help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, W. G.
Right arrow Articles by Baker, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, W. G.
Right arrow Articles by Baker, K. M.
Molecular Endocrinology 12 (10): 1513-1524
Copyright © 1998 by The Endocrine Society

Phosphorylation of the Angiotensin II (AT1A) Receptor Carboxyl Terminus: A Role in Receptor Endocytosis

Walter G. Thomas, Thomas J. Motel, Christopher E. Kule, Vijay Karoor and Kenneth M. Baker

Weis Center for Research (T.J.M., C.E.K., V.K., K.M.B.) Geisinger Clinic Danville, Pennsylvania 17822
Baker Medical Research Institute (W.G.T.) Melbourne 8008, Australia


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The molecular mechanism of angiotensin II type I receptor (AT1) endocytosis is obscure, although the identification of an important serine/threonine rich region (Thr332Lys333Met334Ser335Thr336Leu337Ser338) within the carboxyl terminus of the AT1A receptor subtype suggests that phosphorylation may be involved. In this study, we examined the phosphorylation and internalization of full-length AT1A receptors and compared this to receptors with truncations and mutations of the carboxyl terminus. Epitope-tagged full-length AT1A receptors, when transiently transfected in Chinese hamster ovary (CHO)-K1 cells, displayed a basal level of phosphorylation that was significantly enhanced by angiotensin II (Ang II) stimulation. Phosphorylation of AT1A receptors was progressively reduced by serial truncation of the carboxyl terminus, and truncation to Lys325, which removed the last 34 amino acids, almost completely inhibited Ang II-stimulated 32P incorporation into the AT1A receptor. To investigate the correlation between receptor phosphorylation and endocytosis, an epitope-tagged mutant receptor was produced, in which the carboxyl-terminal residues, Thr332, Ser335, Thr336, and Ser338, previously identified as important for receptor internalization, were substituted with alanine. Compared with the wild-type receptor, this mutant displayed a clear reduction in Ang II-stimulated phosphorylation. Such a correlation was further strengthened by the novel observation that the Ang II peptide antagonist, Sar1Ile8-Ang II, which paradoxically causes internalization of wild-type AT1A receptors, also promoted their phosphorylation. In an attempt to directly relate phosphorylation of the carboxyl terminus to endocytosis, the internalization kinetics of wild-type AT1A receptors and receptors mutated within the Thr332-Ser338 region were compared. The four putative phosphorylation sites (Thr332, Ser335, Thr336, and Ser338) were substituted with either neutral [alanine (A)] or acidic amino acids [glutamic acid (E) and aspartic acid (D)], the former to prevent phosphorylation and the latter to reproduce the acidic charge created by phosphorylation. Wild-type AT1A receptors, expressed in Chinese hamster ovary cells, rapidly internalized after Ang II stimulation [t1/2 2.3 min; maximal level of internalization (Ymax) 78.2%], as did mutant receptors carrying single acidic substitutions (T332E, t1/2 2.7 min, Ymax 76.3%; S335D, t1/2 2.4 min, Ymax 76.7%; T336E, t1/2 2.5 min, Ymax 78.2%; S338D, t1/2 2.6 min, Ymax 78.4%). While acidic amino acid substitutions may simply be not as structurally disruptive as alanine mutations, we interpret the tolerance of a negative charge in this region as suggestive that phosphorylation may permit maximal internalization. Substitution of all four residues to alanine produced a receptor with markedly reduced internalization kinetics (T332A/S335A/T336A/S338A, t1/2 10.1 min, Ymax 47.9%), while endocytosis was significantly rescued in the corresponding quadruple acidic mutant (T332E/S335D/T336E/S338D, t1/2 6.4 min, Ymax 53.4%). Double mutation of S335 and T336 to alanine also diminished the rate and extent of endocytosis (S335A/T336A, 3.9 min, Ymax 69.3%), while the analogous double acidic mutant displayed wild type-like endocytotic parameters (S335D/T336E, t1/2 2.6 min, Ymax 77.5%). Based on the apparent rescue of internalization by acidic amino acid substitutions in a region that we have identified as a site of Ang II-induced phosphorylation, we conclude that maximal endocytosis of the AT1A receptor requires phosphorylation within this serine/threonine-rich segment of the carboxyl terminus.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell surface receptors internalize predominantly via aggregation within the plasma membrane and recruitment into clathrin-coated pits and vesicles. This process, which can occur constitutively or as a consequence of ligand activation, serves to internalize a variety of hormones, growth factors, Igs, and nutrients (for review, see Refs. 1, 2, 3, 4, 5, 6). Receptor-mediated endocytosis is also exploited by viruses for infection and can be manipulated to introduce foreign DNA and cytotoxins into cells (7, 8, 9). While the mechanism of endocytosis is not fully understood, the targeting of receptors to clathrin-coated pits presumably requires recognition of amino acid sequences, or motifs, within the cytoplasmic domains of internalizing receptors by the endocytotic machinery. For ligand-activated receptor endocytosis, implicitly, such motifs must be inaccessible to the internalization machinery, or nonfunctional, before stimulation of the receptor by ligand. Interaction of receptor and ligand then causes an allosteric change or modification of the receptor that reveals or creates a functional motif.

The octapeptide hormone angiotensin II (Ang II) binds and activates receptors on the plasma membrane of target cells, thereby mediating a variety of important cardiovascular, homeostatic, and neuroendocrine functions (10). Pharmacological and molecular cloning studies have identified two major types of Ang II receptor, classified as AT1 and AT2, with subtypes of AT1, termed AT1A and AT1B (11, 12). AT1A, AT1B, and AT2 receptors are members of the seven-transmembrane guanyl nucleotide-binding protein (G protein) receptor (GPCR) superfamily, and the AT1A receptor mediates most of the classical biological actions of Ang II. AT1A and AT1B (13, 14, 15), but not AT2 (14), receptors rapidly internalize (t1/2 ~ 2 min) after Ang II stimulation, although the significance of this disparity is unclear. Internalization of Ang II.AT1A receptor complexes is presumably via a clathrin-mediated pathway (13) and, based on pharmacological and mutational analyses (13, 16), the processes that govern AT1A receptor endocytosis overlap, but are distinct from, those that couple these receptors to activation of heterotrimeric G proteins. Previous mutagenesis studies by us (15, 17) and others (14, 18) have identified a key role for the carboxyl terminus of the 359-amino acid AT1A receptor in Ang II- stimulated endocytosis. Within the 54-amino acid carboxyl terminus, two separate regions appear to be important: a membrane-proximal site (15) and a more distal serine- and threonine-rich region (14, 15, 18). Using serial truncation and alanine point mutations, Hunyady et al. (14) highlighted the importance of the sequence Thr332-Lys333-Met334-Ser335-Thr336-Leu337-Ser338 within the AT1A receptor carboxyl terminus for endocytosis, in particular the so-called "STL" motif of Ser335, Thr336, and Leu337. The preponderance of serine and threonine residues suggests that phosphorylation may play an important role in AT1A receptor endocytosis. While the AT1A receptor is phosphorylated after Ang II stimulation (19), the identification of phosphorylated residues and the relevance to receptor function are lacking.

The substitution of phosphate-accepting serine and threonine residues with acidic amino acids (glutamic or aspartic acid) is a mutational strategy for imitating the phosphorylation of proteins (20, 21, 22, 23, 24, 25). The carboxyl side chain of these acidic amino acids is dissociated (COO-) at physiological pH and presumably mimics the negative charge conferred by phosphorylation (PO32-). In addition, the negative charge of glutamic and aspartic acid is hard-coded and therefore not reversible by phosphatases, an attribute that also provides insight into the potential requirement for dephosphorylation at these sites. Examples where such mimicry has provided a clear correlation between phosphorylation status and phosphoprotein function include the enzymes, isocitrate dehydrogenase (20), p56lck (21), and mitogen-activated protein kinase-activated protein kinase 2 (22); the hormone, PRL (23); and the transcription factors, NF-IL6/LAP (24) and p53 (25).

In the present study, we used this phosphorylation-mimicking mutational strategy, in combination with the direct determination and quantification of 32P incorporation into immunoprecipitated AT1A receptors, to investigate the contribution of AT1A receptor carboxyl terminus phosphorylation to Ang II-induced AT1A receptor endocytosis.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Expression of Wild-Type, Epitope-Tagged, and Carboxyl-Terminal Mutated AT1A Receptors in Chinese Hamster Ovary (CHO)-K1 Cells
Wild-type and epitope-tagged AT1A receptor cDNA or various truncations and single and multiple mutations within the AT1A carboxyl terminus (see Fig. 1Go) were incorporated into the pRc/CMV mammalian expression vector and transiently expressed in CHO-K1 cells, which lack endogenous Ang II receptors. All constructs displayed an equivalent and high level of receptor expression (Bmax, 1800–2200 fmol/mg protein), as measured by competition binding of [125I]Ang II, with the exception of the most truncated mutants (TK333 and TK325) (see Fig. 3Go, middle panel). Competition binding assays revealed that the wild-type, epitope-tagged, and mutated AT1A receptors all displayed high affinity for Ang II (Kd,~ 1 nM) and coupled to a transient elevation of intracellular calcium when stimulated with Ang II (data not shown). Hence, epitope tagging and/or mutation within the carboxyl terminus does not affect the capacity of the AT1A receptor to attain a high-affinity conformation and efficiently couple to signal transduction pathways, confirming previous observations (14, 15, 17).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 1. Epitope Tagging of the AT1A Receptor and Mutagenesis of the Carboxyl Terminus

Shown in the upper portion is the plasma membrane-localized, seven-transmembrane AT1A receptor and its cytoplasmic carboxyl-terminal region. For phosphorylation and immunoprecipitation experiments, the HA epitope (YPYDVPDYA) was engineered into the N terminus of the AT1A receptor, and this construct was used as a template to produce truncated mutants that terminate after D343, K333, and K325, as indicated by the solid bars. Cytoplasmic serine and threonines are shown as solid circles. The region of the carboxyl terminus (residues 332–338), previously identified as important for endocytosis (14 ), is shown in detail; the presence of serine and threonine residues is indicative of modification by phosphorylation/dephosphorylation. Mutations introduced into this carboxyl-terminal region of the AT1A receptor are indicated; residues mutated from the wild type are highlighted by reverse lettering (white on black). To mimic the negative charge generated by phosphorylation, threonine (T) and serine (S) residues were substituted, either singly or in combination, with the acidic amino acids glutamic acid (E) and aspartic acid (D), respectively. Corresponding mutations to the neutral amino acid alanine (A) were created to produce AT1A receptors incapable of phosphorylation in this region. For convenience, the quadruple substitution mutants, T332E/S335D/T336E/S338D and T332A/S335A/T336A/S338A, are represented by the abbreviations, TSTS/ED and TSTS/A, respectively.

 


View larger version (33K):
[in this window]
[in a new window]
 
Figure 3. The Carboxyl Terminus Is the Site of AT1A Receptor Phosphorylation

CHO-K1 cells were transiently transfected with NHA-AT1A or epitope-tagged receptors truncated to remove 16 amino acids (NHA-TD343), 26 amino acids (NHA-TK333), or 34 amino acids (NHA-TK325) from the carboxyl terminus. After 32P-loading, cells were treated with or without Ang II (1 µM, 5 min) and then solubilized and receptor protein immunoprecipitated and analyzed by SDS-PAGE followed by autoradiography (top panel) or phosphoimaging (bottom panel). Phosphoimaging data were normalized for receptor expression as measured by RIA on plates transfected in parallel (middle panel). Data are means ± SD from four separate experiments.

 
Phosphorylation of Epitope-Tagged AT1A Receptors
To examine the phosphorylation of the AT1A receptor, CHO-K1 cells transiently expressing the N-terminally epitope-tagged AT1A receptor (NHA-AT1A) were treated with the agonist, Ang II, and then solubilized, and the immunoprecipitated receptor protein was analyzed by SDS-PAGE. As shown in Fig. 2AGo, a broad band was observed that ranged between 70 and 130 kDa, which displayed both basal and Ang II-stimulated phosphorylation. Phosphoimager analysis revealed an approximate doubling in 32P incorporation after Ang II treatment (see Fig. 3Go). In contrast, no phosphorylation was observed when the empty expression vector was transfected in place of the epitope-tagged receptor (Fig. 2AGo and see Fig. 4Go) or when nontagged wild-type AT1A receptor was transfected (not shown). Based on a predicted mol wt of 40,889 deduced from the cloned rat AT1A cDNA (26), the broad nature (70–130 kDa) of the phosphorylated band suggested considerable N glycosylation of the receptor protein. As shown in Fig. 2BGo, N-glycosidase F treatment of the AT1A receptor immunoprecipitates resulted in a reduction in the apparent molecular mass of the phosphorylated receptor from the broad band at 70–130 kDa to a sharper band migrating at approximately 43 kDa, close to the theoretical molecular mass. Since a consensus N glycosylation site in the N terminus (Asn4) of the AT1A receptor, near the introduced hemagglutinin antigen (HA) epitope, was mutated to prevent steric hindrance during immunoprecipitation (see Materials and Methods), indicates that the receptor is extensively glycosylated in CHO-K1 cells, presumably on one or both of the two remaining consensus sites within extracellular loop 2.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. Agonist-Induced Phosphorylation of the Epitope-Tagged AT1A Receptor

(A) CHO-K1 cells were transiently transfected with either empty vector (pRc/CMV) or the NHA-tagged AT1A receptor. After loading with 32P, cells were stimulated with Ang II (1 µM for 5 min) as indicated and then detergent solubilized. Receptor protein was immunoprecipitated with 12CA5 monoclonal antibody and protein A agarose and analyzed by SDS-PAGE and phosphoimaging. (B) Phosphorylated NHA-AT1A receptor immunoprecipitates were treated with or without 0.5 U of N-glycosidase F for 30 min at 37 C and analyzed by SDS-PAGE and autoradiography. Arrow indicates deglycosylated receptor migrating at a relative molecular mass of approximately 43 kDa. Additional intermediate bands may represent partial deglycosylation of the AT1A receptor or coimmunoprecipitated phosphoproteins.

 


View larger version (32K):
[in this window]
[in a new window]
 
Figure 4. The Carboxyl-Terminal Region Encompassing the STL Internalization Motif Is a Site for AT1A Receptor Phosphorylation

CHO-K1 cells, transiently transfected with NHA-AT1A or an epitope-tagged receptor mutant (Thr332, Ser335, Thr336 and Ser338 to alanine), were 32P-loaded, treated with agonist as indicated, immunoprecipitated, and phosphorylation quantified as described in Materials and Methods. The upper panel shows a representative phosphoimage and the lower panel shows the mean ± SD of phosphoimaging data from seven experiments normalized for cell surface receptor expression, as indicated in the middle panel.

 
Ang II-Induced AT1A Phosphorylation Occurs within the Carboxyl Terminus
The 54-amino acid AT1A receptor carboxyl terminus contains 13 serine and threonine residues that are suggestive of multiple phosphorylation. To investigate phosphorylation within this region, we generated truncated versions of the NHA-AT1A receptor to remove either 16 amino acids (NHA-TD343), 26 amino acids (NHA-TK333), or 34 amino acids (NHA-TK325) from the carboxyl terminus. After transient transfection of these receptors into CHO-K1 cells, we determined the level of basal and agonist-stimulated phosphorylation. In all experiments, quantitative phosphoimaging data were normalized for receptor expression at the cell surface, which was determined by transfecting parallel plates of CHO-K1 cells with the various constructs and performing radioreceptor-binding assays. As shown in Fig. 3Go (upper panel), sequential truncation of the carboxyl terminus caused a serial decrease in both the constitutive as well as Ang II-stimulated level of 32P incorporated into the AT1A receptor. This indicates that phosphorylation occurs at multiple sites throughout the cytoplasmic tail. When the amount of phosphorylation was quantified and normalized for receptor expression, approximately 40% of Ang II-stimulated phosphorylation was decreased by truncation to Asp343, while about 80% was abolished by truncation after Lys333, which suggests that a significant proportion of phosphorylation occurs in the region between Lys333 and Asp343. Almost complete inhibition of AT1A receptor phosphorylation was observed in the receptor truncated to Lys325 to remove all carboxyl-terminal serine and threonines.

Given that phosphorylation occurs in the region between residues Lys333 and Asp343, we next investigated the degree of phosphorylation of a receptor mutant in which four carboxyl-terminal threonine and serine residues (Thr332, Ser335, Thr336, and Ser338) were mutated to alanine. The importance of this region of the carboxyl terminus in the endocytosis process has been previously reported (14). As shown in Fig. 4Go, this quadruple mutant (NHA-TSTS/A) displayed a decrease in both basal and agonist-stimulated phosphorylation, identifying this region as important for both internalization and phosphorylation and, moreover, linking these processes circumstantially.

Both the Agonist, Ang II, and the Antagonist, Sar1Ile8-Ang II, Phosphorylate the AT1A Receptor
We and others have previously reported (13, 27) that the Ang II receptor antagonist, Sar1Ile8-Ang II, promotes robust internalization of the AT1A receptor to a level only slightly lower than that observed with the agonist, Ang II. To compare the coincidence of internalization and phosphorylation, we determine the capacity of Sar1Ile8-Ang II to induce phosphorylation of the AT1A receptor. As shown in Fig. 5Go, Sar1Ile8-Ang II stimulation in five separate experiments caused a significant increase (paired t-test, P = 0.01) in AT1A receptor phosphorylation, which was approximately 50% of the Ang II-stimulated 32P incorporation into the immunoprecipitated NHA-AT1A receptor.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. Phosphorylation of the AT1A Receptor by the Antagonist, Sar1Ile8-Ang II

CHO-K1 cells transiently transfected with NHA-AT1A were stimulated with agonist, Ang II, or the antagonist, Sar1Ile8-Ang II, as indicated. Receptor protein was immunoprecipitated and subjected to SDS-PAGE followed by phosphoimaging. Phosphoimaging data are the means ± SD from five experiments.

 
Effect of Single Acidic Amino Acid Substitutions on AT1A Receptor Endocytosis
Single alanine substitutions for Thr332, Ser335, Thr336, or Ser338 results in reduction (10–45%) in the rate of AT1A receptor internalization (14). To investigate whether an acidic environment within this region (indicative of phosphorylation) is required for maximal endocytosis, we compared internalization kinetics for wild-type receptors and mutants carrying single acidic amino acid substitutions (Fig. 6Go). Wild-type AT1A receptor-expressing CHO-K1 cells internalized with a rate (t1/2 2.3 min) and maximal level (Ymax 78.2%) comparable to previous determinations (14, 15). Interestingly, the internalization kinetic parameters for the single acidic mutants (T332E, t1/2 2.7 min, Ymax 76.3%; S335D, t1/2 2.4 min, Ymax 76.7%; T336E, t1/2 2.5 min, Ymax 78.2%; S338D, t1/2 2.6 min, Ymax 78.4%) were indistinguishable from that of the wild-type AT1A receptor. Thus, the introduction of an acidic charge within this region (Thr332 to Ser338) does not inhibit AT1A receptor endocytosis, consistent with the idea that phosphorylation of one or more of these serines or threonines contributes to maximal internalization.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 6. Internalization Kinetic Curves for Wild-Type and Single-Point Mutants, T332E, S335D, T336E, and S338D

CHO-K1 cells were transiently transfected with plasmid DNA encoding wild-type and mutated AT1A receptors, and 48 h later internalization assays were performed. After exposure to [125I]Ang II for 2–20 min at 37 C, surface-bound and internalized [125I]Ang II were determined by acid washing as described in Materials and Methods. An index of internalization was calculated by expressing the internalized radioactivity (acid-resistant) as a percentage of the total binding (acid-resistant plus acid-susceptible). Data are means ± SD for four experiments performed in duplicate.

 
Effect of Multiple Neutral and Acidic Amino Acid Substitutions on AT1A Receptor Endocytosis
To investigate this possibility further, we generated multiple point mutations within the 332–338 region of the AT1A receptor carboxyl terminus. All four putative phosphate acceptor residues were mutated to alanine (T332A/S335A/T336A/S338A; TSTS/A) to engineer an AT1A receptor incapable of phosphorylation at this site or collectively to either aspartic and glutamic acid (T332E/S335D/T336E/S338D; TSTS/ED) to simulate hyperphosphorylation in this region. Ang II internalization kinetics for CHO-K1 cells expressing these quadruple mutants were compared with the wild-type AT1A receptor (Fig. 7Go). As shown in Fig. 7Go, mutation of all four serine and threonine residues to alanine markedly slowed the rate (t1/2 10.1 min) of internalization compared with wild type (t1/2 2.3 min) and reduced the maximal achievable internalization (Ymax 47.9% vs. wild type 78.2%). In the corresponding multiple acidic mutant, the rate (t1/2 6.4 min) was intermediate between the wild-type and the alanine mutant, and the maximal level of internalization (Ymax 53.4%) was slightly increased compared with the quadruple alanine mutant.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. Comparison of Endocytosis for Wild-Type AT1A Receptors and the Quadruple Mutants TSTS/A and TSTS/ED

Internalization kinetics for CHO-K1 cells transiently expressing wild-type (solid circles), T332A/S335A/T336A/S338A (TSTS/A, open squares), and T332E/S335D/T336E/S338D (TSTS/ED, solid squares) AT1A receptors were determined as described in the legend to Fig. 3Go. Data are the means ± SD from three separate experiments performed in duplicate.

 
Although the internalization kinetics of the quadruple acidic mutant (TSTS/ED) were reduced compared with the wild-type receptor, the enhanced rate and degree of internalization for receptors carrying acidic substitutions over those with alanine mutations predicts that phosphorylation is required for maximal endocytosis. Given the crucial role attributed to the so-called "STL" motif (Ser335-Thr336-Leu337) in AT1A receptor internalization (14), we next investigated the effect of double mutations specifically at residues Ser335 and Thr336. Figure 8Go illustrates the internalization kinetics for the wild-type AT1A receptor, the double alanine mutant (S335A/T336A), and the double acidic amino acid mutant (S335D/T336E). Compared with the wild-type (t1/2 2.3 min and Ymax 78.2%), the S335A/T336A mutant displayed a reduced rate and maximal level of internalization (t1/2 3.9 min, Ymax 69.3%) while the double acidic mutant (S335D/T336E) internalized with parameters (t1/2 2.6 min, Ymax 77.5%) comparable to the wild type. These observations indicate that a phosphorylation event within the STL motif enhances AT1A receptor endocytosis.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 8. Reduced Internalization of the S335A/T336A Mutant and Recovery in the Corresponding Acidic Mutant, S335D/T336E

Internalization kinetics for CHO-K1 cells transiently expressing wild-type (solid circles), S335A/T336A (open squares), and S335D/T336E (solid squares) AT1A receptors were determined as described in the legend to Fig. 3Go. Data are the means ± SD from three separate experiments performed in duplicate.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The present studies demonstrate, for the first time, that the carboxyl terminus of the AT1A receptor is the major site of both basal and Ang II-stimulated phosphorylation. The carboxyl terminus is apparently phosphorylated at multiple sites, although the majority of phosphorylation occurred on residues distal to Lys333. Specifically, we identified significant phosphorylation within a region (Thr332-Ser338) previously associated with receptor internalization. We also observed that the Ang II peptide antagonist, Sar1Ile8-Ang II, which causes robust AT1A receptor internalization (13, 27), was able to promote phosphorylation of the AT1A receptor, thereby strengthening the correlation between receptor endocytosis and phosphorylation. Finally, using a gain-of-function mutational strategy to mimic the phosphorylation of serine and threonine residues, we report evidence that phosphorylation of the carboxyl-terminal STL motif (14) enhances AT1A receptor internalization.

For immunoprecipitation and phosphorylation experiments, we have used epitope-tagging of the AT1A receptor. In our hands, the commercially available antibodies raised against AT1A receptor peptides do not immunoprecipitate the receptor. Notably, the first credible evidence for immunoprecipitation and phosphorylation of AT1A receptors required epitope tagging, as described by Oppermann et al. (19). Our identification of a broad (70 to 130 kDa) band on SDS-PAGE corresponding to the immunoprecipitated, phosphorylated receptor is similar to the broad banding observed by Oppermann et al. (19) and by Balmforth et al. (28), the latter utilizing an N-terminal hexahistidine tag to purify the phosphorylated receptor. We only observed the broad phosphorylated band when the NHA-AT1A receptor expression construct was transfected into CHO-K1 cells; this band was not seen when vector control or nontagged AT1A receptor constructs were transfected, indicating the validity of the epitope-tagging approach. Moreover, the broad nature of the immunoprecipitated receptor, which suggests extensive glycosylation, could be significantly reduced by N-glycosidase F treatment. The AT1A receptor has three putative N glycosylation consensus motifs (Asn4 at the N terminus, and Asn176 and Asn188 in the second extracellular loop), although one (Asn4) was destroyed by mutation to allow efficient immunoprecipitation of the epitope tag. The relative molecular mass of the deglycosylated band (~43 kDa) approximates the theoretical mass of the AT1A receptor protein deduced from the cloned receptor cDNA (26). Hence, using the epitope-tagging approach, we are confident that we can detect and phosphorylate the fully processed (glycosylated) AT1A receptor.

Our identification of the carboxyl terminus as the site of AT1A receptor phosphorylation and the observed correlation of phosphorylation and internalization provide clues as to the mechanism of AT1A receptor endocytosis. A phosphorylated STL motif may serve to attract and/or bind components of the internalization machinery. Indeed, arrestin proteins, which are known to bind phosphorylated GPCRs, have been recently implicated in the internalization of GPCRs (29) and may function as adaptor proteins to link these receptors to the clathrin-coated pits (30). Interestingly, Zhang et al. (31) reported that, in contrast to the ß2-adrenergic receptor, the AT1A receptor expressed in HEK 293 cells appears capable of internalizing independently of ß-arrestins, leading to speculation that different GPCRs may utilize distinct endocytotic pathways. Whether proteins other than the arrestins can bind to the phosphorylated AT1A carboxyl terminus and participate in the endocytotic process remains to be determined. Alternatively, phosphorylation of the AT1A receptor may promote endocytosis via a conformational change that exposes cryptic motifs, or maintains a conformation, in other parts of the receptor. For example, regions other than residues 332–338 of the carboxyl terminus have been shown previously to be important for AT1A receptor internalization (i.e. more proximal regions of the carboxyl terminus (15) and the N-terminal portion of the third cytoplasmic loop (16, 32)). Certainly, reversible phosphorylation or the incorporation of acidic amino acids into proteins is a potent stimulus for the folding and unfolding of polypeptide chains in vitro (33).

Our data, using various truncations of the AT1A receptor, suggest phosphorylation at several sites within the carboxyl terminus. The cytoplasmic tail of the AT1A receptor contains 13 serine/threonine residues that are likely targets for phosphorylation by both GPCR kinases (GRKs) and second messenger-activated protein kinases. In their study, Oppermann et al. (19) demonstrated that the AT1A receptor is phosphorylated in an agonist-, time-, and dose-dependent manner and was phosphorylated (predominantly on unidentified serine residues) by both specific GRKs and by the general protein kinase [protein kinase C (PKC)], in response to Ang II stimulation. Phosphorylation was biphasic: early by GRKs (t1/2 30 sec) and later by PKC (t1/2 3 min), and the early phosphorylation by GRKs, but not PKC, appeared responsible for rapid desensitization of receptor signaling. In contrast, Balmforth et al. (28) observed that PKC phosphorylates the AT1A receptor at low concentrations of Ang II and causes desensitization. While this disparity remains to be resolved, recent evidence indicates that the internalization of AT1 receptors occurs independently of PKC activation (and presumably phosphorylation of the receptor) after Ang II stimulation (34). We also have observed no effect of classical PKC inhibitors on AT1A receptor endocytosis (W. G. Thomas and K. M. Baker, unpublished), and hence, we propose that our acidic amino acid substitutions mimic the early GRK-mediated phosphorylation event. While GRK2 and GRK5 can phosphorylate the AT1A receptor (19), the identity of the specific GRK(s) that is recruited and stimulated to phosphorylate the AT1A receptor after Ang II stimulation is not clear. How this phosphorylation maximizes endocytosis remains to be determined, but studies aimed at investigating whether Ang II-activated AT1A receptors (both wild-type and mutants lacking phosphorylation sites) interact directly with previously identified components of the endocytotic machinery (e.g. the adaptin proteins of the AP-2 complex (35, 36, 37) or the arrestin proteins (29, 30) are required. The platform provided by the present study, with respect to immunoprecipitation of wild-type and carboxyl-terminally mutated AT1A receptors, makes these experiments tenable.

Accumulating evidence suggests a general role for phosphorylation in the endocytosis of GPCRs. Agonist-stimulated GPCRs are phosphorylated by a family of specific, serine/threonine-directed kinases, termed GRKs. Overexpression of GRK2-GRK6 (38, 39), but not GRK 1 (39), was able to phosphorylate and rescue the endocytosis of a mutant ß2-adrenergic receptor (Y326A), defective in its ability to internalize. Internalization was also rescued by overexpression of ß-arrestins (proteins that bind phosphorylated GPCRs), a response that was enhanced by concomitant overexpression of GRK2 (29). The endocytosis of m2 muscarinic acetylcholine receptors is also enhanced by overexpression of GRK2 and suppressed by coexpression of a dominant-negative mutant of GRK2 (40). While Pals-Rylaarsdam et al. (41) could not demonstrate an effect of overexpression of a dominant-negative GRK2 on internalization of m2 muscarinic acetylcholine receptors, when m2 muscarinic receptors were constructed with deletions in the serine/threonine-rich third cytoplasmic loop, these mutants were not phosphorylated in response to agonist and displayed reduced endocytosis. In recent studies, an association between phosphorylation of the carboxyl terminus and internalization has been reported for other GPCRs, including receptors for glucagon (42), LH/CG (43), gastrin-releasing peptide (44), chemoattractants (45, 46), cholecystokinin (47), GLP-1 (48), N-formyl peptide (49), C5a anaphylatoxin (50), and somatostatin (51).

In general agreement with these studies, our direct phosphorylation data, as well as the capacity to rescue endocytosis with acidic amino acid substitutions within the 332–338 region of the AT1A receptor carboxyl terminus, suggest a phosphorylation of the STL motif, which confers a negative charge and permits maximal internalization. Interestingly, phosphorylation of serine/threonine residues also contributes to the endocytosis of other receptors. For example, the internalization of CD3-{gamma} chain, a subunit of the T cell receptor, and gp130, the transducing protein of the interleukin-6 receptor complex, both involve the phosphorylation of a crucial serine residue close to a dileucine internalization motif (52, 53). This phosphorylation allegedly mediates a conformational change in the receptor to expose internalization motifs. Phosphorylation of serine/threonine residues may also contribute to the internalization of the epidermal growth factor receptor (54, 55). For CD4, a T cell-surface antigen, serine/threonine phosphorylation of its carboxyl terminus serves to dissociate the protein kinase p56lck (56), allowing components of the endocytotic machinery to gain access to endocytotic motifs. Altogether, these data suggest an important, and perhaps universal, role for serine/threonine phosphorylation in the facilitation of endocytosis.

Although important, phosphorylation of the AT1A receptor carboxyl terminus appears not to be the sole driving force for endocytosis. First, when all four putative phosphorylation sites within the STL motif were mutated to alanine (TSTS/A), some endocytosis was still observed, although at a markedly reduced rate and extent. Second, a maximal rate of AT1A receptor endocytosis is observed at concentrations of Ang II (<0.5 nM) that cause minimal phosphorylation of the receptor (19). Third, mutant AT1A receptors (D74E and Y302A), which are uncoupled from G protein activation, and presumably poorly phosphorylated in response to agonist, display an almost wild-type degree of internalization (13, 15, 57). Fourth, as reported by Hunyady et al. (14), mutation of Leu337 within the STL motif inhibits internalization as effectively as mutation of the neighboring serine and threonine. While this observation argues that determinants other than phosphorylation are required, it may simply mean that efficient phosphorylation of the adjacent serine and threonine residues requires the presence of the downstream leucine. Finally, when the carboxyl terminus of the noninternalizing AT2 receptor is replaced with the carboxyl terminus of the rapidly internalizing AT1A receptor, the resulting AT2/AT1A receptor chimera fails to internalize after Ang II stimulation (W. G. Thomas and K. M. Baker, unpublished observations). Hence, the AT1A receptor carboxyl terminus and its phosphorylation, although important for maximizing internalization, is apparently not sufficient to direct endocytosis.

Potentially, one of the most interesting results of the present study is the observation that the peptide antagonist, Sar1Ile8-Ang II, causes phosphorylation of the AT1A receptor. Previous studies have shown that Sar1Ile8-Ang II also induces strong internalization of AT1 receptors (13, 27), and we interpret this to mean that receptor phosphorylation and internalization are closely associated. Based on the hypothesis that receptors can isomerize between two or more discrete functional conformations (58), these data suggest that Sar1Ile8-Ang II stabilizes a conformation in the AT1A receptor that favors phosphorylation and internalization, but is incapable of activating the {alpha}-subunit of the heterotrimeric G protein to initiate signaling. While it may seem counterintuitive that an antagonist would select for active receptor forms that internalize or are phosphorylated, there are precedents, including a recent paper by Roettger et al. (59), who demonstrated that a cholecystokinin antagonist, developed as a probe for receptor function, caused robust receptor internalization. Thus, the Sar1Ile8-Ang II antagonist and variations on it may prove very useful tools in dissecting multiple receptor conformations and perhaps elucidating the molecular switches subsequent to receptor-ligand interaction that allow activation and regulation of AT1A receptors.

In conclusion, phosphorylation of the AT1A receptor carboxyl-terminal STL motif appears important for enhancing endocytosis and, taken together with recent studies (29, 30, 31, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56), more broadly implicates receptor phosphorylation as a permissive/required event for the internalization of other receptors. Future experiments will address whether AT1A receptors interact directly with components of the endocytotic machinery, which part(s) of the AT1A receptor constitute the internalization motif, what conformational changes occur after AT1A receptor activation to permit endocytosis, and how phosphorylation status impinges on these processes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents and Cell Culture Materials
125I-Labeled Ang II (specific activity >2000 Ci/mmol) was obtained from DuPont NEN (Boston, MA). The Escherichia coli strain XL1-blue and the ExSite Mutagenesis kit were purchased from Stratagene (La Jolla, CA), and CHO-K1 cells were obtained from the American Type Culture Collection (Rockville, MD). DNA modifying enzymes were from Promega (Madison, WI), Sequenase 2.0 DNA sequencing kits were from US Biochemical Corp. (Cleveland, OH), and the pRc/CMV eukaryotic expression vector was from Invitrogen (San Diego, CA). 5'-Phosphorylated oligonucleotides were made using a DNA synthesizer or purchased from Bresatec (Thebarton, South Australia). {alpha}-MEM, OPTI-MEM, FBS, okadaic acid, and lipofectAMINE were obtained from Life Technologies, Inc. (Gaithersburg, MD). Protein A-agarose was purchased from Boehringer Mannheim (Indianapolis, IN). The 12CA5 monoclonal antibody was affinity purified and supplied by Dr. Jun Ping Liu (Baker Medical Research Institute). All other chemicals were from Sigma Chemical Co. (St. Louis, MO) or Fisher Scientific Co. (Pittsburgh, PA).

Receptor Constructs, Epitope-Tagging, and Mutagenesis
The cloning and incorporation of the full-length rat AT1A receptor (coding for 359 amino acids) into the pRc/CMV vector (pRc2A/AT1A) has been described previously (60). To allow immunoprecipitation of the rat AT1A receptor, we inserted the influenza HA epitope (YPYDVPDYA), which is recognized by the monoclonal antibody 12CA5, at the N terminus of the receptor (pRcNHA/AT1A). This construct was engineered by a PCR-based method (Ex-site mutagenesis, Stratagene) using pRc2A/AT1A as template and two 5'-phosphorylated primers. The sense primer was: 5'-GTCCCAGACTACGCCGCCCTTGACTCTTCTGCTGAAG ATGGTATC-3'.

The underlined sequence corresponds to nucleotides 4 to 33 (coding for Ala2 to Ile10) of the rat AT1A receptor. The gap in the underline indicates an introduced mutation (A to G) that changes Asn4 to Asp to prevent glycosylation at this consensus site and steric hindrance of antibody binding, as suggested by Oppermann et al. (19). The antisense primer was: 5'-GTCGTATGGGTACCCCATGGTGGCCTGGGTTGAGTTG GTCTCAGACAC-3'.

The underlined sequence corresponds to nucleotides -33 to -10 within the 5'-untranslated region of the rat AT1A receptor. A silent KpnI site (shown in italic) was introduced to assist in the selection of mutants, and an optimal ribosome-binding site was incorporated around the initiator methionine sequence (shown in bold). Positive clones were sequenced to confirm these mutations as well as the integrity of the entire coding region. Thus, the new N-terminal sequence generated by this construct was: M1GYPYDVPDYAA2L3D4S5 (superscripts indicate the position of original residues).

Three truncated versions of this N-terminally tagged receptor (NHA-AT1A) were generated to shorten the receptor carboxyl terminus by either 16 amino acids (NHA-TD343, to represent an N-terminal tagged receptor truncated after Asp343), 26 amino acids (NHA-TK333, to represent an N-terminal tagged receptor truncated after Lys333), or 34 amino acids (NHA-TK325, to represent an N-terminal tagged receptor truncated after Lys325) (see Fig. 1Go). A quadruple mutant containing alanine substitutions for Thr332, Ser335, Thr336, and Ser338 was also generated (see below). These various truncations and point mutations were first introduced into the wild-type AT1A receptor expression vector (pRc2A/AT1A) using the Ex-site method and confirmed by sequencing. BbsI restriction fragments, containing the respective mutated regions, were subcloned into the BbsI sites of pRcNHA/AT1A to yield the N-terminally tagged truncated AT1A receptor constructs.

A variety of single- and multiple-point mutations (see Fig. 1Go) were also introduced into the wild-type (nontagged) AT1A receptor by Ex-site mutagenesis. Each PCR mutation reaction used a common oligonucleotide primer (CMPR1) together with a selective oligonucleotide primer carrying the desired mutation(s). A silent XhoI restriction site was incorporated into the common primer to assist with the screening for mutated clones, and all oligonucleotides were 5'-phosphorylated during synthesis. The oligonucleotide sequences 5' to 3' were: CMPR1 AGACAGGCTCGAGTGGGACTTGGCC T332E GAGAAAATGAGCACGCTTTCTTACCGG S335D ACGAAAATGGACACGCTTTCTTACCGG T336E ACGAAAATGAGCGAGCTTTCTTACCGG S338D ACGAAAATGAGCACGCTTGATTACCGGCCTTCG T332A/S335A/T336A/S338A GCGAAAATGGCCGCGCTTGCTTACCGGCCTTCGGAT T332E/S335D/T336E/S338D GAGAAAATGGACGAGCTTGATTACCGGCCTTCGGAT S335A/T336A ACGAAAATGGCCGCGCTTTCTTACCGG S335D/T336E ACGAAAATGGACGAGCTTTCTTACCGG

The silent XhoI restriction site is italicized in CMPR1, and nucleotides mutated from the wild-type sequence are underlined. The rationale for replacing serines and threonines with aspartic acid and glutamic acid residues, respectively, was to closely match the carbon side chains of the original residues, while still imparting a negative charge.

The major 6.7-kb PCR bands, representing the linearized mutated plasmids, were in-gel purified and blunt-end ligated to circularize and reform the expression plasmids. After transformation into XL1-blue E. coli and plating on LB/ampicillin plates, plasmid-bearing colonies were screened for the relevant silent restriction site. Positive clones for each receptor mutant were sequenced to confirm the entire coding region and the relevant nucleotide mutations.

Transient Transfection of CHO-K1 Cells
CHO-K1 cells were maintained in {alpha}-MEM containing horse serum (10%), penicillin G sodium (100 µg/ml), streptomycin sulfate (100 µg/ml), and amphotericin B (0.25 µg/ml) (complete media), seeded in either 6-well or 12-well culture dishes, and grown in complete media until 70–80% confluent. Cells washed in serum-free OPTI-MEM were transfected in triplicate with 1 µg/well (6-well plates) or 0.6 µg/well (12-well plates) of either wild-type, epitope-tagged, or mutated AT1A receptor plasmid DNA using lipofectAMINE, as previously described (15). After a 4-h exposure to DNA/lipofectAMINE complexes in OPTI-MEM, cells were washed and grown in complete media for 48 h.

Phosphorylation and Immunoprecipitation of AT1A Receptors
Phosphorylation and immunoprecipitation experiments were performed on 48-h posttransfection cultures of CHO-K1 cells, in 12-well culture plates, using a procedure synthesized from Oppermann et al. (19) and Hipkin et al. (61). Wells of transfected cells were washed with 1 ml of phosphate-free DMEM and incubated in 0.4 ml of the same medium containing 32Pi (200 µCi/ml) for 2 h at 37 C. Okadaic acid (0.2 µM) was added 10 min before stimulation by the agonist, Ang II (1 µM, 5 min, 37 C), or the antagonist, Sar1Ile8Ang II (1 µM). After stimulation, cells were placed on ice, washed twice with 1 ml/well of HBSS (4 C), and solubilized by the addition of 0.3 ml/well of lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 4 mg/ml n-dodecyl ß-maltoside, 0.5 mg/ml cholesteryl hemisuccinate, 1 mM phenylmethylsulfonyl fluoride, 5 µg/ml leupeptin, 1 µg/ml aprotinin, 1 µg/ml pepstatin) containing 10 mM sodium fluoride, 10 mM sodium pyrophosphate, and 0.5 µM okadaic acid. Plates were rocked at 4 C for 1 h, and the detergent lysates were harvested and clarified by centrifugation (14,000 x g for 15 min). The cell lysates (300 µl containing 500 µg of cellular protein) were precleared by the addition of 10 µl of protein A-agarose and 10 µl of 6% BSA and gentle mixing at 4 C for 2 h. After removal of the protein A-agarose beads by centrifugation, the precleared lysates were incubated with 1.6 µg of affinity-purified 12CA5 antibody and 20 µl of protein A-agarose and agitated overnight at 4 C to immunoprecipitate the epitope-tagged AT1A receptors. The immunoprecipitates were washed twice with ice-cold washing buffer 1 (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 1 mM phenylmethylsulfonyl fluoride, 5 µg/ml leupeptin, 1 µg/ml aprotinin, 1 µg/ml pepstatin), twice with washing buffer 2 (50 mM Tris-HCl, pH 7.5, 500 mM NaCl, 0.1% Triton X-100, 0.05% sodium deoxycholate) and once with washing buffer 3 (50 mM Tris-HCl, pH 7.5, 0.1% Triton X-100, 0.05% sodium deoxycholate). After resuspension in 55 µl of a urea-based SDS sample buffer [62.5 mM Tris-HCl, pH 6.8, 2% SDS, 10% ß-mercaptoethanol (vol/vol), 6 M urea, 20% glycerol], the immunoprecipates were heated at 60 C for 15 min and resolved by 10% SDS-PAGE. Gels were fixed and dried before exposing against Biomax MS film (Eastman Kodak, Rochester, NY) and a BIOMAX TranScreen-HE (High Energy) intensifying screen (Kodak) at -80 C for 6–20 h. After autoradiography, gels were placed against Fuji type BAS-IIIs phosphoimaging plates and exposed overnight. Plates were subsequently read in a FUJIX Bio-imaging Analyzer BAS 1000 (Fuji Photo Film Co., Ltd., Berthold Australia, Melbourne), and the data were analyzed using MacBAS v1.0 software.

In all experiments, the quantification of phosphorylation data was normalized for surface receptor expression by performing Ang II radioreceptor-binding assays, as previously described (15). Binding assays were performed at 4 C, to prevent receptor internalization, on 12-well plates transfected in parallel to those used for phosphorylation assays.

Determination of Receptor Internalization
Internalization kinetic assays were performed as previously described (15). Briefly, transfected CHO-K1 cells in 6-well or 12-well plates were exposed to [125I]Ang II (0.4 nM) in receptor-binding buffer for 2, 5, 10, and 20 min at 37 C. Internalization was terminated, and unbound [125I]Ang II was removed by chilling the plates on ice and washing the wells extensively with ice-cold receptor binding buffer. Bound [125I]Ang II, associated with noninternalized receptors at the cell surface, was removed by acid washing, while internalized [125I]Ang II-receptor complexes were harvested with a 0.25 M NaOH/0.25% SDS solution. An index of internalization was obtained by expressing the acid-insensitive radioactivity (internalized receptors) as a percentage of the total binding (acid-insensitive + acid-sensitive) for each well. The percentage of internalized receptors was plotted against time and analyzed as one-phase exponential associations using GraphPad Prism (GraphPad Software Inc., San Diego, CA). The t1/2 (in min) to reach a Ymax value (in %) was determined for each association curve.


    ACKNOWLEDGMENTS
 
We are grateful to Dr. Jun-Ping Liu (Baker Medical Research Institute) for the supply of affinity-purified 12CA5 monoclonal antibody, to Ms. Kate Kully for photography, and to Ms. Luisa Pipolo for invaluable technical assistance.


    FOOTNOTES
 
Address requests for reprints to: Dr. Walter G. Thomas, c/o Baker Medical Research Institute, P.O. Box 6492, Melbourne 8008, Australia. E-mail walter.thomas{at}baker.edu.au

This work was supported by the Geisinger Clinic Foundation, by NIH Grant HL-44883 (to K.M.B.), by a National Health and Medical Research Council of Australia Institute Block Grant to the Baker Medical Research Institute, and a National Heart Foundation of Australia Grant-in-Aid to W.G.T. During the course of this work, W.G.T. was the recipient of a C.J. Martin Fellowship from the National Health and Medical Research Council of Australia. K.M.B. is an Established Investigator of the American Heart Association.

Received for publication May 4, 1998. Revision received June 18, 1998. Accepted for publication July 6, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Goldstein JL, Brown MS, Anderson RGW, Russel DW, Schneider WJ 1985 Receptor-mediated endocytosis: concepts emerging from the LDL receptor system. Annu Rev Cell Biol 1:1–39[CrossRef]
  2. Pearse BM, Robinson MS 1990 Clathrin, adaptors, and sorting. Annu Rev Cell Biol 6:151–171[CrossRef]
  3. Trowbridge IS 1991 Endocytosis and signals for internalization. Curr Opin Cell Biol 3:634–641[CrossRef][Medline]
  4. Smythe E, Warren G 1991 The mechanism of receptor-mediated endocytosis. Eur J Biochem 202:689–699[Medline]
  5. Vaux D 1992 The structure of an endocytosis signal. Trends Cell Biol 2:189–192[CrossRef][Medline]
  6. Sorkin A, Water CM 1993 Endocytosis of growth factor receptors. Bioessays 15:375–382[CrossRef][Medline]
  7. Michael SI, Curiel DT 1994 Strategies to achieve targeted gene delivery via the receptor-mediated endocytosis pathway. Gene Ther 1:223–232[Medline]
  8. Guy J, Drabek D, Antoniou M 1995 Delivery of DNA into mammalian cells by receptor-mediated endocytosis and gene therapy. Mol Biotechnol 3:237–248[Medline]
  9. Mukhopadhyay A, Mukhopadhyay B, Basu SK 1995 Circumvention of multidrug resistance in neoplastic cells through scavenger receptor mediated drug delivery. FEBS Lett 376:95–98[CrossRef][Medline]
  10. Robertson JIS, Nicholls MG (eds) 1993 The Renin-Angiotensin System: Biochemistry and Physiology. Gower Medical Publishing, London, vol 1
  11. de Gasparo M, Husain A, Alexander W, Catt KJ, Chiu AT, Drew M, Goodfriend T, Harding JW, Inagami T, Timmermans PBM WM 1995 Proposed update of angiotensin receptor nomenclature. Hypertension 25:924–927[Free Full Text]
  12. Sandberg K 1994 Structural analysis and regulation of angiotensin II receptors. Trends Endocrinol Metab 5:28–35
  13. Conchon S, Monnot C, Teutsch B, Corvol P, Clauser E 1994 Internalization of the rat AT1a and AT1b receptors: pharmacological and functional requirements. FEBS Lett 349:365–370[CrossRef][Medline]
  14. Hunyady L, Bor M, Balla T, Catt KJ 1994 Identification of a cytoplasmic Ser-Thr-Leu motif that determines agonist-induced internalization of the AT1 angiotensin receptor. J Biol Chem 269:31378–31382[Abstract/Free Full Text]
  15. Thomas WG, Baker KM, Motel TJ, Thekkumkara TJ 1995 Angiotensin II receptor endocytosis involves two distinct regions of the cytoplasmic tail. A role for residues on the hydrophobic face of a putative amphipathic helix. J Biol Chem 270:22153–22159[Abstract/Free Full Text]
  16. Hunyady L, Baukal AJ, Balla T, Catt KJ 1994 Independence of type I angiotensin II receptor endocytosis from G protein coupling and signal transduction. J Biol Chem 269:24798–24804[Abstract/Free Full Text]
  17. Thomas WG, Thekkumkara TJ, Motel TJ, Baker KM 1995 Stable expression of a truncated AT1A receptor in CHO-K1 cells. The carboxyl-terminal region directs agonist-induced internalization but not receptor signaling or desensitization. J Biol Chem 270:207–213[Abstract/Free Full Text]
  18. Balmforth AJ, Lee AJ, Bajaj BP, Dickinson CJ, Warburton P, Ball SG 1995 Functional domains of the C-terminus of the rat angiotensin AT1A receptor. Eur J Pharmacol 291:135–141[CrossRef][Medline]
  19. Oppermann M, Freedman NJ, Alexander RW, Lefkowitz RJ 1996 Phosphorylation of the type 1A angiotensin II receptor by G protein-coupled receptor kinases and protein kinase C. J Biol Chem 271:13266–13272[Abstract/Free Full Text]
  20. Dean AM, Koshland DE 1990 Electrostatic and steric contributions to regulation at the active site of isocitrate dehydrogenase. Science 249:1044–1046[Abstract/Free Full Text]
  21. Joung I, Kim T, Stolz LA, Payne G, Winkler DG, Walsh CT, Strominger JL, Shin J 1995 Modification of Ser59 in the unique N-terminal region of tyrosine kinase p56lck regulates specificity of its Src homology 2 domain. Proc Natl Acad Sci USA 92:5778–5782[Abstract/Free Full Text]
  22. Engel K, Shultz H, Martin F, Kotlyarov A, Hahn M, Heinemann U, Gaestel M 1995 Constitutive activation of mitogen-activated protein kinase-activated protein kinase 2 by mutation of phosphorylation sites and an A-helix motif. J Biol Chem 270:27213–27221[Abstract/Free Full Text]
  23. Maciejewski PM, Peterson FC, Anderson PJ, Brooks CL 1995 Mutation of serine 90 to glutamic acid mimics phosphorylation of bovine prolactin. J Biol Chem 270:27661–27665[Abstract/Free Full Text]
  24. Trautwein C, Caelles C, vanderGeer P, Hunter T, Karin M, Chojkier M 1993 Transactivation by NF-IL6/LAP is enhanced by phosphorylation of its activation domain. Nature 364:544–547[CrossRef][Medline]
  25. Mayr GA, Reed M, Wang P, Wang Y, Schwedes JF, Tegtmeyer P 1995 Serine phosphorylation in the NH2 terminus of p53 facilitates transactivation. Cancer Res 55:2410–2417[Abstract/Free Full Text]
  26. Murphy TJ, Alexander RW, Griendling KK, Runge MS, Bernstein KE 1991 Isolation of a cDNA encoding the vascular type-1 angiotensin II receptor. Nature 351:233–236[CrossRef][Medline]
  27. Thomas WG, Thekkumkara TJ, Baker KM 1996 Molecular mechanisms for angiotensin II (AT1A) receptor endocytosis. Clin Exp Pharmacol Physiol 23 [Suppl 3]:15–21
  28. Balmforth AJ, Shepherd FH, Warburton P, Ball SG 1997 Evidence of an important and direct role of protein kinase C in agonist-induced phosphorylation leading to desensitization of the angiotensin AT1A receptor. Br J Pharmacol 122:1469–1477[CrossRef][Medline]
  29. Ferguson SSG, Downey WE, Colapietro A-M, Barak LS, Menard L, Caron MG 1996 Role of beta-arrestin in mediating agonist-promoted G protein-coupled receptor internalization. Science 271:363–366[Abstract]
  30. Goodman OB, Krupnick JG, Santini F, Gurevich VV, Penn RB, Gagnon AW, Keen JH, Benovic JL 1996 ß-Arrestin acts as a clathrin adaptor in endocytosis of the ß2-adrenergic receptor. Nature 383:447–450[CrossRef][Medline]
  31. Zhang J, Ferguson SSG, Barak LS, Menard L, Caron MG 1996 Dynamin and ß-arrestin reveal distinct mechanisms for G protein-coupled receptor internalization. J Biol Chem 271:18302–18305[Abstract/Free Full Text]
  32. Hunyady L, Zhang M, Jagadeesh G, Bor M, Balla T, Catt KJ 1996 Dependence of agonist activation on a conserved apolar residue in the third intracellular loop of the AT1 angiotensin receptor. Proc Natl Acad Sci USA 93:10040–10045[Abstract/Free Full Text]
  33. Urry DW 1995 Elastic biomolecular machines. Sci Am 272:64–69
  34. Sasamura H, Hein L, Saruta T, Pratt RE 1997 Evidence for internalization of both type 1 angiotensin receptor subtypes (AT1a, AT1b) by a protein kinase C independent mechanism. Hypertens Res 20:295–300[Medline]
  35. Sorkin A, McKinsey T, Shih W, Kirchhausen T, Carpenter G 1995 Stoichiometric interaction of the epidermal growth factor receptor with the clathrin-associated protein complex AP-2. J Biol Chem 270:619–625[Abstract/Free Full Text]
  36. Nesterov A, Kurten RC, Gill GN 1995 Association of epidermal growth factor receptors with coated pit adaptins via a tyrosine phosphorylation-regulated mechanism. J Biol Chem 270:6320–6327[Abstract/Free Full Text]
  37. Sorkin A, Carpenter G 1993 Interaction of activated EGF receptors with coated pit adaptins. Science 261:612–615[Abstract/Free Full Text]
  38. Ferguson SSG, Menard L, Barak LS, Koch WJ, Colapietro A-M, Caron MG 1995 Role of phosphorylation in agonist-promoted beta 2-adrenergic receptor sequestration. Rescue of a sequestration-defective mutant receptor by beta ARK1. J Biol Chem 270:24782–24789[Abstract/Free Full Text]
  39. Menard L, Ferguson SSG, Barak LS, Bertrand L, Premont RT, Colapietro A-M, Lefkowitz RJ, Caron MG 1996 Members of the G protein-coupled receptor kinase family that phosphorylate the ß-adrenergic receptor facilitate sequestration. Biochemistry 35:4155–4160[CrossRef][Medline]
  40. Tsuga H, Kameyama K, Haga T, Kurose H, Nagao T 1994 Sequestration of muscarinic acetylcholine receptor m2 subtypes. Facilitation by G protein-coupled receptor kinase (GRK2) and attenuation by a dominant-negative mutant of GRK2. J Biol Chem 269:32522–32527[Abstract/Free Full Text]
  41. Pals-Rylaarsdam R, Xu Y, Witt-Enderby P, Benovic JL, Hosey MM 1995 Desensitization and internalization of the m2 muscarinic acetylcholine receptor are directed by independent mechanisms. J Biol Chem 270:29004–29011[Abstract/Free Full Text]
  42. Buggy JJ, Heurich RO, MacDougall M, Kelley KA, Livingston JN, Yoo-Warren H, Rossomando AJ 1997 Role of the glucagon receptor COOH-terminal domain in glucagon-mediated signaling and receptor internalization. Diabetes 46:1400–1405[Abstract]
  43. Ascoli M 1997 Molecular basis of the regulation of the lutropin/choriogonadotropin receptor. Biochem Soc Trans 25:1021–1026[Medline]
  44. Benya RV, Fathi Z, Battey JF, Jensen RT 1993 Serines and threonines in the gastrin-releasing peptide receptor carboxyl terminus mediate internalization. J Biol Chem 268:20285–20290[Abstract/Free Full Text]
  45. Kim JY, Soede RD, Schaap P, Valkema R, Borleis JA, Van Haastert PJ, Devreotes PN, Hereld D 1997 Phosphorylation of chemoattractant receptors is not essential for chemotaxis or termination of G-protein-mediated responses. J Biol Chem 272:27313–27318[Abstract/Free Full Text]
  46. Franci C, Gosling J, Tsou CL, Coughlin SR, Charo IF 1996 Phosphorylation by a G protein-coupled kinase inhibits signaling and promotes internalization of the monocyte chemoattractant protein-1 receptor. Critical role of carboxyl-tail serine/threonines in receptor function. J Immunol 157:5606–5612[Abstract]
  47. Pohl M, Silvente-Poirot S, Pisegna JR, Tarasova NI, Wank SA 1997 Ligand-induced internalization of cholecystokinin receptors. Demonstration of the importance of the carboxyl terminus for ligand-induced internalization of the rat cholecystokinin type B receptor but not the type A receptor. J Biol Chem 272:18179–18184[Abstract/Free Full Text]
  48. Widmann C, Dolci W, Thorens B 1997 Internalization and homologous desensitization of the GLP-1 receptor depend on phosphorylation of the receptor carboxyl tail at the same three sites. Mol Endocrinol 11:1094–1102[Abstract/Free Full Text]
  49. Hsu MH, Chiang SC, Ye RD, Prossnitz ER 1997 Phosphorylation of the N-formyl peptide receptor is required for receptor internalization but not chemotaxis. J Biol Chem 272:29426–29429[Abstract/Free Full Text]
  50. Naik N, Giannini E, Brouchon L, Boulay F 1997 Internalization and recycling of the C5a anaphylatoxin receptor: evidence that the agonist-mediated internalization is modulated by phosphorylation of the C-terminal domain. J Cell Sci 110:2381–2390[Abstract]
  51. Roth A, Kreienkamp HJ, Meyerhof W, Richter D 1997 Phosphorylation of four amino acid residues in the carboxyl terminus of the rat somatostatin receptor subtype 3 is crucial for its desensitization and internalization. J Biol Chem 272:23769–23774[Abstract/Free Full Text]
  52. Dietrich J, Hou X, Wegener A-M, Geisler C 1994 CD3 gamma contains a phosphoserine-dependent di-leucine motif involved in down-regulation of the T cell receptor. EMBO J 13:2156–2166[Medline]
  53. Dittrich E, Haft CR, Muys L, Heinrich PC, Graeve L 1996 A di-leucine motif and an upstream serine in the interleukin-6 (IL-6) signal transducer gp130 mediate ligand-induced endocytosis and down-regulation of the IL-6 receptor. J Biol Chem 271:5487–5494[Abstract/Free Full Text]
  54. Countaway JL, Nairn AC, Davis RJ 1992 Mechanism of desensitization of the epidermal growth factor receptor protein-tyrosine kinase. J Biol Chem 267:1129–1140[Abstract/Free Full Text]
  55. Nesterov A, Lysan S, Vdovina I, Nikolsky N, Fujita DJ 1994 Phosphorylation of the epidermal growth factor receptor during internalization in A-431 cells. Arch Biochem Biophys 313:351–359[CrossRef][Medline]
  56. Pelchen-Matthews A, Boulet I, Littman DR, Fagard R, Marsh M 1992 The protein tyrosine kinase p56lck inhibits CD4 endocytosis by preventing entry of CD4 into coated pits. J Biol Chem 117:279–290
  57. Hunyady L, Bor M, Baukal AJ, Balla T, Catt KJ 1995 A conserved NPLFY sequence contributes to agonist binding and signal transduction but is not an internalization signal for the type 1 angiotensin II receptor. J Biol Chem 270:16602–16609[Abstract/Free Full Text]
  58. Leff P, Scaramellini C, Law C, McKechnie K 1997 A three-state receptor model of agonist action. Trends Pharmacol Sci 18:355–362[Medline]
  59. Roettger BF, Ghanekar D, Rao R, Toledo C, Yingling J, Pinon D, Miller LJ 1997 Antagonist-stimulated internalization of the G protein-coupled cholecystokinin receptor. Mol Pharmacol 51:357–363[Abstract/Free Full Text]
  60. Thekkumkara TJ, Du J, Dostal DE, Motel TJ, Thomas WG, Baker KM 1995 Stable expression of a functional rat angiotensin II (AT1A) receptor in CHO-K1 cells: rapid desensitization by angiotensin II. Mol Cell Biochem 146:79–89[CrossRef][Medline]
  61. Hipkin RW, Friedman J, Clark RB, Eppler CM, Schnonbrunn A 1997 Agonist-induced desensitization, internalization and phosphorylation of the sst2A somatostatin receptor. J Biol Chem 272:13869–13876[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
G. E. Callander, W. G. Thomas, and R. A. D. Bathgate
Prolonged RXFP1 and RXFP2 signaling can be explained by poor internalization and a lack of {beta}-arrestin recruitment
Am J Physiol Cell Physiol, May 1, 2009; 296(5): C1058 - C1066.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Mogi, M. Iwai, and M. Horiuchi
Emerging Concepts of Regulation of Angiotensin II Receptors: New Players and Targets for Traditional Receptors
Arterioscler Thromb Vasc Biol, December 1, 2007; 27(12): 2532 - 2539.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
L. Oliveira, C. M. Costa-Neto, C. R. Nakaie, S. Schreier, S. I. Shimuta, and A. C. M. Paiva
The Angiotensin II AT1 Receptor Structure-Activity Correlations in the Light of Rhodopsin Structure
Physiol Rev, April 1, 2007; 87(2): 565 - 592.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. M. Allen, J. K. Dosanjh, M. Erac, S. Dassanayake, R. D. Hannan, and W. G. Thomas
Expression of Constitutively Active Angiotensin Receptors in the Rostral Ventrolateral Medulla Increases Blood Pressure
Hypertension, June 1, 2006; 47(6): 1054 - 1061.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. T. Dinh, H. Qian, R. Seeber, E. Lim, K. Pfleger, K. A. Eidne, and W. G. Thomas
Helix I of {beta}-Arrestin Is Involved in Postendocytic Trafficking but Is Not Required for Membrane Translocation, Receptor Binding, and Internalization
Mol. Pharmacol., February 1, 2005; 67(2): 375 - 382.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Ronacher, N. Matsiliza, N. Nkwanyana, A. J. Pawson, T. Adam, C. A. Flanagan, R. P. Millar, and A. A. Katz
Serine Residues 338 and 339 in the Carboxyl-Terminal Tail of the Type II Gonadotropin-Releasing Hormone Receptor Are Critical for {beta}-Arrestin-Independent Internalization
Endocrinology, October 1, 2004; 145(10): 4480 - 4488.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
A. SPAT and L. HUNYADY
Control of Aldosterone Secretion: A Model for Convergence in Cellular Signaling Pathways
Physiol Rev, April 1, 2004; 84(2): 489 - 539.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. N. Becker, H.-f. Cheng, T. G. Hammond, and R. C. Harris
The Type 1 Angiotensin II Receptor Tail Affects Receptor Targeting, Internalization, and Membrane Fusion Properties
Mol. Pharmacol., February 1, 2004; 65(2): 362 - 369.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. D. Wyse, I. A. Prior, H. Qian, I. C. Morrow, S. Nixon, C. Muncke, T. V. Kurzchalia, W. G. Thomas, R. G. Parton, and J. F. Hancock
Caveolin Interacts with the Angiotensin II Type 1 Receptor during Exocytic Transport but Not at the Plasma Membrane
J. Biol. Chem., June 20, 2003; 278(26): 23738 - 23746.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Z. Gaborik, G. Jagadeesh, M. Zhang, A. Spat, K. J. Catt, and L. Hunyady
The Role of a Conserved Region of the Second Intracellular Loop in AT1 Angiotensin Receptor Activation and Signaling
Endocrinology, June 1, 2003; 144(6): 2220 - 2228.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. C. Holloway, H. Qian, L. Pipolo, J. Ziogas, S.-i. Miura, S. Karnik, B. R. Southwell, M. J. Lew, and W. G. Thomas
Side-Chain Substitutions within Angiotensin II Reveal Different Requirements for Signaling, Internalization, and Phosphorylation of Type 1A Angiotensin Receptors
Mol. Pharmacol., April 1, 2002; 61(4): 768 - 777.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. H. Shah, J. Alberto Olivares-Reyes, A. Yesilkaya, and K. J. Catt
Independence of Angiotensin II-Induced MAP Kinase Activation from Angiotensin Type 1 Receptor Internalization in Clone 9 Hepatocytes
Mol. Endocrinol., March 1, 2002; 16(3): 610 - 620.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
W. G. Thomas, Y. Brandenburger, D. J. Autelitano, T. Pham, H. Qian, and R. D. Hannan
Adenoviral-Directed Expression of the Type 1A Angiotensin Receptor Promotes Cardiomyocyte Hypertrophy via Transactivation of the Epidermal Growth Factor Receptor
Circ. Res., February 8, 2002; 90(2): 135 - 142.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Berry, R. Touyz, A. F. Dominiczak, R. C. Webb, and D. G. Johns
Angiotensin receptors: signaling, vascular pathophysiology, and interactions with ceramide
Am J Physiol Heart Circ Physiol, December 1, 2001; 281(6): H2337 - H2365.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Qian, L. Pipolo, and W. G. Thomas
Association of {beta}-Arrestin 1 with the Type 1A Angiotensin II Receptor Involves Phosphorylation of the Receptor Carboxyl Terminus and Correlates with Receptor Internalization
Mol. Endocrinol., October 1, 2001; 15(10): 1706 - 1719.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Thibonnier, C. L. Plesnicher, K. Berrada, and L. Berti-Mattera
Role of the human V1 vasopressin receptor COOH terminus in internalization and mitogenic signal transduction
Am J Physiol Endocrinol Metab, July 1, 2001; 281(1): E81 - E92.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
L. Hunyady, Z. Gaborik, G. Vauquelin, and K. J Catt
Review: Structural requirements for signalling and regulation of AT1-receptors
Journal of Renin-Angiotensin-Aldosterone System, March 1, 2001; 2(1_suppl): S16 - S23.
[PDF]


Home page
Mol. Pharmacol.Home page
Z. Gáborik, M. Szaszák, L. Szidonya, B. Balla, S. Paku, K. J. Catt, A. J. L. Clark, and L. Hunyady
{beta}-Arrestin- and Dynamin-Dependent Endocytosis of the AT1 Angiotensin Receptor
Mol. Pharmacol., February 1, 2001; 59(2): 239 - 247.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
P. H. Anborgh, J. L. Seachrist, L. B. Dale, and S. S. G. Ferguson
Receptor/{beta}-Arrestin Complex Formation and the Differential Trafficking and Resensitization of {beta}2-Adrenergic and Angiotensin II Type 1A Receptors
Mol. Endocrinol., December 1, 2000; 14(12): 2040 - 2053.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
J. A. Olivares-Reyes, S. Jayadev, L. Hunyady, K. J. Catt, and R. D. Smith
Homologous and Heterologous Phosphorylation of the AT2 Angiotensin Receptor by Protein Kinase C
Mol. Pharmacol., November 1, 2000; 58(5): 1156 - 1161.
[Abstract] [Full Text]


Home page
HypertensionHome page
J. Ibrahim, A. D. Hughes, and P. S. Sever
Action of Angiotensin II on DNA Synthesis by Human Saphenous Vein in Organ Culture
Hypertension, November 1, 2000; 36(5): 917 - 921.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
M. de Gasparo, K. J. Catt, T. Inagami, J. W. Wright, and Th. Unger
International Union of Pharmacology. XXIII. The Angiotensin II Receptors
Pharmacol. Rev., September 1, 2000; 52(3): 415 - 472.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. G. Thomas, H. Qian, C.-S. Chang, and S. Karnik
Agonist-induced Phosphorylation of the Angiotensin II (AT1A) Receptor Requires Generation of a Conformation That Is Distinct from the Inositol Phosphate-signaling State
J. Biol. Chem., January 28, 2000; 275(4): 2893 - 2900.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. C. Hanyaloglu, M. Vrecl, K. M. Kroeger, L. E. C. Miles, H. Qian, W. G. Thomas, and K. A. Eidne
Casein Kinase II Sites in the Intracellular C-terminal Domain of the Thyrotropin-releasing Hormone Receptor and Chimeric Gonadotropin-releasing Hormone Receptors Contribute to beta -Arrestin-dependent Internalization
J. Biol. Chem., May 18, 2001; 276(21): 18066 - 18074.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. A. Olivares-Reyes, R. D. Smith, L. Hunyady, B. H. Shah, and K. J. Catt
Agonist-induced Signaling, Desensitization, and Internalization of a Phosphorylation-deficient AT1A Angiotensin Receptor
J. Biol. Chem., October 5, 2001; 276(41): 37761 - 37768.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
W. G. Thomas, Y. Brandenburger, D. J. Autelitano, T. Pham, H. Qian, and R. D. Hannan
Adenoviral-Directed Expression of the Type 1A Angiotensin Receptor Promotes Cardiomyocyte Hypertrophy via Transactivation of the Epidermal Growth Factor Receptor
Circ. Res., February 8, 2002; 90(2): 135 - 142.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, W. G.
Right arrow Articles by Baker, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, W. G.
Right arrow Articles by Baker, K. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals