| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
B in Mammalian Testis
Department of Cell Biology and Physiology University of Pittsburgh Pittsburgh, Pennsylvania 15261
| ABSTRACT |
|---|
|
|
|---|
B family of
transcription factors are important intracellular conveyors of
extracellular signals in a number of systems. However, little is known
of their roles in the specialized, hormonally regulated environment of
the mammalian testis. In this study NF-
B p50 and p65 proteins were
found to be constitutively present and active in the nucleus of Sertoli
cells cultured from rat testis. In vivo, NF-
B proteins
are present in the nucleus of Sertoli cells during all 14 (IXIV)
cyclical stages of spermatogenesis; however, nuclear NF-
B expression
was elevated in stage XIV and remained high in stages IVII. In
contrast, NF-
B p50 and p65 subunits are transiently expressed in the
nuclei of germ cells with peak levels found in pachytene spermatocytes
during stages VIIXI and lower levels in stage I-VII spermatids. Tumor
necrosis factor-
, which is produced by round spermatids in
the testis, increased nuclear NF-
B binding activity when added to
Sertoli cells. Stimulation of Sertoli cells with activators of the
cAMP-protein kinase A (PKA) signaling pathway such as forskolin or FSH
also increased NF-
B DNA binding activity. Consistent with the
cellular localization studies, NF-
B was found to be activated as
high basal levels of NF-
B-stimulated reporter gene expression were
detected in transient transfection studies of Sertoli cells. Addition
of tumor necrosis factor-
to Sertoli cells further stimulated
B
enhancer-mediated transcription. These findings suggest that NF-
B
proteins are stage specifically localized to Sertoli cell and
spermatocyte nuclei and may play a role in the regulation of
stage-specific gene expression during the process of spermatogenesis. | INTRODUCTION |
|---|
|
|
|---|
(TNF-
), have been shown to be paracrine regulators of testis gene
expression (5, 6, 7, 8, 9, 10, 11). Interestingly, PKA as well as the cytokines IL-1,
IL-6, and TNF-
, share the ability to activate the nuclear factor
(NF)-
B transcription factor (12, 13, 14, 15, 16). A number of genes expressed in
the testis, including the androgen receptor, urokinase, proenkephalin,
and TNF-
genes, have been shown to be regulated by NF-
B in other
tissues (17, 18, 19, 20, 21, 22). Due to the potential importance of NF-
B in
regulating testis gene expression, we wished to test the hypothesis
that NF-
B is induced in testis seminiferous tubules.
Five NF-
B DNA-binding subunits (Rel A or p65, Rel B, c-Rel, p50, and
p52) have been identified in mammalian cells. The NF-
B (Rel) family
of transcription factors regulate transcription by binding as dimers to
B enhancer elements in the regulatory region of genes. With few
exceptions, NF-
B proteins remain in the cytoplasm of unstimulated
cells where they are tethered to various isoforms of I
B (15, 23, 24). Upon stimulation, I
B is phosphorylated and undergoes
proteosome-mediated degradation, thereby releasing NF-
B to
translocate to the nucleus and regulate gene transcription (24, 25). In
addition to regulated nuclear translocation, NF-
B activity can be
altered by phosphorylation of individual subunits. Direct
phosphorylation of NF-
B p65 by PKA or PKC has been shown to enhance
p65 DNA binding and transactivation activity (16, 26, 27).
With this study we have determined that NF-
B is constitutively
present and active in the nuclei of Sertoli cells cultured from rat
testis. In the testis, nuclear expression of NF-
B proteins was found
to be regulated in a cell- and stage-specific manner. Sertoli
cell levels of nuclear NF-
B were highest during spermatogenesis
stages XIVVII, whereas nuclear expression of NF-
B peaked in stage
VIIXI spermatocytes. Treatment of Sertoli cells with TNF-
, which
is expressed by spermatids, increased NF-
B binding activity. Sertoli
cell nuclear NF-
B DNA-binding activity was also enhanced by the PKA
activators forskolin and FSH. NF-
B was shown to be functional as
basal levels of
B enhancer-mediated transcription were
high in Sertoli cells, and addition of TNF-
further stimulated gene
expression. These data identify NF-
B as a potential regulator of
the genetic program of spermatogenesis.
| RESULTS |
|---|
|
|
|---|
B-Binding Activity in
Sertoli Cells
B in spermatogenesis, the
expression of NF-
B was first tested in electrophoretic mobility
shift assays (EMSAs) using nuclear protein extracts from primary
Sertoli cell cultures and a probe containing a consensus
B
enhancer motif. A series of DNA-protein complexes were formed (Fig. 1A
B enhancer probe: a 50-fold
excess of the homologous
B enhancer oligonucleotide eliminated all
complex formation, but a 50-fold excess of oligonucleotides containing
a Sp1-binding site or a cAMP response element (CRE) did not affect
probe-protein interactions
|
B proteins was performed using
nuclear and cytoplasmic extracts from TM4 and MSC-1 Sertoli cell lines
in addition to primary Sertoli cells. In unstimulated cells, NF-
B is
typically retained in the cytoplasm. In contrast, substantial NF-
B-
binding activity was detected in nuclear extracts from all the Sertoli
cell lines, with nuclear binding activity similar to that of the
corresponding cytoplasmic extracts. The binding activities of nuclear
and cytoplasmic extracts were also compared with cytoplasmic extracts
that were pretreated with deoxycholate (DOC), a detergent known to
dissociate I
B from NF-
B in vitro (28). Treatment of
cytoplasmic extracts with DOC enhanced the formation of DNA-protein
complexes from primary and TM4 Sertoli cells 3- and 1.5-fold,
respectively, but had less effect on MSC-1 cells (1.2-fold induction).
Furthermore, detergent treatment allowed detection of the B1 complex in
primary Sertoli cells that was otherwise only visualized after long
film exposure times (Fig. 1B
The Major Forms of NF-
B in Sertoli Cells Are p50 and p65
Further studies were undertaken to characterize the Sertoli cell
proteins binding to the
B enhancer motifs. UV cross-linked
DNA-protein complexes formed using a photoaffinity,
32P-labeled
B enhancer probe were fractionated by
SDS-PAGE to resolve the proteins covalently bound to the probe.
Complexes formed using extracts from COS-1 cells transfected with
NF-
B p50 or p65 expression vectors were compared with complexes from
unstimulated TM4, MSC-1, and primary Sertoli cell nuclear extracts.
Previous studies have shown that the probe contributes approximately 5
kDa to the apparent molecular mass of the DNA-protein complex
(29). A complex of 70 kDa that comigrates with the p65-containing
complex from transfected COS-1 cells was detected in the B1 band from
MSC-1 and primary Sertoli cells and the B2 bands from TM4, MSC-1, and
primary Sertoli extracts (Fig. 1C
). Lower levels of a 55-kDa adduct
were detected in the B2 complex that comigrated with the complex formed
from p50 expressing Cos cells. The 55-kDa complex, but not the 70 kDa
adduct, was detected in all B3 complexes. The B2 and B3 complexes also
contained varying levels of an additional 40-kDa adduct, which may
represent partial p50 proteolysis or an additional
B element-binding
protein. The 150-kDa adduct detected in the B1 and B2 complexes and the
110-kDa adduct present in the B3 complex may represent p65 dimers,
p65-p50 heterodimers, or p50 dimers simultaneously cross-linked to the
probe. Together, the UV cross-linking studies identify three types of
NF-
B complexes formed in Sertoli cells. B1 complexes contain
predominately p65 homodimers, B2 consists of p50 and p65 heterodimers,
and B3 contains p50 homodimers and an unidentified protein of
approximately 40 kDa.
To confirm that NF-
B p50 and p65 are present in Sertoli cells,
antisera against p50 and p65 were used in immunoprecipitation assays of
primary Sertoli whole-cell extracts (Fig. 1D
). Both NF-
B p50 and p65
were immunoprecipitated from the Sertoli extracts by their respective
antisera. Together, the data from Fig. 1
indicate that p50 and p65 are
major forms of
B enhancer-binding proteins present in Sertoli
cells.
NF-
B p50 and p65 Are Localized in a Stage-Specific Manner to the
Nuclei of Sertoli and Germ Cells in Vivo
To confirm the nuclear localization of NF-
B
proteins shown by the DNA-binding assays, primary Sertoli cells were
probed with p65 and p50 specific antisera in immunohistochemistry
studies. Primary Sertoli cells were found to have high levels of p50
and p65 staining in the nucleus, although some cytoplasmic staining was
also evident (Fig. 2
). In contrast,
immunostaining of NIH 3T3 cells showed p50 and p65 to be predominately
cytoplasmic, in agreement with earlier studies (30). Transferring
primary Sertoli cells from a defined serum-free media mixture to either
DMEM with no supplements or DMEM with 10% serum for 48 h did not
significantly alter the levels of nuclear NF-
B immunostaining (data
not shown). These results raised the possibility that Sertoli cells
normally retain NF-
B in the nucleus.
|
B proteins localize to the nucleus of testis
cells in vivo. Cross-sections from rat testis seminiferous
tubules can be designated as containing one of 14 characteristic
germinal cell association patterns (IXIV) or stages of
spermatogenesis (31, 32). In the rat these stages repeat in cycles of
12.5 days resulting in the cycle of the seminiferous epithelium. Rat
testis tissue sections were probed with NF-
B p50 and p65 antisera.
Both the cytoplasm and the nucleus of Sertoli cells were immunostained
by p50 and p65 antisera (Fig. 3
B
levels were elevated in spermatogenesis stages XIVVII. In contrast,
spermatocyte germ cells show a stage-specific pattern of p50 and p65
nuclear localization with peak immunostaining during stages VIIXI.
NF-
B p50 and p65 are also present in early spermatid nuclei during
stages IIII immediately after spermatocytes undergo meiosis. In some
cases lower levels of p50 immunostaining are seen as late as stage VII
spermatids, but p50 and p65 are not detected in more mature spermatids.
This pattern of staining indicates that NF-
B proteins are not
present in the nuclei of less mature leptotene and zygotene
spermatocytes but are initially expressed in the nucleus during the
pachytene stage of spermatocyte development. A summary of the relative
levels of p65 immunostaining (quantitation of p50 immunostaining was
very similar to p65) in Sertoli and spermatocyte nuclei at each stage
of spermatogenesis is provided in Fig. 4
|
|
and Phorbol 12-Myristate 13-Acetate (PMA) Induce
NF-
B-Binding Activity in Sertoli Cell Nuclei
B p50 and p65 subunit
localization to Sertoli and spermatocyte nuclei suggested that nuclear
accumulation of NF-
B subunits could be induced in response to
appropriate signals. One candidate inducer of NF-
B in the testis is
TNF-
, which has been found to be secreted from spermatids in a
spermatogenesis stage-specific manner (11) and to induce gene
expression in Sertoli cells (33). Addition of TNF-
to Sertoli cells
resulted in a dramatic increase (13.5-fold) in nuclear NF-
B-binding
activity within 0.5 h that declined slightly after 2 and 6 h
(12.5- and 8-fold above nontreated levels, respectively) (Fig. 5
B binding activity rose again
to 10.5-fold higher than basal levels after 12 h of TNF-
stimulation and declined thereafter. The membrane-permeable NF-
B
activator PMA was also able to increase nuclear NF-
B binding
activity 6.5-fold after 0.5 h of treatment with levels decreasing
after 24 h of stimulation to 3.5-fold above the basal condition.
Together, these data suggest that signaling pathways such as that
initiated by TNF-
could induce additional nuclear NF-
B-binding
activity in Sertoli cells.
|
B Binding Activity in
Sertoli Cells
B (34). The possibility
that NF-
B binding activity is increased by activators of PKA in
Sertoli cells was tested in EMSA studies. The
B enhancer probe was
incubated with nuclear extracts from untreated primary Sertoli cells or
from primary Sertoli cells stimulated with forskolin for 2 h to
raise cAMP and PKA activity. NF-
B binding activity was increased
4.5-fold after forskolin addition (Fig. 6
B binding activity 2.5-fold with levels peaking 2
h after FSH addition and falling thereafter.
|
B-Mediated Transcription Is Constitutively Stimulated in Sertoli
Cells
B proteins in testis cells
were studied using the
BLUC expression vector, which contains the
tandem
B enhancer elements of the human immunodeficiency virus-1
(HIV-1) long terminal repeat (LTR) linked to a TATA box minimal
promoter driving the luciferase reporter gene. In unstimulated MSC-1
and primary Sertoli cells,
BLUC activity was at least 50-fold
greater than the pGL2LUCBasic parent vector and 6- to 8-fold greater
than SV40LUC having the luciferase gene driven by the SV40 promoter
(Fig. 7
B p50
and p65 expression vectors into MSC-1 and primary Sertoli cells caused
a further 3 to 4-fold induction of the
BLUC reporter gene. Addition
of TNF-
also induced
BLUC in primary Sertoli cells (3.2-fold,
Fig. 7
BLUC activity (data not shown). To determine whether the high basal
levels of
B enhancer-mediated gene expression were due to NF-
B
proteins, an expression vector encoding an amino-terminal deletion
mutant of I
B
was added to the transfection mixtures. The I
B
mutant used is resistant to phosphorylation-mediated degradation and
therefore is incapable of releasing NF-
B (35). Expression of the
I
B
mutant abolished
B enhancer-directed transcription in
MSC-1 and primary Sertoli cells. The down-regulation of gene expression
after sequestration of NF-
B by the dominant negative I
B mutant
confirmed that free nuclear NF-
B was responsible for activating
transcription through
B enhancers in Sertoli cells.
|
| DISCUSSION |
|---|
|
|
|---|
B transcription factor has the capability to respond to a diverse
range of stimuli ultimately leading to modified gene expression (15, 23). Because the availability of NF-
B stimulators such as TNF-
and PKA are controlled during spermatogenesis in a stage-specific
manner (3, 11), we explored the possibility that NF-
B may be induced
in seminiferous tubules during the various stages of germ cell
development. Our initial studies revealed that primary Sertoli cells
and Sertoli cell lines are unusual in that NF-
B- binding activity in
nuclear extracts was equal to or greater than that present in crude
cytoplasmic extracts. Despite the increased nuclear NF-
B activity,
significant levels of NF-
B were found to be present in the Sertoli
cell cytoplasm, and additional NF-
B activity could be liberated from
I
B by detergent treatment. Compared with primary Sertoli
cells, the transformed Sertoli cell lines released less NF-
B binding
activity after detergent treatment. It is possible that the transformed
Sertoli cell lines may maintain less NF-
B in the cytoplasm or are
less efficient in the release of NF-
B from cytoplasmic stores. This
hypothesis would be consistent with the finding that the B1 band was
only amplified by detergent treatment of primary Sertoli cell
cytoplasmic extracts.
DNA binding and immunoprecipitation studies identified NF-
B p50 and
p65 as the most prevalent isoforms of NF-
B present in the nuclei and
cytoplasm of Sertoli cells. Furthermore, immunohistochemical
examination of testis tissue showed that NF-
B p50 and p65 were
present in Sertoli nuclei and cytoplasm throughout the spermatogenic
cycle. Cytoplasmic staining of NF-
B did not vary greatly, but
nuclear levels fluctuated in a stage-specific manner. Sertoli cell
nuclear NF-
B levels were found to peak in stages XIVVII and then
fall in stages VIIIXIII. The pattern of NF-
B immunostaining shown
throughout the cycle of spermatogenesis demonstrated that Sertoli cells
constitutively express nuclear NF-
B in vivo. Furthermore,
the increase in nuclear NF-
B during stages XIVVII suggests that
additional NF-
B is made available to potentially regulate
stage-specific gene expression in Sertoli cells.
In developing germ cells, nuclear expression of NF-
B first rose
above baseline levels in pachytene spermatocytes during stage IV,
peaked during stages VIIXI, and declined to lower levels in stage
XIIXIV spermatocytes and the subsequent early spermatid stages
IVII. The decline in NF-
B p50 and p65 levels in maturing
spermatids was not unusual, as the expression of many transcription
factors diminish in the later stages of spermatid development when most
transcriptional activity ceases (36). The stage-specific elevations in
nuclear NF-
B expression indicated that it may be required for gene
induction during these stages of spermatogenesis.
Stimulation of primary Sertoli cells with the NF-
B activating
factors PMA or TNF-
resulted in the activation of NF-
B
DNA-binding activity. The TNF-
induction of NF-
B occurred in a
biphasic manner with a dramatic increase in NF-
B-binding activity
within 0.5 h of TNF-
addition followed by a gradual decrease
over 6 h and a subsequent rise and fall of NF-
B-binding
activity at 12 and 24 h. This biphasic pattern of NF-
B
induction mirrored that seen in other systems and has been shown to be
due to the different kinetics with which I
B
and I
Bß are
degraded and regenerated after TNF-
or PMA stimulation (37).
Activation of NF-
B by TNF-
in Sertoli cells is not unexpected as
Sertoli cells express the 55-kDa TNF I receptor (11). However, it may
be more significant that round spermatid germ cells secrete TNF-
in
a stage-specific manner and that the increase in nuclear NF-
B
exhibited in stage IVII Sertoli cells correlates with the presence of
round spermatids in the seminiferous tubule (11, 38). Furthermore,
nuclear NF-
B levels are lower during stages VIIIXIII when
spermatids are elongating and producing less TNF-
(11). Although
further study is required to confirm a direct link between TNF-
and
NF-
B activity in Sertoli cells, the TNF-
paracrine- regulatory
system may be an important mechanism by which spermatids signal
adjacent Sertoli cells to provide factors required during specific
stages of development. In contrast, spermatocytes reportedly do not
express receptors for TNF-
(11), and as suggested by the later peak
in nuclear localization, must activate NF-
B by another pathway.
The FSH-induced PKA activity in Sertoli cells (3) is another candidate
regulator of NF-
B activity in seminiferous tubules. Previous studies
have shown that PKA is able to phosphorylate I
B and initiate the
release of NF-
B to the nucleus (12, 14). FSH induction of Sertoli
cell cAMP and PKA is a cyclical process in vivo. cAMP levels
begin to rise in stage XII, peak in stages III-V, and then fall to much
lower levels during stages VIXI (34). NF-
B levels in Sertoli
nuclei were also found to rise and fall in a cyclical manner, but the
changes in NF-
B nuclear immunolocalization appear to be slightly
delayed (one to two stages) relative to changes in cAMP and PKA levels.
Further study will be required to determine whether there is a direct
relationship between FSH induction of Sertoli cell-signaling
pathways and expression of nuclear NF-
B in vivo.
PKA has also been shown to directly phosphorylate NF-
B p65,
resulting in increased affinity of p65 for the
B enhancer sequence
and increased transactivation activity (13, 26). As the PKA activators
FSH and forskolin increased NF-
B binding activity in Sertoli cells,
an unexpected finding was that these stimuli were unable to induce
B
enhancer-mediated transcription. One explanation for the lack of
PKA-inducible transcription seen in cultured Sertoli cells may be the
absence of a p65 cofactor. Recently, the PKA activation of
B
enhancer-regulated transcription was shown to be mediated by the
functionally conserved transcriptional coactivators, CREB-binding
protein and p300 (CBP/p300). PKA phosphorylation of p65 was found to
promote association with the coactivators. Furthermore,
NF-
B-mediated transcription was induced by p65-CBP/p300 complexes in
a PKA-dependent manner (16). In many cell types CBP/p300 is present in
limited quantities, and a number of transcription factors compete for
coactivator binding (39). It will be interesting to determine whether
the availability of CBP/p300 in Sertoli cells modulates the NF-
B
response to FSH and PKA activation.
The best characterized model of nuclear localized, constitutively
activated NF-
B is the mature B cell. As B cells mature, the levels
of nuclear p50 and c-Rel increase. The mechanisms underlying the
constitutive NF-
B activation in B cells is not yet fully understood,
but recent studies suggest three possible explanations, including an
increase in I
B
turnover (40), a decrease in I
Bß levels (41),
and/or an increase in a hypophosphorylated form of I
Bß that acts
to prevent I
B
interaction with NF-
B subunits and does not
interfere with nuclear translocation (42). Although adult Sertoli cells
are similar to mature B cells in that they are terminally
differentiated, it remains to be determined whether Sertoli cells use
similar mechanisms to maintain NF-
B in the nucleus and whether these
mechanisms are developmentally controlled.
The presence of preexisting nuclear NF-
B proteins in Sertoli cells
and their functional activity was shown in Sertoli cell transfection
studies. The potent transcriptional enhancement mediated by the two
tandem
B repeats demonstrated that NF-
B proteins are primed to
activate transcription in untreated Sertoli cells. Down-regulation of
gene expression after addition of a degradation-resistant form of I
B
confirmed that NF-
B proteins were responsible for the high basal
levels of
B-enhancer-mediated transcription. The potential for
additional gene induction in response to activators of NF-
B was
shown by the further stimulation of gene activity in Sertoli cells
treated with TNF-
.
Although these studies point out the potential for NF-
B regulation
of gene expression in Sertoli cells, it will be important to identify
the genes modulated by NF-
B and understand their regulation.
Potential targets for NF-
B regulation include the androgen receptor
gene, which is required to mediate testosterone effects in the testis,
and the urokinase gene, which is needed for the constant tissue
remodeling performed during spermatogenesis. Both of these genes have
been shown to be regulated by NF-
B in other tissues (18, 19, 20). In our
studies we have noted that the CREB transcription factor promoter,
which transmits signals received from the FSH-cAMP-PKA pathway (43),
also contains four putative
B enhancer motifs (our
unpublished data). A computer-assisted sequence analysis of 10
spermatogenesis-regulating genes expressed by Sertoli cells revealed 5
that contained consensus
B enhancer motifs within their
5'-regulatory regions [gene sequences studied included the FSH
receptor, androgen binding protein (ABP), Mullerian inhibiting
substance (MIS), transferrin, TNF-
receptor I, c-mos, Hox 1.4,
inhibin
, inhibin/actin ßB chain, and stem cell factor]. The
mouse MIS and stem cell factor, as well as the rat inhibin
,
inhibin/actin ß B chain, and ABP genes, were all found to have
putative NF-
B-binding sites within 120-1250 bp of their
transcription initiation sites. Due to the large number of genes that
are potentially regulated by NF-
B, further investigation into the
mechanisms activating NF-
B in Sertoli cells appears to be
warranted.
| MATERIALS AND METHODS |
|---|
|
|
|---|
(20 ng/ml). Animals
used in these studies were maintained and killed according to the
principles and procedures described in the NIH Guide for the Care and
Use of Laboratory Animals.
Protein Extract Preparation
Nuclear and cytoplasmic extracts were prepared by detergent
lysis (50). Cells were lysed by incubation in buffer A [10
mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM
EDTA, 0.1 mM EGTA, 1 mM dithiothreitol (DTT),
0.5 mM phenylmethylsulfonylfluoride (PMSF), and a protease
cocktail consisting of 0.5 ng/ml pepstatin A, and 5 ng/ml each of
leupeptin, antipain, soybean trypsin inhibitor, and aprotinin] for 15
min on ice followed by the addition of 0.06% Nonidet P40. Cells were
vortexed for 10 sec, and nuclei were collected by centrifugation
(12,000 x g, 30 sec). The supernatant containing
cytoplasmic proteins was removed and frozen in 20% glycerol. To
prepare nuclear extracts, pelleted nuclei were washed once with buffer
A and resuspended in buffer C (20 mM HEPES, pH 7.9, 0.4
M NaCl, 1 mM EDTA, 1 mM EGTA, 1
mM DTT, 1 mM PMSF, 20% glycerol, and the
protease cocktail used for buffer A). Cells were mixed vigorously on a
shaking platform (4 C, 15 min), the cell debris pellet was removed
after centrifugation (5 min 12,000 x g), and the
supernatant containing nuclear proteins was frozen. Protein
concentrations were determined by the Bradford method using the Bio-Rad
protein assay.
DNA-Protein-Binding Assays
32P-Radiolabeled DNA probes were generated
by annealing a 27- nucleotide template containing a consensus
B
enhancer element
(5'-CGACACCCCTCGGGAATTCCCC-CACTGGG-CC-3') to a
complementary 10-base primer and then filling in the overhang with
Klenow in the presence of [
-32P]dATP and 5
mM dCTP, dGTP, dTTP, and 5-bromo-2-deoxyuridine
5-triphosphate. EMSAs were performed as described (51).
Briefly, 32P-labeled
B probe was incubated with
210 µg of nuclear, cytoplasmic, or whole-cell extracts from either
COS-1 cells, TM4 or MSC-1 Sertoli cell lines, or 16-day rat primary
Sertoli cell cultures. Binding reactions were incubated 15 min at room
temperature in the presence of 1 µg poly(dI-dC), 250 ng BSA, 5
mM DTT, 50100 mM NaCl or KCl, 20
mM HEPES, and 1 mM EDTA. For competition EMSAs,
a 50-fold excess of double-stranded unlabeled competitor
oligonucleotides including a Sp1-binding site
(GCTGCCTGTGGCCCGGGCGGCTGGGAGAAGCGG), a CRE motif
(GATCCGGCTGACGTCATCAAGCTAGATC), or the unlabeled
B probe were
coincubated with labeled
B probe and nuclear extracts. Protein-DNA
complexes were resolved via PAGE under nondenaturing conditions in a
Tris/borate/EDTA buffer. In binding reactions involving detergent
treatment to release NF-
B proteins from I
B, proteins were
preincubated with 0.5% DOC for 10 min followed by the addition of 1%
Nonidet P40 (NP40) immediately before addition of the radiolabeled
probe. To quantitate the relative levels of DNA-protein complexes,
autoradiograms were digitized on a flatbed scanner, and NIH Image
(version 1.57) analysis software was used to measure the intensity of
individual bands. Values for fold induction of binding activity were
determined relative to the binding activity (band intensity) of the
nuclear extracts for each cell type (Fig. 1
) or the untreated (0 h)
control extracts (Figs. 5
and 6
), and the mean fold induction was
calculated from two (Fig. 6
) or three (Figs. 1
and 5
) independent
experiments.
In Situ UV Cross-Linking and Immunoprecipitation
Assays
DNA/protein binding reactions were performed as described (51).
For in situ UV cross-linking studies, DNA-protein complexes
resolved via 5% nondenaturing PAGE were UV irradiated in
situ for 15 min at 302 nm using a TMW-20 transilluminator.
DNA-protein adducts were excised from the gel resolved by denaturing
discontinuous SDS-PAGE and visualized by autoradiography. For
immunoprecipitation experiments, primary Sertoli cells were cultured
for 1 h in methionine- and cysteine-deficient, serum-free DMEM and
a further 2 h after the addition of 35S-labeleled
methionine and cysteine. Cells were washed twice with PBS and lysed in
1 ml RIPA buffer (150 mM NaCl, 10 mM Tris (pH
7.5), 0.1% SDS, 1% DOC, 1% NP40, 1 mM PMSF, and protease
inhibitor cocktail). Extracts from approximately 2 x
108 cells were incubated with preimmune antisera or
antisera directed against the 21 amino-terminal amino acids of p50 or
p65 and precipitated using protein A Sepharose. Immunoprecipitated
proteins were fractionated by SDS-PAGE and visualized by
fluorography.
Immunocytochemistry
Immunostaining was performed on paraffin-embedded sections (5
µm) from Bouins fixed adult rat testis or primary Sertoli cells or
NIH 3T3 cells cultured on glass coverslips. Testis sections were
deparaffinized in xylene, rehydrated, and then permeabilized for 1 min
in cold 100% methanol. The sections were microwaved on high power for
20 min in citrate buffer (10 mM citrate, 30 mM
NaCl, pH 5.5) and then left undisturbed at room temperature for 20 min
(52). The sections were washed two times for 5 min in PBS and blocked
for 12 h in normal goat serum, 0.5% BSA, and 0.15% glycine at 4
C. Cultured cells were fixed in 4% paraformaldehyde for 5 min,
permeablized for 1 min in ice-cold 100% MeOH, and dried completely
followed by blocking 424 h with normal goat serum, 0.5% BSA, and
0.15% glycine. The testis tissue or cultured cells were then incubated
1224 h with preimmune serum or rabbit polyclonal antiserum directed
against the amino-terminal 21 amino acids of NF-
B p65 or NF-
B
p50. For cultured cells, fluorescent Cy3 secondary goat anti-rabbit
antiserum was added. For tissue sections, anti-rabbit biotinylated
secondary antibody (Vectastain Elite ABC Kit, Vector Laboratories,
Burlingame, CA) was added, and bound antibodies were detected as
described by the kit instructions using AEC staining solution (0.02%,
3-amino-9-ethylcarbazole, 5% N,N-dimethyl formamide,
0.015% H2O2, and 0.1 M sodium
acetate, pH 5.0) as the colorimetric reagent. Slides were washed in
H2O and counterstained with hematoxylin. A charged coupled
device (CCD) video camera system (Optronics, Chelmsford, MA) was used
to capture images of stained cells or tubule cross-sections. The
quantitation of the relative staining intensities of
seminiferous tubule nuclei by p65 and p50 antisera was
accomplished using BioQuant image analysis software (R & M
Biometrics, Inc., Nashville, TN). Immunostained slides of adult rat
testis tissue regularly contained at least 300 seminiferous tubule
cross-sections. Testis tissue sections from three adult rats were used
to quantitate relative nuclear immunostaining with one representative
slide used from each animal. The testis tissue sections regularly
contained at least 300 seminiferous tubule cross-sections. Sertoli cell
and spermatocyte nuclei to be analyzed were chosen from the same
tubules. At least five seminiferous tubule cross-sections representing
each of the 14 (IXIV) stages of spermatogenesis were chosen for
quantitation from each slide. For each slide, threshold windows of red,
green, and blue color values were set within the BioQuant image
analysis program to distinguish only the red-brown staining of nuclei
due to the AEC precipitate. Five of the stained nuclei from each tubule
cross-section, as identified by the image analysis software, were
randomly chosen and the immunostain within each nucleus was measured by
a integrated optical density method that measures the intensity and
density of pixels within an object as a function of object size. The
mean integrated optical densities of nuclei in each stage was
calculated (n
25) and arbitrarily normalized to the mean value
determined for stage I Sertoli nuclei (stage I = 100%). The mean
normalized nuclear immunostaining intensities from the three
independent experiments were determined to give the final relative
immunostaining intensities.
Plasmid Constructs, Transfections, and Luciferase Assays
COS-1 cells were transfected with NF-
B expression
vectors by using diethylaminoethyl-dextran, and whole-cell lysates were
prepared after 48 h (53). For transient reporter transfections,
the
BLUC vector was constructed by inserting a 200-bp
PvuII-XhoI fragment from
B-TATA-CAT
(containing two tandem
B enhancer elements derived from the HIV-1
LTR linked to the albumen gene TATA element) (54) into the
SmaI-XhoI sites directly upstream of the
luciferase gene in the pGL2-Basic vector (Promega, Madison, WI).
SV40LUC is the pGL2-Promoter plasmid (Promega) containing the SV40
promoter upstream of the luciferase gene in the pGL2Basic backbone. The
RSVLUC plasmid is pA3RSV400LUC containing the
enhancer and promoter of the 3'-LTR of Rous sarcoma virus (55). NF-
B
expression vectors contain cDNAs for NF-
B p50 (56) and p65 (57)
positioned downstream of the cytomegalovirus (CMV) promoter/enhancer in
the pCMV4 and pCMV5 expression vectors (58, 59) (pCMV4p50 (53) and
pCMV5p65, respectively (60)). The I
B deletion mutant cDNA
I
B
N containing sequences encoding amino acids 37317 of
I
B
was inserted into the pCMV4 expression vector (35). Primary
Sertoli cells and MSC-1 cells were transfected as described (43) using
1 µg of luciferase reporter plasmid and 1 µg of empty pCMV
expression vector or 1 µg of pCMV expression vectors encoding p50 and
p65 or I
B
N in the absence or presence of 20 ng/ml TNF-
.
Luciferase assays were performed using a luminometer and the Promega
luciferase assay system. Luciferase activity of the extracts was
normalized for protein activity as determined by Bradford assay.
| ACKNOWLEDGMENTS |
|---|
B
antisera, as well as NF-
B and I
B
N expression vectors; and
Barbara Sanborn for providing the MSC-1 cell line. We also are grateful
for access to imaging equipment and expertise provided by Drs. Simon
Watkins, Director of the University of Pittsburgh Center for Biological
Imaging, and Robert Gibbs, Director of the Cell Imaging Core of the
Center for Research in Reproductive Physiology (P-30HD08610). | FOOTNOTES |
|---|
This work was supported by NIH Grant R29-HD-34913.
Received for publication December 5, 1997. Revision received June 29, 1998. Accepted for publication August 7, 1998.
| REFERENCES |
|---|
|
|
|---|
in mouse spermatogenic
cells. Endocrinology 133:389396
B catalyzed cyclic AMP-dependent protein
kinase and protein kinase C. Mol Cell Biol 9:24242430
B is regulated by the
I
B-associated PKAc subunit through a cyclic AMP-independent
mechanism. Cell 89:413424[CrossRef][Medline]
B by phosphorylation of its inhibitor I
B. Nature 344:678682[CrossRef][Medline]
B. Annu Rev Cell Biol 10:405455[CrossRef]
B by
PKA stimulates transcriptional activity by promoting a novel bivalent
interaction with the coactivator CBP/p300. Mol Cell 1:661671[CrossRef][Medline]
B activates proenkephalin transcription in T lymphocytes. Mol
Cell Biol 11:10171022
B and
c-Rel binds to a DNA element involved in the phorbol ester induction of
the human urokinase gene. EMBO J 11:205213[Medline]
B-like binding sites of the human urokinase gene.
Nucleic Acids Res 19:33893393
B functions as a negative regulator for the rat
androgen receptor gene and NF-
B activity increases during the
age-dependent desensitization of the liver. J Biol Chem 270:837842
B-like motifs and of constitutive and inducible forms of NF-
B.
Mol Cell Biol 10:14981506
promoter in primary macrophages. J Immunol 147:16941700[Abstract]
B
in the immune system. Annu Rev Immunol 12:141179[Medline]
B and I
B proteins: new
discoveries and insights. Annu Rev Immunol 14:649681[CrossRef][Medline]
B/I
B family: intimate tales of association and
dissociation. Genes Dev 9:27232735
B in
vivo is regulated by multiple phosphorylations. EMBO J 13:45974607[Medline]
B
transcription factor. Cell 53:211217[CrossRef][Medline]
B:
a family of inducible and differentially expressed enhancer-binding
proteins in human T cells. Proc Natl Acad Sci USA 87:1002810032
B transcription factor by dissociating the cytoplasmic
NF-
B-I
B complex. Proc Natl Acad Sci 90:92479251
-stimulated lactate production is linked to lactate
dehydrogenase A expression and activity increase in porcine cultured
Sertoli cells. Endocrinology 138:19641971
B
to
multiple pathways for NF-
B. Mol Cell Biol 15:28092818[Abstract]
B-ß regulates the persistent response in a biphasic
activation of NF-
B. Cell 80:573582[CrossRef][Medline]
receptor p55 is under hormonal (follicle
stimulating hormone) control in testicular Sertoli cells. Biochem
Biophys Res Commun 224:631637[CrossRef][Medline]
B activity in mature murine B-cell
lines. Mol Cell Biol 14:32763282
B during primary B cell differentiation.
J Immunol 160:23082317
Bß in the persistent
activation of NF-
B. Mol Cell Biol 16:54445449[Abstract]
B enhancer binding protein that inhibits NF-
B function. Cell 63:803814[CrossRef][Medline]
B is identical to factor KBF1 and homologous
to the rel oncogene product. Cell 62:10071018[CrossRef][Medline]
B inhibition of the cloned p65 subunit of NF-
B, a
rel-related polypeptide. Cell 64:961969[CrossRef][Medline]
B functions as a potent
transcriptional activator and a target for v-Rel-mediated repression.
Proc Natl Acad Sci USA 89:18751879This article has been cited by other articles:
![]() |
J. Cheng, S. C. Watkins, and W. H. Walker Testosterone Activates Mitogen-Activated Protein Kinase via Src Kinase and the Epidermal Growth Factor Receptor in Sertoli Cells Endocrinology, May 1, 2007; 148(5): 2066 - 2074. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-L. Yao, Y.-C. Lin, P. Sawhney, and J. H. Richburg Transcriptional Regulation of FasL Expression and Participation of sTNF-{alpha} in Response to Sertoli Cell Injury J. Biol. Chem., February 23, 2007; 282(8): 5420 - 5431. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Rasoulpour and K. Boekelheide NF-kappaB Activation Elicited by Ionizing Radiation Is Proapoptotic in Testis Biol Reprod, February 1, 2007; 76(2): 279 - 285. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-S. Son and K. F. Roby Interleukin-1{alpha}-Induced Chemokines in Mouse Granulosa Cells: Impact on Keratinocyte Chemoattractant Chemokine, a CXC Subfamily Mol. Endocrinol., November 1, 2006; 20(11): 2999 - 3013. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. H Walker and J. Cheng FSH and testosterone signaling in Sertoli cells Reproduction, July 1, 2005; 130(1): 15 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.P. Dadoune, A. Pawlak, M.F. Alfonsi, and J.P. Siffroi Identification of transcripts by macroarrays, RT-PCR and in situ hybridization in human ejaculate spermatozoa Mol. Hum. Reprod., February 1, 2005; 11(2): 133 - 140. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Rasoulpour and K. Boekelheide NF-{kappa}B Is Activated in the Rat Testis Following Exposure to Mono-(2-Ethylhexyl) Phthalate Biol Reprod, February 1, 2005; 72(2): 479 - 486. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Scobey, C. A. Fix, and W. H. Walker The Id2 Transcriptional Repressor Is Induced by Follicle-stimulating Hormone and cAMP J. Biol. Chem., April 16, 2004; 279(16): 16064 - 16070. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, M. Charron, W. W. Wright, B. Chatterjee, C. S. Song, A. K. Roy, and T. R. Brown Nuclear Factor-{kappa}B Activates Transcription of the Androgen Receptor Gene in Sertoli Cells Isolated from Testes of Adult Rats Endocrinology, February 1, 2004; 145(2): 781 - 789. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Y. Hong, J. H. Park, K. H. Seo, J.-M. Kim, S. Y. Im, J. W. Lee, H.-S. Choi, and K. Lee Expression of MIS in the Testis Is Downregulated by Tumor Necrosis Factor Alpha through the Negative Regulation of SF-1 Transactivation by NF-{kappa}B Mol. Cell. Biol., September 1, 2003; 23(17): 6000 - 6012. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lukas-Croisier, C. Lasala, J. Nicaud, P. Bedecarras, T. R. Kumar, M. Dutertre, M. M. Matzuk, J.-Y. Picard, N. Josso, and R. Rey Follicle-Stimulating Hormone Increases Testicular Anti-Mullerian Hormone (AMH) Production through Sertoli Cell Proliferation and a Nonclassical Cyclic Adenosine 5'-Monophosphate-Mediated Activation of the AMH Gene Mol. Endocrinol., April 1, 2003; 17(4): 550 - 561. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Budde, C. Wu, C. Tilman, I. Douglas, and S. Ghosh Regulation of Ikappa Bbeta Expression in Testis Mol. Biol. Cell, December 1, 2002; 13(12): 4179 - 4194. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, S. Chan, and B. K. Tsang Involvement of Inhibitory Nuclear Factor-{kappa}B (NF{kappa}B)-Independent NF{kappa}B Activation in the Gonadotropic Regulation of X-Linked Inhibitor of Apoptosis Expression during Ovarian Follicular Development in Vitro Endocrinology, July 1, 2002; 143(7): 2732 - 2740. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mitsiades, C. S. Mitsiades, V. Poulaki, D. Chauhan, P. G. Richardson, T. Hideshima, N. Munshi, S. P. Treon, and K. C. Anderson Biologic sequelae of nuclear factor-kappa B blockade in multiple myeloma: therapeutic applications Blood, May 13, 2002; 99(11): 4079 - 4086. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sassone-Corsi Editorial: Never Enough--On the Multiplicity and Uniqueness of Transcriptional Regulators in Postmeiotic Male Germ Cells Endocrinology, May 1, 2002; 143(5): 1575 - 1577. [Full Text] [PDF] |
||||
![]() |
S. A. Shell, C. Fix, D. Olejniczak, N. Gram-Humphrey, and W. H. Walker Regulation of Cyclic Adenosine 3',5'-Monophosphate Response Element Binding Protein (CREB) Expression by Sp1 in the Mammalian Testis Biol Reprod, March 1, 2002; 66(3): 659 - 666. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pentikainen, L. Suomalainen, K. Erkkila, E. Martelin, M. Parvinen, M. O. Pentikainen, and L. Dunkel Nuclear Factor-{kappa}B Activation in Human Testicular Apoptosis Am. J. Pathol., January 1, 2002; 160(1): 205 - 218. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pentikainen, K. Erkkila, L. Suomalainen, M. Otala, M. O. Pentikainen, M. Parvinen, and L. Dunkel TNF{alpha} Down-Regulates the Fas Ligand and Inhibits Germ Cell Apoptosis in the Human Testis J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4480 - 4488. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Miao, N. S. Panesar, K.-T. Chan, F. M.M. Lai, N.-s. Xia, Y.-b. Wang, P. J. Johnson, and J. Y.H. Chan Differential Expression of a Stress-modulating Gene, BRE, in the Adrenal Gland, in Adrenal Neoplasia, and in Abnormal Adrenal Tissues J. Histochem. Cytochem., April 1, 2001; 49(4): 491 - 500. [Abstract] [Full Text] |
||||
![]() |
S. GEYMAYER and W. DOPPLER Activation of NF-{kappa}B p50/p65 is regulated in the developing mammary gland and inhibits STAT5-mediated {beta}-casein gene expression FASEB J, June 1, 2000; 14(9): 1159 - 1170. [Abstract] [Full Text] |
||||
![]() |
F. J. Delfino and W. H. Walker NF-kappa B Induces cAMP-response Element-binding Protein Gene Transcription in Sertoli Cells J. Biol. Chem., December 10, 1999; 274(50): 35607 - 35613. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |