Molecular Endocrinology 12 (10): 1513-1524
Copyright © 1998 by The Endocrine Society
Phosphorylation of the Angiotensin II (AT1A) Receptor Carboxyl Terminus: A Role in Receptor Endocytosis
Walter G. Thomas,
Thomas J. Motel,
Christopher E. Kule,
Vijay Karoor and
Kenneth M. Baker
Weis Center for Research (T.J.M., C.E.K., V.K., K.M.B.)
Geisinger Clinic Danville, Pennsylvania 17822
Baker Medical Research Institute (W.G.T.) Melbourne 8008,
Australia
 |
ABSTRACT
|
|---|
The molecular mechanism of angiotensin II type I
receptor (AT1) endocytosis is obscure, although
the identification of an important serine/threonine rich region
(Thr332Lys333Met334Ser335Thr336Leu337Ser338)
within the carboxyl terminus of the AT1A
receptor subtype suggests that phosphorylation may be involved. In this
study, we examined the phosphorylation and internalization of
full-length AT1A receptors and compared this to
receptors with truncations and mutations of the carboxyl terminus.
Epitope-tagged full-length AT1A receptors, when
transiently transfected in Chinese hamster ovary (CHO)-K1 cells,
displayed a basal level of phosphorylation that was significantly
enhanced by angiotensin II (Ang II) stimulation. Phosphorylation of
AT1A receptors was progressively reduced by
serial truncation of the carboxyl terminus, and truncation to
Lys325, which removed the last 34 amino acids,
almost completely inhibited Ang II-stimulated
32P incorporation into the
AT1A receptor. To investigate the correlation
between receptor phosphorylation and endocytosis, an epitope-tagged
mutant receptor was produced, in which the carboxyl-terminal residues,
Thr332, Ser335,
Thr336, and Ser338,
previously identified as important for receptor internalization,
were substituted with alanine. Compared with the wild-type receptor,
this mutant displayed a clear reduction in Ang II-stimulated
phosphorylation. Such a correlation was further strengthened by the
novel observation that the Ang II peptide antagonist,
Sar1Ile8-Ang II, which
paradoxically causes internalization of wild-type
AT1A receptors, also promoted their
phosphorylation. In an attempt to directly relate phosphorylation
of the carboxyl terminus to endocytosis, the internalization kinetics
of wild-type AT1A receptors and receptors
mutated within the
Thr332-Ser338 region
were compared. The four putative phosphorylation sites
(Thr332, Ser335,
Thr336, and Ser338)
were substituted with either neutral [alanine (A)] or acidic amino
acids [glutamic acid (E) and aspartic acid (D)], the former to
prevent phosphorylation and the latter to reproduce the acidic charge
created by phosphorylation. Wild-type AT1A
receptors, expressed in Chinese hamster ovary cells, rapidly
internalized after Ang II stimulation [t1/2
2.3 min; maximal level of internalization
(Ymax) 78.2%], as did mutant receptors
carrying single acidic substitutions (T332E,
t1/2 2.7 min, Ymax
76.3%; S335D, t1/2 2.4 min,
Ymax 76.7%; T336E,
t1/2 2.5 min, Ymax
78.2%; S338D, t1/2 2.6 min,
Ymax 78.4%). While acidic amino acid
substitutions may simply be not as structurally disruptive as alanine
mutations, we interpret the tolerance of a negative charge in this
region as suggestive that phosphorylation may permit maximal
internalization. Substitution of all four residues to alanine produced
a receptor with markedly reduced internalization kinetics
(T332A/S335A/T336A/S338A, t1/2 10.1 min,
Ymax 47.9%), while endocytosis was
significantly rescued in the corresponding quadruple acidic mutant
(T332E/S335D/T336E/S338D, t1/2 6.4 min,
Ymax 53.4%). Double mutation of S335 and T336
to alanine also diminished the rate and extent of endocytosis
(S335A/T336A, 3.9 min, Ymax 69.3%), while the
analogous double acidic mutant displayed wild type-like endocytotic
parameters (S335D/T336E, t1/2 2.6 min,
Ymax 77.5%). Based on the apparent rescue of
internalization by acidic amino acid substitutions in a region that we
have identified as a site of Ang II-induced phosphorylation, we
conclude that maximal endocytosis of the AT1A
receptor requires phosphorylation within this serine/threonine-rich
segment of the carboxyl terminus.
 |
INTRODUCTION
|
|---|
Cell surface receptors internalize predominantly via aggregation
within the plasma membrane and recruitment into clathrin-coated pits
and vesicles. This process, which can occur constitutively or as a
consequence of ligand activation, serves to internalize a variety of
hormones, growth factors, Igs, and nutrients (for review, see Refs.
1, 2, 3, 4, 5, 6). Receptor-mediated endocytosis is also exploited by viruses for
infection and can be manipulated to introduce foreign DNA and
cytotoxins into cells (7, 8, 9). While the mechanism of endocytosis is not
fully understood, the targeting of receptors to clathrin-coated pits
presumably requires recognition of amino acid sequences, or motifs,
within the cytoplasmic domains of internalizing receptors by the
endocytotic machinery. For ligand-activated receptor endocytosis,
implicitly, such motifs must be inaccessible to the internalization
machinery, or nonfunctional, before stimulation of the receptor by
ligand. Interaction of receptor and ligand then causes an allosteric
change or modification of the receptor that reveals or creates a
functional motif.
The octapeptide hormone angiotensin II (Ang II) binds and activates
receptors on the plasma membrane of target cells, thereby mediating a
variety of important cardiovascular, homeostatic, and neuroendocrine
functions (10). Pharmacological and molecular cloning studies have
identified two major types of Ang II receptor, classified as
AT1 and AT2, with subtypes of AT1,
termed AT1A and AT1B (11, 12).
AT1A, AT1B, and AT2 receptors are
members of the seven-transmembrane guanyl nucleotide-binding protein (G
protein) receptor (GPCR) superfamily, and the AT1A receptor
mediates most of the classical biological actions of Ang II.
AT1A and AT1B (13, 14, 15), but not AT2
(14), receptors rapidly internalize (t1/2
2 min) after
Ang II stimulation, although the significance of this disparity is
unclear. Internalization of Ang II.AT1A receptor complexes
is presumably via a clathrin-mediated pathway (13) and, based on
pharmacological and mutational analyses (13, 16), the processes that
govern AT1A receptor endocytosis overlap, but are distinct
from, those that couple these receptors to activation of heterotrimeric
G proteins. Previous mutagenesis studies by us (15, 17) and others (14, 18) have identified a key role for the carboxyl terminus of the
359-amino acid AT1A receptor in Ang II- stimulated
endocytosis. Within the 54-amino acid carboxyl terminus, two separate
regions appear to be important: a membrane-proximal site (15) and a
more distal serine- and threonine-rich region (14, 15, 18). Using
serial truncation and alanine point mutations, Hunyady et
al. (14) highlighted the importance of the sequence
Thr332-Lys333-Met334-Ser335-Thr336-Leu337-Ser338
within the AT1A receptor carboxyl terminus for endocytosis,
in particular the so-called "STL" motif of Ser335,
Thr336, and Leu337. The preponderance of serine
and threonine residues suggests that phosphorylation may play an
important role in AT1A receptor endocytosis. While the
AT1A receptor is phosphorylated after Ang II stimulation
(19), the identification of phosphorylated residues and the relevance
to receptor function are lacking.
The substitution of phosphate-accepting serine and threonine residues
with acidic amino acids (glutamic or aspartic acid) is a mutational
strategy for imitating the phosphorylation of proteins (20, 21, 22, 23, 24, 25). The
carboxyl side chain of these acidic amino acids is dissociated (COO-)
at physiological pH and presumably mimics the negative charge conferred
by phosphorylation (PO32-). In addition, the
negative charge of glutamic and aspartic acid is hard-coded and
therefore not reversible by phosphatases, an attribute that also
provides insight into the potential requirement for dephosphorylation
at these sites. Examples where such mimicry has provided a clear
correlation between phosphorylation status and phosphoprotein function
include the enzymes, isocitrate dehydrogenase (20), p56lck
(21), and mitogen-activated protein kinase-activated protein kinase
2 (22); the hormone, PRL (23); and the transcription factors,
NF-IL6/LAP (24) and p53 (25).
In the present study, we used this phosphorylation-mimicking mutational
strategy, in combination with the direct determination and
quantification of 32P incorporation into immunoprecipitated
AT1A receptors, to investigate the contribution of
AT1A receptor carboxyl terminus phosphorylation to Ang
II-induced AT1A receptor endocytosis.
 |
RESULTS
|
|---|
Expression of Wild-Type, Epitope-Tagged, and Carboxyl-Terminal
Mutated AT1A Receptors in Chinese Hamster Ovary
(CHO)-K1 Cells
Wild-type and epitope-tagged AT1A receptor cDNA or
various truncations and single and multiple mutations within the
AT1A carboxyl terminus (see Fig. 1
) were incorporated into the pRc/CMV
mammalian expression vector and transiently expressed in CHO-K1 cells,
which lack endogenous Ang II receptors. All constructs displayed an
equivalent and high level of receptor expression
(Bmax, 18002200 fmol/mg protein), as measured
by competition binding of [125I]Ang II, with the
exception of the most truncated mutants (TK333 and TK325) (see Fig. 3
, middle panel). Competition binding assays revealed that the
wild-type, epitope-tagged, and mutated AT1A receptors all
displayed high affinity for Ang II (Kd,
1
nM) and coupled to a transient elevation of intracellular
calcium when stimulated with Ang II (data not shown). Hence, epitope
tagging and/or mutation within the carboxyl terminus does not affect
the capacity of the AT1A receptor to attain a high-affinity
conformation and efficiently couple to signal transduction pathways,
confirming previous observations (14, 15, 17).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 1. Epitope Tagging of the AT1A Receptor
and Mutagenesis of the Carboxyl Terminus
Shown in the upper portion is the plasma
membrane-localized, seven-transmembrane AT1A receptor and
its cytoplasmic carboxyl-terminal region. For phosphorylation and
immunoprecipitation experiments, the HA epitope (YPYDVPDYA) was
engineered into the N terminus of the AT1A receptor, and
this construct was used as a template to produce truncated mutants that
terminate after D343, K333, and K325, as indicated by the solid
bars. Cytoplasmic serine and threonines are shown as
solid circles. The region of the carboxyl terminus
(residues 332338), previously identified as important for endocytosis
(14 ), is shown in detail; the presence of serine and threonine residues
is indicative of modification by phosphorylation/dephosphorylation.
Mutations introduced into this carboxyl-terminal region of the
AT1A receptor are indicated; residues mutated from the wild
type are highlighted by reverse lettering (white on
black). To mimic the negative charge generated by phosphorylation,
threonine (T) and serine (S) residues were substituted, either singly
or in combination, with the acidic amino acids glutamic acid (E) and
aspartic acid (D), respectively. Corresponding mutations to the neutral
amino acid alanine (A) were created to produce AT1A
receptors incapable of phosphorylation in this region. For convenience,
the quadruple substitution mutants, T332E/S335D/T336E/S338D and
T332A/S335A/T336A/S338A, are represented by the abbreviations, TSTS/ED
and TSTS/A, respectively.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
Figure 3. The Carboxyl Terminus Is the Site of
AT1A Receptor Phosphorylation
CHO-K1 cells were transiently transfected with NHA-AT1A or
epitope-tagged receptors truncated to remove 16 amino acids
(NHA-TD343), 26 amino acids (NHA-TK333), or 34 amino acids (NHA-TK325)
from the carboxyl terminus. After 32P-loading, cells were
treated with or without Ang II (1 µM, 5 min) and then
solubilized and receptor protein immunoprecipitated and analyzed by
SDS-PAGE followed by autoradiography (top panel) or
phosphoimaging (bottom panel). Phosphoimaging data were
normalized for receptor expression as measured by RIA on plates
transfected in parallel (middle panel). Data are
means ± SD from four separate experiments.
|
|
Phosphorylation of Epitope-Tagged AT1A
Receptors
To examine the phosphorylation of the AT1A receptor,
CHO-K1 cells transiently expressing the N-terminally epitope-tagged
AT1A receptor (NHA-AT1A) were treated with the agonist, Ang
II, and then solubilized, and the immunoprecipitated receptor protein
was analyzed by SDS-PAGE. As shown in Fig. 2A
, a broad band was observed that
ranged between 70 and 130 kDa, which displayed both basal and Ang
II-stimulated phosphorylation. Phosphoimager analysis revealed an
approximate doubling in 32P incorporation after Ang II
treatment (see Fig. 3
). In contrast, no
phosphorylation was observed when the empty expression vector was
transfected in place of the epitope-tagged receptor (Fig. 2A
and see
Fig. 4
) or when nontagged wild-type
AT1A receptor was transfected (not shown). Based on a
predicted mol wt of 40,889 deduced from the cloned rat AT1A
cDNA (26), the broad nature (70130 kDa) of the phosphorylated band
suggested considerable N glycosylation of the receptor protein. As
shown in Fig. 2B
, N-glycosidase F treatment of the
AT1A receptor immunoprecipitates resulted in a reduction in
the apparent molecular mass of the phosphorylated receptor from the
broad band at 70130 kDa to a sharper band migrating at approximately
43 kDa, close to the theoretical molecular mass. Since a consensus N
glycosylation site in the N terminus (Asn4) of the
AT1A receptor, near the introduced hemagglutinin antigen
(HA) epitope, was mutated to prevent steric hindrance during
immunoprecipitation (see Materials and Methods), indicates
that the receptor is extensively glycosylated in CHO-K1 cells,
presumably on one or both of the two remaining consensus sites within
extracellular loop 2.

View larger version (45K):
[in this window]
[in a new window]
|
Figure 2. Agonist-Induced Phosphorylation of the
Epitope-Tagged AT1A Receptor
(A) CHO-K1 cells were transiently transfected with either empty vector
(pRc/CMV) or the NHA-tagged AT1A receptor. After loading
with 32P, cells were stimulated with Ang II (1
µM for 5 min) as indicated and then detergent
solubilized. Receptor protein was immunoprecipitated with 12CA5
monoclonal antibody and protein A agarose and analyzed by SDS-PAGE and
phosphoimaging. (B) Phosphorylated NHA-AT1A receptor immunoprecipitates
were treated with or without 0.5 U of N-glycosidase F
for 30 min at 37 C and analyzed by SDS-PAGE and autoradiography.
Arrow indicates deglycosylated receptor migrating at a
relative molecular mass of approximately 43 kDa. Additional
intermediate bands may represent partial deglycosylation of the
AT1A receptor or coimmunoprecipitated
phosphoproteins.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Figure 4. The Carboxyl-Terminal Region Encompassing the STL
Internalization Motif Is a Site for AT1A Receptor
Phosphorylation
CHO-K1 cells, transiently transfected with NHA-AT1A or an
epitope-tagged receptor mutant (Thr332, Ser335,
Thr336 and Ser338 to alanine), were
32P-loaded, treated with agonist as indicated,
immunoprecipitated, and phosphorylation quantified as described in
Materials and Methods. The upper panel
shows a representative phosphoimage and the lower panel
shows the mean ± SD of phosphoimaging data from seven
experiments normalized for cell surface receptor expression, as
indicated in the middle panel.
|
|
Ang II-Induced AT1A Phosphorylation Occurs
within the Carboxyl Terminus
The 54-amino acid AT1A receptor carboxyl terminus
contains 13 serine and threonine residues that are suggestive of
multiple phosphorylation. To investigate phosphorylation within this
region, we generated truncated versions of the NHA-AT1A receptor to
remove either 16 amino acids (NHA-TD343), 26 amino acids (NHA-TK333),
or 34 amino acids (NHA-TK325) from the carboxyl terminus. After
transient transfection of these receptors into CHO-K1 cells, we
determined the level of basal and agonist-stimulated phosphorylation.
In all experiments, quantitative phosphoimaging data were normalized
for receptor expression at the cell surface, which was determined by
transfecting parallel plates of CHO-K1 cells with the various
constructs and performing radioreceptor-binding assays. As shown in
Fig. 3
(upper panel), sequential truncation of the carboxyl
terminus caused a serial decrease in both the constitutive as well as
Ang II-stimulated level of 32P incorporated into the
AT1A receptor. This indicates that phosphorylation occurs
at multiple sites throughout the cytoplasmic tail. When the amount of
phosphorylation was quantified and normalized for receptor expression,
approximately 40% of Ang II-stimulated phosphorylation was decreased
by truncation to Asp343, while about 80% was abolished by
truncation after Lys333, which suggests that a significant
proportion of phosphorylation occurs in the region between
Lys333 and Asp343. Almost complete inhibition
of AT1A receptor phosphorylation was observed in the
receptor truncated to Lys325 to remove all
carboxyl-terminal serine and threonines.
Given that phosphorylation occurs in the region between residues
Lys333 and Asp343, we next investigated the
degree of phosphorylation of a receptor mutant in which four
carboxyl-terminal threonine and serine residues (Thr332,
Ser335, Thr336, and Ser338) were
mutated to alanine. The importance of this region of the carboxyl
terminus in the endocytosis process has been previously reported (14).
As shown in Fig. 4
, this quadruple mutant (NHA-TSTS/A) displayed a
decrease in both basal and agonist-stimulated phosphorylation,
identifying this region as important for both internalization and
phosphorylation and, moreover, linking these processes
circumstantially.
Both the Agonist, Ang II, and the Antagonist,
Sar1Ile8-Ang II,
Phosphorylate the AT1A Receptor
We and others have previously reported (13, 27) that the Ang II
receptor antagonist, Sar1Ile8-Ang II, promotes
robust internalization of the AT1A receptor to a level only
slightly lower than that observed with the agonist, Ang II. To compare
the coincidence of internalization and phosphorylation, we determine
the capacity of Sar1Ile8-Ang II to induce
phosphorylation of the AT1A receptor. As shown in Fig. 5
, Sar1Ile8-Ang
II stimulation in five separate experiments caused a significant
increase (paired t-test, P = 0.01) in
AT1A receptor phosphorylation, which was approximately 50%
of the Ang II-stimulated 32P incorporation into the
immunoprecipitated NHA-AT1A receptor.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 5. Phosphorylation of the AT1A Receptor by
the Antagonist, Sar1Ile8-Ang II
CHO-K1 cells transiently transfected with NHA-AT1A were stimulated with
agonist, Ang II, or the antagonist,
Sar1Ile8-Ang II, as indicated. Receptor protein
was immunoprecipitated and subjected to SDS-PAGE followed by
phosphoimaging. Phosphoimaging data are the means ±
SD from five experiments.
|
|
Effect of Single Acidic Amino Acid Substitutions on
AT1A Receptor Endocytosis
Single alanine substitutions for Thr332,
Ser335, Thr336, or Ser338 results
in reduction (1045%) in the rate of AT1A receptor
internalization (14). To investigate whether an acidic environment
within this region (indicative of phosphorylation) is required for
maximal endocytosis, we compared internalization kinetics for wild-type
receptors and mutants carrying single acidic amino acid substitutions
(Fig. 6
). Wild-type AT1A
receptor-expressing CHO-K1 cells internalized with a rate
(t1/2 2.3 min) and maximal level (Ymax 78.2%)
comparable to previous determinations (14, 15). Interestingly, the
internalization kinetic parameters for the single acidic mutants
(T332E, t1/2 2.7 min, Ymax 76.3%; S335D,
t1/2 2.4 min, Ymax 76.7%; T336E,
t1/2 2.5 min, Ymax 78.2%; S338D,
t1/2 2.6 min, Ymax 78.4%) were
indistinguishable from that of the wild-type AT1A receptor.
Thus, the introduction of an acidic charge within this region
(Thr332 to Ser338) does not inhibit
AT1A receptor endocytosis, consistent with the idea that
phosphorylation of one or more of these serines or threonines
contributes to maximal internalization.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 6. Internalization Kinetic Curves for Wild-Type and
Single-Point Mutants, T332E, S335D, T336E, and S338D
CHO-K1 cells were transiently transfected with plasmid DNA encoding
wild-type and mutated AT1A receptors, and 48 h later
internalization assays were performed. After exposure to
[125I]Ang II for 220 min at 37 C, surface-bound and
internalized [125I]Ang II were determined by acid washing
as described in Materials and Methods. An index of
internalization was calculated by expressing the internalized
radioactivity (acid-resistant) as a percentage of the total binding
(acid-resistant plus acid-susceptible). Data are means ±
SD for four experiments performed in duplicate.
|
|
Effect of Multiple Neutral and Acidic Amino Acid Substitutions on
AT1A Receptor Endocytosis
To investigate this possibility further, we generated multiple
point mutations within the 332338 region of the AT1A
receptor carboxyl terminus. All four putative phosphate acceptor
residues were mutated to alanine (T332A/S335A/T336A/S338A; TSTS/A) to
engineer an AT1A receptor incapable of phosphorylation at
this site or collectively to either aspartic and glutamic acid
(T332E/S335D/T336E/S338D; TSTS/ED) to simulate hyperphosphorylation in
this region. Ang II internalization kinetics for CHO-K1 cells
expressing these quadruple mutants were compared with the wild-type
AT1A receptor (Fig. 7
). As
shown in Fig. 7
, mutation of all four serine and threonine residues to
alanine markedly slowed the rate (t1/2 10.1 min) of
internalization compared with wild type (t1/2 2.3 min) and
reduced the maximal achievable internalization (Ymax 47.9%
vs. wild type 78.2%). In the corresponding multiple acidic
mutant, the rate (t1/2 6.4 min) was intermediate between
the wild-type and the alanine mutant, and the maximal level of
internalization (Ymax 53.4%) was slightly increased
compared with the quadruple alanine mutant.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 7. Comparison of Endocytosis for Wild-Type
AT1A Receptors and the Quadruple Mutants TSTS/A and TSTS/ED
Internalization kinetics for CHO-K1 cells transiently expressing
wild-type (solid circles), T332A/S335A/T336A/S338A
(TSTS/A, open squares), and T332E/S335D/T336E/S338D
(TSTS/ED, solid squares) AT1A receptors were
determined as described in the legend to Fig. 3 . Data are the
means ± SD from three separate experiments performed
in duplicate.
|
|
Although the internalization kinetics of the quadruple acidic mutant
(TSTS/ED) were reduced compared with the wild-type receptor, the
enhanced rate and degree of internalization for receptors carrying
acidic substitutions over those with alanine mutations predicts that
phosphorylation is required for maximal endocytosis. Given the crucial
role attributed to the so-called "STL" motif
(Ser335-Thr336-Leu337) in
AT1A receptor internalization (14), we next investigated
the effect of double mutations specifically at residues
Ser335 and Thr336. Figure 8
illustrates the internalization
kinetics for the wild-type AT1A receptor, the double
alanine mutant (S335A/T336A), and the double acidic amino acid mutant
(S335D/T336E). Compared with the wild-type (t1/2 2.3 min
and Ymax 78.2%), the S335A/T336A mutant displayed a
reduced rate and maximal level of internalization (t1/2 3.9
min, Ymax 69.3%) while the double acidic mutant
(S335D/T336E) internalized with parameters (t1/2 2.6 min,
Ymax 77.5%) comparable to the wild type. These
observations indicate that a phosphorylation event within the STL motif
enhances AT1A receptor endocytosis.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 8. Reduced Internalization of the S335A/T336A Mutant
and Recovery in the Corresponding Acidic Mutant, S335D/T336E
Internalization kinetics for CHO-K1 cells transiently expressing
wild-type (solid circles), S335A/T336A (open
squares), and S335D/T336E (solid squares)
AT1A receptors were determined as described in the legend
to Fig. 3 . Data are the means ± SD from three
separate experiments performed in duplicate.
|
|
 |
DISCUSSION
|
|---|
The present studies demonstrate, for the first time, that the
carboxyl terminus of the AT1A receptor is the major site of
both basal and Ang II-stimulated phosphorylation. The carboxyl
terminus is apparently phosphorylated at multiple sites, although
the majority of phosphorylation occurred on residues distal to
Lys333. Specifically, we identified significant
phosphorylation within a region (Thr332-Ser338)
previously associated with receptor internalization. We also observed
that the Ang II peptide antagonist,
Sar1Ile8-Ang II, which causes robust
AT1A receptor internalization (13, 27), was able to promote
phosphorylation of the AT1A receptor, thereby strengthening
the correlation between receptor endocytosis and phosphorylation.
Finally, using a gain-of-function mutational strategy to mimic the
phosphorylation of serine and threonine residues, we report evidence
that phosphorylation of the carboxyl-terminal STL motif (14) enhances
AT1A receptor internalization.
For immunoprecipitation and phosphorylation experiments, we have used
epitope-tagging of the AT1A receptor. In our hands, the
commercially available antibodies raised against AT1A
receptor peptides do not immunoprecipitate the receptor. Notably, the
first credible evidence for immunoprecipitation and phosphorylation of
AT1A receptors required epitope tagging, as described by
Oppermann et al. (19). Our identification of a broad (70 to
130 kDa) band on SDS-PAGE corresponding to the immunoprecipitated,
phosphorylated receptor is similar to the broad banding observed by
Oppermann et al. (19) and by Balmforth et al.
(28), the latter utilizing an N-terminal hexahistidine tag to purify
the phosphorylated receptor. We only observed the broad phosphorylated
band when the NHA-AT1A receptor expression construct was transfected
into CHO-K1 cells; this band was not seen when vector control or
nontagged AT1A receptor constructs were transfected,
indicating the validity of the epitope-tagging approach. Moreover, the
broad nature of the immunoprecipitated receptor, which suggests
extensive glycosylation, could be significantly reduced by
N-glycosidase F treatment. The AT1A receptor has
three putative N glycosylation consensus motifs (Asn4 at
the N terminus, and Asn176 and Asn188 in the
second extracellular loop), although one (Asn4) was
destroyed by mutation to allow efficient immunoprecipitation of the
epitope tag. The relative molecular mass of the deglycosylated band
(
43 kDa) approximates the theoretical mass of the AT1A
receptor protein deduced from the cloned receptor cDNA (26). Hence,
using the epitope-tagging approach, we are confident that we can detect
and phosphorylate the fully processed (glycosylated) AT1A
receptor.
Our identification of the carboxyl terminus as the site of
AT1A receptor phosphorylation and the observed correlation
of phosphorylation and internalization provide clues as to the
mechanism of AT1A receptor endocytosis. A phosphorylated
STL motif may serve to attract and/or bind components of the
internalization machinery. Indeed, arrestin proteins, which are known
to bind phosphorylated GPCRs, have been recently implicated in the
internalization of GPCRs (29) and may function as adaptor proteins to
link these receptors to the clathrin-coated pits (30). Interestingly,
Zhang et al. (31) reported that, in contrast to the
ß2-adrenergic receptor, the AT1A receptor
expressed in HEK 293 cells appears capable of internalizing
independently of ß-arrestins, leading to speculation that different
GPCRs may utilize distinct endocytotic pathways. Whether proteins other
than the arrestins can bind to the phosphorylated AT1A
carboxyl terminus and participate in the endocytotic process remains to
be determined. Alternatively, phosphorylation of the AT1A
receptor may promote endocytosis via a conformational change that
exposes cryptic motifs, or maintains a conformation, in other parts of
the receptor. For example, regions other than residues 332338 of the
carboxyl terminus have been shown previously to be important for
AT1A receptor internalization (i.e. more
proximal regions of the carboxyl terminus (15) and the N-terminal
portion of the third cytoplasmic loop (16, 32)). Certainly, reversible
phosphorylation or the incorporation of acidic amino acids into
proteins is a potent stimulus for the folding and unfolding of
polypeptide chains in vitro (33).
Our data, using various truncations of the AT1A receptor,
suggest phosphorylation at several sites within the carboxyl terminus.
The cytoplasmic tail of the AT1A receptor contains 13
serine/threonine residues that are likely targets for phosphorylation
by both GPCR kinases (GRKs) and second messenger-activated protein
kinases. In their study, Oppermann et al. (19) demonstrated
that the AT1A receptor is phosphorylated in an agonist-,
time-, and dose-dependent manner and was phosphorylated (predominantly
on unidentified serine residues) by both specific GRKs and by the
general protein kinase [protein kinase C (PKC)], in response to Ang
II stimulation. Phosphorylation was biphasic: early by GRKs
(t1/2 30 sec) and later by PKC (t1/2 3 min),
and the early phosphorylation by GRKs, but not PKC, appeared
responsible for rapid desensitization of receptor signaling. In
contrast, Balmforth et al. (28) observed that PKC
phosphorylates the AT1A receptor at low concentrations of
Ang II and causes desensitization. While this disparity remains to be
resolved, recent evidence indicates that the internalization of
AT1 receptors occurs independently of PKC activation (and
presumably phosphorylation of the receptor) after Ang II stimulation
(34). We also have observed no effect of classical PKC inhibitors on
AT1A receptor endocytosis (W. G. Thomas and K. M.
Baker, unpublished), and hence, we propose that our acidic amino acid
substitutions mimic the early GRK-mediated phosphorylation event.
While GRK2 and GRK5 can phosphorylate the AT1A receptor
(19), the identity of the specific GRK(s) that is recruited and
stimulated to phosphorylate the AT1A receptor after Ang II
stimulation is not clear. How this phosphorylation maximizes
endocytosis remains to be determined, but studies aimed at
investigating whether Ang II-activated AT1A receptors (both
wild-type and mutants lacking phosphorylation sites) interact directly
with previously identified components of the endocytotic machinery
(e.g. the adaptin proteins of the AP-2 complex (35, 36, 37) or
the arrestin proteins (29, 30) are required. The platform provided by
the present study, with respect to immunoprecipitation of wild-type and
carboxyl-terminally mutated AT1A receptors, makes these
experiments tenable.
Accumulating evidence suggests a general role for phosphorylation in
the endocytosis of GPCRs. Agonist-stimulated GPCRs are
phosphorylated by a family of specific, serine/threonine-directed
kinases, termed GRKs. Overexpression of GRK2-GRK6 (38, 39), but not GRK
1 (39), was able to phosphorylate and rescue the endocytosis of a
mutant ß2-adrenergic receptor (Y326A), defective in its
ability to internalize. Internalization was also rescued by
overexpression of ß-arrestins (proteins that bind phosphorylated
GPCRs), a response that was enhanced by concomitant overexpression of
GRK2 (29). The endocytosis of m2 muscarinic acetylcholine receptors is
also enhanced by overexpression of GRK2 and suppressed by coexpression
of a dominant-negative mutant of GRK2 (40). While Pals-Rylaarsdam
et al. (41) could not demonstrate an effect of
overexpression of a dominant-negative GRK2 on internalization of m2
muscarinic acetylcholine receptors, when m2 muscarinic receptors were
constructed with deletions in the serine/threonine-rich third
cytoplasmic loop, these mutants were not phosphorylated in response to
agonist and displayed reduced endocytosis. In recent studies, an
association between phosphorylation of the carboxyl terminus and
internalization has been reported for other GPCRs, including receptors
for glucagon (42), LH/CG (43), gastrin-releasing peptide (44),
chemoattractants (45, 46), cholecystokinin (47), GLP-1 (48),
N-formyl peptide (49), C5a anaphylatoxin (50), and
somatostatin (51).
In general agreement with these studies, our direct phosphorylation
data, as well as the capacity to rescue endocytosis with acidic amino
acid substitutions within the 332338 region of the AT1A
receptor carboxyl terminus, suggest a phosphorylation of the STL motif,
which confers a negative charge and permits maximal internalization.
Interestingly, phosphorylation of serine/threonine residues also
contributes to the endocytosis of other receptors. For example, the
internalization of CD3-
chain, a subunit of the T cell receptor,
and gp130, the transducing protein of the interleukin-6 receptor
complex, both involve the phosphorylation of a crucial serine residue
close to a dileucine internalization motif (52, 53). This
phosphorylation allegedly mediates a conformational change in the
receptor to expose internalization motifs. Phosphorylation of
serine/threonine residues may also contribute to the internalization of
the epidermal growth factor receptor (54, 55). For CD4, a T
cell-surface antigen, serine/threonine phosphorylation of its carboxyl
terminus serves to dissociate the protein kinase p56lck
(56), allowing components of the endocytotic machinery to gain access
to endocytotic motifs. Altogether, these data suggest an important, and
perhaps universal, role for serine/threonine phosphorylation in the
facilitation of endocytosis.
Although important, phosphorylation of the AT1A receptor
carboxyl terminus appears not to be the sole driving force for
endocytosis. First, when all four putative phosphorylation sites within
the STL motif were mutated to alanine (TSTS/A), some endocytosis was
still observed, although at a markedly reduced rate and extent. Second,
a maximal rate of AT1A receptor endocytosis is observed at
concentrations of Ang II (<0.5 nM) that cause minimal
phosphorylation of the receptor (19). Third, mutant AT1A
receptors (D74E and Y302A), which are uncoupled from G protein
activation, and presumably poorly phosphorylated in response to
agonist, display an almost wild-type degree of internalization (13, 15, 57). Fourth, as reported by Hunyady et al. (14), mutation of
Leu337 within the STL motif inhibits internalization as
effectively as mutation of the neighboring serine and threonine. While
this observation argues that determinants other than phosphorylation
are required, it may simply mean that efficient phosphorylation of the
adjacent serine and threonine residues requires the presence of the
downstream leucine. Finally, when the carboxyl terminus of the
noninternalizing AT2 receptor is replaced with the carboxyl
terminus of the rapidly internalizing AT1A receptor, the
resulting AT2/AT1A receptor chimera fails to
internalize after Ang II stimulation (W. G. Thomas and K. M.
Baker, unpublished observations). Hence, the AT1A receptor
carboxyl terminus and its phosphorylation, although important for
maximizing internalization, is apparently not sufficient to direct
endocytosis.
Potentially, one of the most interesting results of the present study
is the observation that the peptide antagonist,
Sar1Ile8-Ang II, causes phosphorylation of the
AT1A receptor. Previous studies have shown that
Sar1Ile8-Ang II also induces strong
internalization of AT1 receptors (13, 27), and we interpret
this to mean that receptor phosphorylation and internalization are
closely associated. Based on the hypothesis that receptors can
isomerize between two or more discrete functional conformations (58),
these data suggest that Sar1Ile8-Ang II
stabilizes a conformation in the AT1A receptor that favors
phosphorylation and internalization, but is incapable of activating the
-subunit of the heterotrimeric G protein to initiate signaling.
While it may seem counterintuitive that an antagonist would select for
active receptor forms that internalize or are phosphorylated, there are
precedents, including a recent paper by Roettger et al.
(59), who demonstrated that a cholecystokinin antagonist, developed as
a probe for receptor function, caused robust receptor internalization.
Thus, the Sar1Ile8-Ang II antagonist and
variations on it may prove very useful tools in dissecting multiple
receptor conformations and perhaps elucidating the molecular switches
subsequent to receptor-ligand interaction that allow activation and
regulation of AT1A receptors.
In conclusion, phosphorylation of the AT1A receptor
carboxyl-terminal STL motif appears important for enhancing endocytosis
and, taken together with recent studies (29, 30, 31, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56), more broadly
implicates receptor phosphorylation as a permissive/required event for
the internalization of other receptors. Future experiments will address
whether AT1A receptors interact directly with components of
the endocytotic machinery, which part(s) of the AT1A
receptor constitute the internalization motif, what conformational
changes occur after AT1A receptor activation to permit
endocytosis, and how phosphorylation status impinges on these
processes.
 |
MATERIALS AND METHODS
|
|---|
Reagents and Cell Culture Materials
125I-Labeled Ang II (specific activity
>2000 Ci/mmol) was obtained from DuPont NEN (Boston, MA). The
Escherichia coli strain XL1-blue and the ExSite Mutagenesis
kit were purchased from Stratagene (La Jolla, CA), and CHO-K1 cells
were obtained from the American Type Culture Collection (Rockville,
MD). DNA modifying enzymes were from Promega (Madison, WI), Sequenase
2.0 DNA sequencing kits were from US Biochemical Corp. (Cleveland, OH),
and the pRc/CMV eukaryotic expression vector was from Invitrogen (San
Diego, CA). 5'-Phosphorylated oligonucleotides were made using a DNA
synthesizer or purchased from Bresatec (Thebarton, South Australia).
-MEM, OPTI-MEM, FBS, okadaic acid, and lipofectAMINE were obtained
from Life Technologies, Inc. (Gaithersburg, MD). Protein A-agarose was
purchased from Boehringer Mannheim (Indianapolis, IN). The 12CA5
monoclonal antibody was affinity purified and supplied by Dr. Jun Ping
Liu (Baker Medical Research Institute). All other chemicals were from
Sigma Chemical Co. (St. Louis, MO) or Fisher Scientific Co.
(Pittsburgh, PA).
Receptor Constructs, Epitope-Tagging, and Mutagenesis
The cloning and incorporation of the full-length rat
AT1A receptor (coding for 359 amino acids) into the pRc/CMV
vector (pRc2A/AT1A) has been described previously (60). To
allow immunoprecipitation of the rat AT1A receptor, we
inserted the influenza HA epitope (YPYDVPDYA), which is recognized by
the monoclonal antibody 12CA5, at the N terminus of the receptor
(pRcNHA/AT1A). This construct was engineered by a PCR-based
method (Ex-site mutagenesis, Stratagene) using pRc2A/AT1A
as template and two 5'-phosphorylated primers. The sense primer
was:
5'-GTCCCAGACTACGCCGCCCTTGACTCTTCTGCTGAAG ATGGTATC-3'.
The underlined sequence corresponds to nucleotides 4 to 33
(coding for Ala2 to Ile10) of the rat
AT1A receptor. The gap in the underline
indicates an introduced mutation (A to G) that changes Asn4
to Asp to prevent glycosylation at this consensus site and steric
hindrance of antibody binding, as suggested by Oppermann et
al. (19). The antisense primer was:
5'-GTCGTATGGGTACCCCATGGTGGCCTGGGTTGAGTTG GTCTCAGACAC-3'.
The underlined sequence corresponds to nucleotides -33 to
-10 within the 5'-untranslated region of the rat AT1A
receptor. A silent KpnI site (shown in italic)
was introduced to assist in the selection of mutants, and an optimal
ribosome-binding site was incorporated around the initiator methionine
sequence (shown in bold). Positive clones were sequenced to
confirm these mutations as well as the integrity of the entire coding
region. Thus, the new N-terminal sequence generated by this construct
was:
M1GYPYDVPDYAA2L3D4S5
(superscripts indicate the position of original
residues).
Three truncated versions of this N-terminally tagged receptor
(NHA-AT1A) were generated to shorten the receptor carboxyl terminus by
either 16 amino acids (NHA-TD343, to represent an N-terminal tagged
receptor truncated after Asp343), 26 amino acids
(NHA-TK333, to represent an N-terminal tagged receptor truncated after
Lys333), or 34 amino acids (NHA-TK325, to represent an
N-terminal tagged receptor truncated after Lys325) (see
Fig. 1
). A quadruple mutant containing alanine substitutions for
Thr332, Ser335, Thr336, and
Ser338 was also generated (see below). These various
truncations and point mutations were first introduced into the
wild-type AT1A receptor expression vector
(pRc2A/AT1A) using the Ex-site method and confirmed by
sequencing. BbsI restriction fragments, containing the
respective mutated regions, were subcloned into the BbsI
sites of pRcNHA/AT1A to yield the N-terminally tagged
truncated AT1A receptor constructs.
A variety of single- and multiple-point mutations (see Fig. 1
) were
also introduced into the wild-type (nontagged) AT1A
receptor by Ex-site mutagenesis. Each PCR mutation reaction used a
common oligonucleotide primer (CMPR1) together with a selective
oligonucleotide primer carrying the desired mutation(s). A silent
XhoI restriction site was incorporated into the common
primer to assist with the screening for mutated clones, and all
oligonucleotides were 5'-phosphorylated during synthesis. The
oligonucleotide sequences 5' to 3' were: CMPR1
AGACAGGCTCGAGTGGGACTTGGCC T332E
GAGAAAATGAGCACGCTTTCTTACCGG S335D
ACGAAAATGGACACGCTTTCTTACCGG T336E
ACGAAAATGAGCGAGCTTTCTTACCGG S338D
ACGAAAATGAGCACGCTTGATTACCGGCCTTCG
T332A/S335A/T336A/S338A
GCGAAAATGGCCGCGCTTGCTTACCGGCCTTCGGAT T332E/S335D/T336E/S338D
GAGAAAATGGACGAGCTTGATTACCGGCCTTCGGAT
S335A/T336A ACGAAAATGGCCGCGCTTTCTTACCGG
S335D/T336E ACGAAAATGGACGAGCTTTCTTACCGG
The silent XhoI restriction site is italicized in
CMPR1, and nucleotides mutated from the wild-type sequence are
underlined. The rationale for replacing serines and
threonines with aspartic acid and glutamic acid residues, respectively,
was to closely match the carbon side chains of the original residues,
while still imparting a negative charge.
The major 6.7-kb PCR bands, representing the linearized mutated
plasmids, were in-gel purified and blunt-end ligated to circularize and
reform the expression plasmids. After transformation into XL1-blue
E. coli and plating on LB/ampicillin plates, plasmid-bearing
colonies were screened for the relevant silent restriction site.
Positive clones for each receptor mutant were sequenced to confirm the
entire coding region and the relevant nucleotide mutations.
Transient Transfection of CHO-K1 Cells
CHO-K1 cells were maintained in
-MEM containing horse serum
(10%), penicillin G sodium (100 µg/ml), streptomycin sulfate (100
µg/ml), and amphotericin B (0.25 µg/ml) (complete media), seeded in
either 6-well or 12-well culture dishes, and grown in complete media
until 7080% confluent. Cells washed in serum-free OPTI-MEM were
transfected in triplicate with 1 µg/well (6-well plates) or 0.6
µg/well (12-well plates) of either wild-type, epitope-tagged, or
mutated AT1A receptor plasmid DNA using lipofectAMINE, as
previously described (15). After a 4-h exposure to DNA/lipofectAMINE
complexes in OPTI-MEM, cells were washed and grown in complete media
for 48 h.
Phosphorylation and Immunoprecipitation of
AT1A Receptors
Phosphorylation and immunoprecipitation experiments were
performed on 48-h posttransfection cultures of CHO-K1 cells, in 12-well
culture plates, using a procedure synthesized from Oppermann et
al. (19) and Hipkin et al. (61). Wells of transfected
cells were washed with 1 ml of phosphate-free DMEM and incubated in 0.4
ml of the same medium containing 32Pi (200
µCi/ml) for 2 h at 37 C. Okadaic acid (0.2 µM) was
added 10 min before stimulation by the agonist, Ang II (1
µM, 5 min, 37 C), or the antagonist,
Sar1Ile8Ang II (1 µM). After
stimulation, cells were placed on ice, washed twice with 1 ml/well of
HBSS (4 C), and solubilized by the addition of 0.3 ml/well of lysis
buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 4
mg/ml n-dodecyl ß-maltoside, 0.5 mg/ml cholesteryl
hemisuccinate, 1 mM phenylmethylsulfonyl fluoride, 5
µg/ml leupeptin, 1 µg/ml aprotinin, 1 µg/ml pepstatin) containing
10 mM sodium fluoride, 10 mM sodium
pyrophosphate, and 0.5 µM okadaic acid. Plates were
rocked at 4 C for 1 h, and the detergent lysates were harvested
and clarified by centrifugation (14,000 x g for 15
min). The cell lysates (300 µl containing 500 µg of cellular
protein) were precleared by the addition of 10 µl of protein
A-agarose and 10 µl of 6% BSA and gentle mixing at 4 C for 2 h.
After removal of the protein A-agarose beads by centrifugation, the
precleared lysates were incubated with 1.6 µg of affinity-purified
12CA5 antibody and 20 µl of protein A-agarose and agitated overnight
at 4 C to immunoprecipitate the epitope-tagged AT1A
receptors. The immunoprecipitates were washed twice with ice-cold
washing buffer 1 (50 mM Tris-HCl, pH 7.5, 150
mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 1
mM phenylmethylsulfonyl fluoride, 5 µg/ml leupeptin, 1
µg/ml aprotinin, 1 µg/ml pepstatin), twice with washing buffer 2
(50 mM Tris-HCl, pH 7.5, 500 mM NaCl, 0.1%
Triton X-100, 0.05% sodium deoxycholate) and once with washing buffer
3 (50 mM Tris-HCl, pH 7.5, 0.1% Triton X-100, 0.05%
sodium deoxycholate). After resuspension in 55 µl of a urea-based SDS
sample buffer [62.5 mM Tris-HCl, pH 6.8, 2% SDS, 10%
ß-mercaptoethanol (vol/vol), 6 M urea, 20% glycerol],
the immunoprecipates were heated at 60 C for 15 min and resolved by
10% SDS-PAGE. Gels were fixed and dried before exposing against Biomax
MS film (Eastman Kodak, Rochester, NY) and a BIOMAX TranScreen-HE (High
Energy) intensifying screen (Kodak) at -80 C for 620 h. After
autoradiography, gels were placed against Fuji type BAS-IIIs
phosphoimaging plates and exposed overnight. Plates were subsequently
read in a FUJIX Bio-imaging Analyzer BAS 1000 (Fuji Photo Film Co.,
Ltd., Berthold Australia, Melbourne), and the data were analyzed
using MacBAS v1.0 software.
In all experiments, the quantification of phosphorylation data was
normalized for surface receptor expression by performing Ang II
radioreceptor-binding assays, as previously described (15). Binding
assays were performed at 4 C, to prevent receptor internalization, on
12-well plates transfected in parallel to those used for
phosphorylation assays.
Determination of Receptor Internalization
Internalization kinetic assays were performed as previously
described (15). Briefly, transfected CHO-K1 cells in 6-well or 12-well
plates were exposed to [125I]Ang II (0.4 nM)
in receptor-binding buffer for 2, 5, 10, and 20 min at 37 C.
Internalization was terminated, and unbound [125I]Ang II
was removed by chilling the plates on ice and washing the wells
extensively with ice-cold receptor binding buffer. Bound
[125I]Ang II, associated with noninternalized receptors
at the cell surface, was removed by acid washing, while internalized
[125I]Ang II-receptor complexes were harvested with a
0.25 M NaOH/0.25% SDS solution. An index of
internalization was obtained by expressing the acid-insensitive
radioactivity (internalized receptors) as a percentage of the total
binding (acid-insensitive + acid-sensitive) for each well. The
percentage of internalized receptors was plotted against time and
analyzed as one-phase exponential associations using GraphPad Prism
(GraphPad Software Inc., San Diego, CA). The t1/2
(in min) to reach a Ymax value (in %) was determined for
each association curve.
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful to Dr. Jun-Ping Liu (Baker Medical Research
Institute) for the supply of affinity-purified 12CA5 monoclonal
antibody, to Ms. Kate Kully for photography, and to Ms. Luisa Pipolo
for invaluable technical assistance.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Dr. Walter G. Thomas, c/o Baker Medical Research Institute, P.O. Box 6492, Melbourne 8008, Australia. E-mail walter.thomas{at}baker.edu.au
This work was supported by the Geisinger Clinic Foundation, by NIH
Grant HL-44883 (to K.M.B.), by a National Health and Medical Research
Council of Australia Institute Block Grant to the Baker Medical
Research Institute, and a National Heart Foundation of Australia
Grant-in-Aid to W.G.T. During the course of this work, W.G.T. was the
recipient of a C.J. Martin Fellowship from the National Health and
Medical Research Council of Australia. K.M.B. is an Established
Investigator of the American Heart Association.
Received for publication May 4, 1998.
Revision received June 18, 1998.
Accepted for publication July 6, 1998.
 |
REFERENCES
|
|---|
-
Goldstein JL, Brown MS, Anderson RGW, Russel DW,
Schneider WJ 1985 Receptor-mediated endocytosis: concepts emerging from
the LDL receptor system. Annu Rev Cell Biol 1:139[CrossRef]
-
Pearse BM, Robinson MS 1990 Clathrin, adaptors, and sorting.
Annu Rev Cell Biol 6:151171[CrossRef]
-
Trowbridge IS 1991 Endocytosis and signals for
internalization. Curr Opin Cell Biol 3:634641[CrossRef][Medline]
-
Smythe E, Warren G 1991 The mechanism of receptor-mediated
endocytosis. Eur J Biochem 202:689699[Medline]
-
Vaux D 1992 The structure of an endocytosis signal. Trends
Cell Biol 2:189192[CrossRef][Medline]
-
Sorkin A, Water CM 1993 Endocytosis of growth factor
receptors. Bioessays 15:375382[CrossRef][Medline]
-
Michael SI, Curiel DT 1994 Strategies to achieve targeted
gene delivery via the receptor-mediated endocytosis pathway. Gene Ther 1:223232[Medline]
-
Guy J, Drabek D, Antoniou M 1995 Delivery of DNA into
mammalian cells by receptor-mediated endocytosis and gene therapy. Mol
Biotechnol 3:237248[Medline]
-
Mukhopadhyay A, Mukhopadhyay B, Basu SK 1995 Circumvention of
multidrug resistance in neoplastic cells through scavenger receptor
mediated drug delivery. FEBS Lett 376:9598[CrossRef][Medline]
-
Robertson JIS, Nicholls MG (eds) 1993 The
Renin-Angiotensin System: Biochemistry and Physiology. Gower
Medical Publishing, London, vol 1
-
de Gasparo M, Husain A, Alexander W, Catt KJ, Chiu AT, Drew M,
Goodfriend T, Harding JW, Inagami T, Timmermans PBM WM 1995 Proposed
update of angiotensin receptor nomenclature. Hypertension 25:924927[Free Full Text]
-
Sandberg K 1994 Structural analysis and regulation of
angiotensin II receptors. Trends Endocrinol Metab 5:2835
-
Conchon S, Monnot C, Teutsch B, Corvol P, Clauser E 1994 Internalization of the rat AT1a and AT1b receptors: pharmacological and
functional requirements. FEBS Lett 349:365370[CrossRef][Medline]
-
Hunyady L, Bor M, Balla T, Catt KJ 1994 Identification of
a cytoplasmic Ser-Thr-Leu motif that determines agonist-induced
internalization of the AT1 angiotensin receptor. J Biol Chem 269:3137831382[Abstract/Free Full Text]
-
Thomas WG, Baker KM, Motel TJ, Thekkumkara TJ 1995 Angiotensin
II receptor endocytosis involves two distinct regions of the
cytoplasmic tail. A role for residues on the hydrophobic face of a
putative amphipathic helix. J Biol Chem 270:2215322159[Abstract/Free Full Text]
-
Hunyady L, Baukal AJ, Balla T, Catt KJ 1994 Independence of
type I angiotensin II receptor endocytosis from G protein coupling and
signal transduction. J Biol Chem 269:2479824804[Abstract/Free Full Text]
-
Thomas WG, Thekkumkara TJ, Motel TJ, Baker KM 1995 Stable
expression of a truncated AT1A receptor in CHO-K1 cells. The
carboxyl-terminal region directs agonist-induced internalization
but not receptor signaling or desensitization. J Biol Chem 270:207213[Abstract/Free Full Text]
-
Balmforth AJ, Lee AJ, Bajaj BP, Dickinson CJ, Warburton P,
Ball SG 1995 Functional domains of the C-terminus of the rat
angiotensin AT1A receptor. Eur J Pharmacol 291:135141[CrossRef][Medline]
-
Oppermann M, Freedman NJ, Alexander RW, Lefkowitz RJ 1996 Phosphorylation of the type 1A angiotensin II receptor by G
protein-coupled receptor kinases and protein kinase C. J Biol Chem 271:1326613272[Abstract/Free Full Text]
-
Dean AM, Koshland DE 1990 Electrostatic and steric
contributions to regulation at the active site of isocitrate
dehydrogenase. Science 249:10441046[Abstract/Free Full Text]
-
Joung I, Kim T, Stolz LA, Payne G, Winkler DG, Walsh CT,
Strominger JL, Shin J 1995 Modification of Ser59 in the unique
N-terminal region of tyrosine kinase p56lck regulates specificity of
its Src homology 2 domain. Proc Natl Acad Sci USA 92:57785782[Abstract/Free Full Text]
-
Engel K, Shultz H, Martin F, Kotlyarov A, Hahn M,
Heinemann U, Gaestel M 1995 Constitutive activation of
mitogen-activated protein kinase-activated protein kinase 2 by
mutation of phosphorylation sites and an A-helix motif. J Biol
Chem 270:2721327221[Abstract/Free Full Text]
-
Maciejewski PM, Peterson FC, Anderson PJ, Brooks CL 1995 Mutation of serine 90 to glutamic acid mimics phosphorylation of bovine
prolactin. J Biol Chem 270:2766127665[Abstract/Free Full Text]
-
Trautwein C, Caelles C, vanderGeer P, Hunter T, Karin M,
Chojkier M 1993 Transactivation by NF-IL6/LAP is enhanced by
phosphorylation of its activation domain. Nature 364:544547[CrossRef][Medline]
-
Mayr GA, Reed M, Wang P, Wang Y, Schwedes JF, Tegtmeyer P 1995 Serine phosphorylation in the NH2 terminus of p53 facilitates
transactivation. Cancer Res 55:24102417[Abstract/Free Full Text]
-
Murphy TJ, Alexander RW, Griendling KK, Runge MS, Bernstein KE 1991 Isolation of a cDNA encoding the vascular type-1 angiotensin II
receptor. Nature 351:233236[CrossRef][Medline]
-
Thomas WG, Thekkumkara TJ, Baker KM 1996 Molecular mechanisms
for angiotensin II (AT1A) receptor endocytosis. Clin Exp Pharmacol
Physiol 23 [Suppl 3]:1521
-
Balmforth AJ, Shepherd FH, Warburton P, Ball SG 1997 Evidence
of an important and direct role of protein kinase C in agonist-induced
phosphorylation leading to desensitization of the angiotensin AT1A
receptor. Br J Pharmacol 122:14691477[CrossRef][Medline]
-
Ferguson SSG, Downey WE, Colapietro A-M, Barak LS, Menard L,
Caron MG 1996 Role of beta-arrestin in mediating agonist-promoted G
protein-coupled receptor internalization. Science 271:363366[Abstract]
-
Goodman OB, Krupnick JG, Santini F, Gurevich VV, Penn RB,
Gagnon AW, Keen JH, Benovic JL 1996 ß-Arrestin acts as a clathrin
adaptor in endocytosis of the ß2-adrenergic receptor. Nature 383:447450[CrossRef][Medline]
-
Zhang J, Ferguson SSG, Barak LS, Menard L, Caron MG 1996 Dynamin and ß-arrestin reveal distinct mechanisms for G
protein-coupled receptor internalization. J Biol Chem 271:1830218305[Abstract/Free Full Text]
-
Hunyady L, Zhang M, Jagadeesh G, Bor M, Balla T, Catt KJ 1996 Dependence of agonist activation on a conserved apolar residue in the
third intracellular loop of the AT1 angiotensin receptor. Proc Natl
Acad Sci USA 93:1004010045[Abstract/Free Full Text]
-
Urry DW 1995 Elastic biomolecular machines. Sci Am 272:6469
-
Sasamura H, Hein L, Saruta T, Pratt RE 1997 Evidence for
internalization of both type 1 angiotensin receptor subtypes (AT1a,
AT1b) by a protein kinase C independent mechanism. Hypertens Res 20:295300[Medline]
-
Sorkin A, McKinsey T, Shih W, Kirchhausen T, Carpenter G 1995 Stoichiometric interaction of the epidermal growth factor receptor with
the clathrin-associated protein complex AP-2. J Biol Chem 270:619625[Abstract/Free Full Text]
-
Nesterov A, Kurten RC, Gill GN 1995 Association of epidermal
growth factor receptors with coated pit adaptins via a tyrosine
phosphorylation-regulated mechanism. J Biol Chem 270:63206327[Abstract/Free Full Text]
-
Sorkin A, Carpenter G 1993 Interaction of activated EGF
receptors with coated pit adaptins. Science 261:612615[Abstract/Free Full Text]
-
Ferguson SSG, Menard L, Barak LS, Koch WJ, Colapietro A-M,
Caron MG 1995 Role of phosphorylation in agonist-promoted beta
2-adrenergic receptor sequestration. Rescue of a
sequestration-defective mutant receptor by beta ARK1. J Biol Chem 270:2478224789[Abstract/Free Full Text]
-
Menard L, Ferguson SSG, Barak LS, Bertrand L, Premont RT,
Colapietro A-M, Lefkowitz RJ, Caron MG 1996 Members of the G
protein-coupled receptor kinase family that phosphorylate the
ß-adrenergic receptor facilitate sequestration. Biochemistry 35:41554160[CrossRef][Medline]
-
Tsuga H, Kameyama K, Haga T, Kurose H, Nagao T 1994 Sequestration of muscarinic acetylcholine receptor m2 subtypes.
Facilitation by G protein-coupled receptor kinase (GRK2) and
attenuation by a dominant-negative mutant of GRK2. J Biol Chem 269:3252232527[Abstract/Free Full Text]
-
Pals-Rylaarsdam R, Xu Y, Witt-Enderby P, Benovic JL, Hosey MM 1995 Desensitization and internalization of the m2 muscarinic
acetylcholine receptor are directed by independent mechanisms. J
Biol Chem 270:2900429011[Abstract/Free Full Text]
-
Buggy JJ, Heurich RO, MacDougall M, Kelley KA, Livingston
JN, Yoo-Warren H, Rossomando AJ 1997 Role of the glucagon receptor
COOH-terminal domain in glucagon-mediated signaling and receptor
internalization. Diabetes 46:14001405[Abstract]
-
Ascoli M 1997 Molecular basis of the regulation of the
lutropin/choriogonadotropin receptor. Biochem Soc Trans 25:10211026[Medline]
-
Benya RV, Fathi Z, Battey JF, Jensen RT 1993 Serines and
threonines in the gastrin-releasing peptide receptor carboxyl terminus
mediate internalization. J Biol Chem 268:2028520290[Abstract/Free Full Text]
-
Kim JY, Soede RD, Schaap P, Valkema R, Borleis JA, Van
Haastert PJ, Devreotes PN, Hereld D 1997 Phosphorylation of
chemoattractant receptors is not essential for chemotaxis or
termination of G-protein-mediated responses. J Biol Chem 272:2731327318[Abstract/Free Full Text]
-
Franci C, Gosling J, Tsou CL, Coughlin SR, Charo IF 1996 Phosphorylation by a G protein-coupled kinase inhibits signaling and
promotes internalization of the monocyte chemoattractant protein-1
receptor. Critical role of carboxyl-tail serine/threonines in receptor
function. J Immunol 157:56065612[Abstract]
-
Pohl M, Silvente-Poirot S, Pisegna JR, Tarasova NI, Wank SA 1997 Ligand-induced internalization of cholecystokinin receptors.
Demonstration of the importance of the carboxyl terminus for
ligand-induced internalization of the rat cholecystokinin type B
receptor but not the type A receptor. J Biol Chem 272:1817918184[Abstract/Free Full Text]
-
Widmann C, Dolci W, Thorens B 1997 Internalization and
homologous desensitization of the GLP-1 receptor depend on
phosphorylation of the receptor carboxyl tail at the same three sites.
Mol Endocrinol 11:10941102[Abstract/Free Full Text]
-
Hsu MH, Chiang SC, Ye RD, Prossnitz ER 1997 Phosphorylation of
the N-formyl peptide receptor is required for receptor internalization
but not chemotaxis. J Biol Chem 272:2942629429[Abstract/Free Full Text]
-
Naik N, Giannini E, Brouchon L, Boulay F 1997 Internalization
and recycling of the C5a anaphylatoxin receptor: evidence that the
agonist-mediated internalization is modulated by phosphorylation of the
C-terminal domain. J Cell Sci 110:23812390[Abstract]
-
Roth A, Kreienkamp HJ, Meyerhof W, Richter D 1997 Phosphorylation of four amino acid residues in the carboxyl terminus of
the rat somatostatin receptor subtype 3 is crucial for its
desensitization and internalization. J Biol Chem 272:2376923774[Abstract/Free Full Text]
-
Dietrich J, Hou X, Wegener A-M, Geisler C 1994 CD3 gamma
contains a phosphoserine-dependent di-leucine motif involved in
down-regulation of the T cell receptor. EMBO J 13:21562166[Medline]
-
Dittrich E, Haft CR, Muys L, Heinrich PC, Graeve L 1996 A
di-leucine motif and an upstream serine in the interleukin-6 (IL-6)
signal transducer gp130 mediate ligand-induced endocytosis and
down-regulation of the IL-6 receptor. J Biol Chem 271:54875494[Abstract/Free Full Text]
-
Countaway JL, Nairn AC, Davis RJ 1992 Mechanism of
desensitization of the epidermal growth factor receptor
protein-tyrosine kinase. J Biol Chem 267:11291140[Abstract/Free Full Text]
-
Nesterov A, Lysan S, Vdovina I, Nikolsky N, Fujita DJ 1994 Phosphorylation of the epidermal growth factor receptor during
internalization in A-431 cells. Arch Biochem Biophys 313:351359[CrossRef][Medline]
-
Pelchen-Matthews A, Boulet I, Littman DR, Fagard R, Marsh M 1992 The protein tyrosine kinase p56lck inhibits CD4 endocytosis by
preventing entry of CD4 into coated pits. J Biol Chem 117:279290
-
Hunyady L, Bor M, Baukal AJ, Balla T, Catt KJ 1995 A conserved
NPLFY sequence contributes to agonist binding and signal transduction
but is not an internalization signal for the type 1 angiotensin II
receptor. J Biol Chem 270:1660216609[Abstract/Free Full Text]
-
Leff P, Scaramellini C, Law C, McKechnie K 1997 A three-state
receptor model of agonist action. Trends Pharmacol Sci 18:355362[Medline]
-
Roettger BF, Ghanekar D, Rao R, Toledo C, Yingling J, Pinon D,
Miller LJ 1997 Antagonist-stimulated internalization of the G
protein-coupled cholecystokinin receptor. Mol Pharmacol 51:357363[Abstract/Free Full Text]
-
Thekkumkara TJ, Du J, Dostal DE, Motel TJ, Thomas WG, Baker KM 1995 Stable expression of a functional rat angiotensin II (AT1A)
receptor in CHO-K1 cells: rapid desensitization by angiotensin II. Mol
Cell Biochem 146:7989[CrossRef][Medline]
-
Hipkin RW, Friedman J, Clark RB, Eppler CM, Schnonbrunn A 1997 Agonist-induced desensitization, internalization and phosphorylation of
the sst2A somatostatin receptor. J Biol Chem 272:1386913876[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. Mogi, M. Iwai, and M. Horiuchi
Emerging Concepts of Regulation of Angiotensin II Receptors: New Players and Targets for Traditional Receptors
Arterioscler. Thromb. Vasc. Biol.,
December 1, 2007;
27(12):
2532 - 2539.
[Abstract]
[Full Text]
[PDF]
|
 |
|