| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Bone and Mineral Metabolism Charles A. Dana and Thorndike Laboratories Department of Medicine Beth Israel Deaconess Medical Center and Harvard Medical School Boston, Massachusetts 02215
| ABSTRACT |
|---|
|
|
|---|
-pBz2),L-2-Nal23,Arg26,27,Tyr34]bPTH-(134)NH2
(125I-K13). Using site-directed mutagenesis in
combination with biochemical analysis, we have reduced our previously
identified contact domain, 17 residues in the extracellular region of
the receptor (173189), to an 8-amino acid domain (182189).
Furthermore, we have found arginine 186 to be of critical importance to
the interaction of the hPTH1 Rc with 125I-K13:
modification of Arg186 to either lysine or
alanine does not modify receptor avidity or signal transduction by the
receptor, but eliminates cross-linking to
125I-K13. | INTRODUCTION |
|---|
|
|
|---|
The elucidation of the details of the bimolecular interaction between PTH and its receptor is critical for understanding the basis of molecular recognition and the mechanism of signal transduction by the receptor. Such structural insight may aid in the rational design of PTH-like molecules with increased potency, improved selectivity, and even oral bioavailability. While continuous administration of PTH has catabolic effects on bone, low dose, intermittent PTH treatment has been shown to increase bone mass (6, 7, 8, 9), demonstrating that PTH can act as a powerful anabolic agent with potential for clinical use in the treatment of osteoporosis (4).
Previous efforts to understand the nature of hormone-receptor interactions have focused on either analyzing the biological effects of structural modifications of PTH and PTH-related protein (PTHrP) or assessing the activity of mutated, truncated, or chimeric receptors (4, 10, 11, 12, 13, 14). Both hormone-centered and receptor-centered studies (15) have advanced understanding of the structural features present in either hormone or receptor that contribute to biological properties. However, any insights into specific interacting sites between hormone and receptor can at best be inferred and are not assessed directly using either approach. Furthermore, structural changes in either hormone or receptor may alter interaction with complementary sites beyond the position(s) selected for modification through effects on global conformation (4).
In an effort to gain insight into PTH-PTH1 Rc interactions, we have employed a photoaffinity cross-linking methodology that enables direct assessment of bimolecular interactions between complex proteins (16). We reported previously the results of our photoaffinity-based approach, which effectively freezes the bimolecular interaction between hormone and receptor (15, 17, 18, 19). Benzophenone (BP) substituents have the capacity to form stable intermolecular covalent bonds (in the presence of UV light) when in close proximity (within angstroms) of interacting moieties (20). We have incorporated a photoreactive BP moiety at specific positions within the PTH-(134) sequence generating a series of singularly substituted BP-containing PTH analogs (15, 17, 18, 19, 21). These radioligands can be used to photoaffinity label the human (h) PTH1 Rc. This radioactivity-tagged hormone-receptor conjugate can be isolated and subjected to sequential chemical and enzymatic cleavages, creating a unique fragmentation pattern. Detailed analysis of this pattern and comparison to the anticipated fragments derived from the known hPTH1 Rc protein sequence (22, 23) enable the unambiguous identification of the contact domain (and ultimately the amino acid contact point) within the hPTH1 Rc directly interacting with the PTH photoaffinity ligand (15, 19).
To aid our studies and prevent the loss of the radioactive tag upon conjugate fragmentation, we have generated a cleavage-resistant ligand, i.e. one in which amino acid substitutions are strategically incorporated to produce ligands that are biologically active (21), yet resistant to the cleaving agents used in fragmenting the hormone-receptor conjugates. For example, arginine residues replace lysines to eliminate cleavage by the enzyme lysyl endopeptidase (Lys-C), and norleucine replaces methionine to afford resistance to cyanogen bromide (CNBr). Exhaustive individual digestions of the hormone-receptor conjugate each result in a distinctive fragment of the receptor cross-linked to the intact radiolabeled hormone. The size as well as the secondary digestion characteristics of each of these receptor fragments allows for the unambiguous identification of a domain within the receptor that makes contact with hormone. The boundaries of the contact domain within the receptor are determined by the number and location of either the naturally occurring (or mutationally generated) enzymatic or chemical cleavage sites.
Recently, we reported the identification of a 17-amino acid region in
the extracellular N terminus of the hPTH1 Rc, which precedes the first
receptor transmembrane domain (TM1) (residues 173189) (15). This
region cross-links specifically with a radiolabeled, photoreactive PTH
ligand containing a BP moiety
(p-benzoyl-benzoyl,
p-Bz2) at residue 13,
125I-[Nle8,18,Lys13(
-pBz2),L-2-Nal23,Arg26,27,Tyr34]bPTH-(134)NH2
(125I-K13) (15).
We now describe the further delineation of this 125I-K13 contact domain to an 8-amino acid sequence, located in the N-terminal extracellular region, immediately adjacent to TM1 of the PTH1 Rc. In addition, using site-directed mutagenesis we have succeeded in identifying Arg186 as an amino acid within this sequence that appears to be crucial for the interaction of position 13 of PTH-(134) with the hPTH1 Rc and may represent a putative contact point.
| RESULTS |
|---|
|
|
|---|
R179K,
R181K,
R186K) (Fig. 1
|
R179K and
R181K mutant Rcs bind in a manner comparable to wild-type Rc, while
R186K shows an approximate 60% reduction in levels of specific
binding (Fig. 2C
|
|
R181K.S contains about 200,000 receptors per cell, and mutant
R186K.S contains approximately 30,000 receptors/cell, as determined
by Scatchard analysis (24) (Fig. 3
R181K.S was selected for the subsequent refinement
of the identified contact domain.
|
R181K.S cells
revealed a conjugate of 8090 kDa (Fig. 4
|
8090 kDa hormone-receptor
conjugate derived from
R181K.S cells produced a fragment of
approximately 9 kDa (Fig. 4
18 kDa) observed after Lys-C digestion of the
125I-K13-native receptor conjugate (15). The reduction in
size of the Lys-C digestion fragment (
50%) is predicted by the
substitution of Lys186 for Arg186 to generate a
new Lys-C cleavage site (Fig. 1
The 9-kDa fragment obtained from Lys-C-treated
125I-K13-
R181K.S conjugate is not further reduced in
size after treatment by Endo-F. (Fig. 4
, lane 7). Multiple groups have
reported that the PTH1 Rc is N-glycosylated (27, 28), and Leung and
colleagues (29) have used site-directed mutagenesis to determine that
Asn176 of the rat PTH1 Rc is glycosylated in
vivo (29). Furthermore, SDS-PAGE analysis of COS-7 cells
transiently expressing a
N176A mutant hPTH1 Rc shows a radiolabeled
conjugate with an increase in electrophoretic mobility, as compared
with native receptor conjugate (Fig. 4
, lanes 8 and 9). These data
strongly suggest that the human receptor is glycosylated at
Asn176 in vivo. This N glycosylation site within
the 173189 contact domain (Asn176) is amino-terminal to
the novel Lys-C cleavage site in the
R181K mutant. Therefore, the
lack of effect of Endo-F treatment on the size of the 9 kDa conjugate
suggests that the 125I-K13 cross-linking point lies
C-terminal to position 181, namely between residues
Glu182-Met189 of the hPTH1 Rc (Fig. 1
).
We next examined the ability of the
R186K.S cell line to cross-link
to 125I-K13, since the reduction in total binding in cells
transiently expressing this mutant receptor (Fig. 2A
) suggested that
residue 186 may be important for hormone interaction. No cross-linking
of 125I-K13 to
R186K.S cells was observed (Fig. 5
, lane 7), despite the full adenylyl
cyclase response these receptors display when exposed to PTH (Fig. 3C
and Table 1
). These data indicate that the
R186K mutant receptor is
expressed on the cell surface, is functional with regard to hormone
binding and signal transduction, but is unable to cross-link to
125I-K13.
|
R186K.S cells with 125I-K13 may be related to the
moderate number of receptors expressed on the cell surface (
30,000
Rcs per cell). To determine whether the level of receptor expressed in
R186K.S cells is below the threshold for detection by cross-linking,
we compared the cross-linking of
R186K.S to that of other cell lines
expressing either approximately 400,000 or approximately 40,000
wild-type hPTH1 Rcs/cell (C-21 and C-20, respectively) (24). We found
that both wild-type receptor-expressing cell lines cross-linked to
125I-K13 as expected (Fig. 5
R186K.S cells did not (Fig. 5
R186K.S
cells), but cannot cross-link the
R186K mutant receptor despite its
productive interaction, in terms of stimulating signal transduction and
binding.
To determine whether the lack of 125I-K13 cross-linking was
specific for the
R186K mutant, we examined another mutant in which
alanine was substituted for Arg186 (
R186A) (Figs 1
and 6
). Similar to the lysine substitution, this
substitution maintains biological activity (adenylyl cyclase)
comparable to native receptor in transiently transfected COS-7 cells
(Fig. 2B
), has a 1- to 2-fold reduction in specific binding (Fig. 2C
),
and also does not cross-link to 125I-K13 (Fig. 6
). In sharp
contrast, Ala or Lys substitutions at either Arg181 or
Arg179 (Fig. 1
and Table 1
), only five or seven amino acids
away from Arg186, show native hPTH1 Rc-like bioactivity
(adenylyl cyclase) and are specifically cross-linked to
125I-K13 when transiently expressed in COS-7 cells (Fig. 6
, lanes 310).
|
R186K mutant receptor is that the mutation induces a conformational
change in the receptor that specifically inhibits the cross-linking of
125I-K13. To address this issue, we examined the ability of
another BP-containing PTH analog (Bpa1) to cross-link to
the
R186K mutant receptor. This ligand has a
p-benzoylphenylalanine (Bpa) residue at position 1 of
PTH-(134). The analog has been shown to cross-link with a contact
domain localized to the third extracellular loop of the hPTH1 Rc (19).
Cells transiently transfected with the
R186K mutant hPTH1 Rc (data
not shown) or
R186K.S cells do cross-link to
125I-Bpa1 (Fig. 7
R186K.S cell cross-linked
hormone-receptor conjugate obtained from
R186K.S cells is similar
(8090 kDa) to that observed for the cross-linked native receptor
expressed in C-21 cells (Fig. 7
|
D185A) and Gly188 (
G188A).
Neither of these mutations resulted in alteration of PTH-stimulated
adenylyl cyclase activity in transiently transfected COS-7 cells (Table 1
|
| DISCUSSION |
|---|
|
|
|---|
We prepared three hPTH1 Rc mutants designed to dissect the 17-amino
acid contact domain by creating new Lys-C digestion sites in the
receptor (
R179K,
R181K,
R186K). Characterization of these
mutant receptors in transiently and stably transfected cells
demonstrated biological function virtually indistinguishable from
wild-type hPTH1 Rc (Table 1
and Figs. 2A
and 3
), except for ligand
binding, which was moderately reduced in one transiently transfected
mutant,
R186K (Table 1
and Figs. 2C
and 3B
). 125I-K13
binding studies demonstrate that each of the mutant receptors is
expressed on the cell surface and that the general topology of the
mutant receptors does not appear dramatically altered (Fig. 3
, A and
B). Based on high levels of receptor expression (
200,000 Rcs per
cell) and the strategic location of the mutation within the contact
domain, one of the stable cell lines (
R181K.S) was used for detailed
enzymatic mapping of the hormone-receptor conjugate. Our approach to
biochemically analyzing the cross-linked hormone-receptor conjugate
requires large amounts of biologically active receptor;
R181K.S
cells express sufficient receptor for this purpose (Fig. 3A
). The
R181K.S cells were cross-linked with 125I-K13 and the
hormone-receptor conjugate isolated. The specific cleavage pattern
observed for the mutant receptor, compared with the native sequence
receptor (15, 22, 23), confirmed the 17-amino acid (173189) region as
the 125I-K13 contact domain (15) and further restricted the
contact domain to only eight amino acids, namely positions 182189
(Fig. 4
).
The lack of cross-linking of 125I-K13 to
R186K.S cells,
possessing an otherwise efficiently expressed (
30,000 Rcs per cell;
Fig. 3B
) and functional (EC50 = 3 x 10-9
M and IC50 = 4 x 10-8
M; Table 1
) mutant receptor, is of great interest. These
properties were also observed in another mutant in which
Arg186 was replaced by Ala, which, unlike Arg or Lys, lacks
a positive charge on its side chain. The transient
R186A mutant Rc
was functionally intact (Fig. 2B
) but impaired in its capacity to
cross-link to 125I-K13 (Fig. 6
). Hence, mutation of
Arg186 is not a silent mutation. Our receptor dilution
experiments suggest that absence of detectable ligand-receptor
conjugate in the 125I-K13-cross-linked
R186K.S cells
cannot be attributed to the relatively low level of receptor expression
of these cells (
30,000 Rcs per cell) as compared with the receptors
in both the wild-type C-20 cells (
40,000 Rcs per cell) and
R181K.S cells (
200,000 Rcs per cell), which both cross-link
125I-K13 (Figs. 4
and 5
). Moreover, complete sequencing of
the cDNA from
R186K.S cells revealed the integrity of the sequence
with no additional mutations (data not shown).
The lack of cross-linking to 125I-K13 suggests that
Arg186 contributes to the interaction with hormone. The
subtle and localized nature of this interaction is evident from its
selective effect on cross-linking to a photoreactive moiety located at
position 13; there is no effect of this mutation on cross-linking to a
photoreactive moiety at position 1 of PTH (Fig. 7
). Therefore, we
conclude that the perturbation caused by both the R186K and R186A
receptor mutations is local and devoid of global conformational changes
that may result in long-range effects on other ligand-receptor contact
interactions. Finally, the specificity of this perturbation is
demonstrated by an alanine scan of other residues in the contact domain
173189, on both sides of position 186. Neither disruption of
PTH-stimulated adenylyl cyclase activity nor elimination of
cross-linking to 125I-K13 was observed in these mutants
(Table 1
, cross-linking data not shown). Taken together, these data
strongly support the idea that Arg186 of the hPTH1 Rc is
critical for specific interaction with position 13 of PTH-(134).
Arg186 may represent an actual hormone contact point or may
be in very close proximity to the amino acid contacting residue 13 in
native PTH. Because the nature of our studies requires the use of a
BP-substituted hormone, we cannot definitively conclude that
Arg186 is the contact point with position 13 of the
hormone, but it is surely within several angstroms (the radius of the
BP moiety) of this amino acid.
Homologous scanning mutagenesis studies of the rat (r) PTH1 Rc and the
rat secretin (Sec) Rc reveal that replacement of residues 171189 of
the rPTH1 Rc with the corresponding residues of the rSec Rc results in
loss of PTH-(134) binding affinity (12). Further analysis of the
importance of this domain indicated that swapping residues 171179
between the two receptors led to no significant changes in PTH-(134)
binding affinity, while swapping residues 182190 resulted in an 80%
reduction in PTH-(134) binding affinity (12). These data are in
agreement with our direct identification of a contact domain for
125I-K13: residues 182190 appear to be critical for
interaction with PTH-(134). Furthermore, mutations
R186K and
R186A cause no significant change in signal transduction by the
receptor, but they lead to an abolishment of photoaffinity
cross-linking to position 13 in PTH, strongly suggesting that either
Arg186 or an amino acid close to Arg186 in the
hPTH1 Rc is critical for interaction with residue 13 of PTH-(134). We
postulate that the R186K and R186A mutations alter the topology of the
receptor sufficiently to disrupt the normally close spatial arrangement
of position 13 in PTH to Arg186 in the receptor. Hence,
BP-mediated cross-linking does not occur. However, the magnitude of the
change in Rc topology is not enough to compromise a productive
hormone-receptor interaction responsible for signal transduction.
Predictions of the membrane organization of hPTH1 Rc based on
hydropathy analysis indicate that Arg186 lies just at the
N-terminal extracellular/transmembrane (TM)-1 junction (19).
Interestingly, site-directed mutagenesis of polar amino acids at the
membrane-extracellular interface and in TM domains of the rat PTH1 Rc,
as well as in other G protein-coupled receptors, including the m5
muscarinic and
-factor Rcs, has been reported to have effects on
binding affinity and ligand specificity (14, 33, 34).
Also, a BLAST search (35) of the protein sequence of this extracellular-TM1 region (residues 173189) indicates no homology with other members of the secretin/vasoactive intestinal peptide/glucagon subfamily of G protein-coupled receptors, although the flanking domains possess some homology with other family members. In general, most homology among these receptors is between TM domains, but extracellular regions do reveal some homology. The total lack of homology for the contact domain suggests that this region may be particularly important for ligand binding and specificity, as our experimental data suggest.
The PTH1 Rc presumably has a finite number of sites that contact the hormone (36, 37, 38, 39, 40). Our studies with the R186K and R186A mutant receptors suggest that the replacement of Arg186 with lysine or alanine eliminates contact with Lys13 in PTH. Furthermore, it appears as though cross-linking in this region is more sensitive to disruption than hormone binding or signal transduction, suggesting that cooperativity of multiple interaction sites leads to hormone binding and a signal transduction response. Eliminating one site may be enough to prevent cross-linking, but a sufficient number of bimolecular contacts remain intact to permit molecular recognition and stimulation of adenylyl cyclase.
These studies offer new insights into the nature of ligand-receptor interactions. Our findings suggest a hierarchy of bimolecular contacts that differ in their role and significance. Studies in which multiple contact points in the receptor are simultaneously mutated should provide further understanding of the essential set of contacts necessary for receptor activation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Peptides
All peptides were synthesized by the solid phase methodology
with an Applied Biosystems 430A peptide synthesizer using
Boc/HOBt/NMP chemistry. After hydrogen fluoride cleavage the peptides
were purified by RP-HPLC (21). Purity and structure of the peptides
were confirmed by analytical RP-HPLC, amino acid analysis, and electron
spray mass spectrometry. Detailed synthetic protocols, purifications,
and characterization of peptides are reported elsewhere (15,
19, 21, 41). The radioiodination of the ligands,
[Nle8,18,Tyr34]bPTH-(134)NH2
(PTH-(134)),
[Nle8,18,Lys13(
-pBz2),L-2-NaI23,Arg26,27,Tyr34]bPTH-(134)NH2
(K13), and
[Bpa1,Nle8,18,Arg13,26,27,L-2-NaI23,Tyr34]bPTH-(134)NH2
(Bpa1), as well as RP-HPLC purifications, were
performed as previously described (42).
Cell Culture
All cell lines, HEK-293, C-21, C-20 (24),
R181K.S,
R186K.S, and COS-7 (a generous gift of Dr. Steven Goldring, Beth
Israel Deaconess Medical Center) were cultured in DMEM supplemented
with 10% FBS as described (24). C-21 and C-20 cell media were
supplemented with G418 (500 µg/ml).
R181K.S and
R186K.S media
were supplemented with Zeocin (250 µg/ml) (Invitrogen, San Diego,
CA).
Site-Directed Mutagenesis and Analysis of Constructs
The following amino acids of the hPTH1 Rc were modified:
Arg179 to Lys and Ala (
R179K,
R179A);
Arg181 to Lys and Ala (
R181K,
R181A);
Arg186 to Lys and Ala (
R186K,
R186A). Additionally,
Ala mutations were made to amino acids Phe173,
Leu174, Thr175, Asn176,
Glu177, Thr178, Glu180,
Asp185 and Gly188. Primer pairs (sense and
antisense) were prepared containing the appropriate modifications
(GIBCO-BRL Custom primers). The following is a list of sense primers
(5' - 3') for each mutation made:
N176A: caaatttctcaccgcggagactcgtgaac
R179K: caaatttctcaccaatgagactaaagaacgggaggtgtttgaccgcc
R179A: caaatttctcaccaatgagactgctgaacgggaggtgtttgaccgcc
R181K: caccaatgagactcgtgaaaaggaggtgtttgaccgcctgg
R181A: caccaatgagactcgtgaagcggaggtgtttgaccgcctgg
R186K: cgggaggtgtttgacaaactgggcatgatttacaccg
R186A: cgggaggtgtttgacgccctgggcatgatttacaccg
G188A: gaggtgtttgaccgcctggccatgatttacaccgtgggc
F173A: cgagtgtgtcaaagcactcaccaatgagac
L174A: gtgtgtcaaatttgcgaccaatgagactcg
T175A: gtcaaatttctcgccaatgagactcgtg
E177A: caaatttctcaccaatgcgactcgtgaacgggag
T178A: ctcaccaatgaggcacgtgaacgggag
E180A: ccaatgagactcgtgcgcgggaggtgtttg
D185A: cgggaggtgtttgcccgcctgggcbp
Prepared primers were purified by SDS-PAGE and visualized. The gel
portion containing the primers was excised, macerated, and incubated
with shaking in 500 µl water overnight at 37 C. Primer pairs were
used in the PCR-based, Quik-Change Site-Directed Mutagenesis Kit
(Stratagene, La Jolla, CA), using the hPTH1 Rc as a template (17) in
the pZeoSV2 (Invitrogen) mammalian expression vector. Individual PCR
reactions were used to transform DH5
cells (GIBCO-BRL) and
transformations plated on bacteriological agar containing Zeocin.
Colonies were identified and selected for plasmid isolation (QIAGEN,
Santa Clara, CA). Plasmid preparations were cycle sequenced to confirm
mutations (Genomyx, Foster City, CA) using oligonucleotide primers
located 5' to the regions of the hPTH1 Rc targeted for mutation.
Subsequently, the plasmid cDNA of key receptor mutants was fully
sequenced to confirm the fidelity and specificity of the
mutagenesis.
Transient and Stable Transfection
COS-7 cells were plated at 57.5 x 105 cells
per 10-cm dish 24 h before transient transfection. HEK-293 cells
were plated at 106 cells per 10- cm dish before stable
transfection. Ten micrograms of each mutant or native receptor
construct were cotransfected with 10 µg carrier DNA using
calcium/phosphate precipitation (GIBCO-BRL). For transient
transfections, cells were subcultured 24 h after transfection at
2 x 105 cells per 24-well dish. Adenylyl cyclase
activity, ligand binding, and photoaffinity cross-linking were
performed 72 h after transfection. For stable transfection of
HEK-293 cells, growth medium was changed 24 h after transfection,
and the transfected cells split to 1:4 in media containing 250 µg/ml
Zeocin. Fifty to 100 colonies were isolated for each mutant and
transferred to 96-well dishes for several weeks in Zeocin-containing
media. The stable expression of mutant hPTH1 Rc was determined by
assaying the cells for PTH-stimulated adenylyl cyclase activity (17, 21).
Radioligand Binding
Cell lines were subcultured in polylysine-coated 24-well plates
and grown to confluency. RRAs were carried out as previously described
(17, 21) using 125I-K13 as a radioligand.
Adenylyl Cyclase Activity
Cell lines were subcultured in 24-well plates and grown to near
confluency. COS-7 cells transiently expressing mutant receptors were
subcultured 24 h after transfection at a density of 2 x
105 cells per well in 24-well plates and assayed for
adenylyl cyclase activity 72 h after transfection. Stable cell
lines were plated and assayed as described previously (21).
Determination of the activation of adenylyl cyclase by PTH analogs was
carried out using a two-column chromatographic method, as described
previously (21).
Photoaffinity Cross-linking
Analytical Scale
Cells for photoaffinity labeling were grown to confluence in 24-well
tissue culture plates and washed with DMEM. For the experiment, each
well contained 200 µl DMEM and either 25 µl 10-5
M bPTH-(134) in vehicle (PBS/0.1% BSA), or vehicle
alone. Reactions were incubated 15 min at room temperature before 12
million cpm of 125I-K13 or
125I-Bpa1 in DMEM (total volume 25 µl) was
added to each well. Cells were incubated for an additional 1015 min,
at room temperature. Plates were cross-linked on ice approximately
510 cm from six 15-watt, 365-nm UV lamps in a Stratalinker 2400
(Stratagene) for 15 min at 4 C. Each well was washed with PBS, and
cells were lysed with 0.5 ml Laemmli sample buffer (43), gently shaken
on a rocking platform for 1030 min, and harvested into individual
1.5-ml Eppendorf tubes. Tubes were incubated on a rotating platform at
RT for 23 h and either frozen at -80 C or analyzed by reducing
SDS-PAGE.
Preparative Scale
Cells for photoaffinity labeling were cultured in ten
15-cm2 dishes to confluency and harvested with Versine. The
cells were washed twice by centrifugation (800 x g) in
DMEM, and the cell pellet resuspended in 10 ml DMEM. One milliliter
(
0.5 mCi) of 125I-K13 was added to the cells and
approximately l.8 ml cell per ligand aliquots were added to each well
of a six-well tissue culture plate. The cell ligand mixture was
incubated with gentle shaking at room temperature for 1 h. The
uncovered dish was placed on ice, and the photoreaction was carried out
for 60 min at 4 C, as described above. Reaction mixtures were collected
into 50-ml plastic tubes (Falcon), washed three times with PBS by
centrifugation (1,000 x g). The cell pellet obtained
was either frozen at -80 C or immediately used for subsequent membrane
preparation.
Membrane Protein Preparation
Preparative cross-linked cell pellets were resuspended in 11 ml
of 25 mM Tris-base (pH 8.5) and cells lysed by four
freezing (liquid N2) and thawing cycles. The crude cell
lysate was centrifuged (
2,000 x g, 20 min), and the
supernatant was aliquoted (0.9 ml/tube) to ultracentrifuge tubes, and
centrifuged at 125,000 x g for 2 h at 4 C. After
supernatant aspiration, the purified membranes were either stored at
-80 C or processed further.
Membranes were incubated 324 h on a rotating platform in extraction buffer [25 mM Tris, 100 mM dithiotreithol, 2.0% Triton, pH 8.5, 0.02% sodium azide]. The extracted membranes were precipitated in 5 volumes of cold acetone and centrifuged for 30 min in an Eppendorf Microcentrifuge at 8,000 rpm. After supernatant aspiration, the membrane pellets were air-dried and stored at -20 C. The pellets were then resuspended in 20 µl 10% (wt/vol) SDS and diluted with 120 µl 25 mM Tris, pH 8.5. The samples were then reduced with 25 mM (final concentration) dithiothreitol for 1 h at 37 C, and alkylated 3050 mM (final concentration) iodoacetamide for 30 min at 37 C. The buffer was then exchanged to digest buffer (25 mM Tris, 0.1% Triton, 0.01% SDS, pH 8.5) using Centricon 50 concentrators (Amicon, Beverly, MA).
Membrane Protein Digestions
For Lys-C digestion, protein samples were dissolved in 2040
µl of digest buffer. For Endo-F digestion, protein samples were added
to 80 µl Endo F/Kphos buffer (0.1 M potassium phosphate,
2% n-octyl glucoside, 0.2% SDS, 1% ß-mercaptoethanol,
pH 7.5). Buffered samples were digested with 0.20.5 U of enzyme
overnight at 37 C. For CNBr digestion, protein samples were placed in
50 µl FA buffer (formic acid, 1.0% Triton X-100, 0.2% SDS) with a
small crystal of CNBr and reacted overnight in darkness at room
temperature under nitrogen. Samples were evaporated to dryness three to
four times, using successive addition of water followed by
Speed-vac.
Electrophoresis and Autoradiography
Electrophoretic analysis was performed using 7.5% SDS-PAGE (43)
for the intact and deglycosylated hormone-receptor conjugates and
16.5% Tricine/SDS-PAGE (15) for the digested hormone-receptor
fragments. Appropriate mol wt markers [low and high mol wt, Amersham
and Bio-Rad, Richmond, CA)] were included in each gel run. After
electrophoresis, gels were dried and exposed to x-ray film (15 days)
(X-Omat, Eastman-Kodak, Rochester, NY) with intensifying screens
(Kodak) at -80 C. After autoradiography, the radioactive
hormone-receptor fragments were excised from the dried gels,
electroeluted (Bio-Rad, Electro-eluter 422) in SDS-PAGE running buffer,
and concentrated/buffer exchanged using Microcon/Centricon
Microconcentrators (Amicon) of the appropriate mol wt cut-off for
further analysis.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was funded in part by NIH Grant R01-DK-47940 (to M.R.) from the NIH.
1 Harvard Graduate School of Arts and Sciences, Division of Medical
Sciences, Department of Biological Chemistry and Molecular
Pharmacology. ![]()
2 Current address: SmithKline Beecham Pharmaceuticals, 709 Swedeland
Road, King of Prussia, Pennsylvania 19406. ![]()
Received for publication May 11, 1998. Revision received July 15, 1998. Accepted for publication August 4, 1998.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
I. Assil-Kishawi, T. A. Samra, D. F. Mierke, and A. B. Abou-Samra Residue 17 of Sauvagine Cross-links to the First Transmembrane Domain of Corticotropin-releasing Factor Receptor 1 (CRFR1) J. Biol. Chem., December 19, 2008; 283(51): 35644 - 35651. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Murray, L. G. Rao, P. Divieti, and F. R. Bringhurst Parathyroid Hormone Secretion and Action: Evidence for Discrete Receptors for the Carboxyl-Terminal Region and Related Biological Actions of Carboxyl- Terminal Ligands Endocr. Rev., February 1, 2005; 26(1): 78 - 113. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shimizu, T. Dean, J. C. Tsang, A. Khatri, J. T Potts Jr, and T. J. Gardella Novel Parathyroid Hormone (PTH) Antagonists That Bind to the Juxtamembrane Portion of the PTH/PTH-related Protein Receptor J. Biol. Chem., January 21, 2005; 280(3): 1797 - 1807. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pham, J. D. Wade, B. W. Purdue, and P. M. Sexton Spatial Proximity between a Photolabile Residue in Position 19 of Salmon Calcitonin and the Amino Terminus of the Human Calcitonin Receptor J. Biol. Chem., February 20, 2004; 279(8): 6720 - 6729. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dong, D. I. Pinon, R. F. Cox, and L. J. Miller Importance of the Amino Terminus in Secretin Family G Protein-coupled Receptors: INTRINSIC PHOTOAFFINITY LABELING ESTABLISHES INITIAL DOCKING CONSTRAINTS FOR THE CALCITONIN RECEPTOR J. Biol. Chem., January 9, 2004; 279(2): 1167 - 1175. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Gensure, N. Shimizu, J. Tsang, and T. J. Gardella Identification of a Contact Site for Residue 19 of Parathyroid Hormone (PTH) and PTH-Related Protein Analogs in Transmembrane Domain Two of the Type 1 PTH Receptor Mol. Endocrinol., December 1, 2003; 17(12): 2647 - 2658. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shimizu, P. H. Carter, A. Khatri, J. T. Potts Jr., and T. J. Gardella Enhanced Activity in Parathyroid Hormone-(1-14) and -(1-11): Novel Peptides for Probing Ligand-Receptor Interactions Endocrinology, July 1, 2001; 142(7): 3068 - 3074. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. H. Carter, B. D. Petroni, R. C. Gensure, E. Schipani, J. T. Potts Jr., and T. J. Gardella Selective and Nonselective Inverse Agonists for Constitutively Active Type-1 Parathyroid Hormone Receptors: Evidence for Altered Receptor Conformations Endocrinology, April 1, 2001; 142(4): 1534 - 1545. [Abstract] [Full Text] |
||||
![]() |
U. Gether Uncovering Molecular Mechanisms Involved in Activation of G Protein-Coupled Receptors Endocr. Rev., February 1, 2000; 21(1): 90 - 113. [Abstract] [Full Text] |
||||
![]() |
V. Behar, A. Bisello, G. Bitan, M. Rosenblatt, and M. Chorev Photoaffinity Cross-linking Identifies Differences in the Interactions of an Agonist and an Antagonist with the Parathyroid Hormone/Parathyroid Hormone-related Protein Receptor J. Biol. Chem., January 7, 2000; 275(1): 9 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. H. Carter, M. Shimizu, M. D. Luck, and T. J. Gardella The Hydrophobic Residues Phenylalanine 184 and Leucine 187 in the Type-1 Parathyroid Hormone (PTH) Receptor Functionally Interact with the Amino-terminal Portion of PTH-(1-34) J. Biol. Chem., November 5, 1999; 274(45): 31955 - 31960. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. H. Carter, H. Jüppner, and T. J. Gardella Studies of the N-Terminal Region of a Parathyroid Hormone-Related Peptide(1-36) Analog: Receptor Subtype-Selective Agonists, Antagonists, and Photochemical Cross-Linking Agents Endocrinology, November 1, 1999; 140(11): 4972 - 4981. [Abstract] [Full Text] |
||||
![]() |
M. Mannstadt, H. Juppner, and T. J. Gardella Receptors for PTH and PTHrP: their biological importance and functional properties Am J Physiol Renal Physiol, November 1, 1999; 277(5): F665 - F675. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Behar, A. Bisello, M. Rosenblatt, and M. Chorev Direct Identification of Two Contact Sites for Parathyroid Hormone (PTH) in the Novel PTH-2 Receptor using Photoaffinity Cross-Linking Endocrinology, September 1, 1999; 140(9): 4251 - 4261. [Abstract] [Full Text] |
||||
![]() |
M. D. Luck, P. H. Carter, and T. J. Gardella The (1-14) Fragment of Parathyroid Hormone (PTH) Activates Intact and Amino-Terminally Truncated PTH-1 Receptors Mol. Endocrinol., May 1, 1999; 13(5): 670 - 680. [Abstract] [Full Text] |
||||
![]() |
M. Dong, Y. W. Asmann, M. Zang, D. I. Pinon, and L. J. Miller Identification of Two Pairs of Spatially Approximated Residues within the Carboxyl Terminus of Secretin and Its Receptor J. Biol. Chem., August 18, 2000; 275(34): 26032 - 26039. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Jin, S. L. Briggs, S. Chandrasekhar, N. Y. Chirgadze, D. K. Clawson, R. W. Schevitz, D. L. Smiley, A. H. Tashjian, and F. Zhang Crystal Structure of Human Parathyroid Hormone 1-34 at 0.9-A Resolution J. Biol. Chem., August 25, 2000; 275(35): 27238 - 27244. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shimizu, P. H. Carter, and T. J. Gardella Autoactivation of Type-1 Parathyroid Hormone Receptors Containing a Tethered Ligand J. Biol. Chem., June 23, 2000; 275(26): 19456 - 19460. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. J. Hoare, T. J. Gardella, and T. B. Usdin Evaluating the Signal Transduction Mechanism of the Parathyroid Hormone 1 Receptor. EFFECT OF RECEPTOR-G-PROTEIN INTERACTION ON THE LIGAND BINDING MECHANISM AND RECEPTOR CONFORMATION J. Biol. Chem., March 9, 2001; 276(11): 7741 - 7753. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Gensure, T. J. Gardella, and H. Juppner Multiple Sites of Contact between the Carboxyl-terminal Binding Domain of PTHrP-(1-36) Analogs and the Amino-terminal Extracellular Domain of the PTH/PTHrP Receptor Identified by Photoaffinity Cross-linking J. Biol. Chem., July 27, 2001; 276(31): 28650 - 28658. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shimizu, J. Guo, and T. J. Gardella Parathyroid Hormone (PTH)-(1-14) and -(1-11) Analogs Conformationally Constrained by alpha -Aminoisobutyric Acid Mediate Full Agonist Responses via the Juxtamembrane Region of the PTH-1 Receptor J. Biol. Chem., December 21, 2001; 276(52): 49003 - 49012. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shimizu, J. T. Potts Jr., and T. J. Gardella Minimization of Parathyroid Hormone. NOVEL AMINO-TERMINAL PARATHYROID HORMONE FRAGMENTS WITH ENHANCED POTENCY IN ACTIVATING THE TYPE-1 PARATHYROID HORMONE RECEPTOR J. Biol. Chem., July 14, 2000; 275(29): 21836 - 21843. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |