| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
The Curriculum in Genetics and Molecular Biology (D.A.F.) Department of Pediatrics (D.R.J.) The Laboratories for Reproductive Biology The University of North Carolina Chapel Hill, North Carolina 27599
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Previous regulation studies using hypophysectomized rats have implicated hormones in the regulation of testicular ABP. These studies suggested that testosterone and FSH regulated ABP and ABP mRNA production but did not determine whether the effect was indirect or direct on the gene (11, 12, 13, 14, 15). Hansson et al. (16) described that testicular ABP levels increased in Tfm rats, which lack the androgen receptor, thereby providing evidence that androgens do not directly regulate ABP. Experiments with primary Sertoli cell cultures demonstrated that androgens and FSH did modestly increase secreted ABP levels in the medium, but the data could not determine whether the regulation affected transcription/translation or stability of the ABP protein (17). Later, the use of DNA hybridization analysis techniques demonstrated that the addition of androgens to Sertoli cell cultures did not affect ABP mRNA levels (18). Furthermore, dihydrotestosterone did not alter gene transcription in vitro with a promoter-luciferase reporter construct (our unpublished results). In addition, FSH did not increase ABP mRNA levels in primary Sertoli cell cultures but caused dramatic increases in the mRNA levels of c-fos, c-jun, inhibin, and tissue plasminogen activator (20, 21).
The rat ABP gene has been sequenced and its activity partially characterized (our unpublished results and Refs. 22, 23). The gene consists of promoters P1 and PA; P1 regulates the synthesis of the secreted testicular ABP. Several characteristics of a GC-rich "housekeeping" gene are present within the ABP P1 promoter region, including localized high GC content and several putative Sp1 sites (our unpublished results and Ref. 22). These characteristics are even more prevalent in the alternate ABP promoter PA, located 15 kb upstream of the P1 region (23), but this promoter does not show Sertoli cell-specific expression (23, 24). Based on sequence analysis and mutagenesis experiments, no TATA and/or CCAAT box sequences were identified within the ABP P1 promoter (our unpublished results and Ref. 22). The ABP P1 promoter also possesses several characteristics not consistent with a GC-rich type of promoter, such as site-specific initiation of transcription (22, 23, 25, 26). The major transcriptional start site has been previously mapped by primer extension, RNase protection, and primer walking; it is located 36 bp upstream of the translational start site (our unpublished results and Refs. 22, 23). The nucleotide sequences flanking the major start site are consistent with the presence of an initiator element (our unpublished results and Refs. 22, 23, 27). A minor start site is apparently located upstream of the major site (our unpublished results).
Several other genes, which have been characterized as markers of Sertoli cell function, have been studied to ascertain the mechanism of transcriptional regulation. The FSH receptor (FSHR), tissue plasminogen activator, mullerian inhibitory substance (MIS), and the inhibin Bß-subunit genes have specific start sites, but no TATA sequences have been identified (28, 29, 30, 31). The transferrin gene, which is also expressed by Sertoli cells, contains the classic TATA and CCAAT sequences that direct the expression of the gene (32). No Sertoli cell-specific cis-regulatory sequences have been identified in any of these Sertoli cell-expressed genes.
Probably the most interesting characteristics of genes that are specifically expressed by Sertoli cells are the DNA sequences that dictate cell type specificity. In this manuscript, the Sertoli cell-specific transcriptional regulation of the ABP gene P1 promoter was characterized using a luciferase reporter system. Three cis-acting sequences were identified, which appear to play a key role in Sertoli cell-specific expression of the ABP gene. In addition, the results identify several protein complexes and their DNA-binding sequences that appear to be involved in the Sertoli cell-specific transcription of the ABP gene.
| RESULTS |
|---|
|
|
|---|
Deletion mapping experiments were continued by analyzing 12 fragments
within the 619-bp DNA region; each DNA contained the gene promoter and
varied in length at the 5'-end by approximately 50 bp (Fig. 1
). The fragments were unidirectionally cloned into the
luciferase vector pXP1, and the constructs were assayed on the three
cell lines: MSC-1, MA10 Leydig, and NIH3T3 fibroblast cells. Data are
expressed as the relative increase over the smallest construct
(DNA-14:pXP1), which contains the major transcriptional
start site and 14 bp of upstream sequence. The use of
DNA-14 as the reference point provides an internal control
that reduces biases caused by transfection efficiency variations in the
three cell lines. Therefore, absolute luciferase activities between
cell lines are not directly compared. The low activities of
pXP1:DNA-14 in the three cell lines were approximately the
same. Figure 2A
shows that transfections of the DNA
-619:pXP1 construct yielded a 362-fold increase in
luciferase activity on MSC-1 cells as compared with the
DNA-14:pXP1. Thus, the insertion of the 619-bp upstream
sequence with the minimal ABP gene promoter increased the activity
362-fold in MSC-1 cells. On the contrary, the activity was only
modestly increased in MA10 and NIH3T3 cells, 5-fold and 3-fold,
respectively. Figure 2A
summarizes the results with the other deletion
mutants. With each construct, increased activity was higher in the
MSC-1 cells than in the other cell lines. As the fragments were
extended by 50 bp, the activity changed in increments to the maximum
activity with DNA-619 construct. As the length of the
fragment increased, three fragments demonstrated dramatic increases in
activity as compared with the adjacent smaller fragment:
DNA-114, DNA-543, and DNA-619
(Fig. 2A
). Interestingly, only one fragment demonstrated a dramatic
increase with MA10 cells; DNA-114 yielded a 13-fold
increase over DNA-63. There was little activity with any
fragment on NIH3T3 cells. These data suggest the presence of important
regulatory elements between residues -65 to -114, -484 to -543, and
-544 to -619. Moreover, the two upstream elements act specifically in
MSC-1 Sertoli cells and not MA10 or NIH3T3 cells. Furthermore, an
inhibitory activity is associated with residues -164 to -114.
|
|
Analysis of the -114 to -65-bp Region
Mutagenesis of Putative Regulatory Sequences
To further investigate the sequences important for ABP gene expression,
several mutants were constructed within the -65 to -114-bp region.
The sequences were selected by identifying regions of high homology
between the rat and human ABP genes. Two regions were identified: one
contains an inverted repeat sequence from -87 to -101 bp whereas the
second contains a long stretch of pyrimidines from -61 to -78 bp.
Both sequences were independently mutated using oligonucleotides 19 and
20 in DNA-114:pXP1. Each mutant plasmid was used to
transfect MSC-1, MA10, and NIH3T3 cell lines to assess luciferase
expression. Figure 3
demonstrates that mutation of
either region in the DNA-114 construct resulted in a 66%
or 79% increase in activity with MSC-1 cells. Transformation of MA10
cells with the -87 to -101-bp mutant in the DNA-114:
pXP1 construct resulted in a decrease of 59%, whereas the -61 to
-74-bp mutant resulted in 10-fold activity increase (Fig. 3
). In
contrast, luciferase activity change after transformation of NIH3T3
cells was not significant for the -87 to -101-bp mutant. Similar to
the large increase observed in MA10 cells, the -61 to -74-bp mutant
of DNA-114 using NIH3T3 cells yielded a significant
increase (2.5-fold) in activity (Fig. 3
).
|
|
DNase I Footprinting
The results in the previous section indicated that several nuclear
proteins bind to sequences within the -114 to -65-bp region. To
further characterize this DNA, DNase I footprinting was used to
identify the binding sequence(s). Comparison of DNA probes digested in
the presence or absence of nuclear proteins reveals regions protected
by DNA-binding proteins (38, 39). This protection identifies the
nucleotide residues that are directly involved with DNA-protein
interactions. The identical probe is also cleaved with base-specific
(G/A) reagents to generate a ladder of molecular weight markers that
are used to locate the protected region (40). DNase I digestion of a
224-bp fragment containing the -114 to -65-bp region was performed
after a binding reaction using the optimized conditions determined for
the gel retardation assays. Figure 5A
(lanes 2 and 3)
shows that the presence of MSC-1 nuclear proteins yielded an
electrophoretic pattern identical to the pattern without nuclear
proteins. On the contrary, MA10 cell nuclear proteins appeared to
protect a specific region of DNA (residues -101 to -87 bp,
5'-AGGGTCAGTGTCCCT-3') (Fig. 5A
, lane 4). The addition of a 200-fold
excess of the unlabeled DNA probe restored the DNase I digestion
pattern to a pattern similar to the control reaction (Fig. 5A
, lane 5),
indicating that the protection depends on specific sequences. Because
the presence of MA10 nuclear proteins appeared to also affect the DNase
I digestion of the DNA probe (i.e. the level of small
molecular weight bands is decreased in the presence of nuclear proteins
compared with the control), a DNase I titration was performed to
equalize the level of digestion between the control and the MA10
DNA-binding reactions. Figure 5B
(lanes 29) demonstrates that to
achieve equal DNase I digestion in the presence of MA10 proteins, at
least 3 times the amount of DNase I was required. Nevertheless, at
DNase levels of 1.04.0 U, residues -101 to -87 were protected from
digestion. Similarly, DNase I experiments using the complementary
strand as labeled probe showed partial protection of this region (data
not shown). These data demonstrate that MA10 cell nuclear proteins bind
to the -101 to -87-bp region. As shown above, mutation of this region
causes a 60% decrease in the transcription rate as measured by
luciferase activity in MA10 cells, but not MSC-1 cells. The specific
formation of complex E, with MA10 nuclear proteins, provides evidence
that DNase protection has mapped a binding site for this unique
complex.
|
|
Other experiments were performed to test the formation
specificity of complexes G and G1. Figure 7A
demonstrates that the binding of both complexes was reduced by the
addition of the unlabeled DNA-619 to -544. The
competition with complex G increased as the amount of unlabeled probe
increased (lanes 26). Also, the presence of an oligonucleotide
containing the consensus Sp1 sequence did not affect the complex
formation (Fig. 7A
, lanes 710). The binding of two minor DNA-protein
complexes H and I, formed with MSC-1 nuclear extracts, were also
reduced by the addition of unlabeled probe. The band observed under
complex I was not affected by the presence of competitor DNA and was
therefore not formed by specific binding. Similarly, MA10 nuclear
proteins form a complex migrating at the same apparent rate as complex
G; however, the amount of the MA10 complex was much less than the
amount formed with MSC-1 proteins. This complex formation with MA10
nuclear proteins was reduced with an excess of the DNA probe (Fig. 7A
, lanes 1320). The two bands migrating in the same region as MSC-1
complex H (Fig. 7A
, lanes 1320) were not affected by excess probe DNA
and do not represent specific DNA-protein complexes.
|
DNase 1 Footprinting
The identification of the DNA-binding sequence of complex G was
examined using DNase I footprinting as described above. A 208-bp probe
was amplified from residues -619 to -435 using
32P-labeled primers to specifically label one strand. The
optimal binding conditions for complex G formation contained 300
mM KCl, which inhibited DNA digestion by DNase I. To obtain
suitable digestion of the DNA probe, the binding reaction conditions
were changed to 300 mM KCl and 10 mM
MgCl2, which had no apparent effect on formation of complex
G. Even with the addition of MgCl2 to the binding reaction,
DNase I digestion of the free probe required 9 U of the enzyme. Under
these conditions there was no obvious protection with 25 µg or 50
µg of MSC-1 cell nuclear proteins; however, in the presence of 100
µg of protein, there were two areas of limited protection separated
by several nucleotides (Fig. 8
). The two protected
sequences included the sequence
5'-TTCTAGTATCCATTAAACACAGAAAGA-3' (residues -573 to
-547) with the unaffected site from -556 to -554 bp
(underlined). Several attempts were made to optimize the
DNase I footprinting of complex G, including increasing the specific
activity of the probe and the concentration of nuclear proteins, but no
other DNA-protein interactions that protected against DNase I
digestion were identified.
|
|
| DISCUSSION |
|---|
|
|
|---|
DNA-619 increased luciferase activity more than 300-fold in MSC-1 cells. This high activity with only 619 bp of upstream sequence was not surprising since the sequence -620 to -1500 in the 1.5 kb DNA consists of species-specific repetitive elements in the rat and human gene (7, 22). The high sequence homology of rat and human gene sequence from -1 to -600 (rat gene residue numbers) has been previously presented (4). Interestingly, there was not a single Sertoli cell cis-regulatory region, but three regions appeared to contribute to the Sertoli cell specificity. The deletion mapping experiments identified regions -583 to -564, -503 to -484, and -114 to -65 as containing important regulatory elements. Regions -583 to -564 and -503 to -484 appear to stimulate activity only in the Sertoli cell line, but not the other lines, whereas region -114 to -65 acts in the Sertoli cell line MSC-1 and the Leydig cell line MA10, but not the fibroblast line NIH3T3. In addition, the ABP promoter region contains both positive and negative regualtory sequences that direct Sertoli cell-specific expression of the ABP gene. This is demonstrated by the presence of a polypyrimidine stretch in the -114 to -65-bp region, which decreased expression of the ABP gene, in MA10 cells. The sequences in none of these three regions had high homology with any known regulatory elements in the GCG Findpatterns database.
Analysis of the -114 to -65-bp region identified several nuclear proteins that specifically bind to these sequences. Other experiments found that a pyrimidine stretch at residues -74 bp to -61 caused decreased expression of transcriptional activity in MA10 and NIH3T3 cells; there was a 10-fold increase in activity in MA10 cells after mutagenesis of this region. It is somewhat of a paradox that no detectable DNA-binding proteins interacted specifically with this region (i.e. substitution mutagenesis had no effect on protein complexes in band shift assays, and no protection was observed with DNase 1 footprinting), but this sequence acted as a negative regulator of expression in cells other than Sertoli cells. Possible explanations for the apparent lack of specific nuclear proteins are described below. In addition, another cis-regulatory element between residues -101 and -87 was identified; this sequence contains an inverted repeat sequence with a stem-loop structure. Mutation of this sequence reduced gene activity dramatically in MA10 cells. Gel retardation and DNase I footprinting assays were used to identify binding proteins and their specific binding sequences. Mobility shift assays revealed several DNA-protein complexes with nuclear proteins from MSC-1, MA10, and NIH3T3 cells. DNase I footprinting with MA10 nuclear proteins determined that the binding sequence was 5'-AGGGTCAGTGTCCCT-3' (residues -101 to -87). Taken together, these data suggest that a Leydig cell transcription factor complex and its corresponding binding sequence were identified. Although the element increased gene activity in MA10 Leydig cells in vitro, the gene is not known to be active in Leydig cells. Interestingly, an analysis of the FSHR gene (which in vivo is restricted to Sertoli cell expression) found that in vitro gene activities were greater in MA10 cells than MSC-1 cells (28).
Whereas the -114 to -65-bp region stimulates gene activity in a nonspecific manner, two upstream regions increase gene activity specifically in Sertoli cells. Residues -503 to -484 generated a 5-fold increase in transcriptional activity; deletion-mapping experiments demonstrated that this increase was Sertoli cell-specific. In this study, numerous attempts were made to identify nuclear-binding proteins that bind to this sequence. Varying both DNA-binding reaction conditions and electrophoresis parameters failed to reveal evidence of protein binding. However, scanning mutagenesis identified a core sequence of 5'-GGAGGC- 3' (residues -498 to -493). Removal of the sequence reduces gene activity to near the core level obtained with DNA-482:pXP1. There are several possible explanations of why no binding proteins were observed. Although unlikely, the cis-acting element may not be acting via a trans-acting protein or the factors may be present but not detectable by the assays for several reasons. By nature, for the DNase 1 protection assay to be successful, the binding protein molarity must exceed the probe concentration. For many binding proteins this concentration is difficult to achieve without further purification. Furthermore, even though several conditions were used to test binding, the binding conditions may not have been optimal. Nevertheless, a Sertoli cell-specific cis-acting regulatory element, which included the sequence 5'-GGAGGC-3', was identified.
The final regulatory region revealed by mapping was bounded by residues -583 and -564. This region was necessary for full ABP promoter activity in MSC-1 cells, but not heterologous cell lines. In these experiments, gel retardation experiments identified a major DNA-protein complex G. The large reduction in the migration rate for this complex suggests an interaction of several proteins existing as a homo- or heterocomplex. This type of interaction has been described for many transcription factors including the homo-tetramer protein complex, Sp1 (44, 45). Evidence for a multi-polypeptide complex was revealed by UV cross-linking; two species with estimated molecular masses of 60 kDa and 70 kDa were identified. DNase I footprinting of the upstream regulatory region revealed limited protection of the sequence 5'-TTCATAGTATCCATTAAA-3' (-573 to -555 bp). Furthermore, band shift and mutagenesis experiments confirmed the identity of this sequence. Thus, this regulatory element appears to act as a Sertoli cell enhancer.
These data have defined various aspects of the Sertoli cell-specific transcriptional regulation of the rat ABP gene. Three regions upstream of the transcriptional start site that increase promoter P1 transcription were identified; two of these elements act in a Sertoli cell-specific manner. Both positive and negative regulatory sequences appear to be involved with directing expression of the ABP gene in a cell-specific manner. The identification of both cis- and trans-regulatory elements within these three sequences has identified several putative Sertoli cell-regulatory elements. Although the promoters for several Sertoli cell expressed genes, such as the FSHR, tissue plasminogen activator, MIS, transferrin, and the inhibin Bß-subunit genes (28, 29, 30, 31), have been characterized, no Sertoli cell-specific regulatory elements have been described in these genes. Further studies are needed to determine the similarities between the regulatory mechanisms of these Sertoli cell-specific genes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mutagenesis of ABP promoter sequences was performed using the double-stranded mutagenesis system, Chameleon (Stratagene, La Jolla, CA) (47). Oligonucleotides used for each mutagenesis are defined below. Each plasmid DNA construct was isolated and its nature verified by restriction endonuclease fragment analysis and DNA sequence analysis. Plasmid DNA was purified by affinity chromatography using QiaFilter Maxiprep Isolation kit (Qiagen). For each construct the plasmid DNA from two unique isolates was purified for assays. At least one isolate of each construct was sequenced to confirm the identity of the DNA insert. DNA was sequenced at the University of North Carolina at Chapel Hill Automated DNA Sequencing Facility on a model 373A Applied Biosystems DNA Sequencer using the Taq DyeDeoxy Terminator Cycle Sequencing Kit (P-E Applied Biosystems, Foster City, CA).
Transfections and Luciferase Assays
The mouse Sertoli cell line, MSC-1 (43, 48), which expresses the
ABP gene, was cultured in DMEM containing 10% FBS at 32 C and 5%
CO2. MA10, a Leydig cell line (49), was cultured at 37 C
and 5% CO2 in Waymouths medium containing 15% horse
serum, and the mouse fibroblast cell line NIH3T3 was propagated in DMEM
containing 10% FBS at 37 C and 5% CO2. Cells were plated
in 100-mm dishes (in duplicate) in the appropriate medium and cultured
until each culture was approximately 70% confluent. Plasmid DNA was
used to transfect each cell line using LipofectAmine (Life
Technologies, Bethesda MD), according to the manufactures protocols.
Two isolates of each variant were tested for activity. Briefly, the
plasmid DNA (10 µg/plate) was mixed with 800 µl of OptiMEM Reduced
Serum Medium (Life Technologies) and followed by the addition of 30
µl of LipofectAmine in 800 µl of OptiMEM. Liposomal complexes were
allowed to form at room temperature for 20 min, and cells were
incubated at 32/37 C for 5 h. The appropriate medium containing
double the serum concentration (6.4 ml) was added to each plate, and
the cells were incubated for 18 h. The medium was removed from
each plate and changed as described above. After the transfection
process, the cells were incubated for 48 h under the appropriate
conditions. For the luciferase assays, the cells were harvested, washed
twice with ice-cold PBS, pH 7.5, and lysed with a solution of 1%
Triton X-100, 25 mM glycyl glycine (GlyGLy), 15
mM MgSO4, 4 mM EGTA, 1
mM dithiothreitol (DTT), and 0.17 mg/ml
phenylmethylsulfonyl fluoride (PMSF), pH 7.80. The cell lysates were
removed from the plate and sedimented at 14,000 x g
for 5 min at 4 C to remove cellular debris. The supernatant fluid was
analyzed by adding 100 µl cellular lysate + 300 µl reaction buffer
(25 mM GlyGly, 15 mM sodium phosphate buffer,
pH 7.80, 15 mM MgSO4, 4 mM EGTA, 2
mM ATP, and 1 mM DTT, pH 7.80) and 100 µl of
200 µM D-luciferin (sodium salt, Sigma
Chemical Co., St. Louis, MO). Luciferase activity (relative light
units) was measured for 20 sec using a Monolight 2010 luminometer
(Analytical Luminescence Inc, San Diego, CA). The luciferase data were
very consistent with an SEM of less than ±15% (n =
410). A change in activity was considered significant if 1) it was
greater than 30%, 2) the results were reproducible, and 3) the
equivalent results were obtained with at least two isolates.
Constructs with DNA inserts of various lengths were used to compare the activities of gene fragments. Because the length of the DNA could conceivably affect transformation efficiency, the efficiency of constructs of various lengths were compared. Plasmid DNAs were isolated from MSC-1 cells transfected with several fragment:pXP1 constructs 48 h after transfection as previously described (50). The isolated plasmid DNA was digested with HindIII, fractionated by electrophoresis on a 0.7% agarose gel, and transferred to a nylon membrane as described above. The membrane was hybridized with 32P-labeled pXP1 DNA in 50% formamide, 6x NaCl-sodium citrate at 42 C for 18 h. The membrane was washed at a final stringency of 0.1x NaCl-sodium citrate at 65 C and exposed to Kodak XAR x-ray film (Kodak, Rochester, NY) with intensifier screens. Densitometry (using a PhosphorImager; Molecular Dynamics, Sunnyvale, CA) of the signals identified on the Southern blot revealed that the transfection efficiency for each construct did not change due to length of the insert (data not shown).
Nuclear Extract Preparation
Cells were plated in T150 flasks and grown (see above) until the
cells were approximately 90% confluent (1 x 108
cells per flask). Cells were washed twice with ice-cold PBS, pH 7.5,
and scraped from the flasks in PBS, after which they were pooled and
collected by centrifugation. Nuclear proteins were prepared from each
cell line according to methods detailed by Kupfer et al.
(51). Briefly, the cells were gently resuspended in a lysis buffer
containing the protease inhibitors PMSF, pepstatin, leupeptin, and
aprotinin (Sigma). Nuclei were isolated by the addition of the
detergent Nonidet P-40 (NP-40) and separated by centrifugation at
1,400 x g for 5 min at 4 C. The nuclei were suspended
in an extract buffer (20 mM Tris-HCl, pH 7.5, 1
mM EDTA, 0.5 M NaCl, 10% glycerol, 1
mM DTT, 0.5 mM PMSF, and 2 µg/ml of each of
the other protease inhibitors), shaken vigorously for 15 min at 4 C,
and centrifuged at 14,000 x g for 5 min at 4 C. The
supernatant fluid was removed and dialyzed against DNA binding buffer
(10 mM Tris-HCl, pH 7.5, 0.1 mM EDTA, 25
mM KCl, 10% glycerol, 1 mM DTT, 0.5
mM PMSF, and 2 µg/ml of each other protease inhibitors)
for 1 h at 4 C. Nuclear protein solutions were aliquoted and
stored at -80 C. Protein concentrations were determined using the
Micro BCA protein assay (Pierce, Rockford, IL).
Gel Retardation Assays
Gel retardation assays were performed on PCR-amplified fragments
that contained putative regulatory sequences. DNA fragments were
amplified using the following primer sets: -114 to -65-bp region,
primers 21 and 22; -503 to -484-bp region, primers 23 and 24; and
-583 to -564-bp region, primers 25 and 26 (46). Each amplified
fragment included flanking sequence on both ends of the identified
regulatory sequence to ensure the entire DNA-binding site was present.
Amplified fragments were labeled using T4 polynucleotide kinase in a
reaction containing [32P]ATP (NEN/DuPont, Boston, MA) and
used as probes to detect DNA-binding proteins from MSC-1, MA10, and
NIH3T3 nuclear proteins (51, 52). Various binding and gel
electrophoresis conditions were tested to optimize complex formation
(35, 36, 37). The binding assay for the -583-bp to -564-bp region was
performed in a 30-µl reaction containing 10 mM Tris-HCl,
pH 7.5, 1 mM EDTA, 10% glycerol, 300 mM KCl,
0.5 mM DTT, 67 µg/ml
poly(deoxyinosinic-deoxycytidylic)acid (Pharmacia, Uppsala, Sweden),
10,000 cpm of 32P-labeled DNA, and 2050 µg of nuclear
proteins. DNA-binding products were loaded on a 1.5-mm 5%
nondenaturing polyacrylamide gel containing 10% glycerol and 0.5x
Tris-borate-EDTA (TBE) buffer and developed in 0.5x TBE at 175 V for
34 h at 4 C (51). Gel retardation assays were performed with the
-114 bp to -65-bp DNA using a 30-µl binding reaction containing 20
mM HEPES buffer, pH 7.9, 0.1 mM EDTA, 0.025%
NP-40, 10% glycerol, 3.3 µg/ml BSA fraction V, 50 mM
KCl, 1 mM DTT, 67 µg/ml Poly (dI/dC), 10,000 cpm labeled
DNA, and 1050 µg of nuclear proteins. Binding reactions were
incubated at ambient temperature for 40 min, and the products were
fractionated by gel electrophoresis. Electrophoresis was performed, at
room temperature, as previously described except that EDTA and NP-40
were added to the gel and running buffer to a final concentration of 1
mM and 0.05%, respectively (32). Competition experiments
using unlabeled specific and nonspecific probes were performed
using amplified fragments or a series of synthetic oligonucleotides
containing consensus DNA-binding sequences (Promega, Madison, WI). The
gels were fixed in a solution of 10% glacial acetic acid and 15%
ethanol for 15 min, transferred to filter paper, and vacuum dried at 80
C. The dried gels were exposed to XAR film (Kodak) in the presence of
intensifying screens for 1872 h.
DNase I Footprinting and UV Cross-Linking
A 224-bp fragment (-164 to +36 bp) or a 208-bp fragment (-619
to -435 bp) were amplified by PCR using primers 27 and 13, or 25 and
28, respectively. A plasmid containing the entire ABP promoter was used
as template. The PCR reactions contained one 32P-labeled
primer to produce a strand-specific, end-labeled probe for DNase I
footprinting. DNA-binding reactions were performed before DNase I
digestion (32, 51). DNase I footprinting experiments used the SureTrack
DNase I footprinting system (Pharmacia, Piscataway, NJ). DNA-binding
reactions were subjected to DNase digestion with 0.5 U/reaction or 9
U/reaction of DNase I, as determined by titrations for 1 min at room
temperature. Digestions were terminated by the addition of a 4x
solution, containing 768 mM sodium acetate, 128
mM EDTA, 0.56% SDS, and 256 µg/ml yeast RNA, followed by
phenol-chloroform extraction and ethanol precipitation (46). In
addition, Maxam-Gilbert G and A (G/A) sequence reactions were
fractionated as size markers to identify the nucleotide sequence of the
protected region (40). The reaction products were resuspended in
loading buffer (deionized formamide containing 10 mM EDTA,
0.3% bromophenol blue, and 0.3% xylene cyanol), heated at 90 C for 5
min, and loaded on a 0.2-mm 6% denaturing polyacrylamide gel. The gel
was developed at 45 watts in 1x TBE for 12 h. After electrophoresis,
the gel was fixed with 10% glacial acetic acid-15% ethanol,
dehydrated using a vacuum drier, and exposed to XAR film with
intensifying screens at -80 C for 2496 h
UV cross-linking (53, 54) was performed as previously described using the PCR-generated fragment containing residues -619 to -544 of the ABP promoter. The binding assays were performed as described above before UV exposure. The reaction liquid was placed on a small piece of Parafilm at 0 C and exposed 6 cm from a 15-watt UV light (254 nm) for 1545 min. After cross-linking, 2x Laemmli buffer (55) was added to each reaction and heated at 90 C for 2 min. The cross-linked DNA-protein complexes were separated from free DNA by SDS-PAGE. Gels were processed as previously described and exposed to XAR film with intensifying screens at -80 C.
PCR Primers, Mutagenesis, and Probe Oligonucleotides
Oligodeoxynucleotides (primers) were synthesized and purified by
HPLC by the Oligonucleotide Synthesis Facility, Department of
Pathology, University of North Carolina at Chapel Hill. Restriction
endonuclease sites were included in the oligonucleotides to aid in
cloning or mutant identification. Endonuclease sites are
underlined.
Primer 14, residues -583 bp to -564 bp of ABP/SHBG gene, PCR forward primer (SstI site), deletion mapping: 5' GACTATGAGCTCGGCAGATTTCTTCATAGTAT 3'
Primer 15, residues -563 bp to -544 bp of ABP/SHBG gene, PCR forward primer (SstI site), deletion mapping: 5' GACTATGAGCTCCCATTAAACACAGAAAGACA 3'
Primer 16, residues -523 bp to -504 bp of ABP/SHBG gene, PCR forward primer (SstI site), deletion mapping: 5' GACTATGAGCTCCCACATAGGTCTGGGAAATC 3'
Primer 17, residues -503 bp to -484 bp of ABP/SHBG gene, PCR forward primer (SstI site), deletion mapping: 5' GACTATGAGCTCTAAGGGAGGCATTCATGTCG 3'
Primer 18, -5451 bp to 5482 bp of pXP1 plasmid DNA: NdeI site changed to PvuII site: 5'-GGTATTTCACAC-CGCAGCTGGTGCACTCTCAG-3'
Primer 19, -114 bp to -73 of ABP/SHBG gene: -65-bp to -114-bp region mutant: 5'-GGGCCGCATGGTCCTCGAG-CTGACTATGATCTCTTGCCCCC-3'
Primer 20, -91 bp to -47 bp of ABP/SHBG gene: -65-bp to -114-bp region mutant: 5'-CCTATCTCTTGCCCC-GTAATCATGAGCTCAGCAACCTTTAACCC-3'
Primer 21, residues -133 bp to -114 bp of ABP/SHBG gene, PCR forward primer (BamHI site), probe for gel retardation assay: 5'-GACTATGGATCCCATCTCATCTGCCTTC-AGAG-3'
Primer 22, residues -65 bp to -46 bp of the rat ABP gene, PCR reverse primer (KpnI site), probe for gel retardation assay: 5'-GACTATGGTACCAGGGTTAAAGGTTGCTCCGG-3'
Primer 23, residues -523 bp to -504 bp, PCR forward primer (XhoI site), probe for gel retardation assay: 5'-GACTATCTCGAG-CCACATAGGTCTGGGAAATC-3'
Primer 24, residues -483 bp to -464 bp, PCR reverse primer (KpnI site), probe for gel retardation assay: 5'-GACTATGGTACCCAGGCAGAATGCCCGGGATC-3'
Primer 25, residues -619 bp to -600 bp, PCR forward primer (BamHI site), probe for gel retardation assay: 5'-GACTATGGATCCGATTTTGCTGTCTCAACCTT-3'
Primer 26, residues -563 bp to -544 bp, PCR reverse primer (KpnI site), probe for gel retardation assay: 5'-GACTATGTTACCTGTCTTTCTGTGTTTAATGG-3'
Primer 27, residues -164 bp to -145 bp, PCR forward primer (SstI site), probe for DNase I footprinting: 5'-GACTATGAGCTCAAGG-GGATAGTAGTGGAAGGA-3'
Primer 28, residues -454 bp to -435 bp gene, PCR reverse primer, probe for DNase I footprinting: 5'-GCTGCTGGGAATGAGGATCG-3'
Primer 29, residues -516 bp to -484 bp, scanning mutagenesis primer (EcoRI site): 5-'GGTCTGGGAAAGAATTCG GAGGCATTCATGTCG-3'
Primer 30, residues -511 bp to -483 bp, scanning mutagenesis primer (XbaI site): 5'-GGGAAATCTAGGTCTAGA-TTCATGTCGG 3'
Primer 31, residues -505 bp to -477 bp, scanning mutagenesis primer (EcoRI site): 5'-CTAAGGGAGGCGAATTC GTCGGATCCCG-3'
Primer 32, residues -499 bp to -467 bp, scanning mutagenesis primer (EcoRI site): 5'-GGAGGCATTCATGAATTCTCCGGGCATTCTGC-3' Primer 33, residues -579 bp to -547 bp, mutagenesis primer (SalI site): 5'-GATTTC-TTCATAGGTCGACTTAAACACAGAAAG-3'
Primer 34, residues -573 bp to -554 bp, probe for gel retardation assay: 5'-TTCATAGTATCCATTAAACA-3'
Primer 35, residues -573 bp to -554 bp, probe for gel retardation assay: 5'-TGTTTAATGGATACTATGAA-3'.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by PHS grants R01-HD21744 (PI David Joseph) and 5-P30-HD-18968 (Principal Investigator, Frank S. French, The Laboratories for Reproductive Biology). This work represents partial fulfillment of the requirements for a Ph.D. degree.
Received for publication April 25, 1997. Accepted for publication May 20, 1997.
| REFERENCES |
|---|
|
|
|---|
- and ß-B-subunit genes suggest two different
regulatory mechanisms. Mol Endocrinol 3:19141925[Abstract]