help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adams, A. E.
Right arrow Articles by Suva, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adams, A. E.
Right arrow Articles by Suva, L. J.
Molecular Endocrinology 12 (11): 1673-1683
Copyright © 1998 by The Endocrine Society

Arginine 186 in the Extracellular N-Terminal Region of the Human Parathyroid Hormone 1 Receptor Is Essential for Contact with Position 13 of the Hormone

Amy E. Adams1, Alessandro Bisello, Michael Chorev, Michael Rosenblatt and Larry J. Suva2

Division of Bone and Mineral Metabolism Charles A. Dana and Thorndike Laboratories Department of Medicine Beth Israel Deaconess Medical Center and Harvard Medical School Boston, Massachusetts 02215


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PTH maintains blood calcium concentrations within the physiological range by acting on a G protein-coupled heptahelical receptor (PTH1 Rc) located primarily in cells in bone and kidney. We have undertaken a photoaffinity cross-linking approach to elucidate the nature of the bimolecular interaction of PTH with the human (h) PTH1 Rc. Specifically, we have studied the region of the receptor that interacts with the midregion of PTH-(1–34), position 13, using a benzophenone-containing photoaffinity ligand, 125I-[Nle8,18,Lys13({epsilon}-pBz2),L-2-Nal23,Arg26,27,Tyr34]bPTH-(1–34)NH2 (125I-K13). Using site-directed mutagenesis in combination with biochemical analysis, we have reduced our previously identified contact domain, 17 residues in the extracellular region of the receptor (173–189), to an 8-amino acid domain (182–189). Furthermore, we have found arginine 186 to be of critical importance to the interaction of the hPTH1 Rc with 125I-K13: modification of Arg186 to either lysine or alanine does not modify receptor avidity or signal transduction by the receptor, but eliminates cross-linking to 125I-K13.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PTH regulates blood calcium concentration by mobilizing calcium stores in bone and modifying renal calcium reabsorption and vitamin D biosynthesis (1). PTH exerts its actions via a G protein-coupled seven-transmembrane domain-containing receptor (PTH1 Rc), which is a member of the glucagon/vasoactive intestinal peptide/secretin receptor subfamily (2). Like other members of this subgroup, the PTH1 Rc is able to signal via both the cAMP and inositol triphosphate/intracellular calcium second messenger pathways (3, 4, 5).

The elucidation of the details of the bimolecular interaction between PTH and its receptor is critical for understanding the basis of molecular recognition and the mechanism of signal transduction by the receptor. Such structural insight may aid in the rational design of PTH-like molecules with increased potency, improved selectivity, and even oral bioavailability. While continuous administration of PTH has catabolic effects on bone, low dose, intermittent PTH treatment has been shown to increase bone mass (6, 7, 8, 9), demonstrating that PTH can act as a powerful anabolic agent with potential for clinical use in the treatment of osteoporosis (4).

Previous efforts to understand the nature of hormone-receptor interactions have focused on either analyzing the biological effects of structural modifications of PTH and PTH-related protein (PTHrP) or assessing the activity of mutated, truncated, or chimeric receptors (4, 10, 11, 12, 13, 14). Both hormone-centered and receptor-centered studies (15) have advanced understanding of the structural features present in either hormone or receptor that contribute to biological properties. However, any insights into specific interacting sites between hormone and receptor can at best be inferred and are not assessed directly using either approach. Furthermore, structural changes in either hormone or receptor may alter interaction with complementary sites beyond the position(s) selected for modification through effects on global conformation (4).

In an effort to gain insight into PTH-PTH1 Rc interactions, we have employed a photoaffinity cross-linking methodology that enables direct assessment of bimolecular interactions between complex proteins (16). We reported previously the results of our photoaffinity-based approach, which effectively freezes the bimolecular interaction between hormone and receptor (15, 17, 18, 19). Benzophenone (BP) substituents have the capacity to form stable intermolecular covalent bonds (in the presence of UV light) when in close proximity (within angstroms) of interacting moieties (20). We have incorporated a photoreactive BP moiety at specific positions within the PTH-(1–34) sequence generating a series of singularly substituted BP-containing PTH analogs (15, 17, 18, 19, 21). These radioligands can be used to photoaffinity label the human (h) PTH1 Rc. This radioactivity-tagged hormone-receptor conjugate can be isolated and subjected to sequential chemical and enzymatic cleavages, creating a unique fragmentation pattern. Detailed analysis of this pattern and comparison to the anticipated fragments derived from the known hPTH1 Rc protein sequence (22, 23) enable the unambiguous identification of the contact domain (and ultimately the amino acid contact point) within the hPTH1 Rc directly interacting with the PTH photoaffinity ligand (15, 19).

To aid our studies and prevent the loss of the radioactive tag upon conjugate fragmentation, we have generated a cleavage-resistant ligand, i.e. one in which amino acid substitutions are strategically incorporated to produce ligands that are biologically active (21), yet resistant to the cleaving agents used in fragmenting the hormone-receptor conjugates. For example, arginine residues replace lysines to eliminate cleavage by the enzyme lysyl endopeptidase (Lys-C), and norleucine replaces methionine to afford resistance to cyanogen bromide (CNBr). Exhaustive individual digestions of the hormone-receptor conjugate each result in a distinctive fragment of the receptor cross-linked to the intact radiolabeled hormone. The size as well as the secondary digestion characteristics of each of these receptor fragments allows for the unambiguous identification of a domain within the receptor that makes contact with hormone. The boundaries of the contact domain within the receptor are determined by the number and location of either the naturally occurring (or mutationally generated) enzymatic or chemical cleavage sites.

Recently, we reported the identification of a 17-amino acid region in the extracellular N terminus of the hPTH1 Rc, which precedes the first receptor transmembrane domain (TM1) (residues 173–189) (15). This region cross-links specifically with a radiolabeled, photoreactive PTH ligand containing a BP moiety (p-benzoyl-benzoyl, p-Bz2) at residue 13, 125I-[Nle8,18,Lys13({epsilon}-pBz2),L-2-Nal23,Arg26,27,Tyr34]bPTH-(1–34)NH2 (125I-K13) (15).

We now describe the further delineation of this 125I-K13 contact domain to an 8-amino acid sequence, located in the N-terminal extracellular region, immediately adjacent to TM1 of the PTH1 Rc. In addition, using site-directed mutagenesis we have succeeded in identifying Arg186 as an amino acid within this sequence that appears to be crucial for the interaction of position 13 of PTH-(1–34) with the hPTH1 Rc and may represent a putative contact point.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
hPTH1 Receptor Mutants Are Biologically Active
To further delineate the boundaries of the previously identified contact domain (positions 173–189) within the hPTH1 Rc that interact directly with 125I-K13, we prepared a series of mutant hPTH1 Rcs. Initially, all three arginines present in the domain (located at positions 179, 181, and 186) were substituted by lysine ({Delta}R179K, {Delta}R181K, {Delta}R186K) (Fig. 1Go). Each modification generates a novel Lys-C digestion site in the receptor that may facilitate subsequent identification of either a smaller contact domain or the actual contact site.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. Schematic of the 125I-K13 Cross-linking Domain (Residues 173–189) of the hPTH1 Rc

Arginine residues mutated to lysine and putative glycosylation site at Asn176 are noted.

 
The effect of these mutations on receptor function was assessed after transient transfection of the mutant receptors into COS-7 cells. PTH-stimulated adenylyl cyclase activity was measured (Fig. 2AGo; Table 1Go). All three Arg-to-Lys mutant hPTH1 Rcs demonstrated PTH-stimulated adenylyl cyclase activity comparable to that of the transiently transfected wild-type hPTH1 Rc (Fig. 2AGo). Analysis of specific binding using 125I-K13 as the radioligand suggested that transiently transfected {Delta}R179K and {Delta}R181K mutant Rcs bind in a manner comparable to wild-type Rc, while {Delta}R186K shows an approximate 60% reduction in levels of specific binding (Fig. 2CGo).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. bPTH-(1–34)-Stimulated Adenylyl Cyclase Activity and Specific Binding in COS-7 Cells Transiently Expressing Arg 179, 181, and 186 Mutants of hPTH1 Rc

A, Arg-to-Lys mutations: {blacksquare}, native Rc; {square}, {Delta}R179K; •, {Delta}R181K; {circ}, {Delta}R186K. Note that the solid circles ({Delta}R186K) are obscured by the open squares ({Delta}R179K). B, Arg-to-Ala mutations: {blacksquare}, native Rc; {square}, {Delta}R179A; •, {Delta}R181A; {circ}, {Delta}R186A. C, Specific binding of 125I-K13 to transiently transfected hPTH1 Rc mutants. Average specific binding of transiently expressed wild-type hPTH1 Rc was defined as 100%. All experiments were performed in triplicate. For each panel, similar results were obtained in two additional experiments. Mean ± SE is graphed in each panel.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Analysis of Mutations to the hPTH1 Rc

 
Occasionally, we observe differences in the pharmacological profile of transiently vs. stably transfected receptors (data not shown). As a result, for novel receptors and significant mutants, we now routinely prepare cell lines stably expressing these hPTH Rcs (5, 24, 25, 26). Two stable mutant transfectants with significant adenylyl cyclase activity in response to PTH were chosen for analysis. Mutant {Delta}R181K.S contains about 200,000 receptors per cell, and mutant {Delta}R186K.S contains approximately 30,000 receptors/cell, as determined by Scatchard analysis (24) (Fig. 3Go, A and B). Both stable cell lines show competitive and saturable binding curves for 125I-K13 and PTH-(1–34)-stimulated adenylyl cyclase activity similar to that of wild-type receptor (Fig. 3Go and Table 1Go). Hence, these cell lines appear to express functional receptor. Due to the high level of mutant receptor expression, as well as the central location of the R181-to-K181 mutation within the 17-amino acid contact domain (Fig. 1Go) (15), the stable cell line {Delta}R181K.S was selected for the subsequent refinement of the identified contact domain.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. bPTH-(1-34)-Stimulated Adenylyl Cyclase Activity and Specific Binding in HEK 293 Cells Stably Transfected with the Native, and Arg 181 and Arg 186 Mutants of hPTH1 Rc.

A and B, 125I-K13 competitive binding curves of stably transfected HEK 293 cells; C-21 (native hPTH1 Rc), {Delta}R181K.S, and {Delta}R186K.S, and Scatchard analysis (inset). These experiments use 125I-K13 and competeing bPTH-(1–34). A, [{blacksquare}] denote C-21 cell binding and {diamond} denote {Delta}R181K.S binding. Inset depicts Scatchard analysis of {Delta}R181K.S cells. B, {blacksquare} denote C-21 cell binding and • denote {Delta}R186K.S cell binding. Inset depicts Scatchard analysis of {Delta}R186K.S cells. C, bPTH-(1–34)-stimulated adenylyl cyclase activity in stable cell lines expressing Arg 181 ({Delta}R181K.S) and Arg 186 ({Delta}R186K.S) mutants of hPTH1 Rc. {blacksquare} denote C-21 cells (native Rc); {diamond} denote {Delta}R181K.S cells; and • denote {Delta}R186K.S cells. All experiments were performed in triplicate. For each panel, similar results were obtained in two additional experiments. Mean ± SE is graphed in each panel. Mean absolute levels of specific binding in this experiment were as follows (in cpm/106 cells): (A) C-21 cells, 18,070; {Delta}R181K.S cells, 14,122. (B) C-21 cells, 18,305; {Delta}R186K.S cells, 6,300.

 
Photoaffinity Cross-linking of hPTH1 Rc Mutants: Evidence for a Specific Contact Point
Photoaffinity cross-linking of the BP-containing radioligand 125I-K13 to the mutant hPTH1 Rc in {Delta}R181K.S cells revealed a conjugate of 80–90 kDa (Fig. 4Go, lane 2). The hormone-receptor conjugate (Fig. 4Go, lane 2) is identical in size to the native receptor (data not shown) cross-linked to the same ligand (15). Cross-linking is competed specifically by excess (10-6 M) nonradiolabeled PTH-(1–34) (data not shown). Digestion of the 80–90 kDa hormone-receptor conjugate with CNBr caused a reduction in size to approximately 46 kDa (Fig. 4Go, lane 3). Similarly, deglycosylation of the conjugate by endoglycosidase F/N-glycosidase F (Endo-F) treatment reduced the size of the hormone-receptor conjugate to approximately 60 kDa (Fig. 4Go, lane 5). Both fragmentation patterns are consistent with the patterns previously reported after similar digestions of the native sequence hPTH1 Rc in C-21 cells (5, 15).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 4. Gel Electrophoresis of Chemically and Enzymatically Digested 125I-K13 Photoaffinity-Labeled Cells Stably Expressing Mutant {Delta}R181K.S

Lane 1, Free 125I-K13 ligand; lane 2, hormone-receptor cross-linked conjugate (HRCC); lane 3: HRCC digested with CNBr; lane 4, HRCC; lane 5, HRCC digested with Endo-F; lane 6, HRCC digested with Lys-C; lane 7, secondary Endo-F digestion of Lys-C-digested fragment; lane 8, hormone-native receptor cross-linked conjugate; lane 9, hormone-{Delta}N176A mutant receptor cross-linked conjugate. Lanes 1–3, 6, and 7 were analyzed by 16% Tris-Tricine SDS-PAGE. Lanes 4, 5, 8, and 9 were analyzed by 7% SDS-PAGE. Migration pattern of protein mol wt markers is noted at the left of each panel in the figure. The arrow indicates the position of the ~9 kDa conjugated fragment.

 
As expected, Lys-C digestion of the ~80–90 kDa hormone-receptor conjugate derived from {Delta}R181K.S cells produced a fragment of approximately 9 kDa (Fig. 4Go, lane 6), approximately half the size of the band (~18 kDa) observed after Lys-C digestion of the 125I-K13-native receptor conjugate (15). The reduction in size of the Lys-C digestion fragment (~50%) is predicted by the substitution of Lys186 for Arg186 to generate a new Lys-C cleavage site (Fig. 1Go) (15).

The 9-kDa fragment obtained from Lys-C-treated 125I-K13-{Delta}R181K.S conjugate is not further reduced in size after treatment by Endo-F. (Fig. 4Go, lane 7). Multiple groups have reported that the PTH1 Rc is N-glycosylated (27, 28), and Leung and colleagues (29) have used site-directed mutagenesis to determine that Asn176 of the rat PTH1 Rc is glycosylated in vivo (29). Furthermore, SDS-PAGE analysis of COS-7 cells transiently expressing a {Delta}N176A mutant hPTH1 Rc shows a radiolabeled conjugate with an increase in electrophoretic mobility, as compared with native receptor conjugate (Fig. 4Go, lanes 8 and 9). These data strongly suggest that the human receptor is glycosylated at Asn176 in vivo. This N glycosylation site within the 173–189 contact domain (Asn176) is amino-terminal to the novel Lys-C cleavage site in the {Delta}R181K mutant. Therefore, the lack of effect of Endo-F treatment on the size of the 9 kDa conjugate suggests that the 125I-K13 cross-linking point lies C-terminal to position 181, namely between residues Glu182-Met189 of the hPTH1 Rc (Fig. 1Go).

We next examined the ability of the {Delta}R186K.S cell line to cross-link to 125I-K13, since the reduction in total binding in cells transiently expressing this mutant receptor (Fig. 2AGo) suggested that residue 186 may be important for hormone interaction. No cross-linking of 125I-K13 to {Delta}R186K.S cells was observed (Fig. 5Go, lane 7), despite the full adenylyl cyclase response these receptors display when exposed to PTH (Fig. 3CGo and Table 1Go). These data indicate that the {Delta}R186K mutant receptor is expressed on the cell surface, is functional with regard to hormone binding and signal transduction, but is unable to cross-link to 125I-K13.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 5. SDS-PAGE (7.5%) Analysis of 125I-K13 Photoaffinity Cross-linking to C-20 Cells (40,000 Native Rcs per Cell) (Lanes 1 and 2), HEK-293 Parental Cells (Lanes 3 and 4), C-21 Cells (400,000 Native Rcs per Cell) (Lanes 5 and 6), and {Delta}R186K.S Cells (Lanes 7 and 8)

Even-numbered lanes contain excess (10-6 M) of competing nonradiolabeled bPTH-(1–34). Migration pattern of protein mol wt markers is noted at the left of the figure. The arrow indicates the position of the ~80–90 kDa hormone-receptor conjugate.

 
One possible explanation for the lack of detectable cross-linking of {Delta}R186K.S cells with 125I-K13 may be related to the moderate number of receptors expressed on the cell surface (~30,000 Rcs per cell). To determine whether the level of receptor expressed in {Delta}R186K.S cells is below the threshold for detection by cross-linking, we compared the cross-linking of {Delta}R186K.S to that of other cell lines expressing either approximately 400,000 or approximately 40,000 wild-type hPTH1 Rcs/cell (C-21 and C-20, respectively) (24). We found that both wild-type receptor-expressing cell lines cross-linked to 125I-K13 as expected (Fig. 5Go, lanes 1 and 5), but {Delta}R186K.S cells did not (Fig. 5Go, lane 7). We also performed a dilution experiment in which C-20 cells were serially diluted with parental HEK-293 cells, which lack hPTH1 Rc expression (Fig. 5Go, lane 3) (24). Effectively, cells in these mixed cultures express a lower receptor density (number per cell) (30). The mixed cultures were able to cross-link to 125I-K13, even at apparent receptor expression levels of about 20,000 Rcs per cell (data not shown). We interpret these data to indicate that 125I-K13 is capable of specifically cross-linking to and detecting native hPTH1 Rc (even at receptor expression levels that are lower than that of {Delta}R186K.S cells), but cannot cross-link the {Delta}R186K mutant receptor despite its productive interaction, in terms of stimulating signal transduction and binding.

To determine whether the lack of 125I-K13 cross-linking was specific for the {Delta}R186K mutant, we examined another mutant in which alanine was substituted for Arg186 ({Delta}R186A) (Figs 1Go and 6Go). Similar to the lysine substitution, this substitution maintains biological activity (adenylyl cyclase) comparable to native receptor in transiently transfected COS-7 cells (Fig. 2BGo), has a 1- to 2-fold reduction in specific binding (Fig. 2CGo), and also does not cross-link to 125I-K13 (Fig. 6Go). In sharp contrast, Ala or Lys substitutions at either Arg181 or Arg179 (Fig. 1Go and Table 1Go), only five or seven amino acids away from Arg186, show native hPTH1 Rc-like bioactivity (adenylyl cyclase) and are specifically cross-linked to 125I-K13 when transiently expressed in COS-7 cells (Fig. 6Go, lanes 3–10).



View larger version (59K):
[in this window]
[in a new window]
 
Figure 6. SDS-PAGE (7.5%) Analysis of 125I-K13 Photoaffinity Cross-linking to COS-7 Cells Transiently Expressing Native hPTH1 Rc (Lanes 1 and 2), and Mutants {Delta}R179K (Lanes 3 and 4), {Delta}R179A (Lanes 5 and 6), {Delta}R181K (Lanes 7 and 8), {Delta}R181A (Lanes 9 and 10), {Delta}R186K (Lanes 11 and 12), and {Delta}R186A (Lanes 13 and 14)

Even-numbered lanes contain excess (10-6 M) of nonradiolabeled bPTH-(1–34). Migration pattern of protein mol wt markers is noted to the left of lanes 1 and 7. The arrows indicate the positions of the ~80–90 kDa hormone-receptor conjugate.

 
Another possible explanation for the lack of cross-linking to the {Delta}R186K mutant receptor is that the mutation induces a conformational change in the receptor that specifically inhibits the cross-linking of 125I-K13. To address this issue, we examined the ability of another BP-containing PTH analog (Bpa1) to cross-link to the {Delta}R186K mutant receptor. This ligand has a p-benzoylphenylalanine (Bpa) residue at position 1 of PTH-(1–34). The analog has been shown to cross-link with a contact domain localized to the third extracellular loop of the hPTH1 Rc (19). Cells transiently transfected with the {Delta}R186K mutant hPTH1 Rc (data not shown) or {Delta}R186K.S cells do cross-link to 125I-Bpa1 (Fig. 7Go, lane 5). Cross-linking is competed specifically by the addition of excess (final concentration 10-6 M) unlabeled PTH-(1–34) (Fig. 7Go, lane 6). The size of the {Delta}R186K.S cell cross-linked hormone-receptor conjugate obtained from {Delta}R186K.S cells is similar (80–90 kDa) to that observed for the cross-linked native receptor expressed in C-21 cells (Fig. 7Go, lane 3) (15, 17). Taken together, these data support the notion that position 186 of the hPTH1 Rc is critical for cross-linking to position 13 of PTH-(1–34) and that the lack of cross-linking with receptor mutants substituted at position 186 reflects the essential nature of an arginine at this position.



View larger version (74K):
[in this window]
[in a new window]
 
Figure 7. SDS-PAGE Analysis of 125I-Bpa1 Photoaffinity Cross-linking to HEK-293 Parental Cells (Lanes 1 and 2), C-21 Cells (Lanes 3 and 4), and {Delta}R186K.S Cells (Lanes 5 and 6).

Even-numbered Lanes contain excess (10-6 M) of nonradiolabeled bPTH-(1–34). Migration pattern of protein mol wt markers is noted at the left of the figure. The arrow indicates the position of the ~80–90 kDa hormone-receptor conjugate.

 
Effect of hPTH1 Rc Mutations Adjacent to Arg186
To determine the involvement (if any) of the amino acids neighboring the putative contact point at Arg186, we generated hPTH1 Rc mutants with specific substitutions at Asp185 ({Delta}D185A) and Gly188 ({Delta}G188A). Neither of these mutations resulted in alteration of PTH-stimulated adenylyl cyclase activity in transiently transfected COS-7 cells (Table 1Go). Furthermore, both receptors can be cross-linked specifically with 125I-K13 (Fig. 8BGo).



View larger version (74K):
[in this window]
[in a new window]
 
Figure 8. SDS-PAGE Analysis of 125I-K13 Cross-linking to COS-7 Cells Transiently Expressing {Delta}D185A (Lanes 1 and 2) and {Delta}G188A (Lanes 3 and 4)

Even-numbered lanes contain excess (10-6 M) of nonradiolabeled bPTH-(1–34). Migration pattern of protein mol wt markers is noted at the left of the figure. The arrow indicates the position of the ~80–90 kDa hormone-receptor conjugate.

 
In addition, we also conducted an alanine scan by preparing a series of hPTH1 Rc mutants with alanine (Ala) substituted for several amino acids (one-at-a-time) in the originally identified 125I-K13 contact domain (hPTH1 Rc residues Phe173-Met189) (Table 1Go) (31, 32). All the Ala-substituted receptors tested demonstrated biological activity and competeable cross-linking that was comparable to that of native hPTH1 Rc (Table 1Go; cross-linking data not shown). These data suggest that modifications of amino acids Asp185 or Gly188, or of several other amino acids neighboring Arg186 and within the 125I-K13 contact domain, have no major impact on receptor function or cross-linking.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this study we have refined the boundaries of the previously identified 17-amino acid contact domain (amino acids 173–189) within the hPTH1 Rc, which cross-links to 125I-K13 (15), to a shorter epitope. We also identified a specific amino acid in the receptor that plays, at a minimum, a crucial role in interaction with hormone and may represent an actual contact point. To our knowledge, this is the first study to use site-directed mutagenesis to probe the role of structural features within a contact domain identified directly by photoaffinity cross-linking of the hPTH1 Rc.

We prepared three hPTH1 Rc mutants designed to dissect the 17-amino acid contact domain by creating new Lys-C digestion sites in the receptor ({Delta}R179K, {Delta}R181K, {Delta}R186K). Characterization of these mutant receptors in transiently and stably transfected cells demonstrated biological function virtually indistinguishable from wild-type hPTH1 Rc (Table 1Go and Figs. 2AGo and 3Go), except for ligand binding, which was moderately reduced in one transiently transfected mutant, {Delta}R186K (Table 1Go and Figs. 2CGo and 3BGo). 125I-K13 binding studies demonstrate that each of the mutant receptors is expressed on the cell surface and that the general topology of the mutant receptors does not appear dramatically altered (Fig. 3Go, A and B). Based on high levels of receptor expression (~200,000 Rcs per cell) and the strategic location of the mutation within the contact domain, one of the stable cell lines ({Delta}R181K.S) was used for detailed enzymatic mapping of the hormone-receptor conjugate. Our approach to biochemically analyzing the cross-linked hormone-receptor conjugate requires large amounts of biologically active receptor; {Delta}R181K.S cells express sufficient receptor for this purpose (Fig. 3AGo). The {Delta}R181K.S cells were cross-linked with 125I-K13 and the hormone-receptor conjugate isolated. The specific cleavage pattern observed for the mutant receptor, compared with the native sequence receptor (15, 22, 23), confirmed the 17-amino acid (173–189) region as the 125I-K13 contact domain (15) and further restricted the contact domain to only eight amino acids, namely positions 182–189 (Fig. 4Go).

The lack of cross-linking of 125I-K13 to {Delta}R186K.S cells, possessing an otherwise efficiently expressed (~30,000 Rcs per cell; Fig. 3BGo) and functional (EC50 = 3 x 10-9 M and IC50 = 4 x 10-8 M; Table 1Go) mutant receptor, is of great interest. These properties were also observed in another mutant in which Arg186 was replaced by Ala, which, unlike Arg or Lys, lacks a positive charge on its side chain. The transient {Delta}R186A mutant Rc was functionally intact (Fig. 2BGo) but impaired in its capacity to cross-link to 125I-K13 (Fig. 6Go). Hence, mutation of Arg186 is not a silent mutation. Our receptor dilution experiments suggest that absence of detectable ligand-receptor conjugate in the 125I-K13-cross-linked {Delta}R186K.S cells cannot be attributed to the relatively low level of receptor expression of these cells (~30,000 Rcs per cell) as compared with the receptors in both the wild-type C-20 cells (~40,000 Rcs per cell) and {Delta}R181K.S cells (~200,000 Rcs per cell), which both cross-link 125I-K13 (Figs. 4Go and 5Go). Moreover, complete sequencing of the cDNA from {Delta}R186K.S cells revealed the integrity of the sequence with no additional mutations (data not shown).

The lack of cross-linking to 125I-K13 suggests that Arg186 contributes to the interaction with hormone. The subtle and localized nature of this interaction is evident from its selective effect on cross-linking to a photoreactive moiety located at position 13; there is no effect of this mutation on cross-linking to a photoreactive moiety at position 1 of PTH (Fig. 7Go). Therefore, we conclude that the perturbation caused by both the R186K and R186A receptor mutations is local and devoid of global conformational changes that may result in long-range effects on other ligand-receptor contact interactions. Finally, the specificity of this perturbation is demonstrated by an alanine scan of other residues in the contact domain 173–189, on both sides of position 186. Neither disruption of PTH-stimulated adenylyl cyclase activity nor elimination of cross-linking to 125I-K13 was observed in these mutants (Table 1Go, cross-linking data not shown). Taken together, these data strongly support the idea that Arg186 of the hPTH1 Rc is critical for specific interaction with position 13 of PTH-(1–34). Arg186 may represent an actual hormone contact point or may be in very close proximity to the amino acid contacting residue 13 in native PTH. Because the nature of our studies requires the use of a BP-substituted hormone, we cannot definitively conclude that Arg186 is the contact point with position 13 of the hormone, but it is surely within several angstroms (the radius of the BP moiety) of this amino acid.

Homologous scanning mutagenesis studies of the rat (r) PTH1 Rc and the rat secretin (Sec) Rc reveal that replacement of residues 171–189 of the rPTH1 Rc with the corresponding residues of the rSec Rc results in loss of PTH-(1–34) binding affinity (12). Further analysis of the importance of this domain indicated that swapping residues 171–179 between the two receptors led to no significant changes in PTH-(1–34) binding affinity, while swapping residues 182–190 resulted in an 80% reduction in PTH-(1–34) binding affinity (12). These data are in agreement with our direct identification of a contact domain for 125I-K13: residues 182–190 appear to be critical for interaction with PTH-(1–34). Furthermore, mutations {Delta}R186K and {Delta}R186A cause no significant change in signal transduction by the receptor, but they lead to an abolishment of photoaffinity cross-linking to position 13 in PTH, strongly suggesting that either Arg186 or an amino acid close to Arg186 in the hPTH1 Rc is critical for interaction with residue 13 of PTH-(1–34). We postulate that the R186K and R186A mutations alter the topology of the receptor sufficiently to disrupt the normally close spatial arrangement of position 13 in PTH to Arg186 in the receptor. Hence, BP-mediated cross-linking does not occur. However, the magnitude of the change in Rc topology is not enough to compromise a productive hormone-receptor interaction responsible for signal transduction.

Predictions of the membrane organization of hPTH1 Rc based on hydropathy analysis indicate that Arg186 lies just at the N-terminal extracellular/transmembrane (TM)-1 junction (19). Interestingly, site-directed mutagenesis of polar amino acids at the membrane-extracellular interface and in TM domains of the rat PTH1 Rc, as well as in other G protein-coupled receptors, including the m5 muscarinic and {alpha}-factor Rcs, has been reported to have effects on binding affinity and ligand specificity (14, 33, 34).

Also, a BLAST search (35) of the protein sequence of this extracellular-TM1 region (residues 173–189) indicates no homology with other members of the secretin/vasoactive intestinal peptide/glucagon subfamily of G protein-coupled receptors, although the flanking domains possess some homology with other family members. In general, most homology among these receptors is between TM domains, but extracellular regions do reveal some homology. The total lack of homology for the contact domain suggests that this region may be particularly important for ligand binding and specificity, as our experimental data suggest.

The PTH1 Rc presumably has a finite number of sites that contact the hormone (36, 37, 38, 39, 40). Our studies with the R186K and R186A mutant receptors suggest that the replacement of Arg186 with lysine or alanine eliminates contact with Lys13 in PTH. Furthermore, it appears as though cross-linking in this region is more sensitive to disruption than hormone binding or signal transduction, suggesting that cooperativity of multiple interaction sites leads to hormone binding and a signal transduction response. Eliminating one site may be enough to prevent cross-linking, but a sufficient number of bimolecular contacts remain intact to permit molecular recognition and stimulation of adenylyl cyclase.

These studies offer new insights into the nature of ligand-receptor interactions. Our findings suggest a hierarchy of bimolecular contacts that differ in their role and significance. Studies in which multiple contact points in the receptor are simultaneously mutated should provide further understanding of the essential set of contacts necessary for receptor activation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents
Na125I was obtained from Amersham Corp. (Arlington Heights, IL). Endo-F and Lys-C were purchased from Boehringer Mannheim (Indianapolis, IN). DMEM, FBS, trypsin, and PBS were obtained from GIBCO-BRL (Gaithersburg, MD). All tissue culture disposables and plasticware were obtained from Corning (Corning, NY). All other chemical reagents were of the highest analytical grade and were purchased from Sigma (St. Louis, MO).

Peptides
All peptides were synthesized by the solid phase methodology with an Applied Biosystems 430A peptide synthesizer using Boc/HOBt/NMP chemistry. After hydrogen fluoride cleavage the peptides were purified by RP-HPLC (21). Purity and structure of the peptides were confirmed by analytical RP-HPLC, amino acid analysis, and electron spray mass spectrometry. Detailed synthetic protocols, purifications, and characterization of peptides are reported elsewhere (15, 19, 21, 41). The radioiodination of the ligands, [Nle8,18,Tyr34]bPTH-(1–34)NH2 (PTH-(1–34)), [Nle8,18,Lys13({epsilon}-pBz2),L-2-NaI23,Arg26,27,Tyr34]bPTH-(1–34)NH2 (K13), and [Bpa1,Nle8,18,Arg13,26,27,L-2-NaI23,Tyr34]bPTH-(1–34)NH2 (Bpa1), as well as RP-HPLC purifications, were performed as previously described (42).

Cell Culture
All cell lines, HEK-293, C-21, C-20 (24), {Delta}R181K.S, {Delta}R186K.S, and COS-7 (a generous gift of Dr. Steven Goldring, Beth Israel Deaconess Medical Center) were cultured in DMEM supplemented with 10% FBS as described (24). C-21 and C-20 cell media were supplemented with G418 (500 µg/ml). {Delta}R181K.S and {Delta}R186K.S media were supplemented with Zeocin (250 µg/ml) (Invitrogen, San Diego, CA).

Site-Directed Mutagenesis and Analysis of Constructs
The following amino acids of the hPTH1 Rc were modified: Arg179 to Lys and Ala ({Delta}R179K, {Delta}R179A); Arg181 to Lys and Ala ({Delta}R181K, {Delta}R181A); Arg186 to Lys and Ala ({Delta}R186K, {Delta}R186A). Additionally, Ala mutations were made to amino acids Phe173, Leu174, Thr175, Asn176, Glu177, Thr178, Glu180, Asp185 and Gly188. Primer pairs (sense and antisense) were prepared containing the appropriate modifications (GIBCO-BRL Custom primers). The following is a list of sense primers (5' - 3') for each mutation made:

{Delta}N176A: caaatttctcaccgcggagactcgtgaac

{Delta}R179K: caaatttctcaccaatgagactaaagaacgggaggtgtttgaccgcc{Delta}R179A: caaatttctcaccaatgagactgctgaacgggaggtgtttgaccgcc{Delta}R181K: caccaatgagactcgtgaaaaggaggtgtttgaccgcctgg{Delta}R181A: caccaatgagactcgtgaagcggaggtgtttgaccgcctgg{Delta}R186K: cgggaggtgtttgacaaactgggcatgatttacaccg {Delta}R186A: cgggaggtgtttgacgccctgggcatgatttacaccg {Delta}G188A: gaggtgtttgaccgcctggccatgatttacaccgtgggc{Delta}F173A: cgagtgtgtcaaagcactcaccaatgagac {Delta}L174A: gtgtgtcaaatttgcgaccaatgagactcg{Delta}T175A: gtcaaatttctcgccaatgagactcgtg {Delta}E177A: caaatttctcaccaatgcgactcgtgaacgggag{Delta}T178A: ctcaccaatgaggcacgtgaacgggag {Delta}E180A: ccaatgagactcgtgcgcgggaggtgtttg{Delta}D185A: cgggaggtgtttgcccgcctgggcbp

Prepared primers were purified by SDS-PAGE and visualized. The gel portion containing the primers was excised, macerated, and incubated with shaking in 500 µl water overnight at 37 C. Primer pairs were used in the PCR-based, Quik-Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), using the hPTH1 Rc as a template (17) in the pZeoSV2 (Invitrogen) mammalian expression vector. Individual PCR reactions were used to transform DH5{alpha} cells (GIBCO-BRL) and transformations plated on bacteriological agar containing Zeocin. Colonies were identified and selected for plasmid isolation (QIAGEN, Santa Clara, CA). Plasmid preparations were cycle sequenced to confirm mutations (Genomyx, Foster City, CA) using oligonucleotide primers located 5' to the regions of the hPTH1 Rc targeted for mutation. Subsequently, the plasmid cDNA of key receptor mutants was fully sequenced to confirm the fidelity and specificity of the mutagenesis.

Transient and Stable Transfection
COS-7 cells were plated at 5–7.5 x 105 cells per 10-cm dish 24 h before transient transfection. HEK-293 cells were plated at 106 cells per 10- cm dish before stable transfection. Ten micrograms of each mutant or native receptor construct were cotransfected with 10 µg carrier DNA using calcium/phosphate precipitation (GIBCO-BRL). For transient transfections, cells were subcultured 24 h after transfection at 2 x 105 cells per 24-well dish. Adenylyl cyclase activity, ligand binding, and photoaffinity cross-linking were performed 72 h after transfection. For stable transfection of HEK-293 cells, growth medium was changed 24 h after transfection, and the transfected cells split to 1:4 in media containing 250 µg/ml Zeocin. Fifty to 100 colonies were isolated for each mutant and transferred to 96-well dishes for several weeks in Zeocin-containing media. The stable expression of mutant hPTH1 Rc was determined by assaying the cells for PTH-stimulated adenylyl cyclase activity (17, 21).

Radioligand Binding
Cell lines were subcultured in polylysine-coated 24-well plates and grown to confluency. RRAs were carried out as previously described (17, 21) using 125I-K13 as a radioligand.

Adenylyl Cyclase Activity
Cell lines were subcultured in 24-well plates and grown to near confluency. COS-7 cells transiently expressing mutant receptors were subcultured 24 h after transfection at a density of 2 x 105 cells per well in 24-well plates and assayed for adenylyl cyclase activity 72 h after transfection. Stable cell lines were plated and assayed as described previously (21). Determination of the activation of adenylyl cyclase by PTH analogs was carried out using a two-column chromatographic method, as described previously (21).

Photoaffinity Cross-linking
Analytical Scale
Cells for photoaffinity labeling were grown to confluence in 24-well tissue culture plates and washed with DMEM. For the experiment, each well contained 200 µl DMEM and either 25 µl 10-5 M bPTH-(1–34) in vehicle (PBS/0.1% BSA), or vehicle alone. Reactions were incubated 15 min at room temperature before 1–2 million cpm of 125I-K13 or 125I-Bpa1 in DMEM (total volume 25 µl) was added to each well. Cells were incubated for an additional 10–15 min, at room temperature. Plates were cross-linked on ice approximately 5–10 cm from six 15-watt, 365-nm UV lamps in a Stratalinker 2400 (Stratagene) for 15 min at 4 C. Each well was washed with PBS, and cells were lysed with 0.5 ml Laemmli sample buffer (43), gently shaken on a rocking platform for 10–30 min, and harvested into individual 1.5-ml Eppendorf tubes. Tubes were incubated on a rotating platform at RT for 2–3 h and either frozen at -80 C or analyzed by reducing SDS-PAGE.

Preparative Scale
Cells for photoaffinity labeling were cultured in ten 15-cm2 dishes to confluency and harvested with Versine. The cells were washed twice by centrifugation (800 x g) in DMEM, and the cell pellet resuspended in 10 ml DMEM. One milliliter (~0.5 mCi) of 125I-K13 was added to the cells and approximately l.8 ml cell per ligand aliquots were added to each well of a six-well tissue culture plate. The cell ligand mixture was incubated with gentle shaking at room temperature for 1 h. The uncovered dish was placed on ice, and the photoreaction was carried out for 60 min at 4 C, as described above. Reaction mixtures were collected into 50-ml plastic tubes (Falcon), washed three times with PBS by centrifugation (1,000 x g). The cell pellet obtained was either frozen at -80 C or immediately used for subsequent membrane preparation.

Membrane Protein Preparation
Preparative cross-linked cell pellets were resuspended in 11 ml of 25 mM Tris-base (pH 8.5) and cells lysed by four freezing (liquid N2) and thawing cycles. The crude cell lysate was centrifuged (~2,000 x g, 20 min), and the supernatant was aliquoted (0.9 ml/tube) to ultracentrifuge tubes, and centrifuged at 125,000 x g for 2 h at 4 C. After supernatant aspiration, the purified membranes were either stored at -80 C or processed further.

Membranes were incubated 3–24 h on a rotating platform in extraction buffer [25 mM Tris, 100 mM dithiotreithol, 2.0% Triton, pH 8.5, 0.02% sodium azide]. The extracted membranes were precipitated in 5 volumes of cold acetone and centrifuged for 30 min in an Eppendorf Microcentrifuge at 8,000 rpm. After supernatant aspiration, the membrane pellets were air-dried and stored at -20 C. The pellets were then resuspended in 20 µl 10% (wt/vol) SDS and diluted with 120 µl 25 mM Tris, pH 8.5. The samples were then reduced with 25 mM (final concentration) dithiothreitol for 1 h at 37 C, and alkylated 30–50 mM (final concentration) iodoacetamide for 30 min at 37 C. The buffer was then exchanged to digest buffer (25 mM Tris, 0.1% Triton, 0.01% SDS, pH 8.5) using Centricon 50 concentrators (Amicon, Beverly, MA).

Membrane Protein Digestions
For Lys-C digestion, protein samples were dissolved in 20–40 µl of digest buffer. For Endo-F digestion, protein samples were added to 80 µl Endo F/Kphos buffer (0.1 M potassium phosphate, 2% n-octyl glucoside, 0.2% SDS, 1% ß-mercaptoethanol, pH 7.5). Buffered samples were digested with 0.2–0.5 U of enzyme overnight at 37 C. For CNBr digestion, protein samples were placed in 50 µl FA buffer (formic acid, 1.0% Triton X-100, 0.2% SDS) with a small crystal of CNBr and reacted overnight in darkness at room temperature under nitrogen. Samples were evaporated to dryness three to four times, using successive addition of water followed by Speed-vac.

Electrophoresis and Autoradiography
Electrophoretic analysis was performed using 7.5% SDS-PAGE (43) for the intact and deglycosylated hormone-receptor conjugates and 16.5% Tricine/SDS-PAGE (15) for the digested hormone-receptor fragments. Appropriate mol wt markers [low and high mol wt, Amersham and Bio-Rad, Richmond, CA)] were included in each gel run. After electrophoresis, gels were dried and exposed to x-ray film (1–5 days) (X-Omat, Eastman-Kodak, Rochester, NY) with intensifying screens (Kodak) at -80 C. After autoradiography, the radioactive hormone-receptor fragments were excised from the dried gels, electroeluted (Bio-Rad, Electro-eluter 422) in SDS-PAGE running buffer, and concentrated/buffer exchanged using Microcon/Centricon Microconcentrators (Amicon) of the appropriate mol wt cut-off for further analysis.


    ACKNOWLEDGMENTS
 
We wish to thank Vered Behar for her assistance in peptide radioiodination. Thanks also to Stephen Anderson and Marielle Thorne for providing technical support.


    FOOTNOTES
 
Address requests for reprints to: Amy E. Adams, Beth Israel Deaconess Medical Center, Division of Bone and Mineral Metabolism (HIM 944), 330 Brookline Avenue, Boston, Massachusetts 02215. E-mail: aadams{at}bidmc.harvard.edu

This work was funded in part by NIH Grant R01-DK-47940 (to M.R.) from the NIH.

1 Harvard Graduate School of Arts and Sciences, Division of Medical Sciences, Department of Biological Chemistry and Molecular Pharmacology. Back

2 Current address: SmithKline Beecham Pharmaceuticals, 709 Swedeland Road, King of Prussia, Pennsylvania 19406. Back

Received for publication May 11, 1998. Revision received July 15, 1998. Accepted for publication August 4, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Fitzpatrick LA, Bilezikian JP 1996 Actions of parathyroid hormone. In: Bilezikian JP, Raisz LG, Rodan GA (eds) Principles of Bone Biology. Academic Press, San Diego, CA, pp 339–346
  2. Jüppner H 1994 Molecular cloning and characterization of a parathyroid hormone/parathyroid hormone-related peptide receptor: a member of an ancient family of G protein-coupled receptors. Curr Opin Nephrol Hypertens 3:371–378[CrossRef][Medline]
  3. Abou-Samra A-B, Jüppner H, Force T, Freeman MW, Kong X-F, Schipani E, Urena P, Richards J, Bonventre JV, Potts Jr JT, Kronenberg HM, Segre GV 1992 Expression cloning of a common receptor for parathyroid hormone and parathyroid hormone-related peptide from rat osteoblast-like cells: a single receptor stimulates intracellular accumulation of both cAMP and inositol triphosphates and increases intracellular free calcium. Proc Natl Acad Sci USA 89:2732–2736[Abstract/Free Full Text]
  4. Chorev M, Rosenblatt M 1996 Parathyroid hormone: structure–function relations and analog design. In: Bilezikian JP, Raisz LG, Rodan GA (eds) Principles of Bone Biology. Academic Press, San Diego, CA, pp 305–324
  5. Pines M, Fukayama S, Costas K, Meurer E, Goldsmith PK, Xu X, Muallem S, Behar V, Chorev M, Rosenblatt M, Tashjian Jr AH, Suva LJ 1996 Inositol 1-,4-,5-triphosphate-dependent Ca2+ signaling by the recombinant human PTH/PTHrP receptor stably expressed in a human kidney cell line. Bone 18:381–389[Medline]
  6. Hock JM, Gera I, Fonseca J, Raisz LG 1988 Human parathyroid hormone-(1–34) increases bone mass in ovariectomized and orchidectomized rats. Endocrinology 122:2899–2904[Abstract]
  7. Dempster DW, Cosman F, Parisien M, Shen V, Lindsay R 1993 Anabolic actions of parathyroid hormone on bone. Endocr Rev 14:690–709[CrossRef][Medline]
  8. Wronski TJ, Yen C-F, Qi H, Dann LM 1993 Parathyroid hormone is more effective than estrogen or bisphosphonates for restoration of lost bone mass in ovariectomized rats. Endocrinology 132:823–831[Abstract]
  9. Finkelstein JS, Klibanski A, Schaefer EH, Hornstein MD, Schiff I, Neer E 1994 Parathyroid hormone for the prevention of bone loss induced by estrogen deficiency. N Engl J Med 331:1618–1623[Abstract/Free Full Text]
  10. Gardella TJ, Jüppner H, Wilson AK, Keutmann HT, Abou-Samra AB, Segre GB, Bringhurst FR, Potts Jr JT, Nussbaum SR, Kronenberg HM 1994 Determinants of [Arg2]PTH-(1–34) binding and signaling in the transmembrane region of the parathyroid hormone receptor. Endocrinology 135:1186–1194[Abstract]
  11. Huang Z, Chen Y, Pratt S, Chen TH, Bambino T, Shoback DM, Nissenson RA 1995 Mutational analysis of the cytoplasmic tail of the G protein-coupled receptor for parathyroid hormone (PTH) and PTH-related protein: effects on receptor expression and signaling. Mol Endocrinol 9:1240–1249[Abstract]
  12. Lee C, Luck MD, Juppner H, Potts Jr JT, Kronenberg HM, Gardella TJ 1995 Homolog-scanning mutagenesis of the parathyroid hormone (PTH) receptor reveals PTH-(1–34) binding determinants in the third extracellular loop. Mol Endocrinol 9:1269–1278[Abstract]
  13. Bergwitz C, Gardella TJ, Flannery MR, Potts Jr JT, Kronenberg HM, Goldring SR, Jüppner H 1996 Full activation of chimeric receptors by hybrids between parathyroid hormone and calcitonin. Evidence for a common pattern of ligand-receptor interaction. J Biol Chem 271:26469–26472[Abstract/Free Full Text]
  14. Gardella TJ, Luck MD, Fan MH, Lee C 1996 Transmembrane residues of the parathyroid hormone (PTH)/PTH-related peptide receptor that specifically affect binding and signaling by agonist ligands. J Biol Chem 271:12820–12825[Abstract/Free Full Text]
  15. Zhou AT, Besalle R, Bisello A, Nakamoto C, Rosenblatt M, Suva LJ, Chorev M 1997 Direct mapping of an agonist-binding domain within the parathyroid hormone/parathyroid hormone-related protein receptor by photoaffinity crosslinking. Proc Natl Acad Sci USA 94:3644–3649[Abstract/Free Full Text]
  16. Chowdhry V, Westheimer FH 1979 Photoaffinity labeling of biological systems. Annu Rev Biochem 48:293–325[CrossRef][Medline]
  17. Adams AE, Pines M, Nakamoto C, Behar V, Yang QM, Besalle R, Chorev M, Rosenblatt M, Levine MA, Suva LJ 1995 Probing the bimolecular interactions of parathyroid hormone and the human parathyroid hormone/parathyroid hormone-related protein receptor. 2. Cloning, characterization, and photoaffinity labeling of the recombinant human receptor. Biochemistry 34:10553–10559[CrossRef][Medline]
  18. Bisello A, Greenberg Z, Behar V, Rosenblatt M, Suva LJ, Chorev M 1997 Direct mapping of interactions between PTH and the PTH/PTHrP receptor by photoaffinity crosslinking: identification of two distinct contact domains. J Bone Miner Res 12 [Suppl]:S363 [Abstract]
  19. Bisello A, Adams AE, Mierke DF, Pellegrini M, Rosenblatt M, Suva LJ, Chorev M 1998 Parathyroid hormone–receptor interactions identified directly by photocrosslinking and molecular modeling studies. J Biol Chem 273:22498–22505[Abstract/Free Full Text]
  20. Dorman G, Prestwich GD 1994 Benzophenone photophores in biochemistry. Biochemistry 33:5661–5673[CrossRef][Medline]
  21. Nakamoto C, Behar V, Chin KR, Adams AE, Suva LJ, Rosenblatt M, Chorev M 1995 Probing the bimolecular interactions of parathyroid hormone with the human parathyroid hormone/parathyroid hormone-related protein receptor. 1. Design, synthesis and characterization of photoreactive benzophenone-containing analogs of parathyroid hormone. Biochemistry 34:10546–10552[CrossRef][Medline]
  22. Schipani E, Karga H, Karaplis AC, Potts Jr JT, Kronenberg HM, Segre GV, Abou-Samra A-B, Jüppner H 1993 Identical complementary deoxyribonucleic acids encode a human renal and bone parathyroid hormone (PTH)/PTH-related peptide receptor. Endocrinology 132:2157–2165[Abstract]
  23. Adams AE, Chorev M, Rosenblatt M, Suva LJ 1993 Cloning and characterization of the human PTH/PTHrP receptor. J Bone Miner Res 8[Suppl 1]:S195 (Abstract)
  24. Pines M, Adams AE, Stueckle S, Bessalle R, Rashti-Behar V, Chorev M, Rosenblatt M, Suva LJ 1994 Generation and characterization of human kidney cell lines stably expressing recombinant human PTH/PTHrP receptor: lack of interaction with a C-terminal human PTH peptide. Endocrinology 135:1713–1716[Abstract]
  25. Behar V, Nakamoto C, Greenberg Z, Bisello A, Suva LJ, Rosenblatt M, Chorev M 1996 Histidine at position 5 is the specificity "switch" between two parathyroid hormone receptor subtypes. Endocrinology 137:4217–4224[Abstract]
  26. Behar V, Pines M, Nakamoto C, Greenberg Z, Bisello A, Stueckle SM, Bessalle R, Usdin TB, Chorev M, Rosenblatt M, Suva LJ 1996 The human PTH2 receptor: binding and signal transduction properties of the stably expressed recombinant receptor. Endocrinology 137:2748–2757[Abstract]
  27. Shigeno C, Hiraki Y, Westerberg DP, Potts JT, Segre GV 1988 Parathyroid hormone receptors are plasma membrane glycoproteins with asparagine-linked oligosaccharides. J Biol Chem 263:3872–3878[Abstract/Free Full Text]
  28. Bisello A, Greenberg Z, Behar V, Rosenblatt M, Suva LJ, Chorev M 1996 Role of glycosylation in expression and function of the human parathyroid hormone/parathyroid hormone-related protein receptor. Biochemistry 35:15890–15895[CrossRef][Medline]
  29. Leung AT, Oi LJ, Abou-Samra AB 1996 Role of glycosylation in PTH/PTHrP receptor function. J Bone Miner Res 11[Suppl]:S306 (Abstract)
  30. Bringhurst FR, Jüppner H, Guo J, Urena P, Potts Jr JT, Kronenberg HM, Abou-Samra AB, Segre GV 1993 Cloned, stably expressed parathyroid hormone (PTH)/PTH-related peptide receptors activate multiple messenger signals and biological responses in LLC-PK1 kidney cells. Endocrinology 132:2090–2098[Abstract]
  31. Cunningham BC, Wells JA 1989 High-resolution mapping of hGH-receptor interactions by alanine-scanning mutagenesis. Science 244:1081–1085[Abstract/Free Full Text]
  32. Williams PF, Mynarcik DC, Yu GQ, Whittaker J 1995 Mapping of an NH2-terminal ligand binding site of the insulin receptor by alanine scanning mutagenesis. J Biol Chem 270:3012–3016[Abstract/Free Full Text]
  33. Spalding TA, Burstein ES, Wells JW, Brann MR 1997 Constitutive activation of the m5 muscarinic receptor by a series of mutations at the extracellular end of transmembrane 6. Biochemistry 36:10109–10116[CrossRef][Medline]
  34. Konopka JB, Margarit SM, Dube P 1996 Mutation of Pro-258 in transmembrane domain 6 constitutively activates the G protein-coupled alpha-factor receptor. Proc Natl Acad Sci USA 93:6764–6769[Abstract/Free Full Text]
  35. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ 1990 Basic local alignment search tool. J Mol Biol 215:403–410[CrossRef][Medline]
  36. Horiuchi N, Holick MF, Potts Jr JT, Rosenblatt M 1983 A parathyroid hormone inhibitor in vivo: design and biological evaluation of a hormone analog. Science 220:1053–1055[Abstract/Free Full Text]
  37. McGowan JA, Chen TC, Fragola J, Puschett JB, Rosenblatt M 1983 Parathyroid hormone: effects of the 3–34 fragment in vivo and in vitro. Science 219:67–69[Abstract/Free Full Text]
  38. McKee RL, Goldman ME, Caulfield MP, DeHaven PA, Levy JJ, Nutt RF, Rosenblatt M 1988 The 7–34-fragment of human hypercalcemia factor is a partial agonist/antagonist for parathyroid hormone-stimulated cAMP production. Endocrinology 122:3008–3010[Abstract]
  39. Chorev M, Goldman ME, McKee RL, Roubini E, Levy JJ, Gay CT, Reagan JE, Fisher JE, Caporale LH, Golub EE, Caulfield MP, Nutt RF, Rosenblatt M 1990 Modifications of position 12 in parathyroid hormone and parathyroid hormone-related protein: toward the design of highly potent antagonists. Biochemistry 29:1580–1586[CrossRef][Medline]
  40. Chorev M, Roubini E, McKee RL, Gibbons SW, Reagan JE, Goldman ME, Caulfield MP, Rosenblatt M 1991 Biological activity of parathyroid hormone antagonists substituted at position 13. Peptides 12:57–62[CrossRef][Medline]
  41. Goldman ME, Chorev M, Regan JE, Nutt RF, Levy JJ, Rosenblatt M 1988 Evaluation of novel parathyroid hormone analogs using a bovine renal membrane receptor binding assay. Endocrinology 123:1468–1475[Abstract]
  42. Roubini E, Duong LT, Gibbons SW, Leu CT, Caulfield MP, Chorev M, Rosenblatt M 1992 Synthesis of fully active biotinylated analogues of parathyroid hormone and parathyroid hormone-related protein as tools for the characterization of parathyroid hormone receptors. Biochemistry 31:4026–4033[CrossRef][Medline]
  43. Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685[CrossRef][Medline]



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
T. M. Murray, L. G. Rao, P. Divieti, and F. R. Bringhurst
Parathyroid Hormone Secretion and Action: Evidence for Discrete Receptors for the Carboxyl-Terminal Region and Related Biological Actions of Carboxyl- Terminal Ligands
Endocr. Rev., February 1, 2005; 26(1): 78 - 113.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Shimizu, T. Dean, J. C. Tsang, A. Khatri, J. T Potts Jr, and T. J. Gardella
Novel Parathyroid Hormone (PTH) Antagonists That Bind to the Juxtamembrane Portion of the PTH/PTH-related Protein Receptor
J. Biol. Chem., January 21, 2005; 280(3): 1797 - 1807.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Pham, J. D. Wade, B. W. Purdue, and P. M. Sexton
Spatial Proximity between a Photolabile Residue in Position 19 of Salmon Calcitonin and the Amino Terminus of the Human Calcitonin Receptor
J. Biol. Chem., February 20, 2004; 279(8): 6720 - 6729.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Dong, D. I. Pinon, R. F. Cox, and L. J. Miller
Importance of the Amino Terminus in Secretin Family G Protein-coupled Receptors: INTRINSIC PHOTOAFFINITY LABELING ESTABLISHES INITIAL DOCKING CONSTRAINTS FOR THE CALCITONIN RECEPTOR
J. Biol. Chem., January 9, 2004; 279(2): 1167 - 1175.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. C. Gensure, N. Shimizu, J. Tsang, and T. J. Gardella
Identification of a Contact Site for Residue 19 of Parathyroid Hormone (PTH) and PTH-Related Protein Analogs in Transmembrane Domain Two of the Type 1 PTH Receptor
Mol. Endocrinol., December 1, 2003; 17(12): 2647 - 2658.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Shimizu, P. H. Carter, A. Khatri, J. T. Potts Jr., and T. J. G