| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Physiology Southern Illinois University School of Medicine Carbondale, Illinois 62901-6523
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Precise regional expression and interaction of specific transcription factors are also likely to be relevant to the mechanisms by which a master set of selector genes termed HOM-C/Hox can determine the final morphological characteristics of an organism (reviewed in Ref. 3). The HOM-C gene cluster in Drosophila encodes a group of proteins that govern the anterior-to-posterior (A-P) segmentation patterning of developing fly embryos, and the homologous Hox gene clusters have been identified in all metazoans that have been examined (4, 5). In vertebrates, there are four Hox gene clusters, which show not only sequence homology to Drosophila HOM-C, but also display the linear chromosomal arrangement and 3'-to-5' temporal expression pattern observed during development. Mutations in these genes lead to the substitution of one body part for another (homeotic transformation). The HOM/Hox genes encode proteins that share a highly conserved 60-amino acid DNA-binding domain called the homeodomain (6) and are thought to exert their broad range of regulatory effects through DNA binding and transcriptional regulation of downstream target genes (7).
The high degree of amino acid similarity in the homeodomains of these proteins also appears to produce similar DNA-binding specificities in both in vitro and in vivo experiments (see reviews in Refs. 8, 9). The dilemma of achieving precise regulatory specificity with homeodomain proteins could be resolved if interactions with additional cofactors supplied the required specificity (3, 10). Indeed, a growing number of cofactors have been shown to provide functional enhancement to homeodomain proteins. For example, the human Oct-1 homeodomain protein will form high-affinity complexes with certain octamer motifs only in the presence of the coactivator VP16 (11, 12). The homeodomain protein extradenticle in Drosophila and its mammalian counterpart Pbx have also been shown to cooperatively bind DNA in the presence of some homeodomain proteins (13, 14, 15). More recent studies suggest that protein cofactors are required to switch some homeodomain proteins into a transcriptionally active state (3, 16).
Deformed epidermal autoregulatory factor-1 (DEAF-1) was identified as a nonhomeodomain protein that interacted as a cofactor with the Deformed protein from the HOM-C gene cluster in Drosophila. Deformed (Dfd) is a homeodomain protein that is expressed in the mandibular and maxillary segments of the embryonic head and is required for the subsequent development of structures derived from these segments (17, 18, 19). A 120-bp region of the Dfd promoter, referred to as module E, is capable of driving embryonic expression of a reporter gene in a pattern similar to endogenous Dfd expression (20). Module E was further dissected into a 24-bp Dfd-binding site and a 51-bp sequence (called region 56) that was required for appropriate Dfd expression (20). Thus, Dfd is capable of autoregulating its own expression but requires additional cofactors to provide segment-specific expression. DEAF-1 was identified as a protein cofactor that bound the 56 region in gel mobility shift and deoxyribonuclease I (DNase I) protection assays (21). Mutations in region 56 that improved DEAF-1 binding in vitro increased expression in transgenic embryos, indicating DEAF-1 or a similar protein is a required cofactor in Dfd expression. In addition, DEAF-1 was shown to bind multiple regions of the human HOXD4 promoter, a homolog of Dfd (21), suggesting a mammalian counterpart of DEAF-1 may exist to assist in the regulation of paralogous group 4 Hox genes.
Retinoic acid receptors (RARs) are nuclear transcription factors
that, along with retinoid X-receptors (RXRs), bind to retinoic acid
(RA) response elements (RAREs) of target genes to mediate developmental
events such as RA-dependent regulation of embyrogenesis and cellular
differentiation (22). We had previously shown that the catalytic
subunit of cAMP-dependent protein kinase [protein kinase A (PKA)]
could phosphorylate recombinant RAR
in vitro, and that
PKA potentiated RA signaling in transfected cells (23). Rochette-Egly
and co-workers (24) went on to show that serine 369 of RAR
was
phosphorylated upon cotransfection of PKA or by forskolin treatment of
F9 cells. Surprisingly, mutation of this serine to alanine or glutamate
did not eliminate PKA potentiation of RAR
signaling (Ref. 24 and our
own unpublished studies have confirmed this result). To support a
mechanism for the PKA-dependent regulation of RA signaling, we
hypothesized that other PKA-regulated transcription factors were
binding to RAREs or interacting with RAR/RXR dimers. In a search for
binding proteins that might recognize RAREs, we have identified a
protein with significant homology to DEAF-1 which we have designated as
NUDR (for nuclear DEAF-1 related protein). We present evidence that
NUDR is a nuclear protein that activates transcription from the human
proenkephalin promoter, a gene that is expressed in many neuroendocrine
and reproductive tissues. NUDR protein is expressed at elevated levels
in testicular germ cells and developing fetus and will likely function
to regulate gene expression in these tissues. The sequence and
functional similarities between NUDR and DEAF-1 suggest that NUDR is a
potential mammalian homolog of DEAF-1 and may therefore serve as a
transcriptional cofactor of homeodomain proteins in rapidly dividing or
differentiating tissues.
| RESULTS |
|---|
|
|
|---|
|
Comparison of Sequences with Similarities to NUDR
Comparison of the NUDR sequences to the nonredundant GenBank
databases identified two cDNAs, designated as rat suppressin (1882 bp,
accession no. U59659) and human suppressin (1888 bp, accession no.
AF007165), with significant nucleotide and amino acid homologies. The
rat suppressin clone was identified by screening of a pituitary cDNA
library (26) with an antibody to bovine suppressin, a protein isolated
and characterized from bovine pituitary (27). The suppressin protein
has been shown to be synthesized and secreted by the GH3
rat pituitary cell line and to inhibit proliferation of immune cells
(27). Analysis of the rat suppressin and rat (r) NUDR sequences suggest
that suppressin is a partial NUDR cDNA that would produce a protein
lacking 68 amino acids (Fig. 1
) if the suggested protein initiation
site of suppressin were used. Comparison of the conceptual proteins
showed they shared 94% amino acid identity while the nucleotide
sequences were more than 99% identical. Comparison of human suppressin
with hNUDR suggests it is also a partial NUDR cDNA that lacks the
5'-sequence coding for the first 48 amino acids and differs in sequence
to produce four additional amino acid changes. As presented in the
Discussion, we believe that it is unlikely the protein
encoded by NUDR is the equivalent of the secreted protein characterized
as suppressin.
The second most similar sequence identified in computer comparisons was
the Drosophila DEAF-1. For this reason, we have designated
the primate protein as nuclear DEAF-1 related (NUDR) protein. hNUDR
shows 29% identity and 46% overall similarity with the 576 amino
acids of DEAF-1. Other proteins identified in the database comparison
show sequence similarity to specific regions of hNUDR and suggest the
presence of five distinct functional domains (Fig. 2
). The alanine-rich
region near the amino terminus of NUDR is followed by an acidic-rich
region, and together these regions (Alanine-Acidic, AA) produce matches
primarily with proteins recognized as developmental transcription
factors (Fig. 2A
). Of the 17 proteins shown, 10 are
homeodomain-containing proteins and another four are putative
transcription factors closely associated with embryonic development.
The three remaining proteins with AA similarity include the
transcription factor JUN-D, human progesterone receptor (hPR), and a
protein (MLL) that is associated with malignant transformation in
t(11;19) leukemias (28).
|
fusion oncoprotein that disrupts normal localization to PML
nuclear bodies and potentially contributes to APL pathogenesis
(30, 31, 32, 33). The LYSP100-B protein is similar to SP100-B, but its
expression is restricted to lymphoid cells, and it localizes to
subnuclear structures that are distinct from PML nuclear bodies (34).
Phosphoprotein 41 (p41) is one of two highly related nuclear
phosphoproteins that display similarity to the ND region of NUDR and
that are inducible by interferons (35), a property shared with SP100-B
(36).
The carboxy terminus of hNUDR contains a zinc finger homology
(ZFH) region with 56% similarity to the analogous region in DEAF-1 and
also shows similarity to a functionally diverse set of proteins through
the conserved spacing of cysteine and histidine residues (Fig. 2C
). The
spacing of these residues in the nervy gene product was
previously suggested to resemble proteins that coordinate zinc through
zinc-finger domains, while probably lacking the necessary arrangement
for DNA binding (37). However, similarities of the NUDR ZFH domain with
the DNA binding domains of hPR and HNF-4 [a member of the nuclear
hormone receptor superfamily (38)], suggest a potential role of this
region in DNA binding. The AML-1/MTG8 fusion protein arises from a
t(8:21) translocation occurring in acute myeloid leukemias (AML), and
its homology to the ZFH domain suggests a third potential link of hNUDR
to oncogenic proteins produced in leukemias. Four other proteins with
ZFH similarity have potential roles in cell signaling: RACK7 is a
protein kinase C-binding protein (39); t-BOP is a zinc-finger protein
expressed in T cells and muscle (40); BS69 is an inhibitor of
adenovirus E1A transactivation (41); and PDCD2 is associated with the
process of programmed cell death (42). The conservation of the ZFH
pattern can also be seen in proteins from lower eukaryotes (celeganF23,
yeast72kd in Fig. 2C
), suggesting evolutionary conservation of a
functional motif. In summary, the database similarities shown in Fig. 2
suggest that NUDR contains functional domains often found in nuclear
transcription factors with developmental or oncogenic potential.
Tissue Distribution of NUDR mRNA
Northern blot analysis shows that the predominant NUDR mRNA form
in CV-1 cells has a molecular size of 2.4 kb, indicating that the
monkey cDNA that has been isolated is likely to be full length (Fig. 3A
). Examination of various rat tissues
for NUDR RNA expression showed the 2.4-kb mRNA in all tissues, with
highest levels of expression in brain, adrenal, and lung (Fig. 3B
). A
second hybridizing band of RNA, with an estimated size of 6 kb, was
observed in most tissues and represented the more abundant form in
lung. Whether this longer RNA represents an alternative splice variant
of a single NUDR gene or an RNA transcript from a highly related gene
is not currently known.
|
and protein
molecular mass standards. The discrepancy between the observed 72 kDa
and the calculated molecular size of 59 kDa suggests NUDR has an
anomalous mobility in SDS-PAGE. To further investigate this
discrepancy, recombinant sNUDR protein was produced in bacteria from a
plasmid in which the sequence encoding the first 22 amino acids of the
His-Tag vector was fused in frame to the ATG at position 396 of sNUDR
cDNA (see Materials and Methods). A polyclonal antibody to
recombinant NUDR was produced and used to detect the levels of
recombinant sNUDR and endogenous proteins in CV-1 cells, JEG-3 cells,
and various rat tissues by Western blot analysis (Fig. 5A
|
|
Since DEAF-1 had been characterized in the developing fly embryo, we
sought to determine whether NUDR protein was synthesized during
vertebrate development. Total proteins were prepared from 14-, 15-, and
17-day mouse fetuses and subjected to Western blot analysis (Fig. 5C
).
In each age of fetus tested, the 72-kDa NUDR protein was detected with
the immune serum, as well as one or two proteins of higher molecular
mass.
Although all tissues had shown the presence of the 2.4 kb NUDR mRNA in
Northern blots (Fig. 3
), detectable amounts of the 72-kDa NUDR protein
were only observed in testis, fetus, and the cell lines. This may
indicate that NUDR protein is unstable in most tissues and that
significant levels of the protein may occur only in cells that are
rapidly dividing or undergoing differentiation.
Cellular Localization of Endogenous and Transfected NUDR
To confirm that NUDR was a protein distinct from the protein
characterized as the secreted protein suppressin, we tested whether
NUDR was secreted into the media of CV-1 and HeLa cells that were
transfected with an expression vector for hNUDR. Cells were incubated
with 35S-labeled methionine/cysteine, and the proteins in
the culture media and cells were immunoprecipitated (Fig. 6
). 35S-labeled NUDR protein
was observed in the cell extracts of CV-1 and HeLa cells but was not
detected in the culture media. These results indicate that, under our
experimental conditions, NUDR is not a secreted protein.
|
|
|
|
NUDR activation of the pRARECAT6 reporter was compared with the
activation by the ligand-inducible retinoic acid receptor (hRAR
) to
ascertain the effectiveness of NUDR as a transcriptional activator at
the RARE and to investigate potential interactions between the two
proteins in vivo. CV-1 cells have low endogenous levels of
RARs as evidenced by a 1.8-fold increase in reporter activity with
retinoic acid (RA) treatment (Fig. 10
).
Cotransfection of cells with RAR
showed a minimal increase in CAT
activity in the absence of ligand (2-fold), which was increased to
7-fold in the presence of RA. In contrast, hNUDR increased
transcription 41-fold in the absence of RA, which was further elevated
to 50-fold with RA treatment. The RA-dependent increase is most likely
due to low levels of endogenous RA-activated factors and not due to
hNUDR binding of RA. These observations demonstrate the potency of NUDR
as a transcriptional activator relative to RAR
.
|
, additive effects were not
observed, but rather, intermediate levels of transcriptional activation
were observed [27-fold in the absence of RA and 38-fold in the
presence of RA (Fig. 10
) is likely a result
of competition at the RARE in which RAR displaces NUDR binding. This
premise is further supported by the similarity in activations produced
in cotransfections of hNUDR and RAR
with pRARECAT6 (27-fold),
compared with transfections in the absence of the RARE (hNUDR with
pEnk77CAT6 in Fig. 9
Nuclear Import of NUDR Is Essential for Transcriptional Activation
from the Proenkephalin Promoter
We compared the transactivation potential of monkey NUDR (sNUDR),
rat NUDR (rNUDR), and the human NUDR deletion variant (hNUDR8) to the
previously tested hNUDR. As shown in Fig. 11
, sNUDR, rNUDR, and hNUDR8 activated
transcription from the proenkephalin promoter to a similar extent as
hNUDR; however, in some assays the naturally occurring deletion of the
alanine-rich region in hNUDR8 showed a trend for reduced
transactivation by as much as 33% (not shown).
|
NUDR Activation of Proenkephalin Promoter Regions Appears to be
Independent of DNA Binding
In an attempt to identify the sequences through which NUDR
activated transcription of the pEnk77CAT6 reporter, enkephalin
sequences in the 5'-untranslated region (UTR) and 3'-UTR were
deleted, and the resulting reporter constructs were tested in CAT
assays. Deletion of nucleotides 65153 of the intron (position
71157) resulted in a 60.9-fold increase in activation by NUDR (Fig. 12
), but much of this fold change can
be attributed to a significant decrease in basal activity (relative to
pEnk77CAT6), as shown by the normalized CAT activity data. The deletion
of additional 5'-UTR sequences (
65213) decreased NUDR activation
(32.6-fold), indicating that sequences between 153 and 213 may
contribute to activation by NUDR. Additional sequences in the 3'-UTR
(1081 bp) may also contribute slightly to activation by NUDR as seen by
the decreased fold change with the reporters,
pEnk77CAT6
65213,
3'-UTR and pEnk77CAT6
3'-UTR. The normalized
CAT activities are shown for each reporter to indicate that there are
changes in both basal and NUDR-stimulated CAT activities. In all of
these constructs, the majority of the NUDR-dependent activation
appeared to map to a minimal promoter region (position -77 to +65),
suggesting that NUDR may act in close proximity to the basal
transcriptional machinery.
|
Identification of NUDR-Binding Sequences
To identify DNA sequences to which NUDR might bind with high
affinity, we used recombinant NUDR protein to select oligonucleotides
from a library of double-stranded degenerate oligonucleotides and then
amplified the selected sequences based on the method described by Lu
et al. (46). Briefly, a set of oligonucleotides were
synthesized that contained 30 random bases (1 x 1018
potential sequences), flanked on each end by different primer-specific
sequences. Glutathione-S-transferase-sNUDR (GST-sNUDR1.5)
fusion protein was immobilized on glutathione-agarose beads and used to
select DNA sequences from the random set of oligonucleotides for which
NUDR had affinity. Primers to each of the flanking sequences were then
used to amplify the selected internal sequences by PCR, and the
processes of affinity binding and amplification were repeated six times
to select for DNA sequences that were consistently bound to NUDR
protein. The DNA sequences were cloned into pBLCAT5 and sequenced to
produce a collection of NUDR-binding sequences or NBSs. The alignment
of 23 sequences from the approximately 100 oligonucleotides sequenced
is shown in Fig. 13A
. Analysis of the
sequences showed 52% of the 23 NBSs contained one or more copies of
the sequence TTCG, previously identified as the DEAF-1 core-binding
sequence (21). Twenty-two percent and 61% of the NBSs contained one or
more copies of the consensus motifs TTCGGG and TTTCCG,
respectively.
|
To confirm the DNA-binding activity of NUDR, EMSA and DNase I
protection assays were performed on DNA fragments derived from the NBS
consensus sequence (Fig. 14
). In both
assays, poly dI-dC was maintained at a level that had eliminated NUDR
binding to the RARE and proenkephalin sequences (500 ng). Increasing
levels of NUDR protein produced increased band intensity of the shifted
consensus sequence in an EMSA (Fig. 14A
). In DNase I protection assays,
increasing levels of NUDR protein provided increased protection to
three different radiolabeled DNA fragments (Fig. 14
, BD), verifying
NUDR binding to the entire length of the consensus sequence. NUDR also
extended its protection into the flanking vector sequence gatccgg,
which resulted from the ligation of the consensus sequence into the
BamHI site of pBLCAT5. Similar results were obtained for
NUDR binding to several of the individual NBS sequences in EMSA and
DNase I protection assays (data not shown).
|
|
| DISCUSSION |
|---|
|
|
|---|
Depicted as a secreted protein and a novel inhibitor of cell
proliferation, suppressin was initially purified from bovine pituitary
and was identified as a monomeric polypeptide with an isoelectric point
(pI) of 8.1 and a molecular mass of 63 kDa (27). A polyclonal antibody
to bovine suppressin was used to screen a rat pituitary cDNA library,
and a partial cDNA (691 bp) of rat suppressin was obtained. The 691-bp
clone was subsequently used to isolate a 924-bp cDNA by rescreening the
library by hybridization, and additional 5'-sequence was obtained by
5'-RACE (26). The 1882-bp cDNA called rat suppressin in the GenBank
(U59659) is most likely a compilation of these partial sequences.
Comparison of the conceptual protein encoded by the 1882-bp rat
suppressin cDNA (26) and purified bovine suppressin (27) shows little
similarity in amino acid composition and pI. Based on the 99%
nucleotide homology to rat NUDR (Fig. 1
), we suggest that the 1882-bp
rat sequence represents a partial cDNA with a downstream methionine
selected as the initiator methionine. Furthermore, the amino acids that
follow the indicated initiator methionines in either suppressin or NUDR
do not conform to the motifs required of signal peptides (47), making
it highly unlikely that these proteins would be secreted. Using
in vivo labeling, we were able to detect
35S-labeled NUDR protein in CV-1 cell and HeLa cell
extracts by immunoprecipitation, but were unable to detect any secreted
proteins in the culture media (Fig. 6
). As detailed in the experimental
results, we have determined that the encoded NUDR proteins localize to
the nuclei of cells and behave as transcription factors, making them
unlikely candidates for secreted regulatory factors. And although the
secreted protein characterized as suppressin has been shown to inhibit
cell proliferation, it remains to be demonstrated that the protein
encoded by the suppressin rat cDNA produces a secretory product that
can inhibit cell proliferation.
Using antibodies to NUDR in Western blot analysis (Fig. 5
), we observed
three proteins in rat brain extracts that were lower in molecular mass
than full-length NUDR but approximated the size of bovine pituitary
suppressin (63 kDa). The antibody also detected several proteins in
muscle and heart in the 3545 kDa range that either share similar
antigenic determinants with NUDR or are NUDR derivatives. Thus, it is
conceivable that NUDR has antigenic determinants that could be
recognized by anti-suppressin antibodies, potentially enabling the
identification of a rat NUDR clone by antibody screening.
The second most similar sequence to NUDR identified by computer comparisons was the Drosophila DEAF-1. DEAF-1 has been shown to be an important cofactor in Deformed (Dfd) gene expression during embryonic development. A 120-bp region of the Dfd promoter, referred to as module E, is capable of driving embryonic expression of a reporter gene in a pattern similar to endogenous Dfd expression (20) and contains binding sites for DEAF-1 and Dfd, through which Dfd can autoregulate its own expression (21). hNUDR showed 46% similarity overall with DEAF-1 and contained regions of higher homology. DEAF-1 was initially purified from embryonic nuclear extracts by DNA affinity chromatography and migrated as a 85-kDa protein in SDS gels (21). DEAF-1, like NUDR, shows anomalous migration in protein gels, as the calculated molecular mass of DEAF-1 is 62 kDa and the protein produced by in vitro transcription/translation migrates like a 85-kDa protein (noted in Ref. 21).
An alanine-rich region in the amino terminus of NUDR may contribute to
its transactivation as suggested by the decrease in CAT activity with
hNUDR8, which has a naturally occurring deletion of the alanine-rich
region (Fig. 11
). A decrease in transactivation was also obtained using
an amino-terminal deletion of sNUDR that lacked the first 75 amino
acids (data not shown). The sequence similarity of this region to
numerous homeodomain factors suggests that it may mediate an important
transactivation function during development.
NUDR shows high regional similarity to SP100 proteins that colocalize
with PML to subnuclear dot-like structures termed PML nuclear bodies.
In APL, the normal pattern of PML localization to nuclear bodies is
disrupted by a t(15;17) translocation, which produces a PML-RAR
fusion protein. The oncoprotein shows aberrant localization and
potentially contributes to APL pathogenesis (33). Treatment of
APL-derived cells with RA restores the nuclear bodies (33), and RA can
produce clinical remission of APL patients through differentiation of
leukemic cells into mature granulocytes with associated decreases in
cell proliferation (for reviews see Ref. 48). While a uniform nuclear
presence of NUDR is observed in HeLa and CV-1 cells, the similarities
to the SP100 proteins suggest interaction at PML nuclear bodies might
potentially occur in appropriate cell types. Because NUDR also shows
homology to leukemic oncogenes at its AA and ZFH domains, its
precise subnuclear localization in normal and transformed lymphoid
cells should be investigated.
The ZFH domain located at the carboxy terminus of both NUDR and DEAF-1 contains the sequence Cys-X2-Cys-X7-Cys-X2-Cys-X5-Cys-X3-Cys-X7-His-X3-Cys(Cys6HisCys). While cysteine residues frequently form disulfide bonds in extracellular proteins, cysteine and histidine residues are often used to bind metal ions, such as zinc, and stabilize structural folds of intracellular proteins (49). Although the exact spacings between cysteine residues and the histidine in NUDR and DEAF-1 are somewhat unusual, the motif is cognate of forming a zinc-binding domain (49) that may contribute to protein-protein interactions, DNA binding, and transcriptional activation. Gross and McGinnis (21) suggest this domain serves a non-DNA-binding role, since they were unable to obtain DNA binding in EMSA and DNase I protection assays with an amino-terminal truncated DEAF-1 that consisted of only the last 84 amino acids. In addition, they state that altering the second and third cysteines to serines in this domain did not affect the ability of full-length DEAF-1 to bind DNA in EMSA. Similarly, we have found that deletion of the last 60 amino acids of hNUDR resulted in only slight decreases in DNA binding by EMSA and transactivation in CAT assays (data not shown). Unlike many zinc finger domains that are critical for DNA binding, these data suggest that the ZFH region does not appear to be an independent DNA-binding module.
NUDRs affinity for DNA was used to select specific DNA-binding
sequences, and a direct repeat of TTC(G/C)GG was derived as a
NUDR-binding motif. Interestingly, the sequence TTCGG is found between
the RARE half-sites in hRARß2 (50), mRARß2 (51), and the
RA-responsive mHoxa-1 (52) and may contribute to the higher
levels of NUDR-induced CAT activity from pRARECAT6 over pEnk77CAT6.
However, NUDR may also bind to some DNAs with low affinity and/or
recognize additional sequences, since NUDR was able to bind the DR2
RARE (Fig. 8B
), which lacks a TTCGG sequence, and because moderate
levels of nonspecific competitor DNA readily displaced NUDR binding at
the RAREs. NUDR binding of DNA is not synonymous with transactivation
since constructs containing one and two copies of a RARE, NBS, or the
NBS consensus were unable to confer NUDR-dependent activation to the
thymidine kinase promoter in CAT assays. If NUDR DNA-binding activity
exists to promote transactivation, then these studies indicate that the
promoter context and/or the presence of multiple binding motifs of
specific spacing may be important for NUDR transcriptional activation
of target genes. However, as already noted, we have been unable to
demonstrate high-affinity binding of NUDR to any proenkephalin
sequences, which implies that NUDR may regulate proenkephalin
transcription through mechanisms other than DNA binding, such as
protein-protein interaction.
The TTCG motif has been identified as the core binding sequence of DEAF-1 and is found in region 56 of the Dfd promoter (21). Multiple copies of the motif and/or mutations that improved DEAF-1 binding in vitro generally increased the expression of the corresponding transgene in Drosophila embryos (21). Since the Dfd binding site and region 56 were required for segment- specific expression of Dfd in the embryo (20), DEAF-1 or a similar protein was postulated to be a cofactor of the homeodomain protein Dfd and required for Dfd expression (21). DEAF-1 is one of a growing number of nonhomeodomain proteins that have been identified as cofactors of homeodomain proteins. Two models have been proposed in which protein cofactors may interact with Hox and homeodomain-containing proteins to achieve greater target gene binding specificity. The coselective binding model envisions cofactors selectively targeting homeodomain proteins to different DNA sites, and the widespread binding model envisions cofactors altering the activity of homeodomain proteins that are already bound to the DNA (3). The close proximity of the binding sites for DEAF-1 and the homeodomain protein Dfd in the Dfd promoter would suggest a likely interaction among these proteins. However, Gross and McGinnis indicated that, at least in mobility shift assays, they had failed to detect cooperative interaction between DEAF-1 and Dfd and postulated that additional factor(s) may be required to form an activating transcription complex (21). The demonstration that DEAF-1 was also able to bind multiple regions in the promoter of human HOXD4 gene, a vertebrate homolog of Dfd (21), implies the existence of a mammalian counterpart of DEAF-1. The expression of NUDR during mouse fetal development and the strong sequence and functional similarities between NUDR and DEAF-1 would indicate that NUDR is a potential vertebrate homolog of DEAF-1 and, by analogy, may serve as a potential cofactor to homeodomain proteins and regulate the expression of the paralogous group 4 Hox genes and other downstream target genes. Future investigations will focus on the possible mediating role of NUDR in these developmental processes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
ZAP
II vector, Stratagene, La Jolla, CA). Protein replica filters were
prepared as described (53): 7 x 105 pfu were plated
(20 x 150-mm plates) on a lawn of E. coli strain XL-1
Blue MRF'. Plates were incubated 3.5 h at 37 C until pinpoint size
plaques appeared and then overlayed with nitrocellulose filters that
had been soaked in 10 mM
isopropyl-ß-D-thiogalactopyranoside (IPTG). The
filters were incubated at 37 C for 5 h to induce
ß-galactosidase-fusion protein production before being placed in
blocking solution [25 mM KCl, 25 mM HEPES (pH
7.3), 0.05% Triton X-100, 2% nonfat milk, 1 mM
dithiothreitol (DTT)] at 4 C. The filters were then screened for
proteins capable of binding to the DR5 RARE found in the human RARß
promoter (25). The oligo 5'-GATCCAGGGTTCACCGAAAGTTCACTG-3'
was hybridized with the complementary oligo
5'-GATCCAGTGAACTTTCGGTGAACCCTG-3' (the RARE-containing
sequence is shown in bold, with flanking BamHI sites) and 50
pmol of this sequence were radiolabeled by a fill-in reaction with T4
DNA polymerase and 32P-
-dATP (ICN Pharmaceuticals, Costa
Mesa, CA), followed by phosphorylation and ligation of the DNA to form
multimers. The radiolabeled probe was added to the filters in 75 ml of
binding buffer (blocking buffer with nonfat milk reduced to 0.25%, and
10 µg/ml salmon sperm DNA) and incubated overnight with shaking at 4
C. The filters were washed over a 30-min period in 2 x 250 ml
binding buffer with salmon sperm DNA and 2 x 500 ml binding
buffer without salmon sperm DNA, and then exposed to x-ray film
overnight. Initial screening with the RARE sequence showed two positive
plaques, but only one continued to show binding through tertiary
screening. After excision from the
ZAP II vector and
EcoRI digestion, the pBluescript plasmid was found to
contain a 1.6-kb insert, which, upon further sequence analysis, was
identified as a partial clone (sNUDR1.6).
A human choriocarcinoma cell line (JEG-3) cDNA library was constructed
from cDNA synthesized from JEG-3 mRNA primed with oligo-dT using the
SuperScript Choice System (Life Technologies, Gaithersburg, MD). The
cDNA was ligated into
Zap II and packaged with Gigapack III Gold
packaging extracts (Stratagene). The JEG-3 cDNA library contained
3 x 106 independent clones.
A 1.5-kb EcoRI/SmaI fragment of the monkey NUDR cDNA (sNUDR1.6) was radiolabeled by random priming and used to rescreen the CV-1 cDNA library (106 clones) and the JEG-3 cDNA library (106 clones) by hybridization. DNA from the plaques was lifted onto nitrocellulose filters and hybridized to the radiolabeled probe in 5 x SSPE (750 mM NaCl, 50 mM sodium phosphate, 5 mM EDTA), 0.5% SDS, 10 µg/ml salmon sperm DNA, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.1% BSA, and 50% formamide, overnight with shaking at 50 C. Filters were washed in 2 x SSPE for 45 min at 50 C, dried, and exposed to x-ray film to identify hybridizing clones. A monkey clone (2405 bp, sNUDR) and two human clones (2065 bp, hNUDR; 2328 bp, hNUDR8) were isolated and sequenced using Thermo Sequenase cycle sequencing kit (Amersham Corp., Arlington Heights, IL). Sequence comparison of the 1.6-kb and 2.4-kb monkey clones revealed a single nucleotide difference in the coding region that resulted in the substitution of an aspartic acid in the shorter clone relative to the asparagine (codon 287) in sNUDR.
A Sprague Dawley rat testicular germ cell library was constructed from cDNA synthesized in a similar manner to the JEG-3 cDNA library and contained 1 x 106 independent clones. Oligonucleotide primers corresponding to position 12271245 and 16771660 of rat suppressin (accession no. U59659) were used to amplify a 434-bp DNA fragment from rat testis cDNA, which was cloned into pBSKS and sequenced to confirm the identity. The DNA fragment was radiolabeled and used to screen the germ cell library for full-length rat NUDR clones using conditions similar to those stated above.
Bacterial Expression Plasmids and Recombinant Protein
Production
The cDNAs for sNUDR and hNUDR were subcloned into the pET-16b
vector (Novagen, Inc. Madison, WI) for production of recombinant
proteins in bacteria. The cDNA fragments containing sNUDR and hNUDR
were excised from pBSSK by BspEI and EcoRI
digestion, followed by T4 DNA polymerase fill-in, ligation of
XhoI linkers, and digestion with XhoI. The 2.0-kb
XhoI fragments were subcloned into the
XhoI-digested pET-16b vector. DNA sequencing was used to
confirm the correct insertion of the cDNAs in the vector. Resulting
fusion proteins have an amino-terminal extension of 10 histidines
followed by a factor Xa cleavage site.
hNUDR and sNUDR in pET-16b plasmids were introduced into E. coli strain BL21(DE3), and the expression of His-Tag-hNUDR and His-Tag-sNUDR proteins was induced by the addition of 1 mM IPTG during the last hour of bacterial growth. Bacterial pellets were sonicated in 5 ml of buffer A [6 M guanidine HCl, 0.1% IGEPAL CA-630 (Sigma, St. Louis, MO), 100 mM KCl, 20 mM Tris (pH 8.0)] and shaken for 1 h to solubilize proteins. Insoluble material was removed by centrifugation at 15,000 x g at 15 C for 20 min, and the supernatant was loaded onto a column containing 1 ml of His-Bind metal chelation resin (Novagen). The column was washed with buffers and recombinant His-Tag proteins were eluted from the column with buffer D [8 M urea, 100 mM KCl, 20 mM Tris (pH 6.8), 500 mM imidazole]. Proteins were renatured by five successive rounds of dialysis at 4 C in buffers that reduced the urea and increased glycerol to a final buffer of 15 mM Tris (pH 7.5), 50 mM KCl, 50% glycerol, 10 µM ZnCl2, and 1 mM DTT.
A GST-sNUDR (1.5) fusion protein was produced in bacteria from a plasmid constructed by ligation of a 1.5-kb SmaI fragment of sNUDR1.6 into the SmaI site of pGEX-2T (Pharmacia Biotech, Piscataway, NJ). The expression of the GST-sNUDR1.5 fusion protein in E. coli strain CAG 748 (New England BioLabs, Beverly, MA) was induced by the addition of IPTG, and the recombinant protein was purified by affinity chromatography on glutathione-agarose.
hRAR
was excised from the plasmid pGEMhRAR
(kindly provided by
Dr. R. Evans, Salk Institute) by MscI digestion, followed by
ligation of BamHI linkers, digestion with BamHI,
and ligation of the DNA fragment into the BamHI site of
pGEX-2T. GST-hRAR
fusion protein was purified by affinity
chromatography and treated with thrombin to cleave the GST moiety from
hRAR
immediately before use in the EMSA.
Purified recombinant proteins and BSA protein standards were separated on SDS-PAGE, stained with Coomassie blue, and scanned with a Densitometer SI (Molecular Dynamics, Sunnyvale, CA) to determine protein concentrations.
In vitro transcription/translation was used to produce
recombinant proteins using the TNT Coupled Reticulocyte Lysate System
(Promega, Madison, WI) and 1 µg of the plasmids, sNUDR in pBSSK,
hNUDR in pBSSK, and hRXR
(the cDNA equivalent to position 761866
in Ref. 54) in pBSKS, according to the supplied instructions.
Mammalian Expression Plasmids
The cDNAs for NUDR were subcloned into pCMVNeo to obtain high
levels of expression from the human cytomegalovirus immediate early
gene promoter (CMV). The cDNAs for hNUDR, sNUDR, rNUDR, and hNUDR8 were
excised from pBSSK by EcoRI digestion, followed by T4 DNA
polymerase fill-in, ligation of BamHI linkers, and digestion
with BamHI. The BamHI fragments were subcloned
into the BglII site of eukaryotic expression vector pCMVNeo
(55). Sequenc-ing pCMVhNUDR, pCMVsNUDR, pCMVrNUDR, and
pCMVhNUDR8 confirmed that the orientation of the 5'-end of the
cDNAs was adjacent to the CMV promoter.
To examine subcellular localization of hNUDR by a nonimmunological method, hNUDR was also subcloned into pEGFP-N3 vector (CLONTECH, Palo Alto, CA) to produce a fusion protein with GFP at the amino terminus. Expression is under the control of the CMV promoter. The cDNA fragment containing hNUDR was excised from pBSSK by BspEI and Bsu36I digestion, followed by Klenow fill-in, ligation of BamHI linkers (10 mers, New England BioLabs), and digestion with XhoI. The 2.0-kb XhoI fragments were subcloned into BamHI-digested pEGFP-N3. Sequencing pEGFP-hNUDR confirmed the 5'-end of the cDNA was in the same reading frame as GFP.
Site-directed mutagenesis was used to produce in vitro mutations in the NLS of NUDR using a megaprimer PCR method (56). To generate the mutant megaprimers, 20 cycles of amplification were performed using the 2.0-kb EcoRI fragment of NUDR as the template, a reverse primer (TGATAGCCGGGATAGTGAG), and either the mutant R302T primer (GTGCCTTACAAAACGCGC) to change Arg 302 (AGG) codon to a Thr (ACG) or the mutant K304T primer (GCGCACGAAGGAGAATG), which changes the codon for Lys 304 (AAG) to a Thr (ACG). The resultant 289-bp and 302-bp DNA products were gel isolated and used as mutant megaprimers in the second round of amplification using the same template and a forward primer (TTAAACCCTCACGCTGCCTC). The PCR products were gel isolated and digested with AflII and AatII, and the fragments containing the mutations were substituted for the corresponding region in hNUDR in pBSSK. The double mutation R302T/K304T was generated using the R302T mega primer, the reverse primer, and a 2.0-kb EcoRI fragment of hNUDR with the K304T mutation as the template. DNA sequencing confirmed the presence of each of the three mutations before the subcloning of the 2.0-kb EcoRI fragments into the pCMVNeo vector as above. Oligonucleotides were synthesized by Operon Technologies, Inc. (Alameda, CA).
Reporter Constructs
Previously (23), we had constructed a human basal proenkephalin
reporter plasmid (ENK84CAT) that contained 84 bp of 5'-flanking
sequence, 69 bp of exon I, 86 bp of intron A, and 55 bp of exon II,
fused to the CAT gene and followed by 1081 bp of proenkephalin
3'-flanking sequence. This reporter plasmid displayed minimal induction
by cAMP, the PKA catalytic subunit, and RA. Two copies of a DR5 RARE
sequence were inserted into a BamHI site 5' to position -84
of the proenkephalin promoter, producing the plasmid RARECAT, which was
then shown to be RA responsive (23). To remove a potentially
problematic AP2 consensus sequence, these plasmids were digested with
PstI and NaeI, filled in with Klenow, and
religated, resulting in plasmids that eliminated the AP2 site and
reduced proenkephalin 5'-flanking sequence to position -77 to 213
(transcription start site at position +1 as defined by sequence
accession no. J00122). To further reduce basal reporter activity, the
regions defined above were removed as
BglII/HindIII (blunt) cassettes from their parent
pSP73 vectors and substituted into the BglII/SmaI
region of pBLCAT6 (accession no. M80484). The resulting plasmids were
termed pEnk77CAT6 and pRARECAT6, respectively. The plasmid pBLCAT5
(accession no. M80483) contains a 169-bp region of the thymidine kinase
promoter inserted into pBLCAT6. The plasmid pRARECAT5 was constructed
by placement of a BglII/SalI fragment of RARECAT6
(containing two RARE motifs) into the BamHI/SalI
site of pBLCAT5. The plasmid pDynCAT3 was constructed by placement of a
1.9-kb HindIII/NheI fragment of the rat
prodynorphin promoter (57) into the HindIII/XbaI
site of pBLCAT3 (accession no. X64409). The reporter plasmids,
pEnk77CAT6
65153 and pEnk77CAT6
65213, are equivalent to
deletion of bases 65153 and 65213 of the proenkephalin sequences
(accession no. J00122) in pEnk77CAT6, respectively. The plasmids,
pEnk77CAT6
3'-UTR and pEnk77CAT6
65213,
3'UTR, are equivalent
to the deletion of 1081 bases of enkephalins 3'-UTR (position
19853065, accession no. K00489) from pEnk77CAT6 and
pEnk77CAT6
65213, respectively. All plasmid constructs were
confirmed by DNA sequencing. pNBScons2.11CAT5 and pNBScons2.12CAT5
contain a single copy of the NBS consensus sequence shown in Fig. 14E
but in opposite orientations, and pNBScons2.8CAT5 contains two copies
of the NBS consensus sequence as shown in Fig. 14F
. The plasmids,
pBLCAT3, pBLCAT5, and pBLCAT6 (58), were kindly provided by Gunther
Schutz, German Cancer Research Center, Heidelberg.
Selection of NUDR-Binding Sequences
GST-sNUDR (GST-sNUDR1.5) fusion protein was immobilized on
glutathione-agarose beads and used to select DNA sequences with
affinity to NUDR from a random set of double-stranded oligonucleotides
(1 x 1018 potential sequences) that contained 30
random bases and were flanked on each end by different primer-specific
sequences following the method described by Lu et al. (46).
After six rounds of NUDR-affinity selection and PCR amplification, the
oligonucleotides called NBSs were kinased, ligated into the
BamHI site of pBLCAT5, and sequenced. A final round of
selection was performed using EMSA, and the eNBSs were isolated from
the gel-shifted NUDR/DNA complex and cloned into pBLCAT5, as above.
RNA Isolation and Northern Blot Analysis
Total RNA from CV-1 cells and rat tissues was isolated using
TRIzol reagent per suppliers instructions (Life Technologies) with
subsequent isolation of poly A+ RNA by oligo-dT chromatography. Ten
micrograms of total RNA or poly A+ RNA were separated on 1.0% agarose
gels containing 6% formaldehyde, 20 mM HEPES (pH 7.8), and
1 mM EDTA and then transferred to nylon membranes. A
1.37-kb EcoRI/SmaI cDNA fragment of the 1.6- kb
monkey clone was radiolabeled by random priming and used to probe the
membrane containing the CV-1 RNAs. A DNA fragment of rNUDR
(corresponding to position 14811931) was radiolabeled by random
priming and used to probe a membrane containing the rat RNAs. After
overnight hybridization in 400 mM sodium phosphate (pH
7.2), 5% SDS, 1 mM EDTA, 1 mg/ml BSA, and 50% formamide
at 62 C, the membranes were washed in 0.1 x SET (1 mM
Tris, pH 7.5, 0.5 mM EDTA, 0.1% SDS) at 70 C and
autoradiographed. X-ray films were scanned and digitized with a
Densitometer SI (Molecular Dynamics).
Antibodies
Antibodies to the full-length recombinant hNUDR and to the
MAP-conjugated peptide VKKDSPKNITLLPAT (amino acids 314328 of hNUDR)
were produced in rabbits by Research Genetics, Inc. (Huntsville,
AL).
In Vivo Labeling and Immunoprecipitation
HeLa and CV-1 cells were plated at a density of 300,000 cells on
6-cm plates in DMEM supplemented with 5% FBS and transfected with 5
µg CMVsNUDR per plate by calcium phosphate precipitation (59). Five
hours after glycerol shock, the culture medium was replaced with 1 ml
of F-12 medium deficient in methionine and cysteine plus 150 µCi
35S translabel (ICN). The cells were cultured for 4 h
in the labeling media before collection of the media for
immunoprecipitation of secreted proteins. The cells were scraped in 1
ml of immunoprecipitation buffer [0.5% Triton X-100, 0.5%
deoxycholate, 150 mM NaCl, 50 mM Tris, pH 7.5,
5 mM EDTA, and Complete protease inhibitor cocktail
(Boehringer Mannheim, Indianapolis, IN)] and lysed by freeze-thaw.
Particulates were removed from cell extracts and media by
centrifugation for 10 min at 30,000 x g. Aliquots (250
µl) of the cell extracts and media were mixed with 400 µl of
immunoprecipitation buffer plus 2 µl immune serum (antibody to
full-length NUDR) or preimmune serum and incubated overnight with
shaking at 4 C. Ten microliters of protein A agarose beads (Life
Technologies) were added and incubated for 1 h at 25 C. The immune
complexes/beads were washed with 4 x 0.5 ml immunoprecipitation
buffer at 25 C to remove nonspecific binding, boiled in SDS loading
buffer for 10 min, and subjected to SDS-PAGE analysis. The gel was
dried and imaged with a 445 SI PhosphorImager (Molecular Dynamics,
Sunnyvale, CA). Image analysis indicated that 85% of the in
vitro translated NUDR (Fig. 6
, lane 1) was immunoprecipitated
(Fig. 6
, lane 3).
Total Protein Preparation and Western Blot Analysis
Testicular cell fractions were either isolated directly or using
short-term primary culture, as previously described (60). Frozen cell
pellets were resuspended in 300 µl (50 mM HEPES (pH 7.3),
0.4 M NaCl, 2 mM DTT, 20% glycerol, and
Complete protease inhibitor cocktail). Homogenization was performed by
30 strokes in a Dounce homogenizer with A-sized pestle and one
freeze-thaw cycle on dry ice. The homogenate was centrifuged for 1
h at 30,000 x g at 4 C to obtain the soluble protein
fraction. Frozen rat tissues were homogenized in 50 mM Tris
(pH 7.4), 1% IGEPAL CA-630, 0.25% sodium deoxycholate, 150
mM NaCl, 1 mM EDTA, 1 mM
phenylmethylsulfonyl fluoride, 1 mM NaF, and 1 µg/ml of
aprotinin, leupeptin, and bacitracin. Mouse embryos were homogenized in
8 M urea, 50 mM Tris (pH 7.5), 50
mM NaCl, 1 mM EDTA, 0.1% Triton X-100, and
0.1% Tween 20. Protein concentrations of cell and tissue homogenates
were determined from a protein standard curve using a BCA protein assay
(Pierce, Rockford, IL). Total proteins were separated on a 10% SDS
denaturing gel and electrophoretically transferred to a nitrocellulose
membrane. The membrane blot was blocked with 1% BSA and 5% nonfat dry
milk in 200 ml TBS (25 mM Tris, pH 7.4, 137 mM
NaCl, 2.7 mM KCl) with shaking for 12 h, incubated with
NUDR polyclonal antibody (diluted 1:5000) in TBS and 2% nonfat dry
milk for 12 h, washed, incubated with a 1:10,000 dilution of goat
antirabbit second antibody linked to horseradish peroxidase (Vector
Labs, Burlingame, CA) in TBS and 2% nonfat milk for 1 h, washed,
and detected using Super Signal ULTRA substrate (Pierce). All
incubations were performed at 25 C, and washes consisted of 3 x
200 ml volumes of TBS and 0.01%0.05% Tween 20 for 15 min. A
detection limit of approximately 1 ng NUDR protein was achieved with
the polyclonal antiserum, while the detection limit of 20 ng was
achieved with the peptide antibody. Blots were exposed to x-ray film
and the films were scanned with the Densitometer SI.
Electrophoretic Mobility Shifts
Recombinant hNUDR protein (35 pmol) was incubated on ice with
either poly dI-dC, poly dA-dT, or salmon sperm DNA (02 µg) as
nonspecific competitor in a 20-µl reaction containing 50
mM KCl, 20 mM HEPES (pH 7.3), 2 mM
DTT, 5% glycerol, and 0.1% Triton X-100. After 15 min of incubation
on ice, 120240 fmol of 32P-labeled oligonucleotide probe
were added and incubated an additional 20 min at 25 C. Probes were
labeled by Klenow fill-in reactions of double-stranded oligonucleotides
formed by hybridization of complementary oligos for the DR5 RARE
(sequences shown in the cloning section) and the DR2 RARE
[5'GATCCGATAGGTCAAA-AGGTCAGAG-3' and
5'-GATCCTCTGACCTTTTGACCT-ACG-3' from mCRBP-I
(61)]rsqb]; or an EcoRI and HpaI DNA fragment
excised from pNBScons2.11CAT5 for the NBS consensus probes (consensus
sequence shown in Fig. 14E
). In the competition experiment with
RAR/RXR, 240 fmol of radiolabeled DR5 or DR2 oligo were incubated with
38 pmol of hNUDR and/or 1 pmol of hRAR
plus 2 µl of hRXR
produced in a TNT reaction (Promega). Protein-DNA complexes were
separated from free probe on a 4% nondenaturing acrylamide gel
(acrylamide:bis, 40:0.8, in 80 mM Tris, pH 8.0, 1
mM EDTA) at 40 mA for 4 h. Results were imaged with a
445 SI PhosphorImager.
DNase I Protection Assay
DNA fragments containing the NBS consensus sequence (one or two
copies) were radiolabeled by fill-in using Klenow and
-32P-dNTP. After phenol/chloroform extraction and two
ethanol precipitations, the radiolabeled probe was resuspended in 50
mM KCl, 20 mM Tris (pH 7.5) at 2000 cpm/µl.
Recombinant His-Tag-hNUDR protein (40120 pmol) was mixed with 0.5
µg poly dI/dC in binding buffer, (20 mM HEPES, pH 7.3, 75
mM KCl, 2 mM DTT, 7.5% glycerol, 0.1%
Triton-X-100) in a final volume of 25 µl and incubated on ice for 15
min. The radiolabeled DNA probe (5 µl) was added and incubated at 25
C for 1015 min before the addition of 3 µl of diluted (1:75) RQ1
DNase I (Promega) and MgCl2/CaCl2 to a final
concentration of 5 mM. After digestion for 90 sec at 25 C,
the reaction was terminated by the addition of 2 x STOP (0.2
M NaCl, 20 mM EDTA, 0.5% SDS, 0.25 mg/ml
salmon DNA). Samples were phenol/chloroform extracted and ethanol
precipitated before separation on 6% sequencing gels.
Cell Culture and Transfection
Cells were maintained in DMEM supplemented with 5% FBS (Summit
Biotechnologies, Fort Collins, CO) in a humidified chamber maintained
at 37 C and 5% CO2. CV-1 cells were plated at a density of
300,000 cells per 60-mm dish and transfected with plasmid DNA by
calcium phosphate precipitation (59), glycerol shocked, and harvested
3640 h after the precipitates were placed on the cells (55). In all
experiments, triplicate plates of cells were cotransfected with 2 µg
of the indicated reporter plasmid; 5 µg of the internal control
plasmid SV2ßgal; 1 µg of expression plasmid driven by the CMV
promoter [CMVNeo (control), human RAR
(hRAR
), monkey NUDR
(sNUDR), human NUDR (hNUDR), hNUDR with a 14 amino acid deletion
(hNUDR8), nuclear localization mutations (hNUDR-R302T, hNUDR-K304T, and
hNUDR-R302T/K304T)]; and additional plasmid DNA to maintain the total
amount of transfected DNA at 17 µg. For some experiments, cells were
treated with 1 µM RA for the last 24 h before
harvest.
CAT Assay
Cell extracts were prepared by sonication in 200 µl of
homogenization buffer (10 mM sodium phosphate buffer, pH
7.0, 1 mM EDTA, 1 mM DTT, and 250
mM sucrose). CAT activity in 25 µl of extract was assayed
after incubation for 3 h at 37 C (62), and ß-galactosidase
activity in 25 µl of extract was measured, as previously described
(63). CAT activity is the counts per min in the acetylated products,
normalized to the ß-galactosidase activity in each extract. In
addition, the data are expressed as "fold induction" which is the
ratio of CAT activity produced by a reporter plasmid cotransfected with
a given expression vector, divided by the CAT activity produced by the
reporter plasmid alone.
Localization of Proteins by Intrinsic Fluorescence and
Immunofluorescence
Antibodies were used to detect endogenous NUDR expression in
CV-1 cells or overexpressed NUDR in transfected CV-1 cells. For
endogenous NUDR expression, cells were plated onto slides and cultured
overnight before fixation and treatment as described below. For
overexpressed NUDR, cells were plated at a density of 65,000 per well
in a Lab-Tek II chamber slide (Nalge Nunc International, Naperville,
IL) and transfected by calcium phosphate precipitation of 1.5 µg of
plasmid DNA (CMV promoter driving the expression of the cDNAs for
hNUDR, hNUDR-R302T/K304T, GFP, or GFP-hNUDR). The cells were rinsed
with PBS, fixed for 15 min in 4% paraformaldehyde, rinsed with PBS,
permeablized for 7 min in 100% methanol at -20 C, rinsed with PBS,
and then incubated at 25 C in normal goat serum (Vector Laboratories)
for 20 min. The normal goat serum was removed and the slides were
incubated with 1:1000 dilution of either preimmune rabbit serum or
anti-NUDR serum overnight at 4 C. The slides were rinsed with PBS,
incubated for 1 h at 25 C with either a 1:100 dilution of goat
antirabbit antibody conjugated to fluorescein isothiocyanate (Sigma,
St. Louis, MO) or a biotinylated goat antirabbit second antibody and
fluorescein-conjugated avidin, and rinsed with PBS, after which
coverslips were mounted on the slides using VECTASHIELD Mounting Medium
(Vector Laboratories). For endogenous NUDR, indirect immunofluorescence
was observed using fluorescein filters with an Olympus IMT-2
microscope. For overexpressed NUDR, fluorescent images were obtained
from an Olympus Fluoview Confocal Imaging System attached to an Olympus
IX-70 inverted microscope.
Experimental Animals
Use of animals in this study was conducted in accordance with
the principles and procedures outlined in "Guidelines for Care and
Use of Experimental Animals" and also in accordance with protocols
issued by the Southern Illinois University Animal Care Committee.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was funded by NIH Grants HD-31613 (to J.I.H.), HD-32484 (to M.W.C.), and a grant from Southern Illinois Universitys Office of Research Development and Administration.
1 These authors contributed equally to this work. ![]()
2 Current address: Department of Biology, Mailcode 0322, UCSD, La
Jolla, California 92093. ![]()
Received for publication February 25, 1998. Revision received June 16, 1998. Accepted for publication July 6, 1998.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Gyamera-Acheampong and M. Mbikay Proprotein convertase subtilisin/kexin type 4 in mammalian fertility: a review Hum. Reprod. Update, March 1, 2009; 15(2): 237 - 247. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Reed, X. M. Huang, J. A. Wohlschlegel, M. S. Levine, and K. Senger DEAF-1 regulates immunity gene expression in Drosophila PNAS, June 17, 2008; 105(24): 8351 - 8356. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Czesak, S. Lemonde, E. A. Peterson, A. Rogaeva, and P. R. Albert Cell-Specific Repressor or Enhancer Activities of Deaf-1 at a Serotonin 1A Receptor Gene Polymorphism J. Neurosci., February 8, 2006; 26(6): 1864 - 1871. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Jensik, J. I. Huggenvik, and M. W. Collard Identification of a Nuclear Export Signal and Protein Interaction Domains in Deformed Epidermal Autoregulatory Factor-1 (DEAF-1) J. Biol. Chem., July 30, 2004; 279(31): 32692 - 32699. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hahm, E. Y. M. Sum, Y. Fujiwara, G. J. Lindeman, J. E. Visvader, and S. H. Orkin Defective Neural Tube Closure and Anteroposterior Patterning in Mice Lacking the LIM Protein LMO4 or Its Interacting Partner Deaf-1 Mol. Cell. Biol., March 1, 2004; 24(5): 2074 - 2082. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lemonde, G. Turecki, D. Bakish, L. Du, P. D. Hrdina, C. D. Bown, A. Sequeira, N. Kushwaha, S. J. Morris, A. Basak, et al. Impaired Repression at a 5-Hydroxytryptamine 1A Receptor Gene Polymorphism Associated with Major Depression and Suicide J. Neurosci., September 24, 2003; 23(25): 8788 - 8799. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Surdo, M. J. Bottomley, M. Sattler, and K. Scheffzek Crystal Structure and Nuclear Magnetic Resonance Analyses of the SAND Domain from Glucocorticoid Modulatory Element Binding Protein-1 Reveals Deoxyribonucleic Acid and Zinc Binding Regions Mol. Endocrinol., July 1, 2003; 17(7): 1283 - 1295. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kaul, J. A. Blackford Jr., S. Cho, and S. S. Simons Jr. Ubc9 Is a Novel Modulator of the Induction Properties of Glucocorticoid Receptors J. Biol. Chem., April 5, 2002; 277(15): 12541 - 12549. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-H. Chen, J. W. Yip, A. F. R. Stewart, and E. Frank Differential expression of a transcription regulatory factor, the LIM domain only 4 protein Lmo4, in muscle sensory neurons Development, January 11, 2002; 129(21): 4879 - 4889. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kaul, J. A. Blackford Jr., J. Chen, V. V. Ogryzko, and S. S. Simons Jr. Properties of the Glucocorticoid Modulatory Element Binding Proteins GMEB-1 and -2: Potential New Modifiers of Glucocorticoid Receptor Transactivation and Members of the Family of KDWK Proteins Mol. Endocrinol., July 1, 2000; 14(7): 1010 - 1027. [Abstract] [Full Text] |
||||
![]() |
H. Zeng, S. Kaul, and S. S. Simons Genomic organization of human GMEB-1 and rat GMEB-2: structural conservation of two multifunctional proteins Nucleic Acids Res., April 15, 2000; 28(8): 1819 - 1829. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Christensen, S. F. Cotmore, and P. Tattersall Two New Members of the Emerging KDWK Family of Combinatorial Transcription Modulators Bind as a Heterodimer to Flexibly Spaced PuCGPy Half-Sites Mol. Cell. Biol., November 1, 1999; 19(11): 7741 - 7750. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Michelson, M. W. Collard, A. J. Ziemba, J. Persinger, B. Bartholomew, and J. I. Huggenvik Nuclear DEAF-1-related (NUDR) Protein Contains a Novel DNA Binding Domain and Represses Transcription of the Heterogeneous Nuclear Ribonucleoprotein A2/B1 Promoter J. Biol. Chem., October 22, 1999; 274(43): 30510 - 30519. [Abstract] [Full Text] [PDF] |
||||
![]() |
X Li, A Veraksa, and W McGinnis A sequence motif distinct from Hox binding sites controls the specificity of a Hox response element Development, January 12, 1999; 126(24): 5581 - 5589. [Abstract] [PDF] |
||||
![]() |
T. M. Sugihara, I. Bach, C. Kioussi, M. G. Rosenfeld, and B. Andersen Mouse Deformed epidermal autoregulatory factor 1 recruits a LIM domain factor, LMO-4, and CLIM coregulators PNAS, December 22, 1998; 95(26): 15418 - 15423. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |