help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Delfino, F.
Right arrow Articles by Walker, W. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Delfino, F.
Right arrow Articles by Walker, W. H.
Molecular Endocrinology 12 (11): 1696-1707
Copyright © 1998 by The Endocrine Society

Stage-Specific Nuclear Expression of NF-{kappa}B in Mammalian Testis

Frank Delfino and William H. Walker

Department of Cell Biology and Physiology University of Pittsburgh Pittsburgh, Pennsylvania 15261


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Rel/nuclear factor (NF)-{kappa}B family of transcription factors are important intracellular conveyors of extracellular signals in a number of systems. However, little is known of their roles in the specialized, hormonally regulated environment of the mammalian testis. In this study NF-{kappa}B p50 and p65 proteins were found to be constitutively present and active in the nucleus of Sertoli cells cultured from rat testis. In vivo, NF-{kappa}B proteins are present in the nucleus of Sertoli cells during all 14 (I–XIV) cyclical stages of spermatogenesis; however, nuclear NF-{kappa}B expression was elevated in stage XIV and remained high in stages I–VII. In contrast, NF-{kappa}B p50 and p65 subunits are transiently expressed in the nuclei of germ cells with peak levels found in pachytene spermatocytes during stages VII–XI and lower levels in stage I-VII spermatids. Tumor necrosis factor-{alpha}, which is produced by round spermatids in the testis, increased nuclear NF-{kappa}B binding activity when added to Sertoli cells. Stimulation of Sertoli cells with activators of the cAMP-protein kinase A (PKA) signaling pathway such as forskolin or FSH also increased NF-{kappa}B DNA binding activity. Consistent with the cellular localization studies, NF-{kappa}B was found to be activated as high basal levels of NF-{kappa}B-stimulated reporter gene expression were detected in transient transfection studies of Sertoli cells. Addition of tumor necrosis factor-{alpha} to Sertoli cells further stimulated {kappa}B enhancer-mediated transcription. These findings suggest that NF-{kappa}B proteins are stage specifically localized to Sertoli cell and spermatocyte nuclei and may play a role in the regulation of stage-specific gene expression during the process of spermatogenesis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Spermatogenesis, the multistep process by which spermatogonial stem cells give rise to mature spermatozoa, takes place within the seminiferous tubules of the mammalian testis. The seminiferous tubules contain three major cell types: peritubular cells, which form the exterior wall of the seminiferous tubule, germ cells in various stages of development, and Sertoli cells, which relay external signals and provide factors required for the differentiation and proliferation of germ cells. Spermatogenesis is under hormonal control by the hypothalamic-pituitary-testicular axis as well as through local testicular paracrine mechanisms (1, 2). A major hormonal regulator of spermatogenesis is the pituitary gonadotropin, FSH, which acts on Sertoli cells to stimulate increases in cAMP levels leading to the activation of PKA and subsequent induction of genes essential for the process of spermatogenesis (3, 4). In addition, a number of cytokines including interleukin-1 (IL-1), IL-6, and tumor necrosis factor-{alpha} (TNF-{alpha}), have been shown to be paracrine regulators of testis gene expression (5, 6, 7, 8, 9, 10, 11). Interestingly, PKA as well as the cytokines IL-1, IL-6, and TNF-{alpha}, share the ability to activate the nuclear factor (NF)-{kappa}B transcription factor (12, 13, 14, 15, 16). A number of genes expressed in the testis, including the androgen receptor, urokinase, proenkephalin, and TNF-{alpha} genes, have been shown to be regulated by NF-{kappa}B in other tissues (17, 18, 19, 20, 21, 22). Due to the potential importance of NF-{kappa}B in regulating testis gene expression, we wished to test the hypothesis that NF-{kappa}B is induced in testis seminiferous tubules.

Five NF-{kappa}B DNA-binding subunits (Rel A or p65, Rel B, c-Rel, p50, and p52) have been identified in mammalian cells. The NF-{kappa}B (Rel) family of transcription factors regulate transcription by binding as dimers to {kappa}B enhancer elements in the regulatory region of genes. With few exceptions, NF-{kappa}B proteins remain in the cytoplasm of unstimulated cells where they are tethered to various isoforms of I{kappa}B (15, 23, 24). Upon stimulation, I{kappa}B is phosphorylated and undergoes proteosome-mediated degradation, thereby releasing NF-{kappa}B to translocate to the nucleus and regulate gene transcription (24, 25). In addition to regulated nuclear translocation, NF-{kappa}B activity can be altered by phosphorylation of individual subunits. Direct phosphorylation of NF-{kappa}B p65 by PKA or PKC has been shown to enhance p65 DNA binding and transactivation activity (16, 26, 27).

With this study we have determined that NF-{kappa}B is constitutively present and active in the nuclei of Sertoli cells cultured from rat testis. In the testis, nuclear expression of NF-{kappa}B proteins was found to be regulated in a cell- and stage-specific manner. Sertoli cell levels of nuclear NF-{kappa}B were highest during spermatogenesis stages XIV–VII, whereas nuclear expression of NF-{kappa}B peaked in stage VII–XI spermatocytes. Treatment of Sertoli cells with TNF-{alpha}, which is expressed by spermatids, increased NF-{kappa}B binding activity. Sertoli cell nuclear NF-{kappa}B DNA-binding activity was also enhanced by the PKA activators forskolin and FSH. NF-{kappa}B was shown to be functional as basal levels of {kappa}B enhancer-mediated transcription were high in Sertoli cells, and addition of TNF-{alpha} further stimulated gene expression. These data identify NF-{kappa}B as a potential regulator of the genetic program of spermatogenesis.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Constitutive Nuclear Expression of NF-{kappa}B-Binding Activity in Sertoli Cells
To explore the potential role of NF-{kappa}B in spermatogenesis, the expression of NF-{kappa}B was first tested in electrophoretic mobility shift assays (EMSAs) using nuclear protein extracts from primary Sertoli cell cultures and a probe containing a consensus {kappa}B enhancer motif. A series of DNA-protein complexes were formed (Fig. 1AGo). The proteins forming the complexes were shown to specifically bind the {kappa}B enhancer probe: a 50-fold excess of the homologous {kappa}B enhancer oligonucleotide eliminated all complex formation, but a 50-fold excess of oligonucleotides containing a Sp1-binding site or a cAMP response element (CRE) did not affect probe-protein interactions



View larger version (54K):
[in this window]
[in a new window]
 
Figure 1. Sertoli Cell Proteins Bind to the {kappa}B Enhancer Motifs

A, NF-{kappa}B-like proteins in Sertoli cell nuclear extracts bind specifically to a {kappa}B enhancer probe. In EMSA experiments, primary Sertoli nuclear proteins were incubated with a 32P-labeled {kappa}B enhancer probe and no competitor (lane 1), a 50-fold excess of unlabeled {kappa}B enhancer probe (lane 2), a oligonucleotide containing an Sp1-binding site (lane 3), or a CRE-containing oligonucleotide (lane 4). DNA-protein complexes were resolved by nondenaturing PAGE and detected by autoradiography. For all EMSAs the unbound probe was run off of the gel. B, Sertoli nuclear extracts contain high levels of NF-{kappa}B-binding activity. Equal amounts of nuclear (NE) and cytoplasmic (Cyto) extracts from primary Sertoli cells (5 µg, lanes 1–3), as well as TM4 (10 µg, lanes 4–6) and MSC-1 (5 µg, lanes 7–9) Sertoli cell lines, were incubated with a 32P-labeled {kappa}B enhancer probe. Cytoplasmic extracts were also preincubated in the presence of DOC and NP-40 detergents (lanes 3, 6, and 9, Cyto + Det). The various DNA-protein complexes formed (B1-B3) are indicated. The determination of the relative levels of DNA-protein complexes is explained in Materials and Methods. C, UV cross-linking of Sertoli nuclear proteins to the {kappa}B enhancer. DNA-protein complexes derived from Cos-1 cells expressing p65 or p50 homodimers (lanes 1, 2) as well as various B1, B2, and B3 complexes from TM4 (lanes 3, 4), MSC-1 (lanes 5–7), and primary Sertoli cells (lanes 8–10) were resolved by nondenaturing PAGE, UV cross-linked in situ, excised from the gel, and separated by denaturing discontinuous SDS-PAGE. The DNA-protein adducts containing NF-{kappa}B p50 and p65 are indicated. Note: The molecular mass of the DNA-protein complexes is increased by approximately 5 kDa due to the contribution of the cross-linked oligonucleotide probe. EMSA incubations were scaled up 5-fold for cross-linking studies. DNA-protein-binding assays shown are representatives of at least three independent experiments. D, Sertoli cells contain NF-{kappa}B p50 and p65. Whole-cell extracts from Sertoli cells cultured in the presence of [35S]methionine were immunoprecipitated with preimmune serum, or antisera against NF-{kappa}B p50 or p65. SDS-PAGE-fractionated NF-{kappa}B p50 and p65 are indicated. The relative positions of molecular mass markers are shown to the left. The data in panels A and B are representative of three experiments; panels C and D were reproduced twice.

 
Further characterization of NF-{kappa}B proteins was performed using nuclear and cytoplasmic extracts from TM4 and MSC-1 Sertoli cell lines in addition to primary Sertoli cells. In unstimulated cells, NF-{kappa}B is typically retained in the cytoplasm. In contrast, substantial NF-{kappa}B- binding activity was detected in nuclear extracts from all the Sertoli cell lines, with nuclear binding activity similar to that of the corresponding cytoplasmic extracts. The binding activities of nuclear and cytoplasmic extracts were also compared with cytoplasmic extracts that were pretreated with deoxycholate (DOC), a detergent known to dissociate I{kappa}B from NF-{kappa}B in vitro (28). Treatment of cytoplasmic extracts with DOC enhanced the formation of DNA-protein complexes from primary and TM4 Sertoli cells 3- and 1.5-fold, respectively, but had less effect on MSC-1 cells (1.2-fold induction). Furthermore, detergent treatment allowed detection of the B1 complex in primary Sertoli cells that was otherwise only visualized after long film exposure times (Fig. 1BGo). In comparison to primary Sertoli cells, the B1 complex was less prevalent in extracts from the Sertoli cell lines. However, TM4 and MSC-1 cell extracts formed one complex that was similar to that from primary cells (B2) and another complex (B3) that migrated slightly slower than the B3 complex from primary Sertoli cells. The migration pattern of the B3 complex was found to vary slightly when various protein extract preparations were used. In some cases, a less abundant lower complex could be resolved, but due to the inability to reproducibly separate the complexes, all the DNA-protein interactions in this region were characterized as B3.

The Major Forms of NF-{kappa}B in Sertoli Cells Are p50 and p65
Further studies were undertaken to characterize the Sertoli cell proteins binding to the {kappa}B enhancer motifs. UV cross-linked DNA-protein complexes formed using a photoaffinity, 32P-labeled {kappa}B enhancer probe were fractionated by SDS-PAGE to resolve the proteins covalently bound to the probe. Complexes formed using extracts from COS-1 cells transfected with NF-{kappa}B p50 or p65 expression vectors were compared with complexes from unstimulated TM4, MSC-1, and primary Sertoli cell nuclear extracts. Previous studies have shown that the probe contributes approximately 5 kDa to the apparent molecular mass of the DNA-protein complex (29). A complex of 70 kDa that comigrates with the p65-containing complex from transfected COS-1 cells was detected in the B1 band from MSC-1 and primary Sertoli cells and the B2 bands from TM4, MSC-1, and primary Sertoli extracts (Fig. 1CGo). Lower levels of a 55-kDa adduct were detected in the B2 complex that comigrated with the complex formed from p50 expressing Cos cells. The 55-kDa complex, but not the 70 kDa adduct, was detected in all B3 complexes. The B2 and B3 complexes also contained varying levels of an additional 40-kDa adduct, which may represent partial p50 proteolysis or an additional {kappa}B element-binding protein. The 150-kDa adduct detected in the B1 and B2 complexes and the 110-kDa adduct present in the B3 complex may represent p65 dimers, p65-p50 heterodimers, or p50 dimers simultaneously cross-linked to the probe. Together, the UV cross-linking studies identify three types of NF-{kappa}B complexes formed in Sertoli cells. B1 complexes contain predominately p65 homodimers, B2 consists of p50 and p65 heterodimers, and B3 contains p50 homodimers and an unidentified protein of approximately 40 kDa.

To confirm that NF-{kappa}B p50 and p65 are present in Sertoli cells, antisera against p50 and p65 were used in immunoprecipitation assays of primary Sertoli whole-cell extracts (Fig. 1DGo). Both NF-{kappa}B p50 and p65 were immunoprecipitated from the Sertoli extracts by their respective antisera. Together, the data from Fig. 1Go indicate that p50 and p65 are major forms of {kappa}B enhancer-binding proteins present in Sertoli cells.

NF-{kappa}B p50 and p65 Are Localized in a Stage-Specific Manner to the Nuclei of Sertoli and Germ Cells in Vivo
To confirm the nuclear localization of NF-{kappa}B proteins shown by the DNA-binding assays, primary Sertoli cells were probed with p65 and p50 specific antisera in immunohistochemistry studies. Primary Sertoli cells were found to have high levels of p50 and p65 staining in the nucleus, although some cytoplasmic staining was also evident (Fig. 2Go). In contrast, immunostaining of NIH 3T3 cells showed p50 and p65 to be predominately cytoplasmic, in agreement with earlier studies (30). Transferring primary Sertoli cells from a defined serum-free media mixture to either DMEM with no supplements or DMEM with 10% serum for 48 h did not significantly alter the levels of nuclear NF-{kappa}B immunostaining (data not shown). These results raised the possibility that Sertoli cells normally retain NF-{kappa}B in the nucleus.



View larger version (122K):
[in this window]
[in a new window]
 
Figure 2. NF-{kappa}B Subunits Localize to the Nuclei of Primary Sertoli Cells

NIH 3T3 cell (3T3, left column) and primary Sertoli cells (right column) were immunostained with preimmune antiserum, p65-specific antisera, or p50-specific antisera as indicated. NF-{kappa}B immunostaining was visualized using a Cy3-conjugated fluorescent second antibody. The immunocytochemistry results shown are representative of three independent experiments.

 
Immunohistochemistry studies were extended to adult rat testis tissue to determine whether NF-{kappa}B proteins localize to the nucleus of testis cells in vivo. Cross-sections from rat testis seminiferous tubules can be designated as containing one of 14 characteristic germinal cell association patterns (I–XIV) or stages of spermatogenesis (31, 32). In the rat these stages repeat in cycles of 12.5 days resulting in the cycle of the seminiferous epithelium. Rat testis tissue sections were probed with NF-{kappa}B p50 and p65 antisera. Both the cytoplasm and the nucleus of Sertoli cells were immunostained by p50 and p65 antisera (Fig. 3Go, A–E). It should be noted that direct comparison of Sertoli cytoplasmic vs. nuclear immunostaining is difficult due to dilution of antigen in the 5-fold larger volume of the cytoplasm that extends from the basement membrane to the tubule lumen. Immunostaining of the Sertoli cell cytoplasm surrounding the germ cells was not noticeably different in the various cell association stages; however, the staining of Sertoli cell nuclei along the basement membrane of seminiferous tubules varied in a stage-specific manner. Immunostained Sertoli nuclei could be detected in all cell association stages, but nuclear NF-{kappa}B levels were elevated in spermatogenesis stages XIV–VII. In contrast, spermatocyte germ cells show a stage-specific pattern of p50 and p65 nuclear localization with peak immunostaining during stages VII–XI. NF-{kappa}B p50 and p65 are also present in early spermatid nuclei during stages I–III immediately after spermatocytes undergo meiosis. In some cases lower levels of p50 immunostaining are seen as late as stage VII spermatids, but p50 and p65 are not detected in more mature spermatids. This pattern of staining indicates that NF-{kappa}B proteins are not present in the nuclei of less mature leptotene and zygotene spermatocytes but are initially expressed in the nucleus during the pachytene stage of spermatocyte development. A summary of the relative levels of p65 immunostaining (quantitation of p50 immunostaining was very similar to p65) in Sertoli and spermatocyte nuclei at each stage of spermatogenesis is provided in Fig. 4Go.



View larger version (163K):
[in this window]
[in a new window]
 
Figure 3. NF-{kappa}B Subunits Localize in a Stage-Specific Manner to Sertoli Cell and Germ Cell Nuclei in Adult Rat Testes

Paraffin-embedded adult testis sections were immunostained with preimmune antisera (A) or antisera against the p50 subunit (B and D) or the p65 subunit (C and E) of NF-{kappa}B. Panels D and E are higher magnification views from panels B and C, respectively. The brown staining is indicative of the immune avidin-biotin complex; nuclei have been counterstained blue with hematoxylin. Cell association stages are shown with Roman numerals. S, Sertoli cell nucleus; L, leptotene spermatocyte; P, pachytene spermatocyte; Sd, spermatid. An explanation of techniques used to quantitate the relative immunostaining intensity of nuclei is provided in Materials and Methods. The immunostaining experiments were performed at least four times.

 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Summary of NF-{kappa}B Immunoactivity in Testis Tissue Sertoli and Spermatocyte Cells

The relative levels of NF-{kappa}B p65 immunostaining in Sertoli (solid squares) and spermatocyte (open circles) nuclei are shown for each stage of spermatogenesis (germ cell association stages I–XIV; note that data for stages II and III are combined) during the 12-day cycles of germ cell development. An explanation of techniques used to quantitate the relative immunostaining intensity of nuclei is provided in Materials and Methods. Immunostaining intensity levels are given as arbitrary units relative to the mean immunostaining of stage I Sertoli nuclei (=100%). Three independent experiments were used to generate the values shown.

 
TNF-{alpha} and Phorbol 12-Myristate 13-Acetate (PMA) Induce NF-{kappa}B-Binding Activity in Sertoli Cell Nuclei
The stage-specific increases in NF-{kappa}B p50 and p65 subunit localization to Sertoli and spermatocyte nuclei suggested that nuclear accumulation of NF-{kappa}B subunits could be induced in response to appropriate signals. One candidate inducer of NF-{kappa}B in the testis is TNF-{alpha}, which has been found to be secreted from spermatids in a spermatogenesis stage-specific manner (11) and to induce gene expression in Sertoli cells (33). Addition of TNF-{alpha} to Sertoli cells resulted in a dramatic increase (13.5-fold) in nuclear NF-{kappa}B-binding activity within 0.5 h that declined slightly after 2 and 6 h (12.5- and 8-fold above nontreated levels, respectively) (Fig. 5Go). NF-{kappa}B binding activity rose again to 10.5-fold higher than basal levels after 12 h of TNF-{alpha} stimulation and declined thereafter. The membrane-permeable NF-{kappa}B activator PMA was also able to increase nuclear NF-{kappa}B binding activity 6.5-fold after 0.5 h of treatment with levels decreasing after 24 h of stimulation to 3.5-fold above the basal condition. Together, these data suggest that signaling pathways such as that initiated by TNF-{alpha} could induce additional nuclear NF-{kappa}B-binding activity in Sertoli cells.



View larger version (68K):
[in this window]
[in a new window]
 
Figure 5. TNF-{alpha} and PMA Induce NF-{kappa}B DNA-Binding Activity in Sertoli Cells

Nuclear extracts (5 µg) from untreated primary Sertoli cells or cells treated with TNF-{alpha} (20 ng/ml) or PMA (1 nM) for the indicated times were incubated with the consensus {kappa}B probe, and complexes were resolved via PAGE and subjected to autoradiography. B1, B2, and B3 DNA-protein complexes are indicated. Film exposure time for the gel was 3.5 h. The data shown are representative of three experiments.

 
Inducers of cAMP and PKA Increase NF-{kappa}B Binding Activity in Sertoli Cells
FSH is an important regulator of Sertoli cell function and spermatogenesis (1, 2). Among the actions of FSH on Sertoli cells, in vivo, is the cyclical elevation of cAMP and the activation of PKA, a known regulator of NF-{kappa}B (34). The possibility that NF-{kappa}B binding activity is increased by activators of PKA in Sertoli cells was tested in EMSA studies. The {kappa}B enhancer probe was incubated with nuclear extracts from untreated primary Sertoli cells or from primary Sertoli cells stimulated with forskolin for 2 h to raise cAMP and PKA activity. NF-{kappa}B binding activity was increased 4.5-fold after forskolin addition (Fig. 6Go). Treating Sertoli cells with FSH also increased NF-{kappa}B binding activity 2.5-fold with levels peaking 2 h after FSH addition and falling thereafter.



View larger version (70K):
[in this window]
[in a new window]
 
Figure 6. PKA Activators Induce NF-{kappa}B Binding Activity in Sertoli Cells

Nuclear extracts (5 µg) from untreated primary Sertoli cells or cells treated with forskolin and IBMX or FSH and IBMX for the indicated times were incubated with the consensus {kappa}B probe. DNA-protein-binding reactions were resolved via PAGE and subjected to autoradiography. B2 and B3 DNA-protein complexes are indicated. Film exposure time was 30 h (A) and 27 h (B). DNA-protein-binding studies were performed twice.

 
{kappa}B-Mediated Transcription Is Constitutively Stimulated in Sertoli Cells
The transcriptional effects of NF-{kappa}B proteins in testis cells were studied using the {kappa}BLUC expression vector, which contains the tandem {kappa}B enhancer elements of the human immunodeficiency virus-1 (HIV-1) long terminal repeat (LTR) linked to a TATA box minimal promoter driving the luciferase reporter gene. In unstimulated MSC-1 and primary Sertoli cells, {kappa}BLUC activity was at least 50-fold greater than the pGL2LUCBasic parent vector and 6- to 8-fold greater than SV40LUC having the luciferase gene driven by the SV40 promoter (Fig. 7Go). Cotransfection of NF-{kappa}B p50 and p65 expression vectors into MSC-1 and primary Sertoli cells caused a further 3 to 4-fold induction of the {kappa}BLUC reporter gene. Addition of TNF-{alpha} also induced {kappa}BLUC in primary Sertoli cells (3.2-fold, Fig. 7Go) and in MSC-1 cells (5.1-fold, data not shown). In contrast, stimulation of Sertoli cells with FSH or forskolin did not increase {kappa}BLUC activity (data not shown). To determine whether the high basal levels of {kappa}B enhancer-mediated gene expression were due to NF-{kappa}B proteins, an expression vector encoding an amino-terminal deletion mutant of I{kappa}B{alpha} was added to the transfection mixtures. The I{kappa}B{alpha} mutant used is resistant to phosphorylation-mediated degradation and therefore is incapable of releasing NF-{kappa}B (35). Expression of the I{kappa}B{alpha} mutant abolished {kappa}B enhancer-directed transcription in MSC-1 and primary Sertoli cells. The down-regulation of gene expression after sequestration of NF-{kappa}B by the dominant negative I{kappa}B mutant confirmed that free nuclear NF-{kappa}B was responsible for activating transcription through {kappa}B enhancers in Sertoli cells.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. Sertoli Cells Contain Intrinsic Functional Nuclear NF-{kappa}B Activity

MSC-1 and primary Sertoli cells were transiently transfected with luciferase reporter plasmids containing the Rous sarcoma virus LTR (RSVLUC), no promoter (pGL2basic), the SV40 promoter (SV40LUC), or the albumin TATA box linked to two tandem {kappa}B motifs (kBLUC). Reporter plasmids were cotransfected with empty pCMV expression vector or pCMV expression vectors encoding NF-{kappa}B p50 and p65 or I{kappa}B{alpha}{Delta}N (I{kappa}B). TNF-{alpha} (20 ng/ml) or vehicle was added to primary Sertoli cells 16 h before cell harvest. The luciferase activities are expressed relative to RSVLUC (=100%) for each cell type. Data represent the mean and SEM of at least six transfections from three separate experiments. SEM values representing greater than 0.5% of RSVLUC activity are shown.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Spermatogenesis is a complex process requiring precisely timed hormonal and paracrine signals to regulate the genetic pathways responsible for proliferation and differentiation of germ cells. The NF-{kappa}B transcription factor has the capability to respond to a diverse range of stimuli ultimately leading to modified gene expression (15, 23). Because the availability of NF-{kappa}B stimulators such as TNF-{alpha} and PKA are controlled during spermatogenesis in a stage-specific manner (3, 11), we explored the possibility that NF-{kappa}B may be induced in seminiferous tubules during the various stages of germ cell development. Our initial studies revealed that primary Sertoli cells and Sertoli cell lines are unusual in that NF-{kappa}B- binding activity in nuclear extracts was equal to or greater than that present in crude cytoplasmic extracts. Despite the increased nuclear NF-{kappa}B activity, significant levels of NF-{kappa}B were found to be present in the Sertoli cell cytoplasm, and additional NF-{kappa}B activity could be liberated from I{kappa}B by detergent treatment. Compared with primary Sertoli cells, the transformed Sertoli cell lines released less NF-{kappa}B binding activity after detergent treatment. It is possible that the transformed Sertoli cell lines may maintain less NF-{kappa}B in the cytoplasm or are less efficient in the release of NF-{kappa}B from cytoplasmic stores. This hypothesis would be consistent with the finding that the B1 band was only amplified by detergent treatment of primary Sertoli cell cytoplasmic extracts.

DNA binding and immunoprecipitation studies identified NF-{kappa}B p50 and p65 as the most prevalent isoforms of NF-{kappa}B present in the nuclei and cytoplasm of Sertoli cells. Furthermore, immunohistochemical examination of testis tissue showed that NF-{kappa}B p50 and p65 were present in Sertoli nuclei and cytoplasm throughout the spermatogenic cycle. Cytoplasmic staining of NF-{kappa}B did not vary greatly, but nuclear levels fluctuated in a stage-specific manner. Sertoli cell nuclear NF-{kappa}B levels were found to peak in stages XIV–VII and then fall in stages VIII–XIII. The pattern of NF-{kappa}B immunostaining shown throughout the cycle of spermatogenesis demonstrated that Sertoli cells constitutively express nuclear NF-{kappa}B in vivo. Furthermore, the increase in nuclear NF-{kappa}B during stages XIV–VII suggests that additional NF-{kappa}B is made available to potentially regulate stage-specific gene expression in Sertoli cells.

In developing germ cells, nuclear expression of NF-{kappa}B first rose above baseline levels in pachytene spermatocytes during stage IV, peaked during stages VII–XI, and declined to lower levels in stage XII–XIV spermatocytes and the subsequent early spermatid stages I–VII. The decline in NF-{kappa}B p50 and p65 levels in maturing spermatids was not unusual, as the expression of many transcription factors diminish in the later stages of spermatid development when most transcriptional activity ceases (36). The stage-specific elevations in nuclear NF-{kappa}B expression indicated that it may be required for gene induction during these stages of spermatogenesis.

Stimulation of primary Sertoli cells with the NF-{kappa}B activating factors PMA or TNF-{alpha} resulted in the activation of NF-{kappa}B DNA-binding activity. The TNF-{alpha} induction of NF-{kappa}B occurred in a biphasic manner with a dramatic increase in NF-{kappa}B-binding activity within 0.5 h of TNF-{alpha} addition followed by a gradual decrease over 6 h and a subsequent rise and fall of NF-{kappa}B-binding activity at 12 and 24 h. This biphasic pattern of NF-{kappa}B induction mirrored that seen in other systems and has been shown to be due to the different kinetics with which I{kappa}B{alpha} and I{kappa}Bß are degraded and regenerated after TNF-{alpha} or PMA stimulation (37).

Activation of NF-{kappa}B by TNF-{alpha} in Sertoli cells is not unexpected as Sertoli cells express the 55-kDa TNF I receptor (11). However, it may be more significant that round spermatid germ cells secrete TNF-{alpha} in a stage-specific manner and that the increase in nuclear NF-{kappa}B exhibited in stage I–VII Sertoli cells correlates with the presence of round spermatids in the seminiferous tubule (11, 38). Furthermore, nuclear NF-{kappa}B levels are lower during stages VIII–XIII when spermatids are elongating and producing less TNF-{alpha} (11). Although further study is required to confirm a direct link between TNF-{alpha} and NF-{kappa}B activity in Sertoli cells, the TNF-{alpha} paracrine- regulatory system may be an important mechanism by which spermatids signal adjacent Sertoli cells to provide factors required during specific stages of development. In contrast, spermatocytes reportedly do not express receptors for TNF-{alpha} (11), and as suggested by the later peak in nuclear localization, must activate NF-{kappa}B by another pathway.

The FSH-induced PKA activity in Sertoli cells (3) is another candidate regulator of NF-{kappa}B activity in seminiferous tubules. Previous studies have shown that PKA is able to phosphorylate I{kappa}B and initiate the release of NF-{kappa}B to the nucleus (12, 14). FSH induction of Sertoli cell cAMP and PKA is a cyclical process in vivo. cAMP levels begin to rise in stage XII, peak in stages III-V, and then fall to much lower levels during stages VI–XI (34). NF-{kappa}B levels in Sertoli nuclei were also found to rise and fall in a cyclical manner, but the changes in NF-{kappa}B nuclear immunolocalization appear to be slightly delayed (one to two stages) relative to changes in cAMP and PKA levels. Further study will be required to determine whether there is a direct relationship between FSH induction of Sertoli cell-signaling pathways and expression of nuclear NF-{kappa}B in vivo.

PKA has also been shown to directly phosphorylate NF-{kappa}B p65, resulting in increased affinity of p65 for the {kappa}B enhancer sequence and increased transactivation activity (13, 26). As the PKA activators FSH and forskolin increased NF-{kappa}B binding activity in Sertoli cells, an unexpected finding was that these stimuli were unable to induce {kappa}B enhancer-mediated transcription. One explanation for the lack of PKA-inducible transcription seen in cultured Sertoli cells may be the absence of a p65 cofactor. Recently, the PKA activation of {kappa}B enhancer-regulated transcription was shown to be mediated by the functionally conserved transcriptional coactivators, CREB-binding protein and p300 (CBP/p300). PKA phosphorylation of p65 was found to promote association with the coactivators. Furthermore, NF-{kappa}B-mediated transcription was induced by p65-CBP/p300 complexes in a PKA-dependent manner (16). In many cell types CBP/p300 is present in limited quantities, and a number of transcription factors compete for coactivator binding (39). It will be interesting to determine whether the availability of CBP/p300 in Sertoli cells modulates the NF-{kappa}B response to FSH and PKA activation.

The best characterized model of nuclear localized, constitutively activated NF-{kappa}B is the mature B cell. As B cells mature, the levels of nuclear p50 and c-Rel increase. The mechanisms underlying the constitutive NF-{kappa}B activation in B cells is not yet fully understood, but recent studies suggest three possible explanations, including an increase in I{kappa}B{alpha} turnover (40), a decrease in I{kappa}Bß levels (41), and/or an increase in a hypophosphorylated form of I{kappa} that acts to prevent I{kappa}B{alpha} interaction with NF-{kappa}B subunits and does not interfere with nuclear translocation (42). Although adult Sertoli cells are similar to mature B cells in that they are terminally differentiated, it remains to be determined whether Sertoli cells use similar mechanisms to maintain NF-{kappa}B in the nucleus and whether these mechanisms are developmentally controlled.

The presence of preexisting nuclear NF-{kappa}B proteins in Sertoli cells and their functional activity was shown in Sertoli cell transfection studies. The potent transcriptional enhancement mediated by the two tandem {kappa}B repeats demonstrated that NF-{kappa}B proteins are primed to activate transcription in untreated Sertoli cells. Down-regulation of gene expression after addition of a degradation-resistant form of I{kappa}B confirmed that NF-{kappa}B proteins were responsible for the high basal levels of {kappa}B-enhancer-mediated transcription. The potential for additional gene induction in response to activators of NF-{kappa}B was shown by the further stimulation of gene activity in Sertoli cells treated with TNF-{alpha}.

Although these studies point out the potential for NF-{kappa}B regulation of gene expression in Sertoli cells, it will be important to identify the genes modulated by NF-{kappa}B and understand their regulation. Potential targets for NF-{kappa}B regulation include the androgen receptor gene, which is required to mediate testosterone effects in the testis, and the urokinase gene, which is needed for the constant tissue remodeling performed during spermatogenesis. Both of these genes have been shown to be regulated by NF-{kappa}B in other tissues (18, 19, 20). In our studies we have noted that the CREB transcription factor promoter, which transmits signals received from the FSH-cAMP-PKA pathway (43), also contains four putative {kappa}B enhancer motifs (our unpublished data). A computer-assisted sequence analysis of 10 spermatogenesis-regulating genes expressed by Sertoli cells revealed 5 that contained consensus {kappa}B enhancer motifs within their 5'-regulatory regions [gene sequences studied included the FSH receptor, androgen binding protein (ABP), Mullerian inhibiting substance (MIS), transferrin, TNF-{alpha} receptor I, c-mos, Hox 1.4, inhibin {alpha}, inhibin/actin ßB chain, and stem cell factor]. The mouse MIS and stem cell factor, as well as the rat inhibin {alpha}, inhibin/actin ß B chain, and ABP genes, were all found to have putative NF-{kappa}B-binding sites within 120-1250 bp of their transcription initiation sites. Due to the large number of genes that are potentially regulated by NF-{kappa}B, further investigation into the mechanisms activating NF-{kappa}B in Sertoli cells appears to be warranted.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Isolation of Primary Sertoli Cells and Cell Culture
Sertoli cells were isolated from 16-day-old Sprague-Dawley rats as described previously (43). Decapsulated testes were digested with collagenase (0.5 mg/ml, 33 C, 12 min) in enriched Krebs-Ringer bicarbonate media (EKRB) (44), followed by three washes in EKRB (1 x g, 3 min) to isolate seminiferous tubules. Tubules were digested with trypsin (0.5 mg/ml, 33 C, 12 min), and cell aggregates were passed repeatedly through a drawn-out Pasteur pipette. An equal volume of DMEM containing 10% FCS was added to the Sertoli cells, which were then pelleted (500 x g, 5 min) and resuspended in serum-free media containing 50% DMEM, 50% Ham’s F12, 5 µg/ml insulin, 5 µg/ml transferrin, 10-6 M retinoic acid, 10 ng/ml epidermal growth factor, 3 µg/ml cytosine ß-D-arabinofurano-sidase, 2 mM glutamine, 1 mM sodium pyruvate, 100 U/ml penicillin, and 100 µg/ml streptomycin. Sertoli cells were cultured on matrigel (Collaborative Research, Bedford, MA)-coated dishes (32 C, 5% CO2). Sertoli cells were routinely >95% pure as determined by phase microscopy and alkaline phosphatase staining (45). NIH 3T3 cells and mouse MSC-1 and TM4 Sertoli cells were cultured in DMEM supplemented with 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM glutamine (46, 47, 48, 49). In some cases, cells were also cultured in the presence of forskolin (10 µM) and isobutylmethylxanthine (IBMX) (0.5 mM), PMA (1 nM), or TNF-{alpha} (20 ng/ml). Animals used in these studies were maintained and killed according to the principles and procedures described in the NIH Guide for the Care and Use of Laboratory Animals.

Protein Extract Preparation
Nuclear and cytoplasmic extracts were prepared by detergent lysis (50). Cells were lysed by incubation in buffer A [10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol (DTT), 0.5 mM phenylmethylsulfonylfluoride (PMSF), and a protease cocktail consisting of 0.5 ng/ml pepstatin A, and 5 ng/ml each of leupeptin, antipain, soybean trypsin inhibitor, and aprotinin] for 15 min on ice followed by the addition of 0.06% Nonidet P40. Cells were vortexed for 10 sec, and nuclei were collected by centrifugation (12,000 x g, 30 sec). The supernatant containing cytoplasmic proteins was removed and frozen in 20% glycerol. To prepare nuclear extracts, pelleted nuclei were washed once with buffer A and resuspended in buffer C (20 mM HEPES, pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 20% glycerol, and the protease cocktail used for buffer A). Cells were mixed vigorously on a shaking platform (4 C, 15 min), the cell debris pellet was removed after centrifugation (5 min 12,000 x g), and the supernatant containing nuclear proteins was frozen. Protein concentrations were determined by the Bradford method using the Bio-Rad protein assay.

DNA-Protein-Binding Assays
32P-Radiolabeled DNA probes were generated by annealing a 27- nucleotide template containing a consensus {kappa}B enhancer element (5'-CGACACCCCTCGGGAATTCCCC-CACTGGG-CC-3') to a complementary 10-base primer and then filling in the overhang with Klenow in the presence of [{alpha}-32P]dATP and 5 mM dCTP, dGTP, dTTP, and 5-bromo-2-deoxyuridine 5-triphosphate. EMSAs were performed as described (51). Briefly, 32P-labeled {kappa}B probe was incubated with 2–10 µg of nuclear, cytoplasmic, or whole-cell extracts from either COS-1 cells, TM4 or MSC-1 Sertoli cell lines, or 16-day rat primary Sertoli cell cultures. Binding reactions were incubated 15 min at room temperature in the presence of 1 µg poly(dI-dC), 250 ng BSA, 5 mM DTT, 50–100 mM NaCl or KCl, 20 mM HEPES, and 1 mM EDTA. For competition EMSAs, a 50-fold excess of double-stranded unlabeled competitor oligonucleotides including a Sp1-binding site (GCTGCCTGTGGCCCGGGCGGCTGGGAGAAGCGG), a CRE motif (GATCCGGCTGACGTCATCAAGCTAGATC), or the unlabeled {kappa}B probe were coincubated with labeled {kappa}B probe and nuclear extracts. Protein-DNA complexes were resolved via PAGE under nondenaturing conditions in a Tris/borate/EDTA buffer. In binding reactions involving detergent treatment to release NF-{kappa}B proteins from I{kappa}B, proteins were preincubated with 0.5% DOC for 10 min followed by the addition of 1% Nonidet P40 (NP40) immediately before addition of the radiolabeled probe. To quantitate the relative levels of DNA-protein complexes, autoradiograms were digitized on a flatbed scanner, and NIH Image (version 1.57) analysis software was used to measure the intensity of individual bands. Values for fold induction of binding activity were determined relative to the binding activity (band intensity) of the nuclear extracts for each cell type (Fig. 1Go) or the untreated (0 h) control extracts (Figs. 5Go and 6Go), and the mean fold induction was calculated from two (Fig. 6Go) or three (Figs. 1Go and 5Go) independent experiments.

In Situ UV Cross-Linking and Immunoprecipitation Assays
DNA/protein binding reactions were performed as described (51). For in situ UV cross-linking studies, DNA-protein complexes resolved via 5% nondenaturing PAGE were UV irradiated in situ for 15 min at 302 nm using a TMW-20 transilluminator. DNA-protein adducts were excised from the gel resolved by denaturing discontinuous SDS-PAGE and visualized by autoradiography. For immunoprecipitation experiments, primary Sertoli cells were cultured for 1 h in methionine- and cysteine-deficient, serum-free DMEM and a further 2 h after the addition of 35S-labeleled methionine and cysteine. Cells were washed twice with PBS and lysed in 1 ml RIPA buffer (150 mM NaCl, 10 mM Tris (pH 7.5), 0.1% SDS, 1% DOC, 1% NP40, 1 mM PMSF, and protease inhibitor cocktail). Extracts from approximately 2 x 108 cells were incubated with preimmune antisera or antisera directed against the 21 amino-terminal amino acids of p50 or p65 and precipitated using protein A Sepharose. Immunoprecipitated proteins were fractionated by SDS-PAGE and visualized by fluorography.

Immunocytochemistry
Immunostaining was performed on paraffin-embedded sections (5 µm) from Bouin’s fixed adult rat testis or primary Sertoli cells or NIH 3T3 cells cultured on glass coverslips. Testis sections were deparaffinized in xylene, rehydrated, and then permeabilized for 1 min in cold 100% methanol. The sections were microwaved on high power for 20 min in citrate buffer (10 mM citrate, 30 mM NaCl, pH 5.5) and then left undisturbed at room temperature for 20 min (52). The sections were washed two times for 5 min in PBS and blocked for 12 h in normal goat serum, 0.5% BSA, and 0.15% glycine at 4 C. Cultured cells were fixed in 4% paraformaldehyde for 5 min, permeablized for 1 min in ice-cold 100% MeOH, and dried completely followed by blocking 4–24 h with normal goat serum, 0.5% BSA, and 0.15% glycine. The testis tissue or cultured cells were then incubated 12–24 h with preimmune serum or rabbit polyclonal antiserum directed against the amino-terminal 21 amino acids of NF-{kappa}B p65 or NF-{kappa}B p50. For cultured cells, fluorescent Cy3 secondary goat anti-rabbit antiserum was added. For tissue sections, anti-rabbit biotinylated secondary antibody (Vectastain Elite ABC Kit, Vector Laboratories, Burlingame, CA) was added, and bound antibodies were detected as described by the kit instructions using AEC staining solution (0.02%, 3-amino-9-ethylcarbazole, 5% N,N-dimethyl formamide, 0.015% H2O2, and 0.1 M sodium acetate, pH 5.0) as the colorimetric reagent. Slides were washed in H2O and counterstained with hematoxylin. A charged coupled device (CCD) video camera system (Optronics, Chelmsford, MA) was used to capture images of stained cells or tubule cross-sections. The quantitation of the relative staining intensities of seminiferous tubule nuclei by p65 and p50 antisera was accomplished using BioQuant image analysis software (R & M Biometrics, Inc., Nashville, TN). Immunostained slides of adult rat testis tissue regularly contained at least 300 seminiferous tubule cross-sections. Testis tissue sections from three adult rats were used to quantitate relative nuclear immunostaining with one representative slide used from each animal. The testis tissue sections regularly contained at least 300 seminiferous tubule cross-sections. Sertoli cell and spermatocyte nuclei to be analyzed were chosen from the same tubules. At least five seminiferous tubule cross-sections representing each of the 14 (I–XIV) stages of spermatogenesis were chosen for quantitation from each slide. For each slide, threshold windows of red, green, and blue color values were set within the BioQuant image analysis program to distinguish only the red-brown staining of nuclei due to the AEC precipitate. Five of the stained nuclei from each tubule cross-section, as identified by the image analysis software, were randomly chosen and the immunostain within each nucleus was measured by a integrated optical density method that measures the intensity and density of pixels within an object as a function of object size. The mean integrated optical densities of nuclei in each stage was calculated (n >= 25) and arbitrarily normalized to the mean value determined for stage I Sertoli nuclei (stage I = 100%). The mean normalized nuclear immunostaining intensities from the three independent experiments were determined to give the final relative immunostaining intensities.

Plasmid Constructs, Transfections, and Luciferase Assays
COS-1 cells were transfected with NF-{kappa}B expression vectors by using diethylaminoethyl-dextran, and whole-cell lysates were prepared after 48 h (53). For transient reporter transfections, the {kappa}BLUC vector was constructed by inserting a 200-bp PvuII-XhoI fragment from {kappa}B-TATA-CAT (containing two tandem {kappa}B enhancer elements derived from the HIV-1 LTR linked to the albumen gene TATA element) (54) into the SmaI-XhoI sites directly upstream of the luciferase gene in the pGL2-Basic vector (Promega, Madison, WI). SV40LUC is the pGL2-Promoter plasmid (Promega) containing the SV40 promoter upstream of the luciferase gene in the pGL2Basic backbone. The RSVLUC plasmid is pA3RSV400LUC containing the enhancer and promoter of the 3'-LTR of Rous sarcoma virus (55). NF-{kappa}B expression vectors contain cDNAs for NF-{kappa}B p50 (56) and p65 (57) positioned downstream of the cytomegalovirus (CMV) promoter/enhancer in the pCMV4 and pCMV5 expression vectors (58, 59) (pCMV4p50 (53) and pCMV5p65, respectively (60)). The I{kappa}B deletion mutant cDNA I{kappa}B{alpha}{Delta}N containing sequences encoding amino acids 37–317 of I{kappa}B{alpha} was inserted into the pCMV4 expression vector (35). Primary Sertoli cells and MSC-1 cells were transfected as described (43) using 1 µg of luciferase reporter plasmid and 1 µg of empty pCMV expression vector or 1 µg of pCMV expression vectors encoding p50 and p65 or I{kappa}B{alpha}{Delta}N in the absence or presence of 20 ng/ml TNF-{alpha}. Luciferase assays were performed using a luminometer and the Promega luciferase assay system. Luciferase activity of the extracts was normalized for protein activity as determined by Bradford assay.


    ACKNOWLEDGMENTS
 
We are indebted to Drs. Tony Zeleznik, Tony Plant, and Dean Ballard for critical suggestions regarding the manuscript. We wish to thank Donna Olejniczak, Nina Gram-Humphry, and Charity Fix for expert technical assistance; Drs. Dean Ballard and Stefan Dorre for NF-{kappa}B antisera, as well as NF-{kappa}B and I{kappa}B{alpha}{Delta}N expression vectors; and Barbara Sanborn for providing the MSC-1 cell line. We also are grateful for access to imaging equipment and expertise provided by Drs. Simon Watkins, Director of the University of Pittsburgh Center for Biological Imaging, and Robert Gibbs, Director of the Cell Imaging Core of the Center for Research in Reproductive Physiology (P-30HD08610).


    FOOTNOTES
 
Address requests for reprints to: William H. Walker, S333 Biomedical Science Tower, Department of Cell Biology and Physiology, University of Pittsburgh, Pittsburgh, Pennsylvania, 15261. E-mail: walkerw+{at}pitt.edu

This work was supported by NIH Grant R29-HD-34913.

Received for publication December 5, 1997. Revision received June 29, 1998. Accepted for publication August 7, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Sharpe RM 1994 Regulation of spermatogenesis. In: Knobil E, Neil JD (eds) The Physiology of Reproduction. Raven Press, New York, pp 1363–1434
  2. De Kretser DM, Risbridger GP, Kerr J 1995 Basic endocrinology of the testis. In: DeGroot L (ed) Endocrinology. W. B. Saunders, Philadelphia, pp 2307–2335
  3. Steinberger A, Hintz M, Heindel J 1978 Changes in cAMP responses to FSH in isolated rat Sertoli cells during sexual maturation. Biol Reprod 19:566–572[Abstract]
  4. Griswold MD 1993 Actions of FSH on mammalian Sertoli cells. In: Russell LD, Griswold MD (eds) The Sertoli Cell. Cache River Press, Clearwater, FL, pp 493–508
  5. Kishimoto T, Akira S, Taga T 1992 Interleukin-6 and its receptor: a paradigm for cytokines. Science 258:593–597[Abstract/Free Full Text]
  6. Okuda Y, Xiao-Rong S, Morris P 1994 Interleukin-6 (IL-6) mRNAs expressed in Leydig and Sertoli cells are regulated by cytokines, gonadotropins and neuropeptides. Endocrine 2:617–624
  7. Okuda Y, Morris P 1994 Identification of interleukin-6 receptor (IL-6R) mRNA in isolated Sertoli and Leydig cells: regulation by gonadotropin and interleukins in vitro. Endocrine 2:1163–1168
  8. Syed V, Gerard N, Kaipia A, Bardin CW, Parvinen M, Jegou B 1993 Identification, ontogeny, and regulation of an interleukin-6-like factor in the rat seminiferous tubule. Endocrinology 132:293–299[Abstract/Free Full Text]
  9. Gerard N, Syed V, Bardin W, Genetet N, Jegou B 1991 Sertoli cells are the site of interleukin-1 alpha synthesis in rat testis. Mol Cell Endocrinol 82:R13–R16
  10. Boockfor FR, Schwarz LK 1991 Effects of interleukin-6, interleukin-2, and tumor necrosis factor alpha on transferrin release from Sertoli cells in culture. Endocrinology 129:256–262[Abstract/Free Full Text]
  11. De SK, Chen H-L, Pace JLH, Hunt JS, Terranova PF, Enders GC 1993 Expression of tumor necrosis factor-{alpha} in mouse spermatogenic cells. Endocrinology 133:389–396[Abstract/Free Full Text]
  12. Shirakawa F, Mizel S 1989 In vitro activation and nuclear translocation of NF-{kappa}B catalyzed cyclic AMP-dependent protein kinase and protein kinase C. Mol Cell Biol 9:2424–2430[Abstract/Free Full Text]
  13. Zhong H, SuYang H, Erdjument-Bromage H, Tempst P, Ghosh S 1997 The transcriptional activity of NF-{kappa}B is regulated by the I{kappa}B-associated PKAc subunit through a cyclic AMP-independent mechanism. Cell 89:413–424[CrossRef][Medline]
  14. Ghosh S, Baltimore D 1990 Activation in vitro of NF-{kappa}B by phosphorylation of its inhibitor I{kappa}B. Nature 344:678–682[CrossRef][Medline]
  15. Siebenlist U, Franzoso G, Brown K 1994 Structure, regulation, and function of NF-{kappa}B. Annu Rev Cell Biol 10:405–455[CrossRef]
  16. Zhong H, Voll RE, Ghosh S 1998 Phosphorylation of NF-{kappa}B by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300. Mol Cell 1:661–671[CrossRef][Medline]
  17. Rattner A, Korner M, Rosen H, Baeuerle P, Citri Y 1991 Nuclear factor {kappa}B activates proenkephalin transcription in T lymphocytes. Mol Cell Biol 11:1017–1022[Abstract/Free Full Text]
  18. Hansen SK, Nerlov C, Zabel U, Verde P, Johnsen M, Baeuerle PA, Blasi F 1992 A novel complex between the p65 subunit of NF-{kappa}B and c-Rel binds to a DNA element involved in the phorbol ester induction of the human urokinase gene. EMBO J 11:205–213[Medline]
  19. Novak U, Cocks G, Hamilton JA 1991 A labile repressor acts through the NF-{kappa}B-like binding sites of the human urokinase gene. Nucleic Acids Res 19:3389–3393[Abstract/Free Full Text]
  20. Supakar PC, Jung MH, Song CS, Chatterjee B, Roy AK 1995 Nuclear factor {kappa}B functions as a negative regulator for the rat androgen receptor gene and NF-{kappa}B activity increases during the age-dependent desensitization of the liver. J Biol Chem 270:837–842[Abstract/Free Full Text]
  21. Collart MA, Baeuerle P, Vassalli P 1990 Regulation of tumor necrosis alpha transcription in macrophages: involvement of four {kappa}B-like motifs and of constitutive and inducible forms of NF-{kappa}B. Mol Cell Biol 10:1498–1506[Abstract/Free Full Text]
  22. Drouet C, Shakhov AN, Jongeneel CV 1991 Enhancers and transcription factors controlling the inducibility of tumor necrosis factor-{alpha} promoter in primary macrophages. J Immunol 147:1694–1700[Abstract]
  23. Baeuerle PA, Henkel T 1994 Function and activation of NF-{kappa}B in the immune system. Annu Rev Immunol 12:141–179[Medline]
  24. Baldwin AS 1996 The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Annu Rev Immunol 14:649–681[CrossRef][Medline]
  25. Verma IM, Stevenson JK, Scwartz EM, Van Antwerp D, Miyamoto S 1995 Rel/NF-{kappa}B/I{kappa}B family: intimate tales of association and dissociation. Genes Dev 9:2723–2735[Free Full Text]
  26. Naumann M, Scheidereit C 1994 Activation of NF-{kappa}B in vivo is regulated by multiple phosphorylations. EMBO J 13:4597–4607[Medline]
  27. Chen D, Rothberg EV 1994 Interleukin 2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles. J Exp Med 179:931–942[Abstract/Free Full Text]
  28. Baeuerle PA, Baltimore D 1988 Activation of DNA-binding activity in an apparently cytoplasmic precursor of the NF-{kappa}B transcription factor. Cell 53:211–217[CrossRef][Medline]
  29. Moliter JA, Walker WH, Doerre S, Ballard DW, CGW 1990 NF-{kappa}B: a family of inducible and differentially expressed enhancer-binding proteins in human T cells. Proc Natl Acad Sci USA 87:10028–10032[Abstract/Free Full Text]
  30. Li S, Sedivy JM 1993 Raf-1 protein kinase activates the NF-{kappa}B transcription factor by dissociating the cytoplasmic NF-{kappa}B-I{kappa}B complex. Proc Natl Acad Sci 90:9247–9251[Abstract/Free Full Text]
  31. Leblond CP, Clermont Y 1952 Definition of the stages of the cycle of the seminiferous epithelium in the rat. Ann NY Acad Sci 55:548–573
  32. Perey B, Cleremont Y, Leblond CP 1961 The wave of the seminiferous epithelium in the rat. Am J Anat 108:47–77[CrossRef]
  33. Nehar D, Mauduit C, Boussouar F, Benahmed M 1997 Tumor necrosis factor-{alpha}-stimulated lactate production is linked to lactate dehydrogenase A expression and activity increase in porcine cultured Sertoli cells. Endocrinology 138:1964–1971[Abstract/Free Full Text]
  34. Kangasniemi M, Kaipia A, Mali P, Toppari J, Huhtaniemi I, Parvinen M 1990 Modulation of basal and FSH-dependent cyclic AMP production in rat seminiferous tubules staged by an improved transillumination technique. Anat Rec 227:62–76[CrossRef][Medline]
  35. Brockman JA, Scherer DC, McKinsey TA, Hall SM, Qi X, Lee WY, Ballard DW 1995 Coupling of a signal response domain in I{kappa}B{alpha} to multiple pathways for NF-{kappa}B. Mol Cell Biol 15:2809–2818[Abstract]
  36. Erickson RP 1990 Post-meiotic gene expression. Trends Genet 6:264–269[CrossRef][Medline]
  37. Thompson JE, Phillips RJ, Erdjument-Bromage H, Tempst P, Ghosh S 1995 I{kappa}B-ß regulates the persistent response in a biphasic activation of NF-{kappa}B. Cell 80:573–582[CrossRef][Medline]
  38. Mauduit C, Besset V, Caussanel V, Benahmed M 1996 Tumor necrosis factor {alpha} receptor p55 is under hormonal (follicle stimulating hormone) control in testicular Sertoli cells. Biochem Biophys Res Commun 224:631–637[CrossRef][Medline]
  39. Kamei Y, Xu L, TH, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414[CrossRef][Medline]
  40. Miyamato SP, Chiao PJ, Verma IM 1994 Enhanced degradation is responsible for constitutive NF-{kappa}B activity in mature murine B-cell lines. Mol Cell Biol 14:3276–3282[Abstract/Free Full Text]
  41. Kistler B, Rolink A, Marienfield R, Neumann M, Wirth T 1998 Induction of nuclear factor-{kappa}B during primary B cell differentiation. J Immunol 160:2308–2317[Abstract/Free Full Text]
  42. Suyang H, Phillips R, Douglas I, Ghosh S 1996 Role of unphosphorylated, newly synthesized I{kappa}Bß in the persistent activation of NF-{kappa}B. Mol Cell Biol 16:5444–5449[Abstract]
  43. Walker WH, Fucci L, Habener JF 1995 Expression of the gene encoding transcription factor adenosine 3',5'-monophosphate (cAMP) response element-binding protein: regulation by follicle-stimulating hormone-induced cAMP signaling in primary rat Sertoli cells. Endocrinology 136:3534–3545[Abstract]
  44. Bellvé AR, Millette CF, Bhatnagar YM, O’Brien DA 1977 Dissociation of the mouse testis and characterization of isolated spermatogenic cells. J Histochem Cytochem 25:480–494[Medline]
  45. Chapin RE, Phelps JL, Miller BE, Gary TJB 1987 Alkaline phosphatase histochemistry discriminates peritubular cells in primary rat testicular cell culture. J Androl 8:155–161[Abstract/Free Full Text]
  46. McGuinness M, Linder CC, Morales CR, Heckert LL, Pikus J, Griswold MD 1994 Relationship of a mouse Sertoli cell line (MSC-1) to normal Sertoli cells. Biol Reprod 51:116–124[Abstract]
  47. Peschon JJ, Behringer RR, Cate RI, Harwood KA, Idzerda RI, Brinster RI, Palmiter RD 1992 Directed expression of an oncogene to Sertoli cells in transgenic mice using Mullerian inhibiting substance regulatory sequences. Mol Endocrinol 61:1403–1411
  48. Mather JP 1980 Establishment and characterization of two distinct mouse testicular epithelial cell lines. Biol Reprod 23:243–252[Abstract]
  49. Hofmann M-C, Narisawa S, Hess RA, Millian JL 1992 Immortalization of germ cells and somatic testicular cells using the SV40 large T antigen. Exp Cell Res 201:417–435[CrossRef][Medline]
  50. Schreiber E, Matthias P, Muller MM, Schaffner W 1989 Rapid detection of octomer binding proteins with miniextracts prepared from a small number of cells. Nucleic Acids Res 17:6419[Free Full Text]
  51. Ballard DW, Walker WH, Doerre S, Sista P, Molitor JA, Dixon EP, Peffer NJ, Hannink M, Greene WC 1990 The v-rel oncogene encodes a {kappa}B enhancer binding protein that inhibits NF-{kappa}B function. Cell 63:803–814[CrossRef][Medline]
  52. Majdic G, McNeilly AS, Sharpe RM, Evens LR, Groome NP, KSPT 1997 Testicular expression of inhibin and activin subunits and follistatin in the rat and human fetus and neonate during postnatal development in the rat. Endocrinology 138:2136–2147[Abstract/Free Full Text]
  53. Walker WH, Stein B, Ganchi PA, Hoffman JA, Kaufman PA, Ballard DW, Hannink M, Greene WC 1992 The v-rel oncogene: insights into the mechanism of transcriptional activation, repression, and transformation. J Virol 66:5018–5029[Abstract/Free Full Text]
  54. Stein B, Rahmsdorf HJ, Steffen A, Litfin M, Herrlich P 1989 UV-induced DNA damage is an intermediate step in UV-induced expression of human immunodeficiency virus type 1, collagenase, c-fos, and metallothionein. Mol Cell Biol 9:5169–5181[Abstract/Free Full Text]
  55. Wood WM, Kao MY, Gordon DF, Ridgeway EC 1989 Thyroid hormone regulates the mouse thyrotropin ß-subunit gene promoter in transfected primary thyrotropes. J Biol Chem 264:14840–14847[Abstract/Free Full Text]
  56. Kieran M, Blank V, Logeat J, Vandekerckhove J, Lottspeich F, Le Bail O, Urban MB, Kourilsky P, Baeuerle PA, Israel A 1990 The DNA binding subunit of NF-{kappa}B is identical to factor KBF1 and homologous to the rel oncogene product. Cell 62:1007–1018[CrossRef][Medline]
  57. Nolan GP, Ghosh S, Liou H-C, Tempst P, Baltimore D 1991 DNA binding and I{kappa}B inhibition of the cloned p65 subunit of NF-{kappa}B, a rel-related polypeptide. Cell 64:961–969[CrossRef][Medline]
  58. Andersson SD, Davis D, Dahlback H, Jornvall H, Russell DW 1989 Cloning, structure, and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme. J Biol Chem 264:822–829
  59. Chen WJ, Andres DA, Goldstein JL, Russell DW, Brown MS 1991 cDNA cloning and expression of the peptide-binding beta subunit of rat p21ras farnesyltransferase, the counterpart of yeast DPR1/RAM1. Cell 66:327–334[CrossRef][Medline]
  60. Ballard DW, Dixon EP, Peffer NJ, Bogerd H, Doerre S, Stein B, Greene WC 1992 The 65 kDa subunit of NF-{kappa}B functions as a potent transcriptional activator and a target for v-Rel-mediated repression. Proc Natl Acad Sci USA 89:1875–1879[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
J. Cheng, S. C. Watkins, and W. H. Walker
Testosterone Activates Mitogen-Activated Protein Kinase via Src Kinase and the Epidermal Growth Factor Receptor in Sertoli Cells
Endocrinology, May 1, 2007; 148(5): 2066 - 2074.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P.-L. Yao, Y.-C. Lin, P. Sawhney, and J. H. Richburg
Transcriptional Regulation of FasL Expression and Participation of sTNF-{alpha} in Response to Sertoli Cell Injury
J. Biol. Chem., February 23, 2007; 282(8): 5420 - 5431.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. J. Rasoulpour and K. Boekelheide
NF-kappaB Activation Elicited by Ionizing Radiation Is Proapoptotic in Testis
Biol Reprod, February 1, 2007; 76(2): 279 - 285.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D.-S. Son and K. F. Roby
Interleukin-1{alpha}-Induced Chemokines in Mouse Granulosa Cells: Impact on Keratinocyte Chemoattractant Chemokine, a CXC Subfamily
Mol. Endocrinol., November 1, 2006; 20(11): 2999 - 3013.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
W. H Walker and J. Cheng
FSH and testosterone signaling in Sertoli cells
Reproduction, July 1, 2005; 130(1): 15 - 28.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
J.P. Dadoune, A. Pawlak, M.F. Alfonsi, and J.P. Siffroi
Identification of transcripts by macroarrays, RT-PCR and in situ hybridization in human ejaculate spermatozoa
Mol. Hum. Reprod., February 1, 2005; 11(2): 133 - 140.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. J. Rasoulpour and K. Boekelheide
NF-{kappa}B Is Activated in the Rat Testis Following Exposure to Mono-(2-Ethylhexyl) Phthalate
Biol Reprod, February 1, 2005; 72(2): 479 - 486.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Scobey, C. A. Fix, and W. H. Walker
The Id2 Transcriptional Repressor Is Induced by Follicle-stimulating Hormone and cAMP
J. Biol. Chem., April 16, 2004; 279(16): 16064 - 16070.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Zhang, M. Charron, W. W. Wright, B. Chatterjee, C. S. Song, A. K. Roy, and T. R. Brown
Nuclear Factor-{kappa}B Activates Transcription of the Androgen Receptor Gene in Sertoli Cells Isolated from Testes of Adult Rats
Endocrinology, February 1, 2004; 145(2): 781 - 789.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Y. Hong, J. H. Park, K. H. Seo, J.-M. Kim, S. Y. Im, J. W. Lee, H.-S. Choi, and K. Lee
Expression of MIS in the Testis Is Downregulated by Tumor Necrosis Factor Alpha through the Negative Regulation of SF-1 Transactivation by NF-{kappa}B
Mol. Cell. Biol., September 1, 2003; 23(17): 6000 - 6012.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. Lukas-Croisier, C. Lasala, J. Nicaud, P. Bedecarras, T. R. Kumar, M. Dutertre, M. M. Matzuk, J.-Y. Picard, N. Josso, and R. Rey
Follicle-Stimulating Hormone Increases Testicular Anti-Mullerian Hormone (AMH) Production through Sertoli Cell Proliferation and a Nonclassical Cyclic Adenosine 5'-Monophosphate-Mediated Activation of the AMH Gene
Mol. Endocrinol., April 1, 2003; 17(4): 550 - 561.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
L. M. Budde, C. Wu, C. Tilman, I. Douglas, and S. Ghosh
Regulation of Ikappa Bbeta Expression in Testis
Mol. Biol. Cell, December 1, 2002; 13(12): 4179 - 4194.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Wang, S. Chan, and B. K. Tsang
Involvement of Inhibitory Nuclear Factor-{kappa}B (NF{kappa}B)-Independent NF{kappa}B Activation in the Gonadotropic Regulation of X-Linked Inhibitor of Apoptosis Expression during Ovarian Follicular Development in Vitro
Endocrinology, July 1, 2002; 143(7): 2732 - 2740.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Mitsiades, C. S. Mitsiades, V. Poulaki, D. Chauhan, P. G. Richardson, T. Hideshima, N. Munshi, S. P. Treon, and K. C. Anderson
Biologic sequelae of nuclear factor-kappa B blockade in multiple myeloma: therapeutic applications
Blood, May 13, 2002; 99(11): 4079 - 4086.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Sassone-Corsi
Editorial: Never Enough--On the Multiplicity and Uniqueness of Transcriptional Regulators in Postmeiotic Male Germ Cells
Endocrinology, May 1, 2002; 143(5): 1575 - 1577.
[Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. A. Shell, C. Fix, D. Olejniczak, N. Gram-Humphrey, and W. H. Walker
Regulation of Cyclic Adenosine 3',5'-Monophosphate Response Element Binding Protein (CREB) Expression by Sp1 in the Mammalian Testis
Biol Reprod, March 1, 2002; 66(3): 659 - 666.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
V. Pentikainen, L. Suomalainen, K. Erkkila, E. Martelin, M. Parvinen, M. O. Pentikainen, and L. Dunkel
Nuclear Factor-{kappa}B Activation in Human Testicular Apoptosis
Am. J. Pathol., January 1, 2002; 160(1): 205 - 218.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
V. Pentikainen, K. Erkkila, L. Suomalainen, M. Otala, M. O. Pentikainen, M. Parvinen, and L. Dunkel
TNF{alpha} Down-Regulates the Fas Ligand and Inhibits Germ Cell Apoptosis in the Human Testis
J. Clin. Endocrinol. Metab., September 1, 2001; 86(9): 4480 - 4488.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
J. Miao, N. S. Panesar, K.-T. Chan, F. M.M. Lai, N.-s. Xia, Y.-b. Wang, P. J. Johnson, and J. Y.H. Chan
Differential Expression of a Stress-modulating Gene, BRE, in the Adrenal Gland, in Adrenal Neoplasia, and in Abnormal Adrenal Tissues
J. Histochem. Cytochem., April 1, 2001; 49(4): 491 - 500.
[Abstract] [Full Text]


Home page
FASEB J.Home page
S. GEYMAYER and W. DOPPLER
Activation of NF-{kappa}B p50/p65 is regulated in the developing mammary gland and inhibits STAT5-mediated {beta}-casein gene expression
FASEB J, June 1, 2000; 14(9): 1159 - 1170.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
F. J. Delfino and W. H. Walker
NF-kappa B Induces cAMP-response Element-binding Protein Gene Transcription in Sertoli Cells
J. Biol. Chem., December 10, 1999; 274(50): 35607 - 35613.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Delfino, F.
Right arrow Articles by Walker, W. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Delfino, F.
Right arrow Articles by Walker, W. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals