-Rs failed to mediate PRL stimulation of the 1.7-kb IRF-1 promoter (Fig. 2CGo). Similarly, wild type PRL-R mediated about 10-fold induction of the multimerized IRF-1 GAS element (Fig. 2DGo). Interestingly, the FV and the P1P2 mutations severely reduced, but did not abrogate, mutant PRL-R signaling to the GAS element, whereas the P2P3 mutant PRL-R again failed to activate the GAS. These results show that the PRM/Box 1 is critical for PRL-R-mediated signaling to either the IRF-1 GAS element or the full-length IRF-1 promoter.

PRL-R Y309 and Y382 Are Required for Signaling to the IRF-1 Promoter
In addition to the PRM/Box 1 region, the Nb2 PRL-R contains three tyrosine residues in the intracellular domain. Y237 is only two a.a. inside the transmembrane domain and does not appear to be involved in PRL-R phosphorylation or signaling to the ß-casein promoter (22). Mutational analysis has shown that only the most carboxy Y382 residue is required for PRL-R signaling to the ß-casein promoter in 293 cells. Which tyrosine residues are involved in signaling to the IRF-1 promoter is not known. To address this, two PRL-R tyrosine mutant constructs, Y309F and Y382F (Tyr to Phe mutation) (Fig. 2AGo), were transiently cotransfected into COS cells with either the 1.7-kb IRF-1-CAT (Fig. 3AGo) or 3C GAS-TK-CAT (Fig. 3BGo) constructs. Basal PRL-R activity did not change in the presence of mutant PRL-Rs. However, both Y309F and Y382F PRL-R mutants were reduced in their ability to signal to either promoter in response to PRL stimulation. Both Y309F and Y3882F mutant PRL-Rs mediated only about 30%–40% of wild type PRL-R activity in response to PRL stimulation (Fig. 3Go, A and B). These results show that both Y309 and Y382 in the PRL-R are also important for signaling to the IRF-1 promoter, in contrast to the results observed with the ß-casein promoter (22).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Impaired Signaling of Nb2 PRL-R Tyrosine Mutants to the IRF-1 Promoter

Wt, Y309F, or Y382F Nb2 PRL-R constructs (see diagram in Fig. 2AGo) were cotransfected with 1.7-kb IRF-1-CAT (A) or 3C GAS-TK-CAT (B) into COS cells and assayed for PRL inducibility as described in Fig. 1Go. Open bar, -PRL; closed bar, +PRL. Error bar, SEM of three independent experiments.

 
Mutant PRM/Box 1 and Tyrosine PRL-Rs Fail to Activate Stat1
PRL signaling to either 1.7-kb IRF-1 promoter or multimerized IRF-1 GAS is likely mediated through the activation of endogenous Stat factors in COS cells. To assess which Stat factors may be involved, the wild type PRL-R construct was transiently transfected into COS cells, and at 24 h posttransfection, cells were stimulated with PRL for 30 min. Whole-cell extracts were prepared and analyzed by EMSA using a 32P-labeled 32-bp IRF-1 GAS oligo as probe (Fig. 4AGo). In COS cell extracts, PRL stimulated the formation of one complex (arrow) at the IRF-1 GAS (Fig. 4AGo, lanes 1 and 2). The various slower and faster migrating bands in each lane were nonspecific and were not further analyzed. This PRL-inducible complex contains Stat1, as it can be supershifted (asterisk) by increasing concentrations of anti-Stat1 monoclonal antibodies (mAb) (Fig. 4AGo, lanes 3 and 4) and by a pan-Stat polyclonal Ab (Fig. 4AGo, lanes 5 and 6), which recognizes the conserved amino terminus of Stat factors (49), but not by anti-Stat3 mAb (Fig. 4AGo, lanes 7 and 8). The differences in the anti-Stat1 vs. anti-pan-Stat antibody supershifted bands are likely due to differences in the monoclonal vs. polyclonal Abs used. Further, the PRL-inducible complex was specific as it can be competed by increasing concentrations of cold GAS oligo (Fig. 4AGo, lanes 9–11), but not by an unrelated DR1 oligo representing the chicken ovalbumin upstream promoter (COUP) transcription factor-binding site (Fig. 4AGo, lanes 12–14) (33). The EMSA results clearly show that wild type Nb2 PRL-R activates endogenous Stat1 to bind to the IRF-1 GAS in a PRL-inducible manner in PRL-R-transfected COS cells.



View larger version (80K):
[in this window]
[in a new window]
 
Figure 4. PRL-R Mediates PRL-Inducible Stat1 Binding to the IRF-1 GAS

A, PRL induces Stat1 binding to the IRF-1 GAS. Whole cell extracts from control (lane 1) and PRL-stimulated (lanes 2–14) COS cells, which have been transiently transfected with the Nb2 PRL-R construct, were used in EMSA with an IRF-1 GAS oligo. The PRL-inducible complex (arrow) was supershifted (asterisk) with anti-Stat1 mAb (lanes 3 and 4) and with anti-pan-Stat polyclonal Ab (lanes 5 and 6), but not with anti-Stat3 mAb (lanes 7 and 8) in 1:20 and 1:10 dilutions. The specificity of the PRL-inducible complex was determined by competition with excess cold GAS oligo (lanes 9–11) or an unrelated DR1 oligo (lanes 12–14) in 10x, 20x and 50x molar concentrations. B, PRL-R mediates Stat1 binding to the IRF-1 GAS. Whole cell extracts from control or PRL-stimulated COS cells transfected with either control vector alone (lanes 1 and 2), or constructs containing wild type Nb2 PRL-R (lanes 3 and 4), mutant P2P3 Nb2 PRL-R (lanes 5 and 6), mutant Y309F Nb2 PRL-R (lanes 7 and 8), or mutant Y382F Nb2 PRL-R (lanes 9 and 10) were assayed by EMSA with an IRF-1 GAS oligo. Arrow, PRL inducible Stat1 complex.

 
Because the various mutant PRL-Rs retained some ability to signal to the IRF-1 promoter (Figs. 2Go and 3Go), the ability of these PRL-Rs to activate Stat1 to bind to the IRF-1 GAS was examined. Whole-cell extracts prepared from wild type PRL-R-transfected COS cells showed one PRL-inducible Stat1 complex (arrow) (Fig. 4BGo, lanes 3 and 4) that was not present in empty vector transfected control cells (Fig. 4BGo, lanes 1 and 2). In contrast, the inactive P2P3 PRM/Box 1 PRL-R mutant (Fig. 2Go) was unable to activate Stat1 binding to the IRF-1 promoter (Fig. 4BGo, lanes 5 and 6). On the other hand, both Y309F and Y382F PRL-R mutants, which exhibited a reduced ability to activate the IRF-1 GAS (Fig. 3Go), mediated weak Stat1 binding to the IRF-1 GAS in response to PRL stimulation (Fig. 4BGo, lanes 8 and 10). The faint signals are difficult to discern in this experiment but are reproducible (data not shown). These results show that Stat1 binding to the IRF-1 GAS requires activation through the PRL-R and that the degree of inhibition of Stat1/IRF-1 GAS interaction correlated with the severity of the PRL-R mutations, i.e. PRM/Box 1 > Y382 > Y309. Thus, the membrane-proximal PRM/Box 1 is critical, but both Y309 and Y382 in the PRL-R are also involved in activating Stat1 binding to the IRF-1 GAS.

Stat1 is a Positive Mediator in PRL Signaling to the IRF-1 Promoter
The EMSA results strongly suggest that Stat1 is an important mediator of PRL-R signaling to the IRF-1 promoter in COS cells. To directly assess the role of Stat1, a Stat1{alpha} expression construct was introduced into COS cells and examined for its ability to regulate either the 1.7-kb IRF-1 promoter or 3C GAS element. Wild type Stat1{alpha} was cloned into the pcDNA3 expression vector for high level expression and transiently cotransfected into COS cells along with the Nb2 PRL-R and the 1.7-kb IRF-1-CAT constructs (Fig. 5AGo). Vector-transfected control cells showed about a 2-fold induction of the 1.7-kb IRF-1 promoter. Transfected Stat1{alpha} led to a 6-fold PRL induction of the IRF-1 promoter, suggesting that Stat1{alpha} is limiting in the COS cells and that Stat1{alpha} is a positive mediator of PRL signaling to the IRF-1 promoter. The higher level of PRL induction correlated with a higher level (~2- to 3-fold) of Stat1{alpha} protein expression in the transfected COS cells relative to the endogenous Stat1{alpha} levels in vector-transfected control cells (Fig. 5AGo, inset). Again, an enhancement of PRL induction of the 3C GAS element was also observed in the presence of exogenous Stat1{alpha} (Fig. 5BGo). These results support a role of Stat1{alpha} as a positive mediator of PRL signaling to the IRF-1 promoter in COS cells.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 5. Stat1 Mediates PRL Signaling to the IRF-1 Promoter

A pcDNA3-Stat1 construct or pcDNA3 vector alone (1 µg) was cotransfected with the Nb2 PRL-R construct and 1.7 IRF-1-CAT (A) or 3C GAS-TK-CAT (B) into COS cells and assayed for PRL inducibility as described in Fig. 1Go. Inset, Western blot analysis of Stat1 protein levels in vector or Stat1-transfected COS cells. Open bar, -PRL; closed bar, +PRL. Error bar, SEM of three independent experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Signaling along the PRL-R/JAK/Stat1 pathway to the GAS element in the IRF-1 gene was examined in a reconstituted COS cell system. Our studies showed that the PRM/Box 1 region and both tyrosines, Y309 and Y382, in the Nb2 PRL-R cytoplasmic domain are critical for signaling to the IRF-1 promoter. Mutational analysis further demonstrated that the IRF-1 GAS is a target of PRL signaling and that Stat1{alpha} is a positive mediator of PRL signaling to the IRF-1 gene.

Our original observation showed that PRL stimulates IRF-1 gene transcription in a biphasic manner, activating G1 as well as S phase transcription of the IRF-1 gene in Nb2 T cells (32). G1 activation of the IRF-1 gene can be mediated by a minimal promoter that contains the GAS element, but sequences upstream of GAS are also important for mediating G1/S transcription of the IRF-1 gene in response to PRL stimulation (40). Mutational analysis further confirms the critical role of the GAS as a PRL-responsive element, not only in the context of the heterologous TK promoter (Fig. 1AGo), but also in the context of the native 1.7-kb IRF-1 promoter (Fig. 1BGo). It is interesting that mutations in the GAS element not only abolished PRL-inducible activation of the IRF-1 promoter, but also significantly diminished the basal activity of the 1.7-kb IRF-1 promoter. This suggests that in addition to PRL-inducible Stat-like factors, some of the factors interacting directly or indirectly at the GAS and surrounding sequences may be involved in basal transcriptional activity of the IRF-1 gene. These results support our previous observation that the GAS is required for a PRL-inducible effect, but that interactions of factors binding to the GAS with those interacting in promoter-distal regions are required for full IRF-1 promoter activation by PRL and for cell cycle-regulated expression of the IRF-1 gene (32, 39). In this context, sequences in the entire GAS core, TTTC CCC GAAA, appear to be involved in binding PRL-inducible nuclear factors in Nb2 T cells (data not shown). This binding pattern is different from GAS interactions with interferon-{gamma} (IFN{gamma})-inducible Stat1, which contacts mainly the TTC and the middle A residues in the outer portion of the palindrome (50, 51). The broader binding pattern is consistent with the presence of other factors in the GAS complex in response to PRL stimulation in Nb2 T cells.

Using multimerized GAS elements or the 1.7-kb IRF-1 promoter as a read-out, the residues within the cytoplasmic domain of the PRL-R were examined for their role in signal transduction. The PRM/Box 1 region is critical for PRL-R signaling, as pairwise mutations in this region severely reduced PRL-R signaling in both transfected COS cells (Fig. 2Go) and FDC-P1 premyeloid cells (52). It is now recognized that the PRM/Box 1 region mediates interaction of the PRL-R with the JAK2 kinase (19) and perhaps other molecules (53). Such functional interaction has also been observed for the GH receptor (GH-R) PRM/Box 1 region and JAK2 (19, 54).

The Nb2 PRL-R contains a 198-a.a. in-frame truncation relative to the long PRL-R and is missing an additional six tyrosine residues that are present in the long PRL-R (13). Consequently, only three tyrosines, Y237, Y309, and Y382, are present in the Nb2 PRL-R cytoplasmic domain. Y237, which is only two a.a. inside of the transmembrane domain, does not appear to be required for PRL-R functions (22). PRL-R deletions encompassing Y309 affected neither PRL-R tyrosine phosphorylation nor its ability to stimulate the differentiation-specific ß-casein promoter (22, 36). Only the last Y382 appears to mediate PRL-R tyrosine phosphorylation and signaling to the ß-casein promoter (22). In contrast, our studies showed that both Y309 and Y382 are required to fully activate the growth-related IRF-1 promoter or the multimerized GAS-TK promoter (Fig. 3Go). Mutations in either of the two PRL-R Y residues inhibit Stat1 binding to the IRF-1 GAS (Fig. 4Go), suggesting that these Y residues when phosphorylated may serve as docking sites for recruiting Stat1 (55). Recent studies have illustrated that Stat1 SH2 domain can recognize two types of phosphorylated tyrosine residues, one in the IFN{gamma}-R at Y440DKPH (56) and one represented by the gp130 YXPQ motif (57), which is a subset of the Stat3 binding motif YXXQ in gp130 (55). Neither Y309PGQ nor Y382LDP in the Nb2 PRL-R conform to these two Stat1-binding motifs. However, they both contain a P residue in the vicinity of the Y residue, and Y309PGQ could form a potential Stat3 docking site in the PRL-R. It is interesting to note that all three receptor systems, IFN{gamma}-R (56), interleukin-6 through gp130 (57), and PRL-R (Fig. 3Go), can mediate IRF-1 promoter activation through Stat1 recruitment, presumably via the above receptor motifs. Whether Stat1 physically interacts at the two PRL-R Y residues is under investigation.

A mutant Nb2 PRL-R that is deleted at residue G328, leaving intact Y309 at its truncated carboxy terminus, was still capable of inducing the expression of the growth-related gene, ornithine decarboxylase, and mediating mitogenesis in PRL-stimulated promyeloid 32D cells (35). However, the extent of mitogenesis was reduced relative to the full-length Nb2 PRL-R. This suggests that in the presence of intact PRM/Box 1, Y309 in the Nb2 PRL-R is sufficient for Stat activation and some mitogenic signaling (35), in agreement with our analysis that Y309 is important in mediating PRL stimulation of Stat1 (Fig. 4Go) and IRF-1 promoter activation (Fig. 3Go). However, recent studies showed that phosphorylated receptor tyrosine residues may not be needed in certain GH-R-mediated functions (58, 59). This and other observations led to the suggestion that tyrosine residues on the JAK kinase itself may be directly involved in recruiting and activating Stat factors (54, 60, 61). Whether JAK2 can recruit Stats in the PRL-R-signaling pathway is not known. Our studies show that PRM/Box 1 and both Y309 and Y382 residues are involved in signaling to the growth-related IRF-1 promoter. Thus, in contrast to other cytokine receptors that utilize distinct portions of their cytoplasmic domains for signaling for growth vs. differentiation functions (19, 62, 63), the PRL-R Y382 appears to mediate signaling to both a growth-related and a differentiation-specific promoter (22).

PRL activates Stat1, Stat3, Stat5a, and Stat5b tyrosine phosphorylation and DNA-binding activity in various target cells (24, 28, 30, 31, 33, 41, 64). How these Stat factors mediate a specific PRL response depends on the target promoter context and cell type and stage of development. For example, PRL stimulates Stat5a to activate milk protein genes in the mammary cells (26, 28, 30, 46) and Stat5b to activate {alpha}2-macroglobulin gene in ovarian granulosa cells (31). On the other hand, PRL stimulates primarily Stat1 to bind to the IRF-1 GAS (32, 33) (Fig. 4Go), and Stat1 functionally activates the IRF-1 promoter in response to PRL stimulation (Fig. 5Go). Interestingly, a dominant negative Stat1 mutant (Y701F), which has been shown to inhibit IFN{gamma} signaling (65), only partially (20–30%) inhibited endogenous Stat1 activation of the IRF-1 promoter in response to PRL stimulation in transfected COS cells (data not shown). These results suggest that other factors, in addition to Stat1, also play a role in PRL regulation of the IRF-1 promoter.

PRL also stimulates Stat5a and Stat5b to bind to the IRF-1 promoter (33), but surprisingly, this interaction leads to an inhibition by Stat5a as well as Stat5b of PRL induction of the IRF-1 promoter in transfected COS cells (27). Our data further show that inhibition by Stat5b does not require direct DNA binding, but most likely involves squelching (66) by Stat5b of a factor that Stat1 needs to stimulate the IRF-1 promoter (27). The relative kinetics of Stat1 vs. Stat5 induction by PRL and the mechanism underlying the antagonism between Stat1 vs. Stat5 at the IRF-1 promoter are under investigation. Thus, PRL can utilize different Stat factors to activate or repress gene transcription in a promoter-specific manner. Interestingly, PRL can stimulate Stat1, Stat3, and Stat5 tyrosine phosphorylation in various cell types (24, 33), and Stat3 can bind to the IRF-1 GAS in response to interleukin-6 stimulation (67). However, no PRL-inducible Stat3 interaction can be detected at any of the known PRL-inducible promoters (31, 33). Our studies show that Stat1 forms a major complex at the IRF-1 GAS (33) and that Stat1 is a PRL-inducible positive regulator of the IRF-1 promoter (Fig. 5Go).

Recent studies have revealed novel properties of the Stat1 molecule that may further elucidate its functions. Stat1{alpha} (91 kDa) is one of the first Stat factors to be identified in the IFN-signaling pathway, and it can be alternatively spliced to generate a carboxy terminus-truncated, dominant negative Stat1ß (84 kDa) isoform (65). Stat1 activation involves the tyrosine phosphorylation of Y701, which is necessary for Stat1 homodimerization, nuclear translocation, and DNA-binding activities (18, 65). In addition to tyrosine phosphorylation, serine/threonine phosphorylation further enhances Stat1 activation of target promoters (33, 68, 69). Recently, the amino-terminal domain of Stat1 has been suggested to mediate higher-order cooperative interactions of Stat1 dimers (70, 71). Additionally, the first 63 a.a. of Stat1 may also be involved in interaction with a protein tyrosine phosphatase, as its deletion generated a mutant Stat1 protein with enhanced tyrosine phosphorylation and DNA-binding activity (72, 73, 74). Therefore, both amino and carboxy termini of Stat1 may be involved in complex formation with other proteins, which either enhance or diminish Stat1 transactivation potentials. Some of these interacting proteins include Stat2 and non-Stat proteins such as p48 to form the IFN{alpha}-inducible ISGF3 complexes (75, 76) and other transcription factors such as IRF-1 (77, 78) and Sp1 (79). It is also possible that Stat1 activity may be modulated by interaction with steroid hormones as has been shown for Stat5a (80) and by the coactivator p300/CBP, which has been shown to interact with both Stat1 (81, 82) and Stat2 (83). The ability of Stat1 to interact with a myriad of basal as well as inducible transcription factors may explain our previous observation that only certain anti-Stat1 antibodies were effective in supershift assays, as some Stat1 epitopes may be blocked as a result of interaction with nearby proteins (33). The potential interaction of Stat1 with some of these factors highlights the complex regulatory controls involved in PRL- and cell cycle-regulated transcription of the IRF-1 gene.

In summary, our studies show that Stat1 is a positive mediator of PRL signaling to the IRF-1 promoter, and this activation requires the PRM/Box 1, Y309, and Y382 residues in the PRL-R. These mutational analyses, along with studies utilizing Stat1 (84, 85) and IRF-1 (86, 87) knock-out animals, should provide a wide basis from which to address how PRL, through its activation of Stat1 and transcriptional stimulation of IRF-1, plays a role in modulating various immune responses (2, 88).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Ovine PRL (oPRL-20) was obtained from Dr. P. Smith (National Hormone and Pituitary Program/NIDDK, Baltimore, MD). Nb2 PRL-R Y309F and Y382F mutant constructs (22) were obtained from Dr. P. A. Kelly (INSERM, Paris, France). Anti-Stat1 (ISGF3 No. G16920) and anti-Stat3 (No. S21320) mAb were purchased from Transduction Laboratories (Lexington, KY). Anti-pan Stat polyclonal antibodies (Ab), provided by Dr. D. Levy (New York University, New York, NY), and DR1 oligonucleotides (oligos), provided from Dr. S. Tsai (Baylor College of Medicine, Houston, TX), were previously described (33).

Wild Type and Mutant GAS Cloning
Three copies (3C) of wild type and mutant IRF-1 GAS oligo flanked by 5'-XbaI and 3'-BamHI restriction sites (lower case) were synthesized (Genosys, The Woodlands, TX). The mutant GAS sequence was derived from EMSA studies as follows: 30 min PRL-treated Nb2 T cell extracts (33) were incubated with a wild type GAS oligo probe, 5' CTGATTTCCCCGAAATGATG 3' (GAS core underlined), and increasing concentrations of various mutant GAS oligos as competitors (data not shown). The mutant GAS oligos, each containing three mutations across the GAS core sequence, were (mutations underlined): MutGAS1 5'-CTGACGACCCCGAAATGATG-3'; MutGAS2 5'-CTGATTTAGTCGAAATGATG-3'; MutGAS3 5'-CTGAATTCCCTACAATGATG-3'; and MutGAS4 5'-CTGATTTCCCCGAGTCGATG-3'. Wild type 3C GAS sequences are: 5'-GCGtctagaCTGATTTCCCCGAAATGACTGATTTCCCCG-AAATGACTGATTTCCCCGAAATGAggatccGCG-3' (GAS core underlined). Mutant 3C GAS sequences are: 5'-GCGtctagaTGACGATGTTAGCTTGACTGACGATGTTAGCTTGACTGATGACGAT-GTTAGCTggatccGCG 3' (mutations underlined; italicsdenote further changes to avoid generating potential binding sites). Each 72-bp ds oligo was digested with XbaI and BamHI, cloned into pBLCAT2, and tested for its ability to respond to PRL stimulation by transfection.

GAS Mutations in the 1.7-kb IRF-1 Promoter
Site-directed mutations in the GAS element in the context of the full-length 1.7-kb IRF-1 promoter were generated by overlap-extension PCR (47). Oligos containing complementary 12-bp GAS mutations (underlined) were: primer B: 5'-GAGCTAACATCGTCAGGCTGTTGTAGA-3' and primer C: 5'-CGATGTTAGCTCGATGAGGCGAAGTGG-3'.

Outside upstream primer A (-348/-334) and downstream primer D (+21/+40) were derived from IRF-1 gene sequences (37, 40). PCR reaction mixtures contained 1 µg of native 1.7-kb IRF-1 promoter DNA, 1.0 uM primers, 0.2 mM deoxynucleotide triphosphates (Pharmacia, Piscataway, NJ), 1x Pfu reaction buffer, and 2.5 U Pfu DNA polymerase (Clontech, La Jolla, CA) to maximize replication fidelity. Conditions for AB and CD PCR were: 94 C/1 min, 51 C/90 sec, 72 C/2 min with a 5-min extension (72 C) at the end of 20 cycles. The first round of PCR generated 213 bp AB and 172 bp CD PCR products, which were combined with primers A and D for a second round of PCR, using identical conditions except that a 52 C/90 sec annealing step and 25 cycles were used. The final 385-bp AD PCR product contained a mutant GAS within the IRF-1 promoter sequences. The AD fragment was gel purified, phosphorylated by T4 kinase (Promega, Madison, WI), cloned into the EcoRV site in pBluescript SKI(-), and sequenced by the dideoxy sequencing method (United States Biochemical Corp., Cleveland, OH). The AD fragment was digested with SacII and BglII to release the promoter-proximal 250-bp DNA, which was used to replace the corresponding wild type sequences within the 1.7-kb IRF-1 promoter (deleted by a SacII and BamHI digestion) in the pBLCAT3 vector (40). This replacement generated a 1.7-kb IRF-1 promoter CAT construct that contains a mutant GAS in the context of the 1.7-kb IRF-1 promoter.

PRM/Box 1 Mutations in the PRL-R
Overlap-extension PCR (47) was also used to generate two pairwise alanine substitutions (underlined) in the PRM/Box 1 sequence of the Nb2 PRL-R. The mutant PRM/Box 1 primers are (replaced codons underlined) (see also Fig. 2AGo): FV primer B: 5'-AGCTGGTGGAGCGATGCAGGTCATCAT-3'; FV primer C: 5'-TGCATCGCTCCACCAGCTCCTGGGCCAAAA-3'; P1P2 primer B: 5'-AGCAACTGGTGCAAAGATGCAGGTCAT-3'; P1P2 primer C: 5'-ATCTTTGCACCAGTTGCTGG-GCCAAAA-3'; P2P3 primer B: 5'-TGCCCCAGCAACTGGTGGAAAGATGCA-3'; P2P3 primer C: 5'-CCAGTTGCTGGG-GCAAAAATAAAAGGA-3'. Upstream outside primer A: 5'-GCCAGACCATGGATACTGG-3'; downstream outside primerD: 5'-GTGGTCTGCTAGCAAATGTT-3'.

The PCR reaction mixtures contained 1 µg Nb2 PRL-R cDNA (14), 0.5 uM primers, 0.2 mM deoxynucleotide triphosphates, 2.5 U Pfu DNA polymerase, and 1x Pfu reaction buffer. PCR conditions were: 94 C/30 sec, 50 C/1 min, 72 C/90 sec with a 5-min extension (72 C) at the end for 30 cycles. The first round of PCR generated products AB (187, 190, and 196 bp for the FV, P1P2, and P2P3 mutants, respectively), and CD (551, 548 and 539 bp for the FV, P1P2, and P2P3 mutants, respectively). These products were combined in a second round of PCR with primers A and D to synthesize the full-length 720-bp product. The three PRM/Box 1 PCR products were gel purified, digested with NcoI and NheI, replaced into the wild type Nb2 PRL-R cDNA in the pECE vector (14), and confirmed by DNA sequencing.

Stat1 Construct
Stat1{alpha} cDNA (69) was obtained from Drs. Z. Zhong and J. Darnell (Rockefeller University, New York, NY). The 3.5-kb insert was recloned into the pcDNA3 expression vector (pcDNA3-Stat1) (Invitrogen, San Diego, CA) for high level expression in COS cells (27).

Whole Cell Protein Extracts of Transfected COS Cells
COS cells (2 x 106) were seeded in 100-mm plates for transfection as described below. After 24 h, cells were harvested and whole cell extracts were processed on ice. Briefly, three packed cell volumes of extraction buffer (20 mM HEPES, pH 7.9, 20% glycerol, 0.55 M KCl, 0.2 mM EDTA, 1.5 mM MgCl2, and 2 mM dithiothreitol plus protease and phosphatase inhibitors [0.5 mM phenylmethylsulfonyl fluoride, 1 mM sodium orthovanadate, 2 µg/ml leupeptin, and 2 µg/ml aprotinin]) were added to cell pellets that were homogenized for 30 min on ice. Whole cell extracts were harvested after centrifugation at 13,000 rpm for 15 min at 4 C. Supernatant was dialyzed (dialysis buffer: 20 mM HEPES, pH 7.9, 20% glycerol, 0.1 M KCl, 0.2 mM EDTA, 5 mM MgCl2, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 1 mM sodium vanadate) for 2 h. Dialyzed samples were centrifuged again at 13,000 rpm for 15 min. Supernatant was aliquoted and stored at -70 C until use.

EMSA
A 32-bp wild type IRF-1 GAS oligo was kinase-labeled with {gamma}32P-[ATP] (DuPont NEN, Boston, MA) as described previously (33) and used as probe (30–40,000 rpm, 0.1–0.5 ng) to incubate with 4 µg nuclear extracts from Nb2 cells or 8 µg whole cell extracts from transfected COS cells. For competition or antibody supershift assays, cold oligos or antibodies were preincubated with extracts for 20 min at 4 C before incubation with the labeled GAS probe for another 20 min at room temperature as described (33). Samples were loaded onto nondenaturing acrylamide (5%) gels and resolved by electrophoresis using 0.25x Tris-borate-EDTA for 3 h as described (33). Gels were dried and analyzed by auto-radiography.

Cell Culture, Transfection, and CAT Assays
Nb2 T lymphocytes were maintained in Fischer’s medium (GIBCO/BRL, Grand Island, NY) supplemented with 10% newborn serum (JRH BioSciences, Lenexa, KS), and 10% donor horse serum (HS) (JRH BioSciences) as described (33). Cells were made quiescent in Fischer’s medium containing 10% HS for 24 h before PRL stimulation (10 ng/ml), and nuclear extracts were prepared as described (33). COS-1 cells were maintained in DMEM (GIBCO/BRL) containing 10% fetal bovine serum (FBS) (Atlanta Biologicals, Norcross, GA). For transfection, 1.5 x 105 COS cells were seeded per well in DMEM containing 5% HS and allowed to remain overnight. Transfection was performed by applying a mixture of 10 µl lipofectamine (GIBCO/BRL) and 3–5 µg DNA prepared by using a Qiaprep column (Qiagen, Chatsworth, CA) (see figure legends for DNA concentrations). Cells were cultured in DMEM containing 1% HS for 22–24 h in the presence or absence of PRL (100 ng/ml) before harvesting. CMV-ß-gal was used for normalization of transfection efficiency. Cell pellets were frozen and thawed three times in 0.25 M Tris, pH 8.0. After 10 min centrifugation at 14,000 rpm, the soluble fractions were collected for ß-galactosidase and chloramphenicol acetyl transferase (CAT) assays as described (40). After ß-galactosidase normalization, CAT assays were performed for 1–3 h, and samples were separated by chloroform-methanol (127:12) on TLC plates and scanned by the betascope 603 blot analyzer (Betagen, Mountain View, CA). All of the transfection data were analyzed from at least three independent experiments and plotted by StatMost program (DataMost Corporation, Salt Lake City, UT) as percent CAT conversion ± SEM.

Anti-PRL-R Box 2 Polyclonal Antibodies
A synthetic 24 amino acid (a.a.) peptide corresponding to the hydrophilic Box 2 region of the PRL-R (Cys283-Glu-Asp-Leu-Leu-Val-Glu-Phe-Leu-Glu-Val-Asp-Asp-Asn-Glu-Asp-Arg-Leu-Met-Pro-Ser-His-Ser306) (35, 48) was synthesized by an Applied Biosystems 430A Peptide Synthesizer (Baylor College of Medicine, Houston, TX). The peptide was conjugated to keyhole limpet hemocyanin as described (39). Polyclonal anti-PRL-R peptide antibodies (Ab) (R123 Ab) were generated by immunization of rabbits with 50 µg of conjugated peptide each for four times. Ab titers were assessed by enzyme-linked immunosorbent assay. Aliquots of serum were stored at -20 C until use.

Western Blot Analysis
The expression of PRL-R PRM/Box 1 mutants was examined by Western blot analysis as described (33). The pelleted insoluble fractions of PRL-R construct-transfected COS cells were resolved by SDS-PAGE and transferred to immobilon-P membrane. The filter membrane was blocked in 1% nonfat milk for 1 h, incubated with anti-PRL-R Box 2 polyclonal Ab (1:400) for 3 h at room temperature, and further incubated with donkey anti-rabbit IgG conjugated with horseradish peroxidase (1:2000) for 1 h. After extensive washes, the filter membrane was developed by chemiluminescent ECL as described (Amersham, Arlington Heights, IL) (33).


    ACKNOWLEDGMENTS
 
We thank Dr. Jeff Rosen for helpful discussions on the manuscript, Dr. P. A. Kelly for PRL-R mutants, Drs. Z. Zhong and J. Darnell for Stat1{alpha} cDNA, Dr. David Levy for anti-pan Stat antibodies, Dr. S. Tsai for the DR1 oligonucleotides, and Ms. Lulu Lin for technical assistance.


    FOOTNOTES
 
Address requests for reprints to: Dr. Li-yuan Yu-Lee, Department of Medicine, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030.

This work was supported in part by a NIH Training Grant T32-AI07495 (Y.-f. W.), by a National Institutes of Mental Health M.D./Ph.D. Fellowship F30-MH10343 (K.D.O.) and by NIH Grant DK-44625 and American Cancer Society Grant BE-49L (L.-y. Y.-L.).

Received for publication March 21, 1997. Accepted for publication May 22, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Nicoll CS, Bern HA 1972 On the action of prolactin among the vertebrates: is there a common denominator? In: Wolstenholme GEN, Knight J (eds) Lactogenic Hormones. Churchill Livingstone, London, pp 299–324
  2. Yu-Lee L-y. 1997 Molecular actions of prolactin in the immune system. Proc Soc Exp Biol Med 215:1–18[Abstract]
  3. Ben-Jonathan N, Mershon J, Allen D, Steinmetz R 1996 Extrapituitary prolactin: distribution, regulation, functions and clinical aspects. Endocr Rev 17:639–669[CrossRef][Medline]
  4. Groner B, Gouilleux F 1995 Prolactin-mediated gene activation in mammary epithelial cells. Curr Opin Genet Dev 5:587–594[CrossRef][Medline]
  5. Richards JS 1994 Hormonal control of gene expression in the ovary. Endocr Rev 15:725–751[CrossRef][Medline]
  6. Gellersen B, Kempf R, Telgmann R, DiMattia GE 1994 Nonpituitary human prolactin gene transcription is independent of pit-1 and differentially controlled in lymphocytes and endometrial stroma. Mol Endocrinol 8:356–373[Abstract]
  7. Nevalainen MT, Valve EM, Ingleton PM, Harkonen PL 1996 Expression and hormone regulation of prolactin receptors in rat dorsal and lateral prostate. Endocrinology 137:3078–3088[Abstract]
  8. LaVoie HA, Witorsch RJ 1995 Investigation of intracellular signals mediating the anti-apoptotic action of prolactin in Nb2 lymphoma cells. Proc Soc Exp Biol Med 209:257–269[Abstract]
  9. McAveney KM, Gimble JM, Yu-Lee L-y. 1996 Prolactin receptor expression during adipocyte differentiation of bone marrow stroma. Endocrinology 137:5723–5726[Abstract]
  10. Bazan JF 1990 Structural design and molecular evolution of a cytokine receptor superfamily. Proc Natl Acad Sci USA 87:6934–6938[Abstract/Free Full Text]
  11. Cosman D 1993 The hematopoietin receptor superfamily. Cytokine 5:95–106[CrossRef][Medline]
  12. Davis JA, Linzer DIH 1989 Expression of multiple forms of the prolactin receptor in mouse liver. Mol Endocrinol 3:674–680[CrossRef][Medline]
  13. Ali S, Pellegrini I, Kelly PA 1991 A prolactin-dependent immune cell line (Nb2) expresses a mutant form of prolactin receptor. J Biol Chem 266:20110–20117[Abstract/Free Full Text]
  14. O’Neal KD, Yu-Lee L-y. 1994 Differential signal transduction of the short, Nb2, and long PRL receptor: activation of IRF-1 and cell proliferation. J Biol Chem 269:26076–26082[Abstract/Free Full Text]
  15. Lesueur L, Edery M, Ali S, Paly J, Kelly PA, Djiane J 1991 Comparison of long and short forms of the prolactin receptor on prolactin-induced milk protein gene transcription. Proc Natl Acad Sci 88:824–828[Abstract/Free Full Text]
  16. Ali S, Edery M, Pellegrini I, Lesueur L, Paly J, Djiane J, Kelly PA 1992 The Nb2 form of prolactin receptor is able to activate a milk protein gene promoter. Mol Endocrinol 6:1242–1248[Abstract]
  17. Das R, Vonderhaar BK 1995 Transduction of prolactin’s (PRL) growth signal through both long and short forms of the PRL receptor. Mol Endocrinol 9:1750–1759[Abstract]
  18. Schindler C, Darnell Jr JE 1995 Transcriptional responses to polypeptide ligands: the Jak-STAT pathway. Annu Rev Biochem 64:621–651[Medline]
  19. Kelly PA, Edery M, Finidori J, Postel-Vinay M, Gougon L, Ali S, Dinerstein H, Sotiropoulos A, Lochnan H, Ferrag F, et al. 1994 Receptor domains involved in signal transduction of prolactin and growth hormone. Proc Soc Exp Biol Med 206:280–283[Abstract]
  20. Rui H, Lebrun J-J, Kirken RA, Kelly PA, Farrar WL 1994 JAK2 activation and cell proliferation induced by antibody-mediated prolactin receptor dimerization. Endocrinology 135:1299–1306[Abstract]
  21. Chang W-P, Clevenger CV 1996 Modulation of growth factor receptor function by isoform heterodimerization. Proc Natl Acad Sci USA 93:5947–5952[Abstract/Free Full Text]
  22. Lebrun J, Suhad A, Goffin V, Ullrich A, Kelly PA 1995 A single phosphotyrosine residue of the prolactin receptor is responsible for activation of gene transcription. Proc Natl Acad Sci USA 92:4031–4035[Abstract/Free Full Text]
  23. Hunter T 1995 Protein kinases and phosphatases: the yin and yang of protein phosphorylation and signaling. Cell 80:225–236[CrossRef][Medline]
  24. DaSilva L, Rui H, Erwin RA, Howard OMZ, Kriken RA, Malabarba MG, Hackett RH, Larner AC, Farrar WL 1996 Prolactin recruits Stat1, Stat3, and Stat5 independent of conserved receptor tyrosines Tyr402, Tyr479,Tyr515 and Tyr 580. Mol Cell Endocrinol 117:131–140[CrossRef][Medline]
  25. Kazansky AV, Raught B, Lindsey SM, Wang Y-f, Rosen JM 1995 Regulation of MGF/STAT5a during mammary gland development. Mol Endocrinol 9:1598–1609[Abstract]
  26. Liu X, Robinson GW, Gouilleux F, Groner B, Hennighausen L 1995 Cloning and expression of Stat5 and an additional homologue (Stat5b) involved in prolactin signal transduction in mouse mammary tissue. Proc Natl Acad Sci USA 92:8831–8835[Abstract/Free Full Text]
  27. Luo G, Yu-Lee L-y 1997 Transcriptional inhibition by Stat5: differential activities at growth-related vs. differentiation-specific promoters. J Biol Chem, in press
  28. Gouilleux F, Wakao H, Mundt M, Groner B 1994 Prolactin induces phosphorylation of Tyr694 of Stat5 (MGF), a prerequisite for DNA binding and induction of transcription. EMBO J 13:4361–4369[Medline]
  29. Burdon TG, Demmer J, Clark JA, Watson CJ 1994 The mammary factor MPBF is a prolactin-induced transcriptional regulator which binds to STAT factor recognition sites. Fed Eur Biochem Soc 350:177–182
  30. Li S, Rosen JM 1995 CTF/NF1 and mammary gland factor (Stat5) play a critical role in regulating rat whey acidic protein gene expression in transgenic mice. Mol Cell Biol 15:2063–2070[Abstract]
  31. Russell DL, Norman RL, Dajee M, Liu X, Hennighausen L, Richards JS 1996 Prolactin-induced activation and binding of Stat proteins to the IL-GRE of the {alpha}2-macroglobulin ({alpha}2M) promoter: relation to the expression of {alpha}2M in the rat ovary. Biol Reprod 55:1029–1038[Abstract]
  32. Stevens AM, Wang Y-f, Sieger KA, Lu H-f, Yu-Lee L-y. 1995 Biphasic transcriptional regulation of the interferon regulatory factor-1 gene by prolactin: involvement of gamma-interferon activated sequence and Stat-related proteins. Mol Endocrinol 9:513–525[Abstract]
  33. Wang Y-f, Yu-Lee L-y. 1996 Multiple Stat complexes interact at the IRF-1 GAS in prolactin-stimulated Nb2 T cells. Mol Cell Endocrinol 121:19–28[CrossRef][Medline]
  34. O’Neal KD, Yu-Lee L-y. 1993 The proline-rich motif (PRM): a novel feature of the cytokine/hematopoietin receptor superfamily. Lymph Cytokine Res 12:309–312
  35. DaSilva L, Howard OMZ, Rui H, Kirken RA, Farrar WL 1994 Growth signaling and JAK2 association mediated by membrane-proximal cytoplasmic regions of prolactin receptors. J Biol Chem 269:18267–18270[Abstract/Free Full Text]
  36. Lebrun J, Ali S, Ullrich A, Kelly PA 1995 Proline-rich sequence-mediated Jak2 association to the prolactin receptor is required but not sufficient for signal transduction. J Biol Chem 270:10664–10670[Abstract/Free Full Text]
  37. Yu-Lee L-y, Hrachovy JA, Stevens AM, Schwarz LA 1990 Interferon-regulatory factor 1 is an immediate-early gene under transcriptional regulation by prolactin in Nb2 T cells. Mol Cell Biol 10:3087–3094[Abstract/Free Full Text]
  38. Schwarz LA, Stevens AM, Hrachovy JA, Yu-Lee L-y. 1992 Interferon regulatory factor-1 is inducible by prolactin, interleukin-2 and concanavalin A in T cells. Mol Cell Endocrinol 86:103–110[CrossRef][Medline]
  39. Stevens AM, Yu-Lee L-y. 1992 The transcription factor interferon regulatory factor-1 is expressed during both early G1 and the G1/S transition in the prolactin-induced lymphocyte cell cycle. Mol Endocrinol 6:2236–2243[Abstract]
  40. Stevens AM, Yu-Lee L-y. 1994 Multiple prolactin-responsive elements mediate G1 and S phase expression of the interferon regulatory factor-1 gene. Mol Endocrinol 8:345–355[Abstract]
  41. David M, Petricoin EF, III, Igarashi K-I, Feldman GM, Finbloom DS, Larner AC 1994 Prolactin activates the interferon-regulated p91 transcription factor and the Jak2 kinase by tyrosine phosphorylation. Proc Natl Acad Sci USA 91:7174–7178[Abstract/Free Full Text]
  42. Gilmour KC, Reich NC 1994 Receptor to nucleus signaling by prolactin and interleukin 2 via activation of latent DNA-binding factors. Proc Natl Acad Sci USA 91:6850–6854[Abstract/Free Full Text]
  43. Gouilleux F, Mortiz D, Humar M, Moriggl R, Berchtold S, Groner B 1995 Prolactin and interleukin-2 receptors in T lymphocytes signal through a MGF-Stat5-like transcription factor. Endocrinology 136:5700–5708[Abstract]
  44. Wakao H, Gouilleux F, Groner B 1994 Mammary gland factor (MGF) is a novel member of the cytokine regulated transcription factor gene family and confers the prolactin response. EMBO J 13:2182–2191[Medline]
  45. Luckow B, Schutz G 1987 CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res 15:5490[Free Full Text]
  46. Moriggl R, Fouilleux-Gruart V, Jahne R, Berchtold S, Gartmann C, Liu X, Hennighausen L, Sotiropoulos A, Groner B, Gouilleux F 1996 Deletion of the carboxyl-terminal transactivation domain of MGF-Stat5 results in sustained DNA binding and a dominant negative phenotype. Mol Cell Biol 16:5691–5700[Abstract]
  47. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR 1989 Site-directed mutagenesis by overlap extension using polymerase chain reaction. Gene 77:51–59[CrossRef][Medline]
  48. Edery M, Levi-Meyrueis C, Paly J, Kelly PA, Djian J 1994 A limited cytoplasmic region of the prolactin receptor critical for signal transduction. Mol Cell Endocrinol 102:39–44[CrossRef][Medline]
  49. Raz R, Durbin JE, Levy DE 1994 Acute phase response factor and additional members of the interferon-stimulated gene factor 3 family integrate diverse signals from cytokines, interferons, and growth factors. J Biol Chem 269:24391–24395[Abstract/Free Full Text]
  50. Sims SH, Cha Y, Romine MF, Gao P-Q, Gottlieb K, Deisseroth AB 1993 A novel interferon-inducible domain: structural and functional analysis of the human interferon regulatory factor 1 gene promoter. Mol Cell Biol 13:690–702[Abstract/Free Full Text]
  51. Kanno Y, Kozak CA, Schindler C, Driggers PH, Ennist DL, Gleason SL, Darnell Jr JE, Ozato K 1993 The genomic structure of the murine ICSBP gene reveals the presence of the gamma interferon-responsive element, to which an ISGFalpha subunit (or similar) molecule binds. Mol Cell Biol 13:3951–3963[Abstract/Free Full Text]
  52. O’Neal KD, Yu-Lee L-y, Shearer WT 1995 The proline-rich motif is necessary but not sufficient for prolactin receptor signal transduction. Ann NY Acad Sci 766:282–284[Medline]
  53. O’Neal KD, Chari MV, McDonald CH, Cook RG, Yu-Lee L-y, Morrisett JD, Shearer WT 1996 Multiple cis-trans conformers of the prolactin receptor proline-rich motif (PRM) peptide detected by reverse-phase HPLC, CD and NMR spectroscopy. Biochem J 315:833–844
  54. Smit LS, Meyer DJ, Billestrup N, Norstedt G, Schwartz J, Carter-Su C 1996 The role of the growth hormone (GH) receptor and Jak1 and Jak2 kinases in the activation of Stats1, 3, and 5 by GH. Mol Endocrinol 10:519–533[Abstract]
  55. Stahl N, Farruggella TJ, Boulton TG, Zhong Z, Darnell JE, Yancopoulos GD 1995 Choice of STATs and other substrates specified by modular tyrosine-based motifs in cytokine receptors. Science 267:1349–1353[Abstract/Free Full Text]
  56. Greenlund AC, Farrar MA, Viviano BL, Schreiber RD 1994 Ligand-induced IFN-gamma receptor tyrosine phosphorylation couples the receptor to its signal transduction system (p91). EMBO J 13:1591–1600[Medline]
  57. Gerhartz C, Heesel B, Sasse J, Hemmann U, Landgraf C, Schneider-Mergener J, Horn F, Heinrich P, C, Graeve L 1996 Differential activation of acute phase response factor/Stat3 and Stat1 via the cytoplasmic domain of the interleukin 6 signal transducer gp130. I. Definition of a novel phosphotyrosine motif mediating Stat1 activation. J Biol Chem 271:12991–12998[Abstract/Free Full Text]
  58. Wang Y-D, Wong K, Wood WI 1995 Intracellular tyrosine residues of the human growth hormone receptor are not required for the signaling of proliferation or JAK-Stat activation. J Biol Chem 270:7021–7024[Abstract/Free Full Text]
  59. Lobie PE, Allevato G, Nielsen JH, Norstedt G, Billestrup N 1995 Requirement of tyrosine residues 333 and 338 of the growth hormone (GH) receptor for selected GH-stimulated function. J Biol Chem 270:21745–21750[Abstract/Free Full Text]
  60. Yi W, Kim S-O, Jiang J, Park S-H, Kraft AS, Waxman DJ, Frank SJ 1996 Growth hormone receptor cytoplasmic domain differentially promotes tyrosine phosphorylation of signal transducers and activators of transcription 5b and 3 by activated JAK2 kinase. Mol Endocrinol 10:1425–1443[Abstract]
  61. Fujitani Y, Hibit M, Fukada T, Takahashi-Tezuka M, Yoshida H, Yamaguchi T, Sugiyama K, Yamanaka Y, Nakajima K, Hirano T 1997 An alternative pathway for STAT activation that is mediated by the direct interaction between JAK and STAT. Oncogene 751–761
  62. Fukunaga R, Ishizaka-Ikeda E, Nagata S 1993 Growth and differentiation signals mediated by different regions in the cytoplasmic domain of granulocyte colony-stimulating factor receptor. Cell 74:1079–1087[CrossRef][Medline]
  63. Miyazaki T, Liu Z-J, Kawahara A, Minami Y, Yamada K, Tsujimoto Y, Barsoumian EL, Perlmutter RM, Taniguchi T 1995 Three distinct IL-2 signaling pathways mediated by bcl-2, c-myc, and lck cooperate in hematopoietic cell proliferation. Cell 81:223–231[CrossRef][Medline]
  64. Liu X, Robinson GW, Hennighausen L 1996 Activation of Stat5a and Stat5b by tyrosine phosphorylation is tightly linked to mammary gland differentiation. Mol Endocrinol 10:1496–1506[Abstract]
  65. Shuai K, Stark GR, Kerr IM, Darnell Jr JE 1993 A single phosphotyrosine residue of Stat91 required for gene activation by interferon-gamma. Science 261:1744–1746[Abstract/Free Full Text]
  66. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  67. Harroch S, Revel M, Chebath J 1994 Interleukin-6 signaling via four transcription factors binding palindromic enhancers of different genes. J Biol Chem 269:26191–26195[Abstract/Free Full Text]
  68. Zhang X, Blenis J, Li HC, Schindler C, Chen-Kiang S 1995 Requirement of serine phosphorylation for formation of STAT-promoter complexes. Science 267:1990–1994[Abstract/Free Full Text]
  69. Wen ZL, Zhong Z, Darnell JE 1995 Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82:241–250[CrossRef][Medline]
  70. Xu X, Sun Y-L, Hoey T 1996 Cooperative DNA binding and sequence-selective recognition conferred by the Stat amino-terminal domain. Science 273:794–797[Abstract]
  71. Vinkemeier U, Cohen SL, Moarefi I, Chait BT, Kuriyan H, Darnell Jr JE 1996 DNA binding of in vitro activated Stat1{alpha}, Stat1ß and truncated Stat1: interaction between NH2-terminal domains stabilizes binding of two dimers to tandem DNA sites. EMBO J 15:5616–5626[Medline]
  72. Shuai K, Liao J, Song MM 1996 Enhancement of antiproliferative activity of gamma interferon by the specific inhibition of tyrosine dephosphorylation of Stat1. Mol Cell Biol 16:4932–4941[Abstract]
  73. Haspel RL, Salditt-Georgieff M, Darnell Jr JE 1996 The rapid inactivation of nuclear tyrosine phosphorylated Stat1 depends upon a protein tyrosine phosphatase. EMBO J 15:6262–6268[Medline]
  74. Haque SJ, Flati V, Deb A, Williams BRG 1995 Role of protein-tyrosine phosphatases in Stat1{alpha}-mediated cell signaling. J Biol Chem 270:25709–25714[Abstract/Free Full Text]
  75. Li X, Leung S, Qureshi S, Darnell Jr JE, Stark GR 1996 Formation of Stat1-Stat2 heterodimers and their role in the activation of IRF-1 gene transcription by interferon-alpha. J Biol Chem 271:5790–5794[Abstract/Free Full Text]
  76. Horvath CM, Stark GR, Kerr IM, Darnell Jr JE 1996 Interactions between STAT and non-STAT proteins in the interferon-stimulated gene factor 3 transcription complex. Mol Cell Biol 16:6957–6964[Abstract]
  77. Harroch S, Gothelf Y, Revel M, Chebath J 1995 5' upstream sequences of MyD88, an IL-6 primary response gene in M1 cells: detection of functional IRF-1 and Stat factors binding sites. Nucleic Acids Res 23:3539–3546[Abstract/Free Full Text]
  78. Briken V, Ruffner H, Schultz U, Schwartz A, Reis LFL, Strehlow I, Decker T, Staeheli P 1995 Interferon regulatory factor 1 is required for mouse Gbp gene activation by gamma interferon. Mol Cell Biol 15:975–982[Abstract]
  79. Look DC, Pelletier MR, Tidwell RM, Roswit WT, Holtzman MJ 1995 Stat1 depends on transcriptional synergy with Sp1. J Biol Chem 270:30264–30267[Abstract/Free Full Text]
  80. Stocklin E, Wissler M, Gouilleux F, Groner B 1996 Functional interactions between Stat5 and the glucocorticoid receptor. Nature 383:726–728[CrossRef][Medline]
  81. Zhang JJ, Vinkemeier U, Gu W, Chakravarti D, Horvath CM, Darnell Jr JE 1996 Two contact regions between Stat1 and CBP/p300 in interferon gamma signaling. Proc Natl Acad Sci USA 93:15092–15096[Abstract/Free Full Text]
  82. Horvai A, Xu L, Korzus E, Brard G, Kalafus D, Mullen T-M, Rose DW, Rosenfeld MG, Glass CK 1997 Nuclear integration of Jak/Stat and Ras/AP-1 signaling by CBP and p300. Proc Natl Acad Sci USA 94:1074–1079[Abstract/Free Full Text]
  83. Bhattacharya S, Eckner R, Grossman S, Oldread E, Arany Z, D’Andrea A, Livingston DM 1996 Cooperation of Stat2 and p300/CBP in signalling induced by interferon-{alpha}. Nature 383:344–347[CrossRef][Medline]
  84. Meraz MA, White JM, Sheehan KCF, Bach EA, Rodig SJ, Dighe AS, Kaplan DH, Riley JK, Greenlund AC, Campbell D, et al. 1996 Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signaling pathway. Cell 84:431–442[CrossRef][Medline]
  85. Durbin JE, Hackenmiller R, Simon MC, Levy DE 1996 Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 84:443–450[CrossRef][Medline]
  86. Ruffner H, Reis LF, Naf D, Weissmann C 1993 Induction of type I interferon genes and interferon-inducible genes in embryonal stem cells devoid of interferon regulato