Molecular Endocrinology 12 (11): 1696-1707
Copyright © 1998 by The Endocrine Society
Stage-Specific Nuclear Expression of NF-
B in Mammalian Testis
Frank Delfino and
William H. Walker
Department of Cell Biology and Physiology University of
Pittsburgh Pittsburgh, Pennsylvania 15261
 |
ABSTRACT
|
|---|
The Rel/nuclear factor (NF)-
B family of
transcription factors are important intracellular conveyors of
extracellular signals in a number of systems. However, little is known
of their roles in the specialized, hormonally regulated environment of
the mammalian testis. In this study NF-
B p50 and p65 proteins were
found to be constitutively present and active in the nucleus of Sertoli
cells cultured from rat testis. In vivo, NF-
B proteins
are present in the nucleus of Sertoli cells during all 14 (IXIV)
cyclical stages of spermatogenesis; however, nuclear NF-
B expression
was elevated in stage XIV and remained high in stages IVII. In
contrast, NF-
B p50 and p65 subunits are transiently expressed in the
nuclei of germ cells with peak levels found in pachytene spermatocytes
during stages VIIXI and lower levels in stage I-VII spermatids. Tumor
necrosis factor-
, which is produced by round spermatids in
the testis, increased nuclear NF-
B binding activity when added to
Sertoli cells. Stimulation of Sertoli cells with activators of the
cAMP-protein kinase A (PKA) signaling pathway such as forskolin or FSH
also increased NF-
B DNA binding activity. Consistent with the
cellular localization studies, NF-
B was found to be activated as
high basal levels of NF-
B-stimulated reporter gene expression were
detected in transient transfection studies of Sertoli cells. Addition
of tumor necrosis factor-
to Sertoli cells further stimulated
B
enhancer-mediated transcription. These findings suggest that NF-
B
proteins are stage specifically localized to Sertoli cell and
spermatocyte nuclei and may play a role in the regulation of
stage-specific gene expression during the process of spermatogenesis.
 |
INTRODUCTION
|
|---|
Spermatogenesis, the multistep process by which spermatogonial
stem cells give rise to mature spermatozoa, takes place within the
seminiferous tubules of the mammalian testis. The seminiferous tubules
contain three major cell types: peritubular cells, which form the
exterior wall of the seminiferous tubule, germ cells in various stages
of development, and Sertoli cells, which relay external signals and
provide factors required for the differentiation and proliferation of
germ cells. Spermatogenesis is under hormonal control by the
hypothalamic-pituitary-testicular axis as well as through local
testicular paracrine mechanisms (1, 2). A major hormonal regulator of
spermatogenesis is the pituitary gonadotropin, FSH, which acts on
Sertoli cells to stimulate increases in cAMP levels leading to the
activation of PKA and subsequent induction of genes essential for the
process of spermatogenesis (3, 4). In addition, a number of cytokines
including interleukin-1 (IL-1), IL-6, and tumor necrosis factor-
(TNF-
), have been shown to be paracrine regulators of testis gene
expression (5, 6, 7, 8, 9, 10, 11). Interestingly, PKA as well as the cytokines IL-1,
IL-6, and TNF-
, share the ability to activate the nuclear factor
(NF)-
B transcription factor (12, 13, 14, 15, 16). A number of genes expressed in
the testis, including the androgen receptor, urokinase, proenkephalin,
and TNF-
genes, have been shown to be regulated by NF-
B in other
tissues (17, 18, 19, 20, 21, 22). Due to the potential importance of NF-
B in
regulating testis gene expression, we wished to test the hypothesis
that NF-
B is induced in testis seminiferous tubules.
Five NF-
B DNA-binding subunits (Rel A or p65, Rel B, c-Rel, p50, and
p52) have been identified in mammalian cells. The NF-
B (Rel) family
of transcription factors regulate transcription by binding as dimers to
B enhancer elements in the regulatory region of genes. With few
exceptions, NF-
B proteins remain in the cytoplasm of unstimulated
cells where they are tethered to various isoforms of I
B (15, 23, 24). Upon stimulation, I
B is phosphorylated and undergoes
proteosome-mediated degradation, thereby releasing NF-
B to
translocate to the nucleus and regulate gene transcription (24, 25). In
addition to regulated nuclear translocation, NF-
B activity can be
altered by phosphorylation of individual subunits. Direct
phosphorylation of NF-
B p65 by PKA or PKC has been shown to enhance
p65 DNA binding and transactivation activity (16, 26, 27).
With this study we have determined that NF-
B is constitutively
present and active in the nuclei of Sertoli cells cultured from rat
testis. In the testis, nuclear expression of NF-
B proteins was found
to be regulated in a cell- and stage-specific manner. Sertoli
cell levels of nuclear NF-
B were highest during spermatogenesis
stages XIVVII, whereas nuclear expression of NF-
B peaked in stage
VIIXI spermatocytes. Treatment of Sertoli cells with TNF-
, which
is expressed by spermatids, increased NF-
B binding activity. Sertoli
cell nuclear NF-
B DNA-binding activity was also enhanced by the PKA
activators forskolin and FSH. NF-
B was shown to be functional as
basal levels of
B enhancer-mediated transcription were
high in Sertoli cells, and addition of TNF-
further stimulated gene
expression. These data identify NF-
B as a potential regulator of
the genetic program of spermatogenesis.
 |
RESULTS
|
|---|
Constitutive Nuclear Expression of NF-
B-Binding Activity in
Sertoli Cells
To explore the potential role of NF-
B in spermatogenesis, the
expression of NF-
B was first tested in electrophoretic mobility
shift assays (EMSAs) using nuclear protein extracts from primary
Sertoli cell cultures and a probe containing a consensus
B
enhancer motif. A series of DNA-protein complexes were formed (Fig. 1A
). The proteins forming the complexes
were shown to specifically bind the
B enhancer probe: a 50-fold
excess of the homologous
B enhancer oligonucleotide eliminated all
complex formation, but a 50-fold excess of oligonucleotides containing
a Sp1-binding site or a cAMP response element (CRE) did not affect
probe-protein interactions

View larger version (54K):
[in this window]
[in a new window]
|
Figure 1. Sertoli Cell Proteins Bind to the B Enhancer
Motifs
A, NF- B-like proteins in Sertoli cell nuclear extracts bind
specifically to a B enhancer probe. In EMSA experiments, primary
Sertoli nuclear proteins were incubated with a 32P-labeled
B enhancer probe and no competitor (lane 1), a 50-fold excess of
unlabeled B enhancer probe (lane 2), a oligonucleotide containing an
Sp1-binding site (lane 3), or a CRE-containing oligonucleotide (lane
4). DNA-protein complexes were resolved by nondenaturing PAGE and
detected by autoradiography. For all EMSAs the unbound probe was run
off of the gel. B, Sertoli nuclear extracts contain high levels of
NF- B-binding activity. Equal amounts of nuclear (NE) and cytoplasmic
(Cyto) extracts from primary Sertoli cells (5 µg, lanes 13), as
well as TM4 (10 µg, lanes 46) and MSC-1 (5 µg, lanes 79)
Sertoli cell lines, were incubated with a 32P-labeled B
enhancer probe. Cytoplasmic extracts were also preincubated in the
presence of DOC and NP-40 detergents (lanes 3, 6, and 9, Cyto + Det).
The various DNA-protein complexes formed (B1-B3) are indicated. The
determination of the relative levels of DNA-protein complexes is
explained in Materials and Methods. C, UV cross-linking
of Sertoli nuclear proteins to the B enhancer. DNA-protein complexes
derived from Cos-1 cells expressing p65 or p50 homodimers (lanes 1, 2)
as well as various B1, B2, and B3 complexes from TM4 (lanes 3, 4),
MSC-1 (lanes 57), and primary Sertoli cells (lanes 810) were
resolved by nondenaturing PAGE, UV cross-linked in situ,
excised from the gel, and separated by denaturing discontinuous
SDS-PAGE. The DNA-protein adducts containing NF- B p50 and p65 are
indicated. Note: The molecular mass of the DNA-protein complexes is
increased by approximately 5 kDa due to the contribution of the
cross-linked oligonucleotide probe. EMSA incubations were scaled up
5-fold for cross-linking studies. DNA-protein-binding assays shown are
representatives of at least three independent experiments. D, Sertoli
cells contain NF- B p50 and p65. Whole-cell extracts from Sertoli
cells cultured in the presence of [35S]methionine were
immunoprecipitated with preimmune serum, or antisera against NF- B
p50 or p65. SDS-PAGE-fractionated NF- B p50 and p65 are indicated.
The relative positions of molecular mass markers are shown to the
left. The data in panels A and B are representative of
three experiments; panels C and D were reproduced twice.
|
|
Further characterization of NF-
B proteins was performed using
nuclear and cytoplasmic extracts from TM4 and MSC-1 Sertoli cell lines
in addition to primary Sertoli cells. In unstimulated cells, NF-
B is
typically retained in the cytoplasm. In contrast, substantial NF-
B-
binding activity was detected in nuclear extracts from all the Sertoli
cell lines, with nuclear binding activity similar to that of the
corresponding cytoplasmic extracts. The binding activities of nuclear
and cytoplasmic extracts were also compared with cytoplasmic extracts
that were pretreated with deoxycholate (DOC), a detergent known to
dissociate I
B from NF-
B in vitro (28). Treatment of
cytoplasmic extracts with DOC enhanced the formation of DNA-protein
complexes from primary and TM4 Sertoli cells 3- and 1.5-fold,
respectively, but had less effect on MSC-1 cells (1.2-fold induction).
Furthermore, detergent treatment allowed detection of the B1 complex in
primary Sertoli cells that was otherwise only visualized after long
film exposure times (Fig. 1B
). In comparison to primary Sertoli cells,
the B1 complex was less prevalent in extracts from the Sertoli cell
lines. However, TM4 and MSC-1 cell extracts formed one complex that was
similar to that from primary cells (B2) and another complex (B3) that
migrated slightly slower than the B3 complex from primary Sertoli
cells. The migration pattern of the B3 complex was found to vary
slightly when various protein extract preparations were used. In some
cases, a less abundant lower complex could be resolved, but due to the
inability to reproducibly separate the complexes, all the DNA-protein
interactions in this region were characterized as B3.
The Major Forms of NF-
B in Sertoli Cells Are p50 and p65
Further studies were undertaken to characterize the Sertoli cell
proteins binding to the
B enhancer motifs. UV cross-linked
DNA-protein complexes formed using a photoaffinity,
32P-labeled
B enhancer probe were fractionated by
SDS-PAGE to resolve the proteins covalently bound to the probe.
Complexes formed using extracts from COS-1 cells transfected with
NF-
B p50 or p65 expression vectors were compared with complexes from
unstimulated TM4, MSC-1, and primary Sertoli cell nuclear extracts.
Previous studies have shown that the probe contributes approximately 5
kDa to the apparent molecular mass of the DNA-protein complex
(29). A complex of 70 kDa that comigrates with the p65-containing
complex from transfected COS-1 cells was detected in the B1 band from
MSC-1 and primary Sertoli cells and the B2 bands from TM4, MSC-1, and
primary Sertoli extracts (Fig. 1C
). Lower levels of a 55-kDa adduct
were detected in the B2 complex that comigrated with the complex formed
from p50 expressing Cos cells. The 55-kDa complex, but not the 70 kDa
adduct, was detected in all B3 complexes. The B2 and B3 complexes also
contained varying levels of an additional 40-kDa adduct, which may
represent partial p50 proteolysis or an additional
B element-binding
protein. The 150-kDa adduct detected in the B1 and B2 complexes and the
110-kDa adduct present in the B3 complex may represent p65 dimers,
p65-p50 heterodimers, or p50 dimers simultaneously cross-linked to the
probe. Together, the UV cross-linking studies identify three types of
NF-
B complexes formed in Sertoli cells. B1 complexes contain
predominately p65 homodimers, B2 consists of p50 and p65 heterodimers,
and B3 contains p50 homodimers and an unidentified protein of
approximately 40 kDa.
To confirm that NF-
B p50 and p65 are present in Sertoli cells,
antisera against p50 and p65 were used in immunoprecipitation assays of
primary Sertoli whole-cell extracts (Fig. 1D
). Both NF-
B p50 and p65
were immunoprecipitated from the Sertoli extracts by their respective
antisera. Together, the data from Fig. 1
indicate that p50 and p65 are
major forms of
B enhancer-binding proteins present in Sertoli
cells.
NF-
B p50 and p65 Are Localized in a Stage-Specific Manner to the
Nuclei of Sertoli and Germ Cells in Vivo
To confirm the nuclear localization of NF-
B
proteins shown by the DNA-binding assays, primary Sertoli cells were
probed with p65 and p50 specific antisera in immunohistochemistry
studies. Primary Sertoli cells were found to have high levels of p50
and p65 staining in the nucleus, although some cytoplasmic staining was
also evident (Fig. 2
). In contrast,
immunostaining of NIH 3T3 cells showed p50 and p65 to be predominately
cytoplasmic, in agreement with earlier studies (30). Transferring
primary Sertoli cells from a defined serum-free media mixture to either
DMEM with no supplements or DMEM with 10% serum for 48 h did not
significantly alter the levels of nuclear NF-
B immunostaining (data
not shown). These results raised the possibility that Sertoli cells
normally retain NF-
B in the nucleus.

View larger version (122K):
[in this window]
[in a new window]
|
Figure 2. NF- B Subunits Localize to the Nuclei of Primary
Sertoli Cells
NIH 3T3 cell (3T3, left column) and primary Sertoli
cells (right column) were immunostained with preimmune
antiserum, p65-specific antisera, or p50-specific antisera as
indicated. NF- B immunostaining was visualized using a Cy3-conjugated
fluorescent second antibody. The immunocytochemistry results shown are
representative of three independent experiments.
|
|
Immunohistochemistry studies were extended to adult rat testis tissue
to determine whether NF-
B proteins localize to the nucleus of testis
cells in vivo. Cross-sections from rat testis seminiferous
tubules can be designated as containing one of 14 characteristic
germinal cell association patterns (IXIV) or stages of
spermatogenesis (31, 32). In the rat these stages repeat in cycles of
12.5 days resulting in the cycle of the seminiferous epithelium. Rat
testis tissue sections were probed with NF-
B p50 and p65 antisera.
Both the cytoplasm and the nucleus of Sertoli cells were immunostained
by p50 and p65 antisera (Fig. 3
, AE).
It should be noted that direct comparison of Sertoli cytoplasmic
vs. nuclear immunostaining is difficult due to dilution of
antigen in the 5-fold larger volume of the cytoplasm that extends from
the basement membrane to the tubule lumen. Immunostaining of the
Sertoli cell cytoplasm surrounding the germ cells was not noticeably
different in the various cell association stages; however, the staining
of Sertoli cell nuclei along the basement membrane of seminiferous
tubules varied in a stage-specific manner. Immunostained Sertoli nuclei
could be detected in all cell association stages, but nuclear NF-
B
levels were elevated in spermatogenesis stages XIVVII. In contrast,
spermatocyte germ cells show a stage-specific pattern of p50 and p65
nuclear localization with peak immunostaining during stages VIIXI.
NF-
B p50 and p65 are also present in early spermatid nuclei during
stages IIII immediately after spermatocytes undergo meiosis. In some
cases lower levels of p50 immunostaining are seen as late as stage VII
spermatids, but p50 and p65 are not detected in more mature spermatids.
This pattern of staining indicates that NF-
B proteins are not
present in the nuclei of less mature leptotene and zygotene
spermatocytes but are initially expressed in the nucleus during the
pachytene stage of spermatocyte development. A summary of the relative
levels of p65 immunostaining (quantitation of p50 immunostaining was
very similar to p65) in Sertoli and spermatocyte nuclei at each stage
of spermatogenesis is provided in Fig. 4
.

View larger version (163K):
[in this window]
[in a new window]
|
Figure 3. NF- B Subunits Localize in a Stage-Specific
Manner to Sertoli Cell and Germ Cell Nuclei in Adult Rat Testes
Paraffin-embedded adult testis sections were immunostained with
preimmune antisera (A) or antisera against the p50 subunit (B and D) or
the p65 subunit (C and E) of NF- B. Panels D and E are higher
magnification views from panels B and C, respectively. The brown
staining is indicative of the immune avidin-biotin complex; nuclei have
been counterstained blue with hematoxylin. Cell association stages are
shown with Roman numerals. S, Sertoli cell nucleus; L,
leptotene spermatocyte; P, pachytene spermatocyte; Sd, spermatid. An
explanation of techniques used to quantitate the relative
immunostaining intensity of nuclei is provided in Materials and
Methods. The immunostaining experiments were performed at least
four times.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Figure 4. Summary of NF- B Immunoactivity in Testis Tissue
Sertoli and Spermatocyte Cells
The relative levels of NF- B p65 immunostaining in Sertoli
(solid squares) and spermatocyte (open
circles) nuclei are shown for each stage of spermatogenesis
(germ cell association stages IXIV; note that data for stages II and
III are combined) during the 12-day cycles of germ cell development. An
explanation of techniques used to quantitate the relative
immunostaining intensity of nuclei is provided in Materials and
Methods. Immunostaining intensity levels are given as arbitrary
units relative to the mean immunostaining of stage I Sertoli nuclei
(=100%). Three independent experiments were used to generate the
values shown.
|
|
TNF-
and Phorbol 12-Myristate 13-Acetate (PMA) Induce
NF-
B-Binding Activity in Sertoli Cell Nuclei
The stage-specific increases in NF-
B p50 and p65 subunit
localization to Sertoli and spermatocyte nuclei suggested that nuclear
accumulation of NF-
B subunits could be induced in response to
appropriate signals. One candidate inducer of NF-
B in the testis is
TNF-
, which has been found to be secreted from spermatids in a
spermatogenesis stage-specific manner (11) and to induce gene
expression in Sertoli cells (33). Addition of TNF-
to Sertoli cells
resulted in a dramatic increase (13.5-fold) in nuclear NF-
B-binding
activity within 0.5 h that declined slightly after 2 and 6 h
(12.5- and 8-fold above nontreated levels, respectively) (Fig. 5
). NF-
B binding activity rose again
to 10.5-fold higher than basal levels after 12 h of TNF-
stimulation and declined thereafter. The membrane-permeable NF-
B
activator PMA was also able to increase nuclear NF-
B binding
activity 6.5-fold after 0.5 h of treatment with levels decreasing
after 24 h of stimulation to 3.5-fold above the basal condition.
Together, these data suggest that signaling pathways such as that
initiated by TNF-
could induce additional nuclear NF-
B-binding
activity in Sertoli cells.
Inducers of cAMP and PKA Increase NF-
B Binding Activity in
Sertoli Cells
FSH is an important regulator of Sertoli cell function
and spermatogenesis (1, 2). Among the actions of FSH on Sertoli cells,
in vivo, is the cyclical elevation of cAMP and the
activation of PKA, a known regulator of NF-
B (34). The possibility
that NF-
B binding activity is increased by activators of PKA in
Sertoli cells was tested in EMSA studies. The
B enhancer probe was
incubated with nuclear extracts from untreated primary Sertoli cells or
from primary Sertoli cells stimulated with forskolin for 2 h to
raise cAMP and PKA activity. NF-
B binding activity was increased
4.5-fold after forskolin addition (Fig. 6
). Treating Sertoli cells with FSH also
increased NF-
B binding activity 2.5-fold with levels peaking 2
h after FSH addition and falling thereafter.

View larger version (70K):
[in this window]
[in a new window]
|
Figure 6. PKA Activators Induce NF- B Binding Activity in
Sertoli Cells
Nuclear extracts (5 µg) from untreated primary Sertoli cells or cells
treated with forskolin and IBMX or FSH and IBMX for the indicated times
were incubated with the consensus B probe. DNA-protein-binding
reactions were resolved via PAGE and subjected to autoradiography. B2
and B3 DNA-protein complexes are indicated. Film exposure time was
30 h (A) and 27 h (B). DNA-protein-binding studies were
performed twice.
|
|
B-Mediated Transcription Is Constitutively Stimulated in Sertoli
Cells
The transcriptional effects of NF-
B proteins in testis cells
were studied using the
BLUC expression vector, which contains the
tandem
B enhancer elements of the human immunodeficiency virus-1
(HIV-1) long terminal repeat (LTR) linked to a TATA box minimal
promoter driving the luciferase reporter gene. In unstimulated MSC-1
and primary Sertoli cells,
BLUC activity was at least 50-fold
greater than the pGL2LUCBasic parent vector and 6- to 8-fold greater
than SV40LUC having the luciferase gene driven by the SV40 promoter
(Fig. 7
). Cotransfection of NF-
B p50
and p65 expression vectors into MSC-1 and primary Sertoli cells caused
a further 3 to 4-fold induction of the
BLUC reporter gene. Addition
of TNF-
also induced
BLUC in primary Sertoli cells (3.2-fold,
Fig. 7
) and in MSC-1 cells (5.1-fold, data not shown). In contrast,
stimulation of Sertoli cells with FSH or forskolin did not increase
BLUC activity (data not shown). To determine whether the high basal
levels of
B enhancer-mediated gene expression were due to NF-
B
proteins, an expression vector encoding an amino-terminal deletion
mutant of I
B
was added to the transfection mixtures. The I
B
mutant used is resistant to phosphorylation-mediated degradation and
therefore is incapable of releasing NF-
B (35). Expression of the
I
B
mutant abolished
B enhancer-directed transcription in
MSC-1 and primary Sertoli cells. The down-regulation of gene expression
after sequestration of NF-
B by the dominant negative I
B mutant
confirmed that free nuclear NF-
B was responsible for activating
transcription through
B enhancers in Sertoli cells.
 |
DISCUSSION
|
|---|
Spermatogenesis is a complex process requiring precisely timed
hormonal and paracrine signals to regulate the genetic pathways
responsible for proliferation and differentiation of germ cells. The
NF-
B transcription factor has the capability to respond to a diverse
range of stimuli ultimately leading to modified gene expression (15, 23). Because the availability of NF-
B stimulators such as TNF-
and PKA are controlled during spermatogenesis in a stage-specific
manner (3, 11), we explored the possibility that NF-
B may be induced
in seminiferous tubules during the various stages of germ cell
development. Our initial studies revealed that primary Sertoli cells
and Sertoli cell lines are unusual in that NF-
B- binding activity in
nuclear extracts was equal to or greater than that present in crude
cytoplasmic extracts. Despite the increased nuclear NF-
B activity,
significant levels of NF-
B were found to be present in the Sertoli
cell cytoplasm, and additional NF-
B activity could be liberated from
I
B by detergent treatment. Compared with primary Sertoli
cells, the transformed Sertoli cell lines released less NF-
B binding
activity after detergent treatment. It is possible that the transformed
Sertoli cell lines may maintain less NF-
B in the cytoplasm or are
less efficient in the release of NF-
B from cytoplasmic stores. This
hypothesis would be consistent with the finding that the B1 band was
only amplified by detergent treatment of primary Sertoli cell
cytoplasmic extracts.
DNA binding and immunoprecipitation studies identified NF-
B p50 and
p65 as the most prevalent isoforms of NF-
B present in the nuclei and
cytoplasm of Sertoli cells. Furthermore, immunohistochemical
examination of testis tissue showed that NF-
B p50 and p65 were
present in Sertoli nuclei and cytoplasm throughout the spermatogenic
cycle. Cytoplasmic staining of NF-
B did not vary greatly, but
nuclear levels fluctuated in a stage-specific manner. Sertoli cell
nuclear NF-
B levels were found to peak in stages XIVVII and then
fall in stages VIIIXIII. The pattern of NF-
B immunostaining shown
throughout the cycle of spermatogenesis demonstrated that Sertoli cells
constitutively express nuclear NF-
B in vivo. Furthermore,
the increase in nuclear NF-
B during stages XIVVII suggests that
additional NF-
B is made available to potentially regulate
stage-specific gene expression in Sertoli cells.
In developing germ cells, nuclear expression of NF-
B first rose
above baseline levels in pachytene spermatocytes during stage IV,
peaked during stages VIIXI, and declined to lower levels in stage
XIIXIV spermatocytes and the subsequent early spermatid stages
IVII. The decline in NF-
B p50 and p65 levels in maturing
spermatids was not unusual, as the expression of many transcription
factors diminish in the later stages of spermatid development when most
transcriptional activity ceases (36). The stage-specific elevations in
nuclear NF-
B expression indicated that it may be required for gene
induction during these stages of spermatogenesis.
Stimulation of primary Sertoli cells with the NF-
B activating
factors PMA or TNF-
resulted in the activation of NF-
B
DNA-binding activity. The TNF-
induction of NF-
B occurred in a
biphasic manner with a dramatic increase in NF-
B-binding activity
within 0.5 h of TNF-
addition followed by a gradual decrease
over 6 h and a subsequent rise and fall of NF-
B-binding
activity at 12 and 24 h. This biphasic pattern of NF-
B
induction mirrored that seen in other systems and has been shown to be
due to the different kinetics with which I
B
and I
Bß are
degraded and regenerated after TNF-
or PMA stimulation (37).
Activation of NF-
B by TNF-
in Sertoli cells is not unexpected as
Sertoli cells express the 55-kDa TNF I receptor (11). However, it may
be more significant that round spermatid germ cells secrete TNF-
in
a stage-specific manner and that the increase in nuclear NF-
B
exhibited in stage IVII Sertoli cells correlates with the presence of
round spermatids in the seminiferous tubule (11, 38). Furthermore,
nuclear NF-
B levels are lower during stages VIIIXIII when
spermatids are elongating and producing less TNF-
(11). Although
further study is required to confirm a direct link between TNF-
and
NF-
B activity in Sertoli cells, the TNF-
paracrine- regulatory
system may be an important mechanism by which spermatids signal
adjacent Sertoli cells to provide factors required during specific
stages of development. In contrast, spermatocytes reportedly do not
express receptors for TNF-
(11), and as suggested by the later peak
in nuclear localization, must activate NF-
B by another pathway.
The FSH-induced PKA activity in Sertoli cells (3) is another candidate
regulator of NF-
B activity in seminiferous tubules. Previous studies
have shown that PKA is able to phosphorylate I
B and initiate the
release of NF-
B to the nucleus (12, 14). FSH induction of Sertoli
cell cAMP and PKA is a cyclical process in vivo. cAMP levels
begin to rise in stage XII, peak in stages III-V, and then fall to much
lower levels during stages VIXI (34). NF-
B levels in Sertoli
nuclei were also found to rise and fall in a cyclical manner, but the
changes in NF-
B nuclear immunolocalization appear to be slightly
delayed (one to two stages) relative to changes in cAMP and PKA levels.
Further study will be required to determine whether there is a direct
relationship between FSH induction of Sertoli cell-signaling
pathways and expression of nuclear NF-
B in vivo.
PKA has also been shown to directly phosphorylate NF-
B p65,
resulting in increased affinity of p65 for the
B enhancer sequence
and increased transactivation activity (13, 26). As the PKA activators
FSH and forskolin increased NF-
B binding activity in Sertoli cells,
an unexpected finding was that these stimuli were unable to induce
B
enhancer-mediated transcription. One explanation for the lack of
PKA-inducible transcription seen in cultured Sertoli cells may be the
absence of a p65 cofactor. Recently, the PKA activation of
B
enhancer-regulated transcription was shown to be mediated by the
functionally conserved transcriptional coactivators, CREB-binding
protein and p300 (CBP/p300). PKA phosphorylation of p65 was found to
promote association with the coactivators. Furthermore,
NF-
B-mediated transcription was induced by p65-CBP/p300 complexes in
a PKA-dependent manner (16). In many cell types CBP/p300 is present in
limited quantities, and a number of transcription factors compete for
coactivator binding (39). It will be interesting to determine whether
the availability of CBP/p300 in Sertoli cells modulates the NF-
B
response to FSH and PKA activation.
The best characterized model of nuclear localized, constitutively
activated NF-
B is the mature B cell. As B cells mature, the levels
of nuclear p50 and c-Rel increase. The mechanisms underlying the
constitutive NF-
B activation in B cells is not yet fully understood,
but recent studies suggest three possible explanations, including an
increase in I
B
turnover (40), a decrease in I
Bß levels (41),
and/or an increase in a hypophosphorylated form of I
Bß that acts
to prevent I
B
interaction with NF-
B subunits and does not
interfere with nuclear translocation (42). Although adult Sertoli cells
are similar to mature B cells in that they are terminally
differentiated, it remains to be determined whether Sertoli cells use
similar mechanisms to maintain NF-
B in the nucleus and whether these
mechanisms are developmentally controlled.
The presence of preexisting nuclear NF-
B proteins in Sertoli cells
and their functional activity was shown in Sertoli cell transfection
studies. The potent transcriptional enhancement mediated by the two
tandem
B repeats demonstrated that NF-
B proteins are primed to
activate transcription in untreated Sertoli cells. Down-regulation of
gene expression after addition of a degradation-resistant form of I
B
confirmed that NF-
B proteins were responsible for the high basal
levels of
B-enhancer-mediated transcription. The potential for
additional gene induction in response to activators of NF-
B was
shown by the further stimulation of gene activity in Sertoli cells
treated with TNF-
.
Although these studies point out the potential for NF-
B regulation
of gene expression in Sertoli cells, it will be important to identify
the genes modulated by NF-
B and understand their regulation.
Potential targets for NF-
B regulation include the androgen receptor
gene, which is required to mediate testosterone effects in the testis,
and the urokinase gene, which is needed for the constant tissue
remodeling performed during spermatogenesis. Both of these genes have
been shown to be regulated by NF-
B in other tissues (18, 19, 20). In our
studies we have noted that the CREB transcription factor promoter,
which transmits signals received from the FSH-cAMP-PKA pathway (43),
also contains four putative
B enhancer motifs (our
unpublished data). A computer-assisted sequence analysis of 10
spermatogenesis-regulating genes expressed by Sertoli cells revealed 5
that contained consensus
B enhancer motifs within their
5'-regulatory regions [gene sequences studied included the FSH
receptor, androgen binding protein (ABP), Mullerian inhibiting
substance (MIS), transferrin, TNF-
receptor I, c-mos, Hox 1.4,
inhibin
, inhibin/actin ßB chain, and stem cell factor]. The
mouse MIS and stem cell factor, as well as the rat inhibin
,
inhibin/actin ß B chain, and ABP genes, were all found to have
putative NF-
B-binding sites within 120-1250 bp of their
transcription initiation sites. Due to the large number of genes that
are potentially regulated by NF-
B, further investigation into the
mechanisms activating NF-
B in Sertoli cells appears to be
warranted.
 |
MATERIALS AND METHODS
|
|---|
Isolation of Primary Sertoli Cells and Cell Culture
Sertoli cells were isolated from 16-day-old Sprague-Dawley rats
as described previously (43). Decapsulated testes were digested with
collagenase (0.5 mg/ml, 33 C, 12 min) in enriched Krebs-Ringer
bicarbonate media (EKRB) (44), followed by three washes in EKRB (1
x g, 3 min) to isolate seminiferous tubules. Tubules were
digested with trypsin (0.5 mg/ml, 33 C, 12 min), and cell aggregates
were passed repeatedly through a drawn-out Pasteur pipette. An equal
volume of DMEM containing 10% FCS was added to the Sertoli cells,
which were then pelleted (500 x g, 5 min) and
resuspended in serum-free media containing 50% DMEM, 50% Hams F12,
5 µg/ml insulin, 5 µg/ml transferrin, 10-6
M retinoic acid, 10 ng/ml epidermal growth factor, 3
µg/ml cytosine ß-D-arabinofurano-sidase, 2
mM glutamine, 1 mM sodium pyruvate, 100 U/ml
penicillin, and 100 µg/ml streptomycin. Sertoli cells were cultured
on matrigel (Collaborative Research, Bedford, MA)-coated dishes (32 C,
5% CO2). Sertoli cells were routinely >95% pure as
determined by phase microscopy and alkaline phosphatase staining (45).
NIH 3T3 cells and mouse MSC-1 and TM4 Sertoli cells were cultured in
DMEM supplemented with 10% FBS, 100 U/ml penicillin, 100 µg/ml
streptomycin, and 2 mM glutamine (46, 47, 48, 49). In some cases,
cells were also cultured in the presence of forskolin (10
µM) and isobutylmethylxanthine (IBMX) (0.5
mM), PMA (1 nM), or TNF-
(20 ng/ml). Animals
used in these studies were maintained and killed according to the
principles and procedures described in the NIH Guide for the Care and
Use of Laboratory Animals.
Protein Extract Preparation
Nuclear and cytoplasmic extracts were prepared by detergent
lysis (50). Cells were lysed by incubation in buffer A [10
mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM
EDTA, 0.1 mM EGTA, 1 mM dithiothreitol (DTT),
0.5 mM phenylmethylsulfonylfluoride (PMSF), and a protease
cocktail consisting of 0.5 ng/ml pepstatin A, and 5 ng/ml each of
leupeptin, antipain, soybean trypsin inhibitor, and aprotinin] for 15
min on ice followed by the addition of 0.06% Nonidet P40. Cells were
vortexed for 10 sec, and nuclei were collected by centrifugation
(12,000 x g, 30 sec). The supernatant containing
cytoplasmic proteins was removed and frozen in 20% glycerol. To
prepare nuclear extracts, pelleted nuclei were washed once with buffer
A and resuspended in buffer C (20 mM HEPES, pH 7.9, 0.4
M NaCl, 1 mM EDTA, 1 mM EGTA, 1
mM DTT, 1 mM PMSF, 20% glycerol, and the
protease cocktail used for buffer A). Cells were mixed vigorously on a
shaking platform (4 C, 15 min), the cell debris pellet was removed
after centrifugation (5 min 12,000 x g), and the
supernatant containing nuclear proteins was frozen. Protein
concentrations were determined by the Bradford method using the Bio-Rad
protein assay.
DNA-Protein-Binding Assays
32P-Radiolabeled DNA probes were generated
by annealing a 27- nucleotide template containing a consensus
B
enhancer element
(5'-CGACACCCCTCGGGAATTCCCC-CACTGGG-CC-3') to a
complementary 10-base primer and then filling in the overhang with
Klenow in the presence of [
-32P]dATP and 5
mM dCTP, dGTP, dTTP, and 5-bromo-2-deoxyuridine
5-triphosphate. EMSAs were performed as described (51).
Briefly, 32P-labeled
B probe was incubated with
210 µg of nuclear, cytoplasmic, or whole-cell extracts from either
COS-1 cells, TM4 or MSC-1 Sertoli cell lines, or 16-day rat primary
Sertoli cell cultures. Binding reactions were incubated 15 min at room
temperature in the presence of 1 µg poly(dI-dC), 250 ng BSA, 5
mM DTT, 50100 mM NaCl or KCl, 20
mM HEPES, and 1 mM EDTA. For competition EMSAs,
a 50-fold excess of double-stranded unlabeled competitor
oligonucleotides including a Sp1-binding site
(GCTGCCTGTGGCCCGGGCGGCTGGGAGAAGCGG), a CRE motif
(GATCCGGCTGACGTCATCAAGCTAGATC), or the unlabeled
B probe were
coincubated with labeled
B probe and nuclear extracts. Protein-DNA
complexes were resolved via PAGE under nondenaturing conditions in a
Tris/borate/EDTA buffer. In binding reactions involving detergent
treatment to release NF-
B proteins from I
B, proteins were
preincubated with 0.5% DOC for 10 min followed by the addition of 1%
Nonidet P40 (NP40) immediately before addition of the radiolabeled
probe. To quantitate the relative levels of DNA-protein complexes,
autoradiograms were digitized on a flatbed scanner, and NIH Image
(version 1.57) analysis software was used to measure the intensity of
individual bands. Values for fold induction of binding activity were
determined relative to the binding activity (band intensity) of the
nuclear extracts for each cell type (Fig. 1
) or the untreated (0 h)
control extracts (Figs. 5
and 6
), and the mean fold induction was
calculated from two (Fig. 6
) or three (Figs. 1
and 5
) independent
experiments.
In Situ UV Cross-Linking and Immunoprecipitation
Assays
DNA/protein binding reactions were performed as described (51).
For in situ UV cross-linking studies, DNA-protein complexes
resolved via 5% nondenaturing PAGE were UV irradiated in
situ for 15 min at 302 nm using a TMW-20 transilluminator.
DNA-protein adducts were excised from the gel resolved by denaturing
discontinuous SDS-PAGE and visualized by autoradiography. For
immunoprecipitation experiments, primary Sertoli cells were cultured
for 1 h in methionine- and cysteine-deficient, serum-free DMEM and
a further 2 h after the addition of 35S-labeleled
methionine and cysteine. Cells were washed twice with PBS and lysed in
1 ml RIPA buffer (150 mM NaCl, 10 mM Tris (pH
7.5), 0.1% SDS, 1% DOC, 1% NP40, 1 mM PMSF, and protease
inhibitor cocktail). Extracts from approximately 2 x
108 cells were incubated with preimmune antisera or
antisera directed against the 21 amino-terminal amino acids of p50 or
p65 and precipitated using protein A Sepharose. Immunoprecipitated
proteins were fractionated by SDS-PAGE and visualized by
fluorography.
Immunocytochemistry
Immunostaining was performed on paraffin-embedded sections (5
µm) from Bouins fixed adult rat testis or primary Sertoli cells or
NIH 3T3 cells cultured on glass coverslips. Testis sections were
deparaffinized in xylene, rehydrated, and then permeabilized for 1 min
in cold 100% methanol. The sections were microwaved on high power for
20 min in citrate buffer (10 mM citrate, 30 mM
NaCl, pH 5.5) and then left undisturbed at room temperature for 20 min
(52). The sections were washed two times for 5 min in PBS and blocked
for 12 h in normal goat serum, 0.5% BSA, and 0.15% glycine at 4
C. Cultured cells were fixed in 4% paraformaldehyde for 5 min,
permeablized for 1 min in ice-cold 100% MeOH, and dried completely
followed by blocking 424 h with normal goat serum, 0.5% BSA, and
0.15% glycine. The testis tissue or cultured cells were then incubated
1224 h with preimmune serum or rabbit polyclonal antiserum directed
against the amino-terminal 21 amino acids of NF-
B p65 or NF-
B
p50. For cultured cells, fluorescent Cy3 secondary goat anti-rabbit
antiserum was added. For tissue sections, anti-rabbit biotinylated
secondary antibody (Vectastain Elite ABC Kit, Vector Laboratories,
Burlingame, CA) was added, and bound antibodies were detected as
described by the kit instructions using AEC staining solution (0.02%,
3-amino-9-ethylcarbazole, 5% N,N-dimethyl formamide,
0.015% H2O2, and 0.1 M sodium
acetate, pH 5.0) as the colorimetric reagent. Slides were washed in
H2O and counterstained with hematoxylin. A charged coupled
device (CCD) video camera system (Optronics, Chelmsford, MA) was used
to capture images of stained cells or tubule cross-sections. The
quantitation of the relative staining intensities of
seminiferous tubule nuclei by p65 and p50 antisera was
accomplished using BioQuant image analysis software (R & M
Biometrics, Inc., Nashville, TN). Immunostained slides of adult rat
testis tissue regularly contained at least 300 seminiferous tubule
cross-sections. Testis tissue sections from three adult rats were used
to quantitate relative nuclear immunostaining with one representative
slide used from each animal. The testis tissue sections regularly
contained at least 300 seminiferous tubule cross-sections. Sertoli cell
and spermatocyte nuclei to be analyzed were chosen from the same
tubules. At least five seminiferous tubule cross-sections representing
each of the 14 (IXIV) stages of spermatogenesis were chosen for
quantitation from each slide. For each slide, threshold windows of red,
green, and blue color values were set within the BioQuant image
analysis program to distinguish only the red-brown staining of nuclei
due to the AEC precipitate. Five of the stained nuclei from each tubule
cross-section, as identified by the image analysis software, were
randomly chosen and the immunostain within each nucleus was measured by
a integrated optical density method that measures the intensity and
density of pixels within an object as a function of object size. The
mean integrated optical densities of nuclei in each stage was
calculated (n
25) and arbitrarily normalized to the mean value
determined for stage I Sertoli nuclei (stage I = 100%). The mean
normalized nuclear immunostaining intensities from the three
independent experiments were determined to give the final relative
immunostaining intensities.
Plasmid Constructs, Transfections, and Luciferase Assays
COS-1 cells were transfected with NF-
B expression
vectors by using diethylaminoethyl-dextran, and whole-cell lysates were
prepared after 48 h (53). For transient reporter transfections,
the
BLUC vector was constructed by inserting a 200-bp
PvuII-XhoI fragment from
B-TATA-CAT
(containing two tandem
B enhancer elements derived from the HIV-1
LTR linked to the albumen gene TATA element) (54) into the
SmaI-XhoI sites directly upstream of the
luciferase gene in the pGL2-Basic vector (Promega, Madison, WI).
SV40LUC is the pGL2-Promoter plasmid (Promega) containing the SV40
promoter upstream of the luciferase gene in the pGL2Basic backbone. The
RSVLUC plasmid is pA3RSV400LUC containing the
enhancer and promoter of the 3'-LTR of Rous sarcoma virus (55). NF-
B
expression vectors contain cDNAs for NF-
B p50 (56) and p65 (57)
positioned downstream of the cytomegalovirus (CMV) promoter/enhancer in
the pCMV4 and pCMV5 expression vectors (58, 59) (pCMV4p50 (53) and
pCMV5p65, respectively (60)). The I
B deletion mutant cDNA
I
B
N containing sequences encoding amino acids 37317 of
I
B
was inserted into the pCMV4 expression vector (35). Primary
Sertoli cells and MSC-1 cells were transfected as described (43) using
1 µg of luciferase reporter plasmid and 1 µg of empty pCMV
expression vector or 1 µg of pCMV expression vectors encoding p50 and
p65 or I
B
N in the absence or presence of 20 ng/ml TNF-
.
Luciferase assays were performed using a luminometer and the Promega
luciferase assay system. Luciferase activity of the extracts was
normalized for protein activity as determined by Bradford assay.
 |
ACKNOWLEDGMENTS
|
|---|
We are indebted to Drs. Tony Zeleznik, Tony Plant, and Dean
Ballard for critical suggestions regarding the manuscript. We wish to
thank Donna Olejniczak, Nina Gram-Humphry, and Charity Fix for expert
technical assistance; Drs. Dean Ballard and Stefan Dorre for NF-
B
antisera, as well as NF-
B and I
B
N expression vectors; and
Barbara Sanborn for providing the MSC-1 cell line. We also are grateful
for access to imaging equipment and expertise provided by Drs. Simon
Watkins, Director of the University of Pittsburgh Center for Biological
Imaging, and Robert Gibbs, Director of the Cell Imaging Core of the
Center for Research in Reproductive Physiology (P-30HD08610).
 |
FOOTNOTES
|
|---|
Address requests for reprints to: William H. Walker, S333 Biomedical Science Tower, Department of Cell Biology and Physiology, University of Pittsburgh, Pittsburgh, Pennsylvania, 15261. E-mail:
walkerw+{at}pitt.edu
This work was supported by NIH Grant R29-HD-34913.
Received for publication December 5, 1997.
Revision received June 29, 1998.
Accepted for publication August 7, 1998.
 |
REFERENCES
|
|---|
-
Sharpe RM 1994 Regulation of spermatogenesis. In: Knobil
E, Neil JD (eds) The Physiology of Reproduction. Raven Press, New York,
pp 13631434
-
De Kretser DM, Risbridger GP, Kerr J 1995 Basic endocrinology
of the testis. In: DeGroot L (ed) Endocrinology. W. B. Saunders,
Philadelphia, pp 23072335
-
Steinberger A, Hintz M, Heindel J 1978 Changes in cAMP
responses to FSH in isolated rat Sertoli cells during sexual
maturation. Biol Reprod 19:566572[Abstract]
-
Griswold MD 1993 Actions of FSH on mammalian Sertoli cells.
In: Russell LD, Griswold MD (eds) The Sertoli Cell. Cache River Press,
Clearwater, FL, pp 493508
-
Kishimoto T, Akira S, Taga T 1992 Interleukin-6 and its
receptor: a paradigm for cytokines. Science 258:593597[Abstract/Free Full Text]
-
Okuda Y, Xiao-Rong S, Morris P 1994 Interleukin-6 (IL-6)
mRNAs expressed in Leydig and Sertoli cells are regulated by cytokines,
gonadotropins and neuropeptides. Endocrine 2:617624
-
Okuda Y, Morris P 1994 Identification of interleukin-6
receptor (IL-6R) mRNA in isolated Sertoli and Leydig cells: regulation
by gonadotropin and interleukins in vitro. Endocrine 2:11631168
-
Syed V, Gerard N, Kaipia A, Bardin CW, Parvinen M, Jegou B 1993 Identification, ontogeny, and regulation of an interleukin-6-like
factor in the rat seminiferous tubule. Endocrinology 132:293299[Abstract]
-
Gerard N, Syed V, Bardin W, Genetet N, Jegou B 1991 Sertoli
cells are the site of interleukin-1 alpha synthesis in rat testis. Mol
Cell Endocrinol 82:R13R16
-
Boockfor FR, Schwarz LK 1991 Effects of interleukin-6,
interleukin-2, and tumor necrosis factor alpha on transferrin release
from Sertoli cells in culture. Endocrinology 129:256262[Abstract]
-
De SK, Chen H-L, Pace JLH, Hunt JS, Terranova PF, Enders GC 1993 Expression of tumor necrosis factor-
in mouse spermatogenic
cells. Endocrinology 133:389396[Abstract]
-
Shirakawa F, Mizel S 1989 In vitro activation and
nuclear translocation of NF-
B catalyzed cyclic AMP-dependent protein
kinase and protein kinase C. Mol Cell Biol 9:24242430[Abstract/Free Full Text]
-
Zhong H, SuYang H, Erdjument-Bromage H, Tempst P, Ghosh S 1997 The transcriptional activity of NF-
B is regulated by the
I
B-associated PKAc subunit through a cyclic AMP-independent
mechanism. Cell 89:413424[CrossRef][Medline]
-
Ghosh S, Baltimore D 1990 Activation in vitro of
NF-
B by phosphorylation of its inhibitor I
B. Nature 344:678682[CrossRef][Medline]
-
Siebenlist U, Franzoso G, Brown K 1994 Structure, regulation,
and function of NF-
B. Annu Rev Cell Biol 10:405455[CrossRef]
-
Zhong H, Voll RE, Ghosh S 1998 Phosphorylation of NF-
B by
PKA stimulates transcriptional activity by promoting a novel bivalent
interaction with the coactivator CBP/p300. Mol Cell 1:661671[CrossRef][Medline]
-
Rattner A, Korner M, Rosen H, Baeuerle P, Citri Y 1991 Nuclear
factor
B activates proenkephalin transcription in T lymphocytes. Mol
Cell Biol 11:10171022[Abstract/Free Full Text]
-
Hansen SK, Nerlov C, Zabel U, Verde P, Johnsen M, Baeuerle PA,
Blasi F 1992 A novel complex between the p65 subunit of NF-
B and
c-Rel binds to a DNA element involved in the phorbol ester induction of
the human urokinase gene. EMBO J 11:205213[Medline]
-
Novak U, Cocks G, Hamilton JA 1991 A labile repressor acts
through the NF-
B-like binding sites of the human urokinase gene.
Nucleic Acids Res 19:33893393[Abstract/Free Full Text]
-
Supakar PC, Jung MH, Song CS, Chatterjee B, Roy AK 1995 Nuclear factor
B functions as a negative regulator for the rat
androgen receptor gene and NF-
B activity increases during the
age-dependent desensitization of the liver. J Biol Chem 270:837842[Abstract/Free Full Text]
-
Collart MA, Baeuerle P, Vassalli P 1990 Regulation of tumor
necrosis alpha transcription in macrophages: involvement of four
B-like motifs and of constitutive and inducible forms of NF-
B.
Mol Cell Biol 10:14981506[Abstract/Free Full Text]
-
Drouet C, Shakhov AN, Jongeneel CV 1991 Enhancers and
transcription factors controlling the inducibility of tumor necrosis
factor-
promoter in primary macrophages. J Immunol 147:16941700[Abstract]
-
Baeuerle PA, Henkel T 1994 Function and activation of NF-
B
in the immune system. Annu Rev Immunol 12:141179[Medline]
-
Baldwin AS 1996 The NF-
B and I
B proteins: new
discoveries and insights. Annu Rev Immunol 14:649681[CrossRef][Medline]
-
Verma IM, Stevenson JK, Scwartz EM, Van Antwerp D, Miyamoto S 1995 Rel/NF-
B/I
B family: intimate tales of association and
dissociation. Genes Dev 9:27232735[Free Full Text]
-
Naumann M, Scheidereit C 1994 Activation of NF-
B in
vivo is regulated by multiple phosphorylations. EMBO J 13:45974607[Medline]
-
Chen D, Rothberg EV 1994 Interleukin 2 transcription factors
as molecular targets of cAMP inhibition: delayed inhibition kinetics
and combinatorial transcription roles. J Exp Med 179:931942[Abstract/Free Full Text]
-
Baeuerle PA, Baltimore D 1988 Activation of DNA-binding
activity in an apparently cytoplasmic precursor of the NF-
B
transcription factor. Cell 53:211217[CrossRef][Medline]
-
Moliter JA, Walker WH, Doerre S, Ballard DW, CGW 1990 NF-
B:
a family of inducible and differentially expressed enhancer-binding
proteins in human T cells. Proc Natl Acad Sci USA 87:1002810032[Abstract/Free Full Text]
-
Li S, Sedivy JM 1993 Raf-1 protein kinase activates the
NF-
B transcription factor by dissociating the cytoplasmic
NF-
B-I
B complex. Proc Natl Acad Sci 90:92479251[Abstract/Free Full Text]
-
Leblond CP, Clermont Y 1952 Definition of the stages of the
cycle of the seminiferous epithelium in the rat. Ann NY Acad Sci 55:548573
-
Perey B, Cleremont Y, Leblond CP 1961 The wave of the
seminiferous epithelium in the rat. Am J Anat 108:4777[CrossRef]
-
Nehar D, Mauduit C, Boussouar F, Benahmed M 1997 Tumor
necrosis factor-
-stimulated lactate production is linked to lactate
dehydrogenase A expression and activity increase in porcine cultured
Sertoli cells. Endocrinology 138:19641971[Abstract/Free Full Text]
-
Kangasniemi M, Kaipia A, Mali P, Toppari J, Huhtaniemi I,
Parvinen M 1990 Modulation of basal and FSH-dependent cyclic AMP
production in rat seminiferous tubules staged by an improved
transillumination technique. Anat Rec 227:6276[CrossRef][Medline]
-
Brockman JA, Scherer DC, McKinsey TA, Hall SM, Qi X, Lee WY,
Ballard DW 1995 Coupling of a signal response domain in I
B
to
multiple pathways for NF-
B. Mol Cell Biol 15:28092818[Abstract]
-
Erickson RP 1990 Post-meiotic gene expression. Trends Genet 6:264269[CrossRef][Medline]
-
Thompson JE, Phillips RJ, Erdjument-Bromage H, Tempst P, Ghosh
S 1995 I
B-ß regulates the persistent response in a biphasic
activation of NF-
B. Cell 80:573582[CrossRef][Medline]
-
Mauduit C, Besset V, Caussanel V, Benahmed M 1996 Tumor
necrosis factor
receptor p55 is under hormonal (follicle
stimulating hormone) control in testicular Sertoli cells. Biochem
Biophys Res Commun 224:631637[CrossRef][Medline]
-
Kamei Y, Xu L, TH, Torchia J, Kurokawa R, Gloss B, Lin SC,
Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator
complex mediates transcriptional activation and AP-1 inhibition by
nuclear receptors. Cell 85:403414[CrossRef][Medline]
-
Miyamato SP, Chiao PJ, Verma IM 1994 Enhanced degradation is
responsible for constitutive NF-
B activity in mature murine B-cell
lines. Mol Cell Biol 14:32763282[Abstract/Free Full Text]
-
Kistler B, Rolink A, Marienfield R, Neumann M, Wirth T 1998 Induction of nuclear factor-
B during primary B cell differentiation.
J Immunol 160:23082317[Abstract/Free Full Text]
-
Suyang H, Phillips R, Douglas I, Ghosh S 1996 Role of
unphosphorylated, newly synthesized I
Bß in the persistent
activation of NF-
B. Mol Cell Biol 16:54445449[Abstract]
-
Walker WH, Fucci L, Habener JF 1995 Expression of the gene
encoding transcription factor adenosine 3',5'-monophosphate (cAMP)
response element-binding protein: regulation by follicle-stimulating
hormone-induced cAMP signaling in primary rat Sertoli cells.
Endocrinology 136:35343545[Abstract]
-
Bellvé AR, Millette CF, Bhatnagar YM, OBrien DA 1977 Dissociation of the mouse testis and characterization of isolated
spermatogenic cells. J Histochem Cytochem 25:480494[Medline]
-
Chapin RE, Phelps JL, Miller BE, Gary TJB 1987 Alkaline
phosphatase histochemistry discriminates peritubular cells in primary
rat testicular cell culture. J Androl 8:155161[Abstract/Free Full Text]
-
McGuinness M, Linder CC, Morales CR, Heckert LL, Pikus J,
Griswold MD 1994 Relationship of a mouse Sertoli cell line (MSC-1) to
normal Sertoli cells. Biol Reprod 51:116124[Abstract]
-
Peschon JJ, Behringer RR, Cate RI, Harwood KA, Idzerda RI,
Brinster RI, Palmiter RD 1992 Directed expression of an oncogene to
Sertoli cells in transgenic mice using Mullerian inhibiting substance
regulatory sequences. Mol Endocrinol 61:14031411
-
Mather JP 1980 Establishment and characterization of two
distinct mouse testicular epithelial cell lines. Biol Reprod 23:243252[Abstract]
-
Hofmann M-C, Narisawa S, Hess RA, Millian JL 1992 Immortalization of germ cells and somatic testicular cells using the
SV40 large T antigen. Exp Cell Res 201:417435[CrossRef][Medline]
-
Schreiber E, Matthias P, Muller MM, Schaffner W 1989 Rapid
detection of octomer binding proteins with miniextracts prepared from a
small number of cells. Nucleic Acids Res 17:6419[Free Full Text]
-
Ballard DW, Walker WH, Doerre S, Sista P, Molitor JA, Dixon
EP, Peffer NJ, Hannink M, Greene WC 1990 The v-rel oncogene encodes a
B enhancer binding protein that inhibits NF-
B function. Cell 63:803814[CrossRef][Medline]
-
Majdic G, McNeilly AS, Sharpe RM, Evens LR, Groome NP, KSPT 1997 Testicular expression of inhibin and activin subunits and
follistatin in the rat and human fetus and neonate during postnatal
development in the rat. Endocrinology 138:21362147[Abstract/Free Full Text]
-
Walker WH, Stein B, Ganchi PA, Hoffman JA, Kaufman PA, Ballard
DW, Hannink M, Greene WC 1992 The v-rel oncogene: insights
into the mechanism of transcriptional activation, repression, and
transformation. J Virol 66:50185029[Abstract/Free Full Text]
-
Stein B, Rahmsdorf HJ, Steffen A, Litfin M, Herrlich P 1989 UV-induced DNA damage is an intermediate step in UV-induced expression
of human immunodeficiency virus type 1, collagenase, c-fos,
and metallothionein. Mol Cell Biol 9:51695181[Abstract/Free Full Text]
-
Wood WM, Kao MY, Gordon DF, Ridgeway EC 1989 Thyroid hormone
regulates the mouse thyrotropin ß-subunit gene promoter in
transfected primary thyrotropes. J Biol Chem 264:1484014847[Abstract/Free Full Text]
-
Kieran M, Blank V, Logeat J, Vandekerckhove J, Lottspeich F,
Le Bail O, Urban MB, Kourilsky P, Baeuerle PA, Israel A 1990 The DNA
binding subunit of NF-
B is identical to factor KBF1 and homologous
to the rel oncogene product. Cell 62:10071018[CrossRef][Medline]
-
Nolan GP, Ghosh S, Liou H-C, Tempst P, Baltimore D 1991 DNA
binding and I
B inhibition of the cloned p65 subunit of NF-
B, a
rel-related polypeptide. Cell 64:961969[CrossRef][Medline]
-
Andersson SD, Davis D, Dahlback H, Jornvall H, Russell DW 1989 Cloning, structure, and expression of the mitochondrial cytochrome
P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme. J
Biol Chem 264:822829
-
Chen WJ, Andres DA, Goldstein JL, Russell DW, Brown MS 1991 cDNA cloning and expression of the peptide-binding beta subunit of rat
p21ras farnesyltransferase, the counterpart of yeast DPR1/RAM1. Cell 66:327334[CrossRef][Medline]
-
Ballard DW, Dixon EP, Peffer NJ, Bogerd H, Doerre S, Stein B,
Greene WC 1992 The 65 kDa subunit of NF-
B functions as a potent
transcriptional activator and a target for v-Rel-mediated repression.
Proc Natl Acad Sci USA 89:18751879[Abstract/Free Full Text]
This article has been cited by other articles: