| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Weis Center for Research (T.J.M., C.E.K., V.K., K.M.B.)
Geisinger Clinic Danville, Pennsylvania 17822
Baker Medical Research Institute (W.G.T.) Melbourne 8008,
Australia
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The octapeptide hormone angiotensin II (Ang II) binds and activates
receptors on the plasma membrane of target cells, thereby mediating a
variety of important cardiovascular, homeostatic, and neuroendocrine
functions (10). Pharmacological and molecular cloning studies have
identified two major types of Ang II receptor, classified as
AT1 and AT2, with subtypes of AT1,
termed AT1A and AT1B (11, 12).
AT1A, AT1B, and AT2 receptors are
members of the seven-transmembrane guanyl nucleotide-binding protein (G
protein) receptor (GPCR) superfamily, and the AT1A receptor
mediates most of the classical biological actions of Ang II.
AT1A and AT1B (13, 14, 15), but not AT2
(14), receptors rapidly internalize (t1/2
2 min) after
Ang II stimulation, although the significance of this disparity is
unclear. Internalization of Ang II.AT1A receptor complexes
is presumably via a clathrin-mediated pathway (13) and, based on
pharmacological and mutational analyses (13, 16), the processes that
govern AT1A receptor endocytosis overlap, but are distinct
from, those that couple these receptors to activation of heterotrimeric
G proteins. Previous mutagenesis studies by us (15, 17) and others (14, 18) have identified a key role for the carboxyl terminus of the
359-amino acid AT1A receptor in Ang II- stimulated
endocytosis. Within the 54-amino acid carboxyl terminus, two separate
regions appear to be important: a membrane-proximal site (15) and a
more distal serine- and threonine-rich region (14, 15, 18). Using
serial truncation and alanine point mutations, Hunyady et
al. (14) highlighted the importance of the sequence
Thr332-Lys333-Met334-Ser335-Thr336-Leu337-Ser338
within the AT1A receptor carboxyl terminus for endocytosis,
in particular the so-called "STL" motif of Ser335,
Thr336, and Leu337. The preponderance of serine
and threonine residues suggests that phosphorylation may play an
important role in AT1A receptor endocytosis. While the
AT1A receptor is phosphorylated after Ang II stimulation
(19), the identification of phosphorylated residues and the relevance
to receptor function are lacking.
The substitution of phosphate-accepting serine and threonine residues with acidic amino acids (glutamic or aspartic acid) is a mutational strategy for imitating the phosphorylation of proteins (20, 21, 22, 23, 24, 25). The carboxyl side chain of these acidic amino acids is dissociated (COO-) at physiological pH and presumably mimics the negative charge conferred by phosphorylation (PO32-). In addition, the negative charge of glutamic and aspartic acid is hard-coded and therefore not reversible by phosphatases, an attribute that also provides insight into the potential requirement for dephosphorylation at these sites. Examples where such mimicry has provided a clear correlation between phosphorylation status and phosphoprotein function include the enzymes, isocitrate dehydrogenase (20), p56lck (21), and mitogen-activated protein kinase-activated protein kinase 2 (22); the hormone, PRL (23); and the transcription factors, NF-IL6/LAP (24) and p53 (25).
In the present study, we used this phosphorylation-mimicking mutational strategy, in combination with the direct determination and quantification of 32P incorporation into immunoprecipitated AT1A receptors, to investigate the contribution of AT1A receptor carboxyl terminus phosphorylation to Ang II-induced AT1A receptor endocytosis.
| RESULTS |
|---|
|
|
|---|
1
nM) and coupled to a transient elevation of intracellular
calcium when stimulated with Ang II (data not shown). Hence, epitope
tagging and/or mutation within the carboxyl terminus does not affect
the capacity of the AT1A receptor to attain a high-affinity
conformation and efficiently couple to signal transduction pathways,
confirming previous observations (14, 15, 17).
|
|
|
|
Given that phosphorylation occurs in the region between residues
Lys333 and Asp343, we next investigated the
degree of phosphorylation of a receptor mutant in which four
carboxyl-terminal threonine and serine residues (Thr332,
Ser335, Thr336, and Ser338) were
mutated to alanine. The importance of this region of the carboxyl
terminus in the endocytosis process has been previously reported (14).
As shown in Fig. 4
, this quadruple mutant (NHA-TSTS/A) displayed a
decrease in both basal and agonist-stimulated phosphorylation,
identifying this region as important for both internalization and
phosphorylation and, moreover, linking these processes
circumstantially.
Both the Agonist, Ang II, and the Antagonist,
Sar1Ile8-Ang II,
Phosphorylate the AT1A Receptor
We and others have previously reported (13, 27) that the Ang II
receptor antagonist, Sar1Ile8-Ang II, promotes
robust internalization of the AT1A receptor to a level only
slightly lower than that observed with the agonist, Ang II. To compare
the coincidence of internalization and phosphorylation, we determine
the capacity of Sar1Ile8-Ang II to induce
phosphorylation of the AT1A receptor. As shown in Fig. 5
, Sar1Ile8-Ang
II stimulation in five separate experiments caused a significant
increase (paired t-test, P = 0.01) in
AT1A receptor phosphorylation, which was approximately 50%
of the Ang II-stimulated 32P incorporation into the
immunoprecipitated NHA-AT1A receptor.
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
For immunoprecipitation and phosphorylation experiments, we have used
epitope-tagging of the AT1A receptor. In our hands, the
commercially available antibodies raised against AT1A
receptor peptides do not immunoprecipitate the receptor. Notably, the
first credible evidence for immunoprecipitation and phosphorylation of
AT1A receptors required epitope tagging, as described by
Oppermann et al. (19). Our identification of a broad (70 to
130 kDa) band on SDS-PAGE corresponding to the immunoprecipitated,
phosphorylated receptor is similar to the broad banding observed by
Oppermann et al. (19) and by Balmforth et al.
(28), the latter utilizing an N-terminal hexahistidine tag to purify
the phosphorylated receptor. We only observed the broad phosphorylated
band when the NHA-AT1A receptor expression construct was transfected
into CHO-K1 cells; this band was not seen when vector control or
nontagged AT1A receptor constructs were transfected,
indicating the validity of the epitope-tagging approach. Moreover, the
broad nature of the immunoprecipitated receptor, which suggests
extensive glycosylation, could be significantly reduced by
N-glycosidase F treatment. The AT1A receptor has
three putative N glycosylation consensus motifs (Asn4 at
the N terminus, and Asn176 and Asn188 in the
second extracellular loop), although one (Asn4) was
destroyed by mutation to allow efficient immunoprecipitation of the
epitope tag. The relative molecular mass of the deglycosylated band
(
43 kDa) approximates the theoretical mass of the AT1A
receptor protein deduced from the cloned receptor cDNA (26). Hence,
using the epitope-tagging approach, we are confident that we can detect
and phosphorylate the fully processed (glycosylated) AT1A
receptor.
Our identification of the carboxyl terminus as the site of AT1A receptor phosphorylation and the observed correlation of phosphorylation and internalization provide clues as to the mechanism of AT1A receptor endocytosis. A phosphorylated STL motif may serve to attract and/or bind components of the internalization machinery. Indeed, arrestin proteins, which are known to bind phosphorylated GPCRs, have been recently implicated in the internalization of GPCRs (29) and may function as adaptor proteins to link these receptors to the clathrin-coated pits (30). Interestingly, Zhang et al. (31) reported that, in contrast to the ß2-adrenergic receptor, the AT1A receptor expressed in HEK 293 cells appears capable of internalizing independently of ß-arrestins, leading to speculation that different GPCRs may utilize distinct endocytotic pathways. Whether proteins other than the arrestins can bind to the phosphorylated AT1A carboxyl terminus and participate in the endocytotic process remains to be determined. Alternatively, phosphorylation of the AT1A receptor may promote endocytosis via a conformational change that exposes cryptic motifs, or maintains a conformation, in other parts of the receptor. For example, regions other than residues 332338 of the carboxyl terminus have been shown previously to be important for AT1A receptor internalization (i.e. more proximal regions of the carboxyl terminus (15) and the N-terminal portion of the third cytoplasmic loop (16, 32)). Certainly, reversible phosphorylation or the incorporation of acidic amino acids into proteins is a potent stimulus for the folding and unfolding of polypeptide chains in vitro (33).
Our data, using various truncations of the AT1A receptor, suggest phosphorylation at several sites within the carboxyl terminus. The cytoplasmic tail of the AT1A receptor contains 13 serine/threonine residues that are likely targets for phosphorylation by both GPCR kinases (GRKs) and second messenger-activated protein kinases. In their study, Oppermann et al. (19) demonstrated that the AT1A receptor is phosphorylated in an agonist-, time-, and dose-dependent manner and was phosphorylated (predominantly on unidentified serine residues) by both specific GRKs and by the general protein kinase [protein kinase C (PKC)], in response to Ang II stimulation. Phosphorylation was biphasic: early by GRKs (t1/2 30 sec) and later by PKC (t1/2 3 min), and the early phosphorylation by GRKs, but not PKC, appeared responsible for rapid desensitization of receptor signaling. In contrast, Balmforth et al. (28) observed that PKC phosphorylates the AT1A receptor at low concentrations of Ang II and causes desensitization. While this disparity remains to be resolved, recent evidence indicates that the internalization of AT1 receptors occurs independently of PKC activation (and presumably phosphorylation of the receptor) after Ang II stimulation (34). We also have observed no effect of classical PKC inhibitors on AT1A receptor endocytosis (W. G. Thomas and K. M. Baker, unpublished), and hence, we propose that our acidic amino acid substitutions mimic the early GRK-mediated phosphorylation event. While GRK2 and GRK5 can phosphorylate the AT1A receptor (19), the identity of the specific GRK(s) that is recruited and stimulated to phosphorylate the AT1A receptor after Ang II stimulation is not clear. How this phosphorylation maximizes endocytosis remains to be determined, but studies aimed at investigating whether Ang II-activated AT1A receptors (both wild-type and mutants lacking phosphorylation sites) interact directly with previously identified components of the endocytotic machinery (e.g. the adaptin proteins of the AP-2 complex (35, 36, 37) or the arrestin proteins (29, 30) are required. The platform provided by the present study, with respect to immunoprecipitation of wild-type and carboxyl-terminally mutated AT1A receptors, makes these experiments tenable.
Accumulating evidence suggests a general role for phosphorylation in the endocytosis of GPCRs. Agonist-stimulated GPCRs are phosphorylated by a family of specific, serine/threonine-directed kinases, termed GRKs. Overexpression of GRK2-GRK6 (38, 39), but not GRK 1 (39), was able to phosphorylate and rescue the endocytosis of a mutant ß2-adrenergic receptor (Y326A), defective in its ability to internalize. Internalization was also rescued by overexpression of ß-arrestins (proteins that bind phosphorylated GPCRs), a response that was enhanced by concomitant overexpression of GRK2 (29). The endocytosis of m2 muscarinic acetylcholine receptors is also enhanced by overexpression of GRK2 and suppressed by coexpression of a dominant-negative mutant of GRK2 (40). While Pals-Rylaarsdam et al. (41) could not demonstrate an effect of overexpression of a dominant-negative GRK2 on internalization of m2 muscarinic acetylcholine receptors, when m2 muscarinic receptors were constructed with deletions in the serine/threonine-rich third cytoplasmic loop, these mutants were not phosphorylated in response to agonist and displayed reduced endocytosis. In recent studies, an association between phosphorylation of the carboxyl terminus and internalization has been reported for other GPCRs, including receptors for glucagon (42), LH/CG (43), gastrin-releasing peptide (44), chemoattractants (45, 46), cholecystokinin (47), GLP-1 (48), N-formyl peptide (49), C5a anaphylatoxin (50), and somatostatin (51).
In general agreement with these studies, our direct phosphorylation
data, as well as the capacity to rescue endocytosis with acidic amino
acid substitutions within the 332338 region of the AT1A
receptor carboxyl terminus, suggest a phosphorylation of the STL motif,
which confers a negative charge and permits maximal internalization.
Interestingly, phosphorylation of serine/threonine residues also
contributes to the endocytosis of other receptors. For example, the
internalization of CD3-
chain, a subunit of the T cell receptor,
and gp130, the transducing protein of the interleukin-6 receptor
complex, both involve the phosphorylation of a crucial serine residue
close to a dileucine internalization motif (52, 53). This
phosphorylation allegedly mediates a conformational change in the
receptor to expose internalization motifs. Phosphorylation of
serine/threonine residues may also contribute to the internalization of
the epidermal growth factor receptor (54, 55). For CD4, a T
cell-surface antigen, serine/threonine phosphorylation of its carboxyl
terminus serves to dissociate the protein kinase p56lck
(56), allowing components of the endocytotic machinery to gain access
to endocytotic motifs. Altogether, these data suggest an important, and
perhaps universal, role for serine/threonine phosphorylation in the
facilitation of endocytosis.
Although important, phosphorylation of the AT1A receptor carboxyl terminus appears not to be the sole driving force for endocytosis. First, when all four putative phosphorylation sites within the STL motif were mutated to alanine (TSTS/A), some endocytosis was still observed, although at a markedly reduced rate and extent. Second, a maximal rate of AT1A receptor endocytosis is observed at concentrations of Ang II (<0.5 nM) that cause minimal phosphorylation of the receptor (19). Third, mutant AT1A receptors (D74E and Y302A), which are uncoupled from G protein activation, and presumably poorly phosphorylated in response to agonist, display an almost wild-type degree of internalization (13, 15, 57). Fourth, as reported by Hunyady et al. (14), mutation of Leu337 within the STL motif inhibits internalization as effectively as mutation of the neighboring serine and threonine. While this observation argues that determinants other than phosphorylation are required, it may simply mean that efficient phosphorylation of the adjacent serine and threonine residues requires the presence of the downstream leucine. Finally, when the carboxyl terminus of the noninternalizing AT2 receptor is replaced with the carboxyl terminus of the rapidly internalizing AT1A receptor, the resulting AT2/AT1A receptor chimera fails to internalize after Ang II stimulation (W. G. Thomas and K. M. Baker, unpublished observations). Hence, the AT1A receptor carboxyl terminus and its phosphorylation, although important for maximizing internalization, is apparently not sufficient to direct endocytosis.
Potentially, one of the most interesting results of the present study
is the observation that the peptide antagonist,
Sar1Ile8-Ang II, causes phosphorylation of the
AT1A receptor. Previous studies have shown that
Sar1Ile8-Ang II also induces strong
internalization of AT1 receptors (13, 27), and we interpret
this to mean that receptor phosphorylation and internalization are
closely associated. Based on the hypothesis that receptors can
isomerize between two or more discrete functional conformations (58),
these data suggest that Sar1Ile8-Ang II
stabilizes a conformation in the AT1A receptor that favors
phosphorylation and internalization, but is incapable of activating the
-subunit of the heterotrimeric G protein to initiate signaling.
While it may seem counterintuitive that an antagonist would select for
active receptor forms that internalize or are phosphorylated, there are
precedents, including a recent paper by Roettger et al.
(59), who demonstrated that a cholecystokinin antagonist, developed as
a probe for receptor function, caused robust receptor internalization.
Thus, the Sar1Ile8-Ang II antagonist and
variations on it may prove very useful tools in dissecting multiple
receptor conformations and perhaps elucidating the molecular switches
subsequent to receptor-ligand interaction that allow activation and
regulation of AT1A receptors.
In conclusion, phosphorylation of the AT1A receptor carboxyl-terminal STL motif appears important for enhancing endocytosis and, taken together with recent studies (29, 30, 31, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56), more broadly implicates receptor phosphorylation as a permissive/required event for the internalization of other receptors. Future experiments will address whether AT1A receptors interact directly with components of the endocytotic machinery, which part(s) of the AT1A receptor constitute the internalization motif, what conformational changes occur after AT1A receptor activation to permit endocytosis, and how phosphorylation status impinges on these processes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-MEM, OPTI-MEM, FBS, okadaic acid, and lipofectAMINE were obtained
from Life Technologies, Inc. (Gaithersburg, MD). Protein A-agarose was
purchased from Boehringer Mannheim (Indianapolis, IN). The 12CA5
monoclonal antibody was affinity purified and supplied by Dr. Jun Ping
Liu (Baker Medical Research Institute). All other chemicals were from
Sigma Chemical Co. (St. Louis, MO) or Fisher Scientific Co.
(Pittsburgh, PA).
Receptor Constructs, Epitope-Tagging, and Mutagenesis
The cloning and incorporation of the full-length rat
AT1A receptor (coding for 359 amino acids) into the pRc/CMV
vector (pRc2A/AT1A) has been described previously (60). To
allow immunoprecipitation of the rat AT1A receptor, we
inserted the influenza HA epitope (YPYDVPDYA), which is recognized by
the monoclonal antibody 12CA5, at the N terminus of the receptor
(pRcNHA/AT1A). This construct was engineered by a PCR-based
method (Ex-site mutagenesis, Stratagene) using pRc2A/AT1A
as template and two 5'-phosphorylated primers. The sense primer
was:
5'-GTCCCAGACTACGCCGCCCTTGACTCTTCTGCTGAAG ATGGTATC-3'.
The underlined sequence corresponds to nucleotides 4 to 33 (coding for Ala2 to Ile10) of the rat AT1A receptor. The gap in the underline indicates an introduced mutation (A to G) that changes Asn4 to Asp to prevent glycosylation at this consensus site and steric hindrance of antibody binding, as suggested by Oppermann et al. (19). The antisense primer was: 5'-GTCGTATGGGTACCCCATGGTGGCCTGGGTTGAGTTG GTCTCAGACAC-3'.
The underlined sequence corresponds to nucleotides -33 to -10 within the 5'-untranslated region of the rat AT1A receptor. A silent KpnI site (shown in italic) was introduced to assist in the selection of mutants, and an optimal ribosome-binding site was incorporated around the initiator methionine sequence (shown in bold). Positive clones were sequenced to confirm these mutations as well as the integrity of the entire coding region. Thus, the new N-terminal sequence generated by this construct was: M1GYPYDVPDYAA2L3D4S5 (superscripts indicate the position of original residues).
Three truncated versions of this N-terminally tagged receptor
(NHA-AT1A) were generated to shorten the receptor carboxyl terminus by
either 16 amino acids (NHA-TD343, to represent an N-terminal tagged
receptor truncated after Asp343), 26 amino acids
(NHA-TK333, to represent an N-terminal tagged receptor truncated after
Lys333), or 34 amino acids (NHA-TK325, to represent an
N-terminal tagged receptor truncated after Lys325) (see
Fig. 1
). A quadruple mutant containing alanine substitutions for
Thr332, Ser335, Thr336, and
Ser338 was also generated (see below). These various
truncations and point mutations were first introduced into the
wild-type AT1A receptor expression vector
(pRc2A/AT1A) using the Ex-site method and confirmed by
sequencing. BbsI restriction fragments, containing the
respective mutated regions, were subcloned into the BbsI
sites of pRcNHA/AT1A to yield the N-terminally tagged
truncated AT1A receptor constructs.
A variety of single- and multiple-point mutations (see Fig. 1
) were
also introduced into the wild-type (nontagged) AT1A
receptor by Ex-site mutagenesis. Each PCR mutation reaction used a
common oligonucleotide primer (CMPR1) together with a selective
oligonucleotide primer carrying the desired mutation(s). A silent
XhoI restriction site was incorporated into the common
primer to assist with the screening for mutated clones, and all
oligonucleotides were 5'-phosphorylated during synthesis. The
oligonucleotide sequences 5' to 3' were: CMPR1
AGACAGGCTCGAGTGGGACTTGGCC T332E
GAGAAAATGAGCACGCTTTCTTACCGG S335D
ACGAAAATGGACACGCTTTCTTACCGG T336E
ACGAAAATGAGCGAGCTTTCTTACCGG S338D
ACGAAAATGAGCACGCTTGATTACCGGCCTTCG
T332A/S335A/T336A/S338A
GCGAAAATGGCCGCGCTTGCTTACCGGCCTTCGGAT T332E/S335D/T336E/S338D
GAGAAAATGGACGAGCTTGATTACCGGCCTTCGGAT
S335A/T336A ACGAAAATGGCCGCGCTTTCTTACCGG
S335D/T336E ACGAAAATGGACGAGCTTTCTTACCGG
The silent XhoI restriction site is italicized in CMPR1, and nucleotides mutated from the wild-type sequence are underlined. The rationale for replacing serines and threonines with aspartic acid and glutamic acid residues, respectively, was to closely match the carbon side chains of the original residues, while still imparting a negative charge.
The major 6.7-kb PCR bands, representing the linearized mutated plasmids, were in-gel purified and blunt-end ligated to circularize and reform the expression plasmids. After transformation into XL1-blue E. coli and plating on LB/ampicillin plates, plasmid-bearing colonies were screened for the relevant silent restriction site. Positive clones for each receptor mutant were sequenced to confirm the entire coding region and the relevant nucleotide mutations.
Transient Transfection of CHO-K1 Cells
CHO-K1 cells were maintained in
-MEM containing horse serum
(10%), penicillin G sodium (100 µg/ml), streptomycin sulfate (100
µg/ml), and amphotericin B (0.25 µg/ml) (complete media), seeded in
either 6-well or 12-well culture dishes, and grown in complete media
until 7080% confluent. Cells washed in serum-free OPTI-MEM were
transfected in triplicate with 1 µg/well (6-well plates) or 0.6
µg/well (12-well plates) of either wild-type, epitope-tagged, or
mutated AT1A receptor plasmid DNA using lipofectAMINE, as
previously described (15). After a 4-h exposure to DNA/lipofectAMINE
complexes in OPTI-MEM, cells were washed and grown in complete media
for 48 h.
Phosphorylation and Immunoprecipitation of
AT1A Receptors
Phosphorylation and immunoprecipitation experiments were
performed on 48-h posttransfection cultures of CHO-K1 cells, in 12-well
culture plates, using a procedure synthesized from Oppermann et
al. (19) and Hipkin et al. (61). Wells of transfected
cells were washed with 1 ml of phosphate-free DMEM and incubated in 0.4
ml of the same medium containing 32Pi (200
µCi/ml) for 2 h at 37 C. Okadaic acid (0.2 µM) was
added 10 min before stimulation by the agonist, Ang II (1
µM, 5 min, 37 C), or the antagonist,
Sar1Ile8Ang II (1 µM). After
stimulation, cells were placed on ice, washed twice with 1 ml/well of
HBSS (4 C), and solubilized by the addition of 0.3 ml/well of lysis
buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 4
mg/ml n-dodecyl ß-maltoside, 0.5 mg/ml cholesteryl
hemisuccinate, 1 mM phenylmethylsulfonyl fluoride, 5
µg/ml leupeptin, 1 µg/ml aprotinin, 1 µg/ml pepstatin) containing
10 mM sodium fluoride, 10 mM sodium
pyrophosphate, and 0.5 µM okadaic acid. Plates were
rocked at 4 C for 1 h, and the detergent lysates were harvested
and clarified by centrifugation (14,000 x g for 15
min). The cell lysates (300 µl containing 500 µg of cellular
protein) were precleared by the addition of 10 µl of protein
A-agarose and 10 µl of 6% BSA and gentle mixing at 4 C for 2 h.
After removal of the protein A-agarose beads by centrifugation, the
precleared lysates were incubated with 1.6 µg of affinity-purified
12CA5 antibody and 20 µl of protein A-agarose and agitated overnight
at 4 C to immunoprecipitate the epitope-tagged AT1A
receptors. The immunoprecipitates were washed twice with ice-cold
washing buffer 1 (50 mM Tris-HCl, pH 7.5, 150
mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 1
mM phenylmethylsulfonyl fluoride, 5 µg/ml leupeptin, 1
µg/ml aprotinin, 1 µg/ml pepstatin), twice with washing buffer 2
(50 mM Tris-HCl, pH 7.5, 500 mM NaCl, 0.1%
Triton X-100, 0.05% sodium deoxycholate) and once with washing buffer
3 (50 mM Tris-HCl, pH 7.5, 0.1% Triton X-100, 0.05%
sodium deoxycholate). After resuspension in 55 µl of a urea-based SDS
sample buffer [62.5 mM Tris-HCl, pH 6.8, 2% SDS, 10%
ß-mercaptoethanol (vol/vol), 6 M urea, 20% glycerol],
the immunoprecipates were heated at 60 C for 15 min and resolved by
10% SDS-PAGE. Gels were fixed and dried before exposing against Biomax
MS film (Eastman Kodak, Rochester, NY) and a BIOMAX TranScreen-HE (High
Energy) intensifying screen (Kodak) at -80 C for 620 h. After
autoradiography, gels were placed against Fuji type BAS-IIIs
phosphoimaging plates and exposed overnight. Plates were subsequently
read in a FUJIX Bio-imaging Analyzer BAS 1000 (Fuji Photo Film Co.,
Ltd., Berthold Australia, Melbourne), and the data were analyzed
using MacBAS v1.0 software.
In all experiments, the quantification of phosphorylation data was normalized for surface receptor expression by performing Ang II radioreceptor-binding assays, as previously described (15). Binding assays were performed at 4 C, to prevent receptor internalization, on 12-well plates transfected in parallel to those used for phosphorylation assays.
Determination of Receptor Internalization
Internalization kinetic assays were performed as previously
described (15). Briefly, transfected CHO-K1 cells in 6-well or 12-well
plates were exposed to [125I]Ang II (0.4 nM)
in receptor-binding buffer for 2, 5, 10, and 20 min at 37 C.
Internalization was terminated, and unbound [125I]Ang II
was removed by chilling the plates on ice and washing the wells
extensively with ice-cold receptor binding buffer. Bound
[125I]Ang II, associated with noninternalized receptors
at the cell surface, was removed by acid washing, while internalized
[125I]Ang II-receptor complexes were harvested with a
0.25 M NaOH/0.25% SDS solution. An index of
internalization was obtained by expressing the acid-insensitive
radioactivity (internalized receptors) as a percentage of the total
binding (acid-insensitive + acid-sensitive) for each well. The
percentage of internalized receptors was plotted against time and
analyzed as one-phase exponential associations using GraphPad Prism
(GraphPad Software Inc., San Diego, CA). The t1/2
(in min) to reach a Ymax value (in %) was determined for
each association curve.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by the Geisinger Clinic Foundation, by NIH Grant HL-44883 (to K.M.B.), by a National Health and Medical Research Council of Australia Institute Block Grant to the Baker Medical Research Institute, and a National Heart Foundation of Australia Grant-in-Aid to W.G.T. During the course of this work, W.G.T. was the recipient of a C.J. Martin Fellowship from the National Health and Medical Research Council of Australia. K.M.B. is an Established Investigator of the American Heart Association.
Received for publication May 4, 1998. Revision received June 18, 1998. Accepted for publication July 6, 1998.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. E. Callander, W. G. Thomas, and R. A. D. Bathgate Prolonged RXFP1 and RXFP2 signaling can be explained by poor internalization and a lack of {beta}-arrestin recruitment Am J Physiol Cell Physiol, May 1, 2009; 296(5): C1058 - C1066. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mogi, M. Iwai, and M. Horiuchi Emerging Concepts of Regulation of Angiotensin II Receptors: New Players and Targets for Traditional Receptors Arterioscler Thromb Vasc Biol, December 1, 2007; 27(12): 2532 - 2539. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Oliveira, C. M. Costa-Neto, C. R. Nakaie, S. Schreier, S. I. Shimuta, and A. C. M. Paiva The Angiotensin II AT1 Receptor Structure-Activity Correlations in the Light of Rhodopsin Structure Physiol Rev, April 1, 2007; 87(2): 565 - 592. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Allen, J. K. Dosanjh, M. Erac, S. Dassanayake, R. D. Hannan, and W. G. Thomas Expression of Constitutively Active Angiotensin Receptors in the Rostral Ventrolateral Medulla Increases Blood Pressure Hypertension, June 1, 2006; 47(6): 1054 - 1061. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Dinh, H. Qian, R. Seeber, E. Lim, K. Pfleger, K. A. Eidne, and W. G. Thomas Helix I of {beta}-Arrestin Is Involved in Postendocytic Trafficking but Is Not Required for Membrane Translocation, Receptor Binding, and Internalization Mol. Pharmacol., February 1, 2005; 67(2): 375 - 382. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ronacher, N. Matsiliza, N. Nkwanyana, A. J. Pawson, T. Adam, C. A. Flanagan, R. P. Millar, and A. A. Katz Serine Residues 338 and 339 in the Carboxyl-Terminal Tail of the Type II Gonadotropin-Releasing Hormone Receptor Are Critical for {beta}-Arrestin-Independent Internalization Endocrinology, October 1, 2004; 145(10): 4480 - 4488. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. SPAT and L. HUNYADY Control of Aldosterone Secretion: A Model for Convergence in Cellular Signaling Pathways Physiol Rev, April 1, 2004; 84(2): 489 - 539. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. N. Becker, H.-f. Cheng, T. G. Hammond, and R. C. Harris The Type 1 Angiotensin II Receptor Tail Affects Receptor Targeting, Internalization, and Membrane Fusion Properties Mol. Pharmacol., February 1, 2004; 65(2): 362 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Wyse, I. A. Prior, H. Qian, I. C. Morrow, S. Nixon, C. Muncke, T. V. Kurzchalia, W. G. Thomas, R. G. Parton, and J. F. Hancock Caveolin Interacts with the Angiotensin II Type 1 Receptor during Exocytic Transport but Not at the Plasma Membrane J. Biol. Chem., June 20, 2003; 278(26): 23738 - 23746. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Gaborik, G. Jagadeesh, M. Zhang, A. Spat, K. J. Catt, and L. Hunyady The Role of a Conserved Region of the Second Intracellular Loop in AT1 Angiotensin Receptor Activation and Signaling Endocrinology, June 1, 2003; 144(6): 2220 - 2228. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Holloway, H. Qian, L. Pipolo, J. Ziogas, S.-i. Miura, S. Karnik, B. R. Southwell, M. J. Lew, and W. G. Thomas Side-Chain Substitutions within Angiotensin II Reveal Different Requirements for Signaling, Internalization, and Phosphorylation of Type 1A Angiotensin Receptors Mol. Pharmacol., April 1, 2002; 61(4): 768 - 777. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. H. Shah, J. Alberto Olivares-Reyes, A. Yesilkaya, and K. J. Catt Independence of Angiotensin II-Induced MAP Kinase Activation from Angiotensin Type 1 Receptor Internalization in Clone 9 Hepatocytes Mol. Endocrinol., March 1, 2002; 16(3): 610 - 620. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Thomas, Y. Brandenburger, D. J. Autelitano, T. Pham, H. Qian, and R. D. Hannan Adenoviral-Directed Expression of the Type 1A Angiotensin Receptor Promotes Cardiomyocyte Hypertrophy via Transactivation of the Epidermal Growth Factor Receptor Circ. Res., February 8, 2002; 90(2): 135 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Berry, R. Touyz, A. F. Dominiczak, R. C. Webb, and D. G. Johns Angiotensin receptors: signaling, vascular pathophysiology, and interactions with ceramide Am J Physiol Heart Circ Physiol, December 1, 2001; 281(6): H2337 - H2365. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qian, L. Pipolo, and W. G. Thomas Association of {beta}-Arrestin 1 with the Type 1A Angiotensin II Receptor Involves Phosphorylation of the Receptor Carboxyl Terminus and Correlates with Receptor Internalization Mol. Endocrinol., October 1, 2001; 15(10): 1706 - 1719. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Thibonnier, C. L. Plesnicher, K. Berrada, and L. Berti-Mattera Role of the human V1 vasopressin receptor COOH terminus in internalization and mitogenic signal transduction Am J Physiol Endocrinol Metab, July 1, 2001; 281(1): E81 - E92. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hunyady, Z. Gaborik, G. Vauquelin, and K. J Catt Review: Structural requirements for signalling and regulation of AT1-receptors Journal of Renin-Angiotensin-Aldosterone System, March 1, 2001; 2(1_suppl): S16 - S23. [PDF] |
||||
![]() |
Z. Gáborik, M. Szaszák, L. Szidonya, B. Balla, S. Paku, K. J. Catt, A. J. L. Clark, and L. Hunyady {beta}-Arrestin- and Dynamin-Dependent Endocytosis of the AT1 Angiotensin Receptor Mol. Pharmacol., February 1, 2001; 59(2): 239 - 247. [Abstract] [Full Text] |
||||
![]() |
P. H. Anborgh, J. L. Seachrist, L. B. Dale, and S. S. G. Ferguson Receptor/{beta}-Arrestin Complex Formation and the Differential Trafficking and Resensitization of {beta}2-Adrenergic and Angiotensin II Type 1A Receptors Mol. Endocrinol., December 1, 2000; 14(12): 2040 - 2053. [Abstract] [Full Text] |
||||
![]() |
J. A. Olivares-Reyes, S. Jayadev, L. Hunyady, K. J. Catt, and R. D. Smith Homologous and Heterologous Phosphorylation of the AT2 Angiotensin Receptor by Protein Kinase C Mol. Pharmacol., November 1, 2000; 58(5): 1156 - 1161. [Abstract] [Full Text] |
||||
![]() |
J. Ibrahim, A. D. Hughes, and P. S. Sever Action of Angiotensin II on DNA Synthesis by Human Saphenous Vein in Organ Culture Hypertension, November 1, 2000; 36(5): 917 - 921. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. de Gasparo, K. J. Catt, T. Inagami, J. W. Wright, and Th. Unger International Union of Pharmacology. XXIII. The Angiotensin II Receptors Pharmacol. Rev., September 1, 2000; 52(3): 415 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Thomas, H. Qian, C.-S. Chang, and S. Karnik Agonist-induced Phosphorylation of the Angiotensin II (AT1A) Receptor Requires Generation of a Conformation That Is Distinct from the Inositol Phosphate-signaling State J. Biol. Chem., January 28, 2000; 275(4): 2893 - 2900. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Hanyaloglu, M. Vrecl, K. M. Kroeger, L. E. C. Miles, H. Qian, W. G. Thomas, and K. A. Eidne Casein Kinase II Sites in the Intracellular C-terminal Domain of the Thyrotropin-releasing Hormone Receptor and Chimeric Gonadotropin-releasing Hormone Receptors Contribute to beta -Arrestin-dependent Internalization J. Biol. Chem., May 18, 2001; 276(21): 18066 - 18074. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Olivares-Reyes, R. D. Smith, L. Hunyady, B. H. Shah, and K. J. Catt Agonist-induced Signaling, Desensitization, and Internalization of a Phosphorylation-deficient AT1A Angiotensin Receptor J. Biol. Chem., October 5, 2001; 276(41): 37761 - 37768. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Thomas, Y. Brandenburger, D. J. Autelitano, T. Pham, H. Qian, and R. D. Hannan Adenoviral-Directed Expression of the Type 1A Angiotensin Receptor Promotes Cardiomyocyte Hypertrophy via Transactivation of the Epidermal Growth Factor Receptor Circ. Res., February 8, 2002; 90(2): 135 - 142. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |