help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, H.-L. C.
Right arrow Articles by Zajchowski, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, H.-L. C.
Right arrow Articles by Zajchowski, D. A.
Molecular Endocrinology 12 (11): 1733-1748
Copyright © 1998 by The Endocrine Society

The Novel Estrogen-Responsive B Box Protein (EBBP) Gene Is Tamoxifen Regulated in Cells Expressing an Estrogen Receptor DNA-Binding Domain Mutant

Hsiao-Lai C. Liu, Elina Golder-Novoselsky1, Marian H. Seto, Lynn Webster, John McClary and Deborah A. Zajchowski

Departments of Cancer (H.L.L., L.W., D.A.Z.), Biophysics (M.H.S.), and Biologics Research (J.M.) Berlex Biosciences Richmond, California 94804


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have identified a 2.6-kb mRNA whose steady state levels are increased 2- to 4-fold by treatment of human mammary epithelial cells (HMEC) stably expressing an estrogen receptor (ER) transgene with either estrogen (E) or the antiestrogen, 4- hydroxy-tamoxifen (HT). The cDNA corresponding to this mRNA encodes a 564-amino acid protein, named estrogen-responsive B box protein (EBBP), that is a new member of a subfamily within the B box zinc finger protein family, which includes transcription factors (e.g. TIF1), tumor suppressor proteins (e.g. PML), and proteins implicated in development (e.g. ret finger protein, XNF7). The EBBP mRNA is detectable by Northern blot analysis in most tissues, with the exception of liver and peripheral blood lymphocytes, and the gene has been mapped to human chromosome 17p11.2. In contrast to most B box family members, EBBP has a predominantly cytoplasmic localization. Studies of the estrogenic regulation of EBBP expression demonstrated that the E-dependent increase in EBBP mRNA levels in the ER-transfected HMEC is an early, ER-mediated, and cycloheximide-insensitive process. In HMEC stably transfected with an ER mutant containing a deletion in the second zinc finger of the DNA-binding domain, E and HT had different effects on EBBP gene expression; EBBP regulation by E was dramatically reduced while the effects of HT were augmented. These data indicate that HT can modulate EBBP mRNA expression through a mutated ER, which has little activity when bound by E, and suggest that different molecular mechanisms control the E and HT responsiveness of the EBBP gene.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Although the role of estrogen (E) in the etiology and progression of breast cancer is well documented (1), our understanding of the E-dependent regulation of growth, differentiation, and gene expression in the normal human mammary gland is not as extensive. This is primarily due to difficulties in establishing continuous cultures of human mammary epithelial cells (HMEC) that maintain estrogen (E) responsiveness. One of the factors contributing to this problem is the absence of detectable estrogen receptor (ER) protein expression in later-passage cultured HMEC (2). In an attempt to create an appropriate model system to study E effects, we stably expressed recombinant ER in the 184B5 (3) immortal, nontumorigenic HMEC line (2). Our studies of gene expression in these 184B5-ER transfectants (referred to as B5-ER) demonstrated E-dependent regulation of the known E-responsive genes, pS2, progesterone receptor (PR), transforming growth factor-{alpha} (TGF{alpha}), and 52-kDa cathepsin D (2, 4). However, a seemingly paradoxical effect of E was also observed in our studies with these cells; instead of acting as a proliferative stimulus as it does in ER-positive (ER+) breast carcinomas, E treatment of the B5-ER cells resulted in marked growth inhibition (5). We therefore proposed that E could have both positive and negative effects on growth, depending upon the cellular context of the expressed ER (4). In this regard, recent studies (6, 7) that investigated the proliferative status of ER+ and ER-negative cells in the normal human breast by in situ immunohistochemical staining for the ER, PR, and Ki67 demonstrated that it is primarily the ER-negative and not the ER+ cells that proliferate. It is conceivable that exposure of the normal breast to E prevents the proliferation of the ER+ cells but induces them to produce paracrine growth factors that enhance the growth of nearby ER-negative cells. Indeed, the response of the B5-ER cells to E treatment is growth inhibition (5) and increased expression of growth-modulatory factors such as TGF{alpha} and 52-kDa cathepsin D (2). In contrast to the normal mammary gland, in ER+ breast tumors, ER positivity and proliferation are significantly associated (6). This suggests that escape of ER+ cells in the normal breast from an E-mediated inhibitory effect on growth could be one step in the development of malignancy. Elucidation of the mechanisms regulating the antiproliferative activity of E in the B5-ER cells should aid our understanding of the means by which ER+ breast tumors evade this control.

Our studies using this B5-ER cell model have revealed that, like E, the partial ER agonist-antagonist, 4-hydroxy tamoxifen (HT), also inhibited cell growth (5), while the full ER antagonist, ICI164384 (ICI) did not. These data suggested that the effect of HT on B5-ER cell growth is a result of its partial estrogenic activity. This partial estrogenicity has been implicated in the emergence of some tamoxifen-resistant breast carcinomas (8), as well as in tamoxifen’s beneficial effects in protecting postmenopausal women from cardiovascular disease and osteoporotic bone loss (8). As expected for a partial ER agonist, we found that only some E-responsive genes were modulated by HT treatment, i.e. HT increased TGF{alpha} and pS2, but not 52-kDa cathepsin D or PR mRNA levels (Ref. 4 and data not shown). Such selective gene expression regulation by HT has been attributed to promoter- and cell type-specific differences in the requirements for ER-mediated transcriptional activation (for review, see Ref. 9). To elucidate these mechanisms, numerous studies have been performed using the promoters of several well characterized E and HT-responsive genes and various mutated ER that are, for example, defective in DNA interaction or in transcriptional activation. One model to explain the tissue-specific activity of tamoxifen invoked selective activation of the AP1 transcription factor by HT in uterine, but not breast, cancer cells (10). In this model, different molecular mechanisms were implicated in E- and HT-dependent regulation; the activation of AP1 by E was independent of the DNA-binding ability of the ER, while HT activation required the intact DNA-binding domain (DBD).

In our previous studies, we determined the ER structural domains that were important for E- and HT- mediated antiproliferative responses in 184B5 cells stably expressing mutant ER. Our results suggested that different mechanisms were involved in the growth-inhibitory effects of E and HT. However, the requirements were not the same as for AP1-dependent transcriptional control; HT-dependent effects could be elicited in cells containing mutant ER that did not have DNA-binding ability, while E effects were dramatically reduced in the same cells.

With the aim of better understanding the mechanism for the E- and HT-dependent antiproliferative effects on B5-ER and to identify genes that could be used to study this novel pathway of HT-mediated gene expression modulation, we employed differential display PCR in the search for E-regulated genes. This strategy resulted in the identification and cloning of a cDNA encoding a protein with homology to members of the B box zinc finger protein family. The hormonal regulation and chromosomal mapping of this gene, as well as the subcellular localization of the encoded protein, are described.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Identification and Cloning of an E-Responsive Gene
The differential display (DD)-PCR technique was used to identify genes whose expression was altered by E treatment of the B5-ER cells. This strategy identified a 167-bp band that was amplified to a greater extent in the E-treated cells than in the control cells. To confirm that this DD-PCR product represented a mRNA that was differentially regulated by E, the 167-bp cDNA fragment was used as a hybridization probe for Northern blot analysis of the same RNA samples used in the DD-PCR. E-dependent enhancement of a major 2.6-kb mRNA and a minor 2.2-kb species was observed (data not shown).

A combination of cDNA library (i.e. human testis) screening with this 167-bp cDNA probe and 5'-rapid amplification of cDNA ends (RACE)-PCR cloning using RNA isolated from the B5-ER cells, as well as human mammary gland and skeletal muscle, led to the isolation of a 2568-bp cDNA and several overlapping cDNA clones that correspond to the sequence provided in Fig. 1AGo. DNA sequence analysis (11) revealed a 564-codon open reading frame. The ATG start codon is in an adequate context for translation initiation (12), and stop codons are present in all three upstream reading frames. A putative polyadenylation signal (i.e. AATAAA) is found at bp 2549 of this cDNA clone. These results and the similarity between the size of the cDNA and the 2.6-kb mRNA expressed in B5-ER cells (Fig. 2Go) suggest that this cDNA may be full-length. The predicted protein has a calculated molecular mass of 64 kDa and an isoelectric point of 5.2. No signal peptide sequence or nuclear localization signal was identified.




View larger version (140K):
[in this window]
[in a new window]
 
Figure 1. Sequence and Predicted Structural Domains of EBBP

A, Nucleotide sequence and deduced amino acid sequence of EBBP (GenBank af096870). Numbers on the left refer to nucleotide position and those on the right to amino acid position. The B1 and B2 boxes, coiled-coil domain, and the B30.2-like domain are underlined and indicated by the brackets at the right. The polyadenylation sequence is double underlined. B, Homology between the EBBP B boxes and the B box domains of other B box family proteins. The alignment for members containing both B1 and B2 boxes is shown at the top, and the alignment of single B box-containing proteins is shown at the bottom. Gaps are indicated by dots. Numbers on the left refer to the amino acid position at the start of the B box in each protein. The consensus B box sequence is CX2-4HX7-9CX7CX2CX5-6HX2H (15 ), where X can be any amino acid. The aligned cysteine and histidine residues are indicated by reverse-contrasted letters. C, Schematic representation of protein domains of EBBP, other B box family proteins, and B30.2 domain-containing proteins without B boxes. The numbers listed at the bottom represent the EBBP amino acid positions. The contiguous protein sequence is shown by solid lines, and gaps are indicated by dashed lines. Vertical arrows represent insertions. Horizontal arrows represent additional sequences in the direction indicated. Database accession numbers for the indicated protein sequences are: ATDC (human, PIR a49618); efp (human, SWISS-PROT q14258); TIF1 (huamn, Genbank af009353); KAP1 (human, SWISS-PROT q93040); PML (human, PIR a40044); 1A1.3B/Nbr1 (human, SWISS-PROT q14596); KIAA0129 (human, Genbank d50919); PWA33 (newt, SWISS-PROT q02084); XNF7 (Xenopus laevis, SWISS-PROT q92021); RFP(human, SWISS-PROT p14373); AFP (human, Genbank u09825); staf50 (human, SWISS-PROT q15521); RPT (mouse, SWISS-PROT p15533); SSA/Ro (human, SWISS-PROT p19474); RFB30 (human, Genbank y07829); pyrin (human, Genbank af018080); butyrophilin (human, SWISS-PROT o00478); BT2 (human, SWISS-PROT p78408); Stonustoxin {alpha} (human, SWISS-PROT q98989); Stonustoxin ß (human, SWISS-PROT q91453).

 


View larger version (55K):
[in this window]
[in a new window]
 
Figure 2. Expression of EBBP mRNA in Human Tissues

Northern blots containing polyA+ RNA (2 µg/lane) from adult (A) and fetal (B) tissues were hybridized with the EBBP cDNA probe. The tissue source for the RNA in each lane is indicated at the top. Size markers (in kilobases) are indicated. The ß-actin controls are shown at the bottom.

 
The Predicted Protein Has Structural Motifs Characteristic of B Box Zinc Finger Family Proteins
No sequences that were highly homologous to this cDNA at the nucleic acid or protein level were found in searches of the Gen/EMBL and Swiss-Prot databases. However, there was significant amino acid sequence homology to E-responsive finger protein (efp; 43%) (13) and ataxia telangectasia group D-complementing gene (ATDC; 46%) (14) within a cysteine- and histidine-rich segment that corresponds to a zinc finger motif called a B box (15). Both the order and the spacing of cysteine and histidine residues of the consensus B box motif (15) are preserved in this protein sequence. We have accordingly named this gene EBBP for E-responsive B box protein. The sequence alignment of the EBBP B box domain with those of other B box family members is shown in Fig. 1BGo. Like ATDC, efp, TIF1 (16), Kap1 (17), and PML, EBBP contains two B boxes (called B1 and B2). Amino acid sequence analysis using the Coil Scan program (11, 18) predicted the existence of two {alpha}-helical regions within EBBP immediately downstream from the B boxes (i.e.,Ser164 to Ser203 and Ala244 to Met272).

The B box motif and a predicted coiled-coil domain are found in all of the B box family proteins, some of which also contain a RING zinc finger (19) or a B30.2 homology region (20, 21) (Fig. 1CGo). The EBBP does not have a RING finger but contains sequences that correspond to the consensus sequence for the B30.2 domain (20). It is noteworthy that a subset of B30.2 domain-containing proteins do not have B boxes (Fig. 1CGo) and that the B30.2 domain of EBBP is most homologous to those in non-B box family members, i.e. stonustoxins {alpha} and ß and BT2 (with sequence identities of 32%, 34%, and 32%, respectively; data not shown).

EBBP Tissue Distribution
The tissue specificity of EBBP expression was assessed by Northern blot analysis of poly(A)+ RNA isolated from various human adult and fetal tissues. As shown in Fig. 2AGo, two EBBP transcripts of 2.6 kb and 2.2 kb were detected in the adult tissues tested. The 2.6-kb mRNA was detected in most of the tissues with the highest levels being found in testis, ovary, small intestine, colon, placenta, heart, and mammary gland (Fig. 2AGo). The expression pattern of the 2.2-kb species is different from that of the 2.6-kb mRNA; the highest levels of this form are found in skeletal muscle, heart, and testis. No EBBP mRNA was detectable in liver or peripheral blood lymphocytes. Comparison of these data with those obtained from analysis of four fetal tissues (Fig. 2BGo) revealed that EBBP was more highly expressed in the fetus than in the corresponding adult tissues. This is most apparent for the brain, where EBBP expression is barely detectable in the adult. There is also an ~3 kb EBBP mRNA detected in fetal tissues, most noticeably in the brain.

Chromosomal Localization
Using the EBBP cDNA as a hybridization probe for Southern blot analysis of DNA isolated from a panel of human-rodent somatic cell monochromosomal hybrids, EBBP was localized to human chromosome 17 (Fig. 3AGo). The EBBP probe also hybridized to mouse and hamster DNA, suggesting the existence of rodent homologs of this gene. The chromosomal location of the EBBP gene was mapped by two-color fluorescence in situ hybridization using a P1 genomic clone containing the EBBP-coding sequences and a chromosome 17 centromere-specific probe (Fig. 3BGo). By this analysis, the EBBP gene was determined to be at a position that is 26% of the distance from the centromere to the telomere of chromosomal arm 17p, in a region that corresponds to band 17p11.2.



View larger version (64K):
[in this window]
[in a new window]
 
Figure 3. Chromosomal Localization of the EBBP Gene

A, Southern blot analysis. A Southern blot containing DNA isolated from human-rodent somatic cell monochromosomal hybrids (12–14 µg/lane) was hybridized with the EBBP cDNA probe. Control lanes (human, mouse, and hamster) and hybrid lanes representing human chromosomes 1 through 22, X, and Y are indicated at the top. Size markers (in kilobases) are indicated on the left. B, FISH analysis. Normal metaphase chromosomes derived from PHA-stimulated peripheral blood lymphocytes were cohybridized with a P1 clone containing EBBP and a chromosome 17-specific probe. Eighty metaphase cells were analyzed, with 72 exhibiting specific labeling, and measurements of 10 specifically hybridized chromosomes 17 were made using digital imaging microscopy. Location of the centromere is indicated by the red fluorescence, and the localization of EBBP is indicated by the green fluorescence.

 
Recombinant EBBP Expression
To determine whether the EBBP cDNA encodes the protein predicted by the open reading frame described above, the 1692-bp coding sequence of EBBP was subcloned into an eukaryotic expression vector with and without an N-terminal FLAG epitope tag. Since no detectable EBBP mRNA was found by Northern blot analysis in the human adult liver (Fig. 2AGo) or in the HepG2 human hepatocellular carcinoma cell line (data not shown), the HepG2 cell line was selected for the transfection with the EBBP expression constructs. Northern blot analysis demonstrated the presence of EBBP mRNA in the EBBP-transfected cells but not in the control vector-only transfectants (Fig. 4AGo). Cell extracts prepared from these cells were analyzed for protein expression by immunoblotting using a polyclonal anti-EBBP peptide antibody (Fig. 4BGo). Two protein bands of approximately 64 and 70 kDa were detected in the EBBP-transfected cells, but were absent in the vector-only controls. The majority of the translated protein product was found as the 70-kDa band. The presence of this higher molecular mass band, in addition to the band of the predicted mass of 64 kDa, may be due to posttranslational modification. The incorporation of the eight amino acid FLAG epitope tag resulted in the same relative expression of the two proteins, but of a slightly larger size than the untagged proteins, as expected. When the M2 monoclonal anti-FLAG antibody was employed in this analysis, only the FLAG-tagged EBBP was detected (data not shown).



View larger version (54K):
[in this window]
[in a new window]
 
Figure 4. Expression of EBBP in Transfected HepG2 Cells

Analyses were performed on HepG2 cells stably transfected with the vector control, pSV2neo/CMV (lane 1) or EBBP constructs, pCMV-EBBP (lane 2), and pCMV-FlagEBBP (lane 3). A, mRNA expression. Total RNA was isolated from transfected HepG2 cells, and 20 µg were used for Northern blot analysis. The locations of the 18S and 28S rRNA are indicated. B, Protein expression. Cell lysates (100 µg protein/lane) from the same transfectants were separated on a 10% SDS-polyacrylamide gel under reducing conditions and further analyzed by immunoblotting with anti-EBBP antibody. Molecular mass standards (kDa) are shown at the left.

 
Subcellular Localization of EBBP protein
The localization of the EBBP protein was determined in HepG2 cells that stably express the EBBP protein with and without an N-terminal FLAG tag. The anti-EBBP peptide antibody (Fig. 5BGo) and the M2 monoclonal anti-FLAG antibody (Fig. 5DGo) were used to detect the EBBP protein. Both antibodies detected the EBBP protein in the cytoplasm of the positive cells; only weak, diffuse staining was observed using the isotype control antibodies (Fig. 5Go, A and C). Similar cytoplasmic localization was observed in breast and ovarian cancer cells transfected with EBBP (data not shown). Biochemical fractionation procedures and Western blot analysis confirmed the cytoplasmic localization of the majority of the transfected EBBP (data not shown).



View larger version (110K):
[in this window]
[in a new window]
 
Figure 5. Immunofluorescent Localization of EBBP Protein in Transfected HepG2 Cells

HepG2 cells stably transfected with EBBP expression constructs pCMV-EBBP (A and B) or pCMV-FlagEBBP (C and D) were analyzed by indirect immunofluorescence staining with rabbit IgG (A), rabbit anti-EBBP polyclonal antibody (B), mouse IgG (C), and mouse M2 anti-FLAG monoclonal antibody (D). Photograph is a 400x magnification.

 
E-Enhanced EBBP mRNA Expression Is an Early, ER-Mediated Response
E treatment of the B5-ER cells increased EBBP steady-state mRNA levels approximately 3-fold in each of the tested ER transfectants (Fig. 6AGo; B5-ER clones E-4 and E-23), but had no effect on the vector-only transfected clone (Fig. 6AGo; B5 clone V-1) or the parental 184B5 cell line (data not shown). No stimulatory effect was seen after treatment with the pure ER antagonist ICI (Fig. 6Go, A and B), but the effect of E was blocked by cotreatment with ICI at concentrations that are 10- to 100-fold greater than those of E (Fig. 6BGo). These data demonstrate that the ER is required for the E-dependent increase in EBBP mRNA levels.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 6. Northern Blot Analysis of E-regulated EBBP mRNA Expression

The RNA blots were prepared from total RNA and hybridized with an EBBP cDNA probe. The same blots were stripped and rehybridized to a GAPDH cDNA probe as a control for variations in sample loading. The locations of the 18S and 28S rRNA are indicated. A, Effect of E and ICI treatment on EBBP mRNA levels in B5-ER cells. The RNA blot was prepared from 12.5 µg total RNA isolated from vector-only control cells (V-1) and B5-ER transfectants (E-4 and E-23) treated with the vehicle (0), 2 x 10-7 M E2 (E), or 2 x 10-7 M ICI (ICI) for 24 h. B, Effect of ICI treatment on E-regulated EBBP expression. The RNA blot was prepared from 20 µg of total RNA isolated from B5-ER transfectant, E-1 treated with the vehicle (0), 2 x 10-7 M E2 (E), ICI at 10-7 M and 10-6 M (ICI), or a combination of E2 and ICI (E+I) for 36 h. C, Time course for E-dependent EBBP mRNA expression. Northern blot analyses were performed using RNA isolated from B5-ER transfectants, E-1 and E-23, after treatment with vehicle or 2 x 10-7 M E2 for the indicated times. The fold change in EBBP mRNA levels in the E2-treated relative to vehicle-treated cells is graphically depicted. The data are the average of two independent experiments. D, The effect of protein synthesis inhibition on E-regulated EBBP mRNA levels. The RNA blot was prepared from 12.5 µg total RNA isolated from B5-ER transfectant, E-23 after treatment with vehicle, or 2 x 10-7 M E2 for the indicated times, as well as from E-23 cells treated with 10-5 M CHX alone or in combination with 2 x 10-7 M E2 (E+CHX).

 
The effect of E treatment on EBBP mRNA levels was evaluated over a 72-h time period. EBBP mRNA levels were significantly increased 2 h (1.9-fold) after E addition, but maximal effects (~3.5-fold) were not observed until 24 h (Fig. 6CGo). To determine whether this E-dependent regulation required ongoing protein synthesis, studies were performed with the protein synthesis inhibitor, cycloheximide (CHX; Fig. 6DGo). The presence of CHX did not prevent the E-dependent increase in EBBP mRNA levels at any of the time points tested. All of these data demonstrate that regulation of EBBP expression is an early, ER-mediated response that does not require new protein synthesis.

EBBP mRNA Levels Are Increased by HT through a Mechanism That Does Not Require an Intact ER DNA-Binding Domain
Our previous studies indicated that the partial agonist-antagonist HT had some estrogenic activities in the B5-ER-transfected cells. Both E and HT caused antiproliferative effects and induced the expression of the pS2 gene (4, 5). But, unlike E, HT did not induce PR gene expression (4). We therefore evaluated the effect of HT treatment on EBBP mRNA expression. As shown in Fig. 7AGo (left side), regulation of EBBP mRNA levels by E treatment was dose-dependent with maximal effects observed at concentrations of 10-7 M or greater at both the 24- and 72-h timepoints. In contrast, HT treatment caused an increase in EBBP mRNA levels only at the 72-h timepoint and with a biphasic dose-response curve that peaked at 10-8 M and declined at higher concentrations.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 7. Effects of E and HT Treatment on mRNA Levels of EBBP and TGF-{alpha} in B5-ER WT and DBD-{Delta} Mutant

Northern blot analysis was performed using RNA isolated from (A) B5-ER clones E-1, E-4, and E-23 (panel A) (i.e. WT ER) or DBD-{Delta} clones D-1, D-4, D-7 (panel B) (i.e. DBD-{Delta}) after treatment with the indicated concentrations of E2 (solid bars) or HT (striped bars) for either 24 or 72 h. The data shown correspond to the average change in EBBP (left side) or TGF{alpha} (right side) mRNA levels relative to the vehicle control from at least two separate experiments. SEs (error bars) are provided for results generated from a minimum of three data points.

 
This biphasic dose-response relationship for HT-dependent EBBP regulation was not observed for other HT-regulated genes in the B5-ER cells, such as TGF{alpha} (Fig. 7AGo, right side) and pS2 (data not shown). TGF{alpha} mRNA levels increased with increasing concentrations of both E and HT, with maximal responses observed at 10-7 M and 10-8 M, respectively.

We had previously shown that the antiproliferative effects of E and HT could be distinguished by different activities of these ER ligands on B5-ER transfectants bearing mutations in the DBD. In DBD mutant-containing cells, HT was much more effective than E at eliciting growth-inhibitory effects (4). We therefore asked whether the DNA-binding ability of the ER was critical for EBBP regulation by E and HT. 184B5 cells stably transfected with an ER mutant lacking the second zinc finger of the DNA-binding domain [DBD-{Delta} (4)] were employed in these analyses. Each of the tested DBD-{Delta} transfectants exhibits levels of ER comparable to those found in the WT-ER- transfected cells, and the relative binding affinities of E and HT for the DBD-{Delta} ER are similar to those for the WT-ER (4). As shown in Fig. 7BGo (left side), E had only a slightly stimulatory effect on EBBP expression in the DBD-{Delta} cells (i.e. 1.7-fold relative to the 2.8-fold effect on the WT-ER) at the highest dose (i.e. 10-6 M). In contrast, HT (10-7 M) increased EBBP mRNA levels by 3-fold in the DBD-{Delta} cells. Moreover, the response to increasing concentrations of HT was not biphasic as in the WT-ER cells, but was similar to the effects of E in the WT-ER cells (compare with Fig. 7AGo, left side). The HT-mediated increase in EBBP mRNA levels in the DBD-{Delta} transfectants was inhibited by cotreatment with the pure ER antagonist ICI (data not shown), demonstrating that HT binding to the mutant ER is required for EBBP mRNA expression.

For comparison, we measured the effects of E and HT on TGF{alpha} gene expression. In contrast to the observations for EBBP, neither E nor HT was effective in increasing TGF{alpha} mRNA levels in the DBD-{Delta} mutant-expressing cells (Fig. 7BGo, right side), consistent with a requirement for DNA binding in the hormonal regulation of TGF{alpha} expression. Other genes, such as PR and pS2, were also unresponsive to E or HT treatment in the DBD-{Delta} mutant-expressing cells (4). These data suggest that EBBP differs from other E and HT-responsive genes in that an intact ER DBD is important for E, but not for HT-mediated regulation.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this study, we have identified and cloned a novel cDNA that is E- and HT-regulated in ER-expressing HMEC. The protein encoded by this cDNA, designated EBBP, contains a structural motif comprising two cysteine- and histidine-rich B box domains and a coiled-coiled region that is characteristic of the B box zinc finger protein family. Proteins of this family have been implicated in diverse biological processes including cell growth and differentiation [e.g. XNF7 (22), RFP (23), PML (24)], transcriptional regulation [e.g. rpt-1 (25), Staf 50 (26), TIF1 (16)], and pathogenesis [e.g. SS-A/Ro (27), and pyrin (28)]. Chromosomal translocations involving some of them have created oncogenes [e.g. PML-retinoic acid receptor fusion (29), TIF1-B-raf fusion in T18 (16), and RFP-RET (30)]. Most members of this family have an N-terminal zinc-binding RING finger. EBBP does not have this motif and therefore belongs to a subfamily of B box-containing proteins, which also includes ATDC (31), pyrin, KIAA0129 (32), and 1A1.3B/Nbr1 (33). Among these, only EBBP, pyrin, and KIAA0129 contain a C-terminal 170-amino acid B30.2 domain (20) that is also found in transmembrane glycoproteins [e.g. butyrophilin, BT2 (20)] and secreted protein toxins [e.g. stonustoxins {alpha} and ß (34)]. The B30.2 domain of butyrophilin has been suggested to be involved in milk fat secretion in the breast (35), and three missense mutations clustering in the B30.2 domain of pyrin have been proposed to be responsible for familial Mediterranean fever (28). In EBBP, the B30.2 domain may play an important role in its biological function.

The EBBP mRNA is expressed at varying levels in most human tissues by Northern blot analysis, with the exception of liver and peripheral blood leukocytes. Therefore, EBBP tissue distribution is not limited to the classical E target tissues (e.g. ovary, uterus, mammary gland), and its expression is not totally dependent upon E. This observation contrasts with the more restricted expression of efp, the other E-responsive member of the B box protein family, which is very highly expressed in placenta, uterus, and ovary with lower levels in the mammary gland and liver (36).

The EBBP is localized in the cytoplasm of EBBP-transfected HepG2 liver carcinoma cells as well as breast and ovarian cell lines transfected with the same EBBP constructs (data not shown). Although most members of the B box zinc finger protein family are nuclear proteins, they can exhibit cytoplasmic localization in some instances, such as during particular stages in embryonic development [i.e. XNF7 (37)]. Recently, it was shown that the subcellular distribution of RFP is cell type specific and that the RING finger motif was required for its nuclear localization in HeLa cells, while the B box was important for its cytoplasmic retention in NIH3T3 cells (38). Interestingly, the ATDC protein, which has a B box but no RING finger, is also a cytoplasmic protein (39). The absence of a RING finger, signal peptide, and a nuclear localization signal in the EBBP is consistent with its cytoplasmic localization. However, in view of the reported cell type-specific or developmental stage-dependent subcellular localization of the other B box family members, it is possible that EBBP will have a different localization in other cell lines or under altered conditions.

Chromosomal mapping by fluorescence in situ hybridization (FISH) analysis revealed that EBBP is located at chromosome 17p11.2, a region that has no known association with cancer. This locus is, however, associated with several syndromes having clinical manifestations of neurological disorder: Sjorgren-Larsson syndrome (40), Charcot-Marie-Tooth neuropathy-1A (41), hereditary neuropathy with pressure palsies (42), Dejerine-Sottas syndrome (43), and Smith Magenis syndrome (44).

The levels of EBBP mRNA are increased after treatment of B5-ER cells with either E or the partial agonist-antagonist, HT. The B5-ER cells employed in our studies are HMEC, which stably express the HEO cDNA, which encodes an ER protein that has a Gly->Val amino acid replacement at position 400. This protein is less stable and has a lower binding affinity for E at physiological temperature than the wild-type (WT) ER, whose corresponding cDNA is called HEGO (45). Nevertheless, many of the tested transcriptional activating properties of the HEO-encoded ER are identical to the HEGO ER. One exception was reported by Jiang et al (46) concerning tamoxifen effects on the proliferation of HEO vs. HEGO-transfected MDA231 breast cancer cells; they found that the HEO form of the ER was more sensitive to tamoxifen than was the HEGO ER. However, we have found little difference in the antiproliferative or gene expression-modulatory effects of E and HT on HEGO vs. HEO-expressing HMEC (data not shown). The regulation of EBBP mRNA levels by E and HT in the B5-HEGO transfectant (data not shown) is very similar to that observed in the B5-ER (i.e. HEO) clones presented here. Due to the extremely low efficiency of generating stable HEGO- expressing transfectants (4, 47), the HEO parental background was used to evaluate the activities of WT or mutant ER described in this study.

We have shown that E-responsive EBBP expression requires the ER since it does not occur in the parental or vector-only transfected 184B5 cells and is blocked by the pure ER antagonist ICI. Regulation of EBBP mRNA expression by E is a direct ER-mediated effect that is detected as early as 2 h post-treatment and occurs in the presence of the protein synthesis inhibitor, cycloheximide. Our data for HT-dependent EBBP gene regulation demonstrate kinetics that are delayed relative to those of E and also suggest that the molecular mechanisms that are involved in EBBP regulation by E and HT are distinct. Studies of EBBP expression in B5-ER transfectants containing an ER mutant lacking the second zinc finger of the DBD (i.e. DBD-{Delta} cells) revealed that optimal E-dependent regulation of EBBP requires the ER DBD. In contrast, HT was able to increase EBBP expression in the DBD-{Delta} cells to the same extent as in the WT ER transfectants, suggesting that the intact DBD is not required for this HT-mediated effect. It is theoretically possible that the HT responsiveness observed in the DBD-{Delta} cells is dependent upon the particular mutation that deletes the entire second zinc finger. However, our preliminary data reveal a similar difference in the responsiveness of EBBP gene expression to E and HT treatment in B5-ER transfected with a different DBD mutant [DBD-X (4)], in which the first zinc finger is disrupted by mutations in critical cysteine residues.

Regulation of the transcription of ERE-driven promoters has been shown to require the DBD of the ER (48, 49). The DBD-{Delta} mutant is inactive in binding to consensus ERE (50) and cannot activate transcription of the ERE-driven reporter construct, pVit-tkcat (50, 51). One interpretation of the markedly reduced activity of E in modulating EBBP expression in the cells containing the DBD-{Delta} ER is that DNA binding is critical for E-dependent regulation. Yet, it is also possible that the mechanism requires an intact ER DBD but not DNA binding, as has been described for regulation by E of the interleukin 6 (52, 53) and insulin-like growth factor 1 (54) genes.

In contrast to the observations with E, HT enhanced EBBP expression in the DBD-{Delta} transfectants. However, HT did not stimulate expression of the TGF{alpha} or pS2 genes in these cells, suggesting that the mechanism by which HT regulates TGF{alpha} and pS2 is different from the one used for EBBP. It is known that E-dependent regulation of some genes does not require the ER DBD [e.g. GATA-1 (55), retinoic acid receptor-{alpha} (56), ovalbumin proximal AP-1 site (57)], but the effect of HT on such genes has not been reported. Of particular relevance to our observation are results indicating that E- and HT-dependent activation of the AP1 transcription factor occurs through different molecular mechanisms that are distinguished by their requirement for the DBD (10). In this case, activation by tamoxifen, but not E, was shown to require an intact ER DBD. The EBBP gene may be the first example of a gene whose HT-mediated regulation does not depend upon an intact ER DBD, while E-dependent expression does.

In addition to the difference in the ER domain requirement for EBBP regulatory activity, E and HT also differed in their dose-response curves in the WT ER transfectants. E treatment enhanced EBBP mRNA levels in a dose-dependent manner that plateaued at high concentrations, while similar doses of HT caused a biphasic response, i.e. increased EBBP gene expression was observed at low doses but not at higher concentrations. However, this biphasic response was not observed in the DBD-{Delta} cells; the dose-dependent response to HT in these cells was similar to that of E treatment in the WT ER transfectants. A recent report has indicated that some transcriptional coregulatory factors can mediate repression [i.e. N-CoR, SMRT (58)] of HT-, but not E-regulated gene expression. In view of this, one possible interpretation of our data is that the second zinc finger that is deleted in the DBD-{Delta} construct is important for either directly binding or maintaining the proper ER structure for interaction with specific corepressors. We propose that in the WT ER cells, high concentrations of HT drive formation of more HT-bound ER than at low concentrations. These HT-bound ER can therefore recruit more corepressors than at low HT concentrations. This would shift the balance of repressor-free toward repressor-bound ER and thereby cancel out any stimulatory effect of HT on EBBP expression. We speculate that these or similar factors would not interact with the HT-bound DBD-{Delta} ER and as a result, EBBP transcription would be stimulated. Such a regulatory mechanism would also predict that under some physiological or pathophysiological conditions (e.g. corepressor scarcity), HT would be a potent enhancer of EBBP expression via the WT ER even at high ligand concentrations. In this regard, it should be noted that a biphasic dose-response curve is also characteristic of the effects of HT on the growth of E-dependent breast cancer cells; HT stimulates proliferation at low, but not high, concentrations (59, 60). Progression of ER+ breast cancer to a tamoxifen-resistant phenotype has been hypothesized to involve cellular loss of corepressors (61). EBBP may be one example of a gene that is coordinately regulated with this process. The identification of the actual target(s) of the ER important for EBBP regulation by E and HT and testing of this proposed model awaits EBBP promoter isolation and characterization.

One of the aims of our differential gene expression cloning strategy was to identify potential effectors of the E- and HT-induced antiproliferative effects on ER-transfected HMEC. The changes in EBBP gene expression elicited by E in the WT ER and DBD-{Delta} ER cells are consistent with the possible involvement of EBBP in growth inhibition. E inhibits the growth of the WT ER, but not the DBD-{Delta} ER transfectants; E treatment enhances EBBP mRNA levels in the WT ER, but not in the DBD-{Delta} ER cells. Interpretation of the results obtained after HT treatment is more complicated. HT significantly inhibits the growth of both the WT ER and the DBD-{Delta} transfectants and also increases EBBP expression in both of these cell lines. These data appear to suggest a correlation between HT’s effects on EBBP expression and growth. However, although HT is an effective modulator of EBBP expression in the WT ER cells, its dose-response curve is biphasic. Furthermore, a biphasic dose-response relationship was not observed for the antiproliferative activity of HT (5). Therefore, these data indicate that there is no direct correspondence between HT-mediated changes in EBBP mRNA levels and growth inhibition. However, at this time we cannot exclude the possibility that EBBP plays a role in the growth-inhibitory process at lower HT doses but not at the higher concentrations.

In summary, we have identified the EBBP gene as an E and HT-modulated gene in immortal, non-tumorigenic HMEC expressing exogenous ER. Further studies will be required to determine whether EBBP plays a role in preventing the proliferation of E-stimulated ER-positive cells in the normal mammary gland. In addition, these studies have also identified a potentially valuable new model system for studying the regulation of gene expression of mixed ER agonist-antagonists, such as HT. Unlike other E- and HT-responsive genes, the modulation of EBBP gene expression by HT occurs in cells expressing ER that do not have DNA-binding ability.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Chemicals
17ß-Estradiol (E2) was obtained in 1-mg vials (Sigma Chemical Co., St. Louis, MO) and reconstituted in absolute ethanol to a stock concentration of 5 x 10-4 M. HT and ICI were obtained from Besins Iscovesco (Paris, France) and Zeneca Pharmaceuticals (Cheshire, England), respectively and were similarly reconstituted. Stocks were serially diluted in ethanol as needed. Cycloheximide (Sigma) was reconstituted in absolute ethanol at a stock concentration of 10-2 M.

Cell Lines and Culture Conditions
The human liver hepatoma cell line, HepG2 (ATCC, Rockville, MD), was routinely cultured in Eagle’s MEM containing 10% FBS (Intergen, Purchase, NY), and 2 mM glutamine, 0.1 mM MEM non-essential amino acids, 1 mM sodium pyruvate, and 50 µg/ml gentamycin sulfate. The production and characterization of the stable WT and mutant ER transfectants of the human mammary epithelial cell line, 184B5, have been previously described (4). The WT ER transfectants expressing the HEO cDNA (62) that were employed in this study are clones E-1, E-4, and E-23; the DBD-{Delta} ER transfectants expressing the HE34 cDNA (50) are clones D-1, D-4, and D-7. The 184B5 cell line and its transfected derivatives were routinely cultured in phenol red-free DFCI-1 medium (63) containing 1% dextran-coated charcoal (DCC)-treated FBS (prepared as described in Ref. 2 except that there was no heat-inactivation at 56 C). The medium used for the transfectants contained 100 µg/ml G418. For studies of gene expression, cells (5 x 105/100-mm dish) were plated in phenol red-free {alpha}-MEM supplemented with 5% DCC-treated FBS, 1.0 µg/ml insulin, 12.5 ng/ml epidermal growth factor, 2.8 uM hydrocortisone (Sigma), 2 mM glutamine, 0.1 mM MEM nonessential amino acids, 1 mM sodium pyruvate, and 50 µg/ml gentamycin sulfate. After cell attachment overnight, the culture medium was exchanged with medium containing the ER ligands (i.e. E2, HT, ICI) indicated for each experiment. Initiating treatment with 10 µM cycloheximide 1 h before addition of the test compounds tested the effects of protein synthesis inhibition. For the DD-PCR experiments, the B5-ER clone E-1 was treated with either vehicle (0.02% ethanol) or 100 nM E2 for 24 h before RNA isolation. Unless noted otherwise, Life Technology, Inc. (Gaithersburg, MD) supplied all cell culture reagents.

Differential Display PCR
Differential display PCR was performed following the methods described by Liang and Pardee (64). Total RNA was isolated using the guanidinium isothiocyanate/cesium chloride method (65) and treated with ribonuclease-free deoxyribonuclease I (Boehringer Mannheim, Indianapolis, IN). One microgram of DNA-free RNA was used for the first strand cDNA synthesis carried out at 37 C for 1 h in 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 20 µM deoxynucleoside triphosphates (dNTPs), 1 uM dT12-MN primer (M = G, A, or C; n = G, A, T, or C) with 5 U of Superscript reverse transcriptase (Life Technology, Inc.). Two microliters of the first strand cDNA template were used for PCR in 10 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl, 2.5 µM dNTPs, 10 µCi of [{alpha}-35S]dATP (Amersham, Arlington Heights, IL), 1 µM dT12-MN primer (same primer used in cDNA synthesis), 0.2 M 5'-random primer (GenHunter, Nashville, TN), and 1 U of Taq polymerase (Perkin-Elmer, Foster City, CA). PCR was performed in a Perkin-Elmer 4800 cycler as follows: 30 sec at 94 C, 2 min at 40 C, and 30 sec at 68 C for 40 cycles, followed by a 5-min extension at 72 C. PCR products were analyzed on a 6% sequencing gel, and differentially displayed bands were eluted from the gel and reamplified by PCR. The PCR-generated products were isolated and used in preparation of radiolabeled probes for Northern analysis and cDNA library screening.

Northern Blot Analysis
The Northern blot preparation and hybridization procedure was carried out essentially as described (66) except that the RNA was transferred to Zeta-Probe GT nylon membranes (Bio-Rad, Hercules, CA) and fixed by UV cross-linking. The samples of poly A+ RNA from human uterus and mammary gland, as well as multiple tissue Northern blots (adult and fetal tissues), were purchased from CLONTECH (Palo Alto, CA). The DNA restriction fragment used to probe Northern blots for expression of the TGF{alpha} gene has been previously described (66), and the EBBP-specific probe is a cDNA fragment encompassing the sequences between bp 534 and 1390. The blots were either exposed to x-ray films and quantitated by a computing densitometer (Molecular Dynamics, Sunnyvale, CA) or to an image plate and analyzed by a phosphoimage analyzer (Fujix, Fuji Medical Systems, Stanford, CT). Normalization based upon levels of GAPDH mRNA was also carried out when necessary for quantitation.

cDNA Library Screening
Approximately 1,500,000 recombinant phage from an oligo dT-primed human testis cDNA library (in ZAP Express, Stratagene, La Jolla, CA) were screened with the 167-bp DD-PCR-derived cDNA probe. Replica filters were prepared following the protocol provided by Stratagene and hybridized with the cDNA probe as described for Northern blot analysis. After primary and secondary screening, positive clones were isolated, converted to phagemids by in vivo excision as recommended by Stratagene, analyzed by restriction mapping, and sequenced.

RACE Cloning
5'-RACE was performed using the Marathon cDNA amplification kit (CLONTECH). One microgram of total RNA isolated from E-treated B5-ER clone E-1 was reverse transcribed to make first strand cDNA. The first strand cDNA synthesis, second strand cDNA synthesis, and adaptor ligation were carried out according to the manufacturer’s protocol. In the subsequent PCR, two EBBP gene-specific primers (AG-GSP1:GCGGGCTGCATCCAGGGAGACT, reverse complement of bp 713–734; AG-GSP2:GAAATACGCAAGTTAGCAATT, reverse complement of bp 2553–2568) were designed to amplify the 5'-end of the EBBP cDNA and the full-length EBBP cDNA, respectively, in combination with the Marathon adaptor primer, AP1. For long-distance PCR, the Expand Long Template PCR system (Boehringer Manheim) was used as recommended in the protocol. PCR was performed on the adaptor-ligated B5-ER E-1 cDNA, as well as on Marathon-ready cDNA from human mammary gland and skeletal muscle (CLONTECH). The PCR was carried out for 5 min at 94 C, 40 cycles of 30 sec at 94 C, 30 sec at 55 C, and 4 min at 68 C, followed by a 5-min extension at 68 C. After analysis by agarose gel electrophoresis and Southern blot hybridization, PCR-amplified products were cloned into the PCRII/PCR2.1 vector (Invitrogen) and sequenced.

Construction of EBBP Eukaryotic Expression Plasmids
The full-length coding sequence of EBBP was isolated from an EBBP cDNA clone by PCR. The PCR primers (5'-primer: TGTATACAAACGCGTACCATGGCTGAGTTGGATCTA-ATGG; 3'-primer: GCGCTAGCTACTAAGGAGCAGTCCCCACCAAGG) were designed to create a 3-bp Kozak’s consensus sequence (ACC) immediately upstream of the ATG start codon of the EBBP coding sequence, and unique restriction enzyme cleavage sites at both ends (i.e. AccI and MluI at 5'-end, and NheI at 3'-end). The PCR conditions were 5 min at 94 C, 35 cycles of 1 min at 94 C, and 2 min at 72 C, followed by a 5-min extension at 72 C. After subsequent subcloning into the TA cloning vector PCRII, the sequence of the EBBP coding region was verified. The EcoRI restriction fragment containing the full-length coding sequence of EBBP was subcloned into the mammalian expression vector pSV2neo/CMV(2) to generate pCMV-EBBP for EBBP protein expression. A synthetic linker-adaptor containing the FLAG-sequence (67) was inserted into the AccI and MluI sites upstream of the EBBP coding region in pCMV-EBBP to create plasmid pCMV-FlagEBBP for expression of a N-terminal FLAG-tagged EBBP protein.

HepG2 Cell Transfection
Calcium phosphate-mediated transfection of HepG2 cells (1.5 x 106/60 mm plate) was performed as described, using 5.7 µg pCMV-EBBP or pCMV-FlagEBBP DNA/plate. After a 6-h incubation with the DNA precipitates, the cells were subjected to hyperosmotic shock for 4 min in 15% glycerol-PBS, rinsed twice with PBS, and refed with fresh medium. Selection was initiated approximately 48 h posttransfection by addition of medium containing 100 µg/ml G418; after 2 weeks, surviving colonies were pooled for further analyses.

EBBP Antibody Generation
A synthetic peptide (TNTTPWEHPYPDLPS) representing the EBBP protein sequence from amino acid residues 396–410 was conjugated to keyhole limpet hemocyanin. Polyclonal antibody was generated by immunizing rabbits with the conjugated peptide after a standard immunization protocol (68). The anti-EBBP antibody was affinity-purified from rabbit antiserum by Protein A-fast protein liquid chromatography.

Western Blot Analysis
Lysates from subconfluent cell monolayers of the pooled HepG2 transfectants were prepared, and samples (~100 µg protein) were fractionated on 10% (wt/vol) SDS-polyacrylamide gels (Novex, San Diego, CA) and transferred to polyvinylidene difluoride blotting membranes (Novex). Immunodetection was carried out as previously described (2), except that the primary antibody was a polyclonal anti-EBBP antibody (P4) used at 1:1000 dilution or a mouse monoclonal anti-FLAG antibody (M2) used at 10 µg/ml, and the secondary antibody was a horseradish peroxidase-coupled goat antimouse/rabbit IgG (Boehringer Manheim) used at 1:125 dilution.

Immunofluorescent Localization Studies
HepG2 cells were plated (1–2 x 105 cells per well) in two-well glass chamber slides (LabTek, Naperville, IL). After overnight incubation, the cells were washed twice with PBS, followed by a 10-min fixation in 4% formaldehyde in PBS. Cells were rinsed with PBS and permeabilized by submerging the slides in a -20 C methanol bath for 4 min, followed by 4 min in a -20 C methanol/acetone (1:1) bath. To rehydrate, cells were washed in PBS and incubated for 1 h at room temperature with the indicated primary antibody (rabbit polyclonal anti-EBBP peptide antibody (1:100), mouse monoclonal M2-anti-FLAG antibody (25 µg/ml; Eastman Kodak, Rochester, NY), or mouse or rabbit IgG (1:100; Vector Laboratories, Burlingame, CA). The cells were sequentially washed for 10 min each with PBS, PBS-containing Avidin (Avidin/Biotin Blocking Kit; Zymed, South San Francisco, CA), and PBS. The secondary antibody, goat antimouse, or rabbit IgG (Vector Laboratories) was diluted 1:100 in PBS-containing Biotin (Avidin/Biotin Blocking Kit by Zymed) and applied for 30 min after a PBS wash, followed by a fluorescein isothiocyanate-conjugated streptavidin (1:200; Molecular Probes, Inc., Eugene, OR) for 30 min. The stained cells were photographed using a Zeiss Axioplan microscope equipped with a fluorescein-specific filter.

Chromosomal Localization Studies
A Southern blot containing DNA isolated from human-rodent somatic cell monochromosomal hybrids was purchased from Oncor (Gaithersburg, MD). Hybridization using a random primer-labeled probe prepared from the EBBP cDNA was performed as described for Nothern blot analysis. FISH studies were performed by Genome Systems (St. Louis, MO). Purified DNA from an EBBP P1 clone (identified by hybridization to the EBBP cDNA) was labeled with digoxigenin dUTP by nick translation. A biotin-labeled chromosome 17 centromere probe was cohybridized with the EBBP P1 probe in the presence of sheared human DNA to normal metaphase chromosomes derived from phytohemagglutinin-stimulated peripheral blood lymphocytes in a solution containing 50% formamide, 10% dextran sulfate, and 2xsaline-sodium citrate essentially as described (69). Specific hybridization signals were detected by incubating the hybridized slides in fluoresceinated antidigoxigenin antibodies and Texas Red avidin followed by counterstaining with 4,6-diamidino-2-phenylindole. Measurements of specifically hybridized chromosomes 17 were made using digital imaging microscopy as described (69).


    ACKNOWLEDGMENTS
 
For assistance in the generation of antibodies against EBBP peptides, we acknowledge D. Nitecki, S. Biancalana, W. Fraser, and B. Lillis. For cell culture support, we thank R. Humm and J. MacRobbie. We gratefully acknowledge P. Chambon (HEO, HEGO, HE34 plasmids), M. Stampfer (184B5 cells), P. Yaswen (pCMV/SVneo expression vector), Besins Iscovesco (HT), and Zeneca Pharmaceuticals (ICI 164384) for providing research tools. We also thank P. Johnson, N. Miyamoto, and R. Feldman for critical reading of the manuscript and R. Johnson for assistance in preparing the figures.


    FOOTNOTES
 
Address requests for reprints to: Deborah A. Zajchowski, Department of Cancer Research, Berlex Biosciences, 15049 San Pablo Avenue, Richmond, California 94804.

1 Present address: Molecular and Nuclear Medicine, Lawrence Berkeley National Laboratory, One Cyclotron Road, Donner Laboratory, Berkeley, California 94720. Back

Received for publication May 12, 1998. Revision received July 7, 1998. Accepted for publication July 23, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. McGuire W, Carbone P, Vollmer R 1975 Estrogen Receptors in Human Breast Cancer. Raven Press, New York
  2. Zajchowski DA, Sager R 1991 Induction of estrogen-regulated genes differs in immortal and tumorigenic human mammary epithelial cells expressing a recombinant estrogen receptor. Mol Endocrinol 5:1613–1623[Abstract/Free Full Text]
  3. Stampfer MR, Bartley JC 1985 Induction of transformation and continuous cell lines from normal human mammary epithelial cells after exposure to benzo[a]pyrene. Proc Natl Acad Sci USA 82:2394–2398[Abstract/Free Full Text]
  4. Zajchowski DA, Webster L, Humm R, White FA, Simmons SJ, Bartholdi M 1997 Different estrogen receptor structural domains are required for estrogen- and tamoxifen-dependent anti-proliferative activity in human mammary epithelial cells expressing an exogenous estrogen receptor. J Steroid Biochem Mol Biol 62:373–383[CrossRef][Medline]
  5. Zajchowski DA, Sager R, Webster L 1993 Estrogen inhibits the growth of estrogen receptor-negative, but not estrogen receptor-positive, human mammary epithelial cells expressing a recombinant estrogen receptor. Cancer Res 53:5004–5011[Abstract/Free Full Text]
  6. Clarke RB, Howell A, Potten CS, Anderson E 1997 Dissociation between steroid receptor expression and cell proliferation in the human breast. Cancer Res 57:4987–4991[Abstract/Free Full Text]
  7. Russo J, Ao X, Grill C, Russo IH, Estrogen, progesterone receptor positive cells are not the proliferating cells in the mammary gland. Proceedings of the 89th Annual Meeting of the American Association for Cancer Research, New Orleans, LA, 1998, p 552
  8. Jordan VC 1992 The Role of Tamoxifen in the Treatment and Prevention of Breast Cancer. Mosby-Year Book, St. Louis, MO
  9. Katzenellenbogen JA, O’Malley BW, Katzenellenbogen BS 1996 Tripartite steroid hormone receptor pharmacology: interaction with multiple effector sites as a basis for the cell- and promoter-specific action of these hormones. Mol Endocrinol 10:119–131[Free Full Text]
  10. Webb P, Lopez GN, Uht RM, Kushner PJ 1995 Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol 9:443–456[Abstract/Free Full Text]
  11. Group GC Wisconsin Package, ed 9.1 Genetics Computer Group, Inc., Madison, WI, 1997
  12. Kozak M 1996 Interpreting cDNA sequences: some insights from studies on translation. Mamm Genome 7:563–574[CrossRef][Medline]
  13. Inoue S, Orimo A, Hosoi T, Kondo S, Toyoshima H, Kondo T, Ikegami A, Ouchi Y, Orimo H, Muramatsu M 1993 Genomic binding-site cloning reveals an estrogen-responsive gene that encodes a RING finger protein. Proc Natl Acad Sci USA 90:11117–11121[Abstract/Free Full Text]
  14. Kapp LN, Painter RB, Yu LC, van Loon N, Richard CW, James MR, Cox DR, Murnane JP 1992 Cloning of a candidate gene for ataxia-telangiectasia group D. Am J Hum Genet 51:45–54[Medline]
  15. Reddy BA, Etkin LD 1991 A unique bipartite cysteine-histidine motif defines a subfamily of potential zinc-finger proteins. Nucleic Acids Res 19:6330[Free Full Text]
  16. LeDouarin B, Zechel C, Garnier JM, Lutz Y, Tora L, Pierrat P, Heery P, Gronemeyer H, Chambon P, Losson R 1995 The N-terminal part of TIF1, a putative mediator of the ligand-dependent activation function (AF-2) of nuclear receptors, is fused to B-raf in the oncogenic protein T18. EMBO J 14:2020–2033[Medline]
  17. Friedman JR, Fredericks WJ, Jensen DE, Speicher DW, Huang XP, Neilson EG, Rauscher Jr F 1996 KAP-1, a novel corepressor for the highly conserved KRAB repression domain. Genes Dev 10:2067–2078[Abstract/Free Full Text]
  18. Lupas A 1996 Prediction and analysis of coiled-coil structures. Methods Enzymol 266:513–525[Medline]
  19. Freemont PS 1993 The RING finger. A novel protein sequence motif related to the zinc finger. Ann NY Acad Sci 684:174–192[Medline]
  20. Henry J, Ribouchon MT, Offer C, Pontarotti P 1997 B30.2-like domain proteins: a growing family. Biochem Biophys Res Commun 235:162–165[CrossRef][Medline]
  21. Vernet C, Boretto J, Mattei MG, Takahashi M, Jack LJ, Mather IH, Rouquier S, Pontarotti P 1993 Evolutionary study of multigenic families mapping close to the human MHC class I region. J Mol Evol 37:600–612[Medline]
  22. Reddy BA, Kloc M, Etkin L 1991 The cloning and characterization of a maternally expressed novel zinc finger nuclear phosphoprotein (xnf7) in Xenopus laevis. Dev Biol 148:107–116[CrossRef][Medline]
  23. Cao T, Shannon M, Handel MA, Etkin LD 1996 Mouse ret finger protein (rfp) proto-oncogene is expressed at specific stages of mouse spermatogenesis. Dev Genet 19:309–320[CrossRef][Medline]
  24. Mu ZM, Chin KV, Liu JH, Lozano G, Chang KS 1994 PML, a growth suppressor disrupted in acute promyelocytic leukemia. Mol Cell Biol 14:6858–6867[Abstract/Free Full Text]
  25. Patarca R, Freeman GJ, Schwartz J, Singh RP, Kong QT, Murphy E, Anderson Y, Sheng FY, Singh P, Johnson KA, Guarnagia SM, Durfee T, Blattner F, Cantor H 1988 rpt-1, an intracellular protein from helper/inducer T cells that regulates gene expression of interleukin 2 receptor and human immunodeficiency virus type I. Proc Natl Acad Sci USA 85:2733–2737[Abstract/Free Full Text]
  26. Tissot C, Mechti N 1995 Molecular cloning of a new interferon-induced factor that represses human immunodeficiency virus type 1 long terminal repeat expression. J Biol Chem 270:14891–14898[Abstract/Free Full Text]
  27. Chan EK, Di Donato F, Hamel JC, Tseng CE, Buyon JP 1995 52-kD SS-A/Ro: genomic structure and identification of an alternatively spliced transcript encoding a novel leucine zipper-minus autoantigen expressed in fetal and adult heart. J Exp Med 182:983–992[Abstract/Free Full Text]
  28. Consortium IF 1997 Ancient missense mutations in a new member of the RoRet gene family are likely to cause familial Mediterranean fever. The International FMF Consortium. Cell 90:797–807[CrossRef][Medline]
  29. Goddard AD, Borrow J, Freemont PS, Solomon E 1991 Characterization of a zinc finger gene disrupted by the t(15;17) in acute promyelocytic leukemia. Science 254:1371–1374[Abstract/Free Full Text]
  30. Takahashi M, Inaguma Y, Hiai H, Hirose F 1988 Developmentally regulated expression of a human "finger"-containing gene encoded by the 5' half of the ret transforming gene. Mol Cell Biol 8:1853–1856[Abstract/Free Full Text]
  31. Leonhardt EA, Kapp LN, Young BR, Murnane JP 1994 Nucleotide sequence analysis of a candidate gene for ataxia-telangiectasia group D (ATDC). Genomics 19:130–136[CrossRef][Medline]
  32. Henry J, Ribouchon M, Depetris D, Mattei M, Offer C, Tazi-Ahnini R, Pontarotti P 1997 Cloning, structural analysis, and mapping of the B30 and B7 multigenic families to the major histocompatibility complex (MHC) and other chromosomal regions. Immunogenetics 46:383–395[CrossRef][Medline]
  33. Campbell IG, Nicolai HM, Foulkes WD, Senger G, Stamp GW, Allan G, Boyer C, Jones K, Bast Jr RC, Solomon E 1994 A novel gene encoding a B-box protein within the BRCA1 region at 17q21.1. Hum Mol Genet 3:589–594[Abstract/Free Full Text]
  34. Ghadessy FJ, Chen D, Kini RM, Chung MCM, Jeyaseelan K, Khoo HE, Yuen R 1996 Stonustoxin is a novel lethal factor from stonefish (Synanceja horrida) venom. cDNA cloning and characterization. J Biol Chem 271:25575–25581[Abstract/Free Full Text]
  35. Ishii T, Aoki N, Noda A, Adachi T, Nakamura R, Matsuda T 1995 Carboxy-terminal cytoplasmic domain of mouse butyrophilin specifically associates with a 150-kDa protein of mammary epithelial cells and milk fat globule membrane. Biochim Biophys Acta 1245:285–292[Medline]
  36. Orimo A, Inoue S, Ikeda K, Noji S, Muramatsu M 1995 Molecular cloning, structure, and expression of mouse estrogen-responsive finger protein Efp. Co-localization with estrogen receptor mRNA in target organs. J Biol Chem 270:24406–24413[Abstract/Free Full Text]
  37. Li X, Shou W, Kloc M, Reddy BA, Etkin LD 1994 Cytoplasmic retention of Xenopus nuclear factor 7 before the mid blastula transition uses a unique anchoring mechanism involving a retention domain and several phosphorylation sites. J Cell Biol 124:7–17[Abstract/Free Full Text]
  38. Cao T, Borden KL, Freemont PS, Etkin LD 1997 Involvement of the rfp tripartite motif in protein-protein interactions and subcellular distribution. J Cell Sci 110:1563–1571[Abstract]
  39. Brzoska PM, Chen H, Zhu Y, Levin NA, Disatnik MH, Mochly-Rosen D, Murnane JP, Christman MF 1995 The product of the ataxia-telangiectasia group D complementing gene, ATDC, interacts with a protein kinase C substrate and inhibitor. Proc Natl Acad Sci USA 92:7824–7828[Abstract/Free Full Text]
  40. De Laurenzi V, Rogers GR, Hamrock DJ, Marekov LN, Steinert PM, Compton JG, Markova N, Rizzo WB 1996 Sjogren-Larsson syndrome is caused by mutations in the fatty aldehyde dehydrogenase gene. Nat Genet 12:52–57[CrossRef][Medline]
  41. Timmerman V, Raeymaekers P, De Jonghe P, De Winter G, Swerts L, Jacobs K, Gheuens J, Martin JJ, Vandenberghe A, Van Broeckhoven C 1990 Assignment of the Charcot-Marie-Tooth neuropathy type 1 (CMT 1a) gene to 17p11.2-p12. Am J Hum Genet 47:680–685[Medline]
  42. LeGuern E, Gouider R, Ravise N, Lopes J, Tardieu S, Gugenheim M, Abbas N, Bouche P, Agid Y, Brice A 1996 A de novo case of hereditary neuropathy with liability to pressure palsies (HNPP) of maternal origin: a new mechanism for deletion in 17p11.2? Hum Mol Genet 5:103–106[Abstract/Free Full Text]
  43. Silander K, Meretoja P, Nelis E, Timmerman V, Van Broeckhoven C, Aula P, Savontaus ML 1996 A de novo duplication in 17p11.2 and a novel mutation in the Po gene in two Dejerine-Sottas syndrome patients. Hum Mutat 8:304–310[CrossRef][Medline]
  44. Greenberg F, Guzzetta V, Montes de Oca-Luna R, Magenis RE, Smith AC, Richter SF, Kondo I, Dobyns WB, Patel PI, Lupski JR 1991 Molecular analysis of the Smith-Magenis syndrome: a possible contiguous-gene syndrome associated with del(17)(p11.2). Am J Hum Genet 49:1207–1218[Medline]
  45. Tora L, Mullick A, Metzger D, Ponglikitmongkol M, Park I, Chambon P 1989 The cloned human oestrogen receptor contains a mutation which alters its hormone binding properties. EMBO J 8:1981–1986[Medline]
  46. Jiang SY, Langan Fahey SM, Stella AL, McCague R, Jordan VC 1992 Point mutation of estrogen receptor (ER) in the ligand-binding domain changes the pharmacology of antiestrogens in ER-negative breast cancer cells stably expressing complementary DNAs for ER. Mol Endocrinol 6:2167–2174[Abstract/Free Full Text]
  47. Kushner PJ, Hort E, Shine J, Baxter JD, Greene GL 1990 Construction of cell lines that express high levels of the human estrogen receptor and are killed by estrogens. Mol Endocrinol 4:1465–1473[Abstract/Free Full Text]
  48. Gronemeyer H, Meyer ME 1991 Nuclear receptors. Hormones, anti-hormones and regulation of the transcription. Ann Endocrinol Paris 52:335–338[Medline]
  49. Parker MG, Arbuckle N, Dauvois S, Danielian P, White R 1993 Structure and function of the estrogen receptor. Ann NY Acad Sci 684:119–126[Medline]
  50. Green S, Kumar V, Theulaz I, Wahli W, Chambon P 1988 The N-terminal DNA-binding ‘zinc finger’ of the oestrogen and glucocorticoid receptors determines target gene specificity. EMBO J 7:3037–3044[Medline]
  51. Green S, Chambon P 1987 Oestradiol induction of a glucocorticoid-responsive gene by a chimaeric receptor. Nature 325:75–78[CrossRef][Medline]
  52. Ray A, Prefontaine KE, Ray P 1994 Down-modulation of interleukin-6 gene expression by 17 beta-estradiol in the absence of high affinity DNA binding by the estrogen receptor. J Biol Chem 269:12940–12946[Abstract/Free Full Text]
  53. Stein B, Yang MX 1995 Repression of the interleukin-6 promoter by estrogen receptor is mediated by NF-kappa B and C/EBP beta. Mol Cell Biol 15:4971–4979[Abstract/Free Full Text]
  54. Umayahara Y, Kawamori R, Watada H, Imano E, Iwama N, Morishima T, Yamasaki Y, Kajimoto Y, Kamada T 1994 Estrogen regulation of the insulin-like growth factor I gene transcription involves an AP-1 enhancer. J Biol Chem 269:16433–16442[Abstract/Free Full Text]
  55. Blobel GA, Sieff CA, Orkin SH 1995 Ligand-dependent repression of the erythroid transcription factor GATA-1 by the estrogen receptor. Mol Cell Biol 15:3147–3153[Abstract/Free Full Text]
  56. Elgort MG, Zou A, Marschke KB, Allegretto EA 1996 Estrogen and estrogen receptor antagonists stimulate transcription from the human retinoic acid receptor-{alpha}1 promoter via a novel sequence. Mol Endocrinol 10:477–487[Abstract/Free Full Text]
  57. Gaub MP, Bellard M, Scheuer I, Chambon P, Sassone Corsi P 1990 Activation of the ovalbumin gene by the estrogen receptor involves the fos-jun complex. Cell 63:1267–1276[CrossRef][Medline]
  58. Smith CL, Nawaz Z, O’Malley BW 1997 Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol Endocrinol 11:657–666[Abstract/Free Full Text]
  59. Berthois Y, Katzenellenbogen JA, Katzenellenbogen BS 1986 Phenol red in tissue culture media is a weak estrogen: implications concerning the study of estrogen-responsive cells in culture. Proc Natl Acad Sci USA 83:2496–2500[Abstract/Free Full Text]
  60. Glover JF, Irwin JT, Darbre PD 1988 Interaction of phenol red with estrogenic and antiestrogenic action on growth of human breast cancer cells ZR-75–1 and T-47-D. Cancer Res 48:3693–3697[Abstract/Free Full Text]
  61. Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:1167–1177[Abstract/Free Full Text]
  62. Green S, Walter P, Kumar V, Krust A, Bornert JM, Argos P, Chambon P 1986 Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 320:134–139[CrossRef][Medline]
  63. Band V, Sager R 1989 Distinctive traits of normal and tumor-derived human mammary epithelial cells expressed in a medium that supports long-term growth of both cell types. Proc Natl Acad Sci USA 86:1249–1253[Abstract/Free Full Text]
  64. Liang P, Pardee AB 1992 Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257:967–971[Abstract/Free Full Text]
  65. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ 1979 Isolation of biologically active ribonucleic acid from sources enriched in ribonucleases. Biochemistry 18:5294–5299[CrossRef][Medline]
  66. Zajchowski D, Band V, Pauzie N, Tager A, Stampfer M, Sager R 1988 Expression of growth factors and oncogenes in normal and tumor-derived human mammary epithelial cells. Cancer Res 48:7041–7047[Abstract/Free Full Text]
  67. Hopp TP, Prickett KS, Price VL, Libby RT, March CJ, Ceretti DP, Urdal DL, Conlon PJ 1988 A short polypeptide marker sequence useful for recombinant protein identification and purification. Bio/Technology 6:1204–1210[CrossRef]
  68. Harlow E, Lane D 1988 Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  69. Stokke T, Collins C, Kuo W-L, Kowbel D, Shadravan F, Tanner M, Kallioniemi O-P, Pinkel D, Deaven L, Gray JW 1995 A physical map of chromosome 20 established using fluorescence in situ hybridization and digital image analysis. Genomics 26:134–137[CrossRef][Medline]



This article has been cited by other articles:


Home page
Toxicol SciHome page
E. L. Hsu, D. Yoon, H. H. Choi, F. Wang, R. T. Taylor, N. Chen, R. Zhang, and O. Hankinson
A Proposed Mechanism for the Protective Effect of Dioxin against Breast Cancer
Toxicol. Sci., August 1, 2007; 98(2): 436 - 444.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
S. M Johnson, M. Maleki-Dizaji, J. A Styles, and I. N H White
Ishikawa cells exhibit differential gene expression profiles in response to oestradiol or 4-hydroxytamoxifen
Endocr. Relat. Cancer, June 1, 2007; 14(2): 337 - 350.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. B. Cheung, J. Bell, A. Raif, A. Bohlken, J. Yan, B. Roediger, A. Poljak, S. Smith, M. Lee, W. D. Thomas, et al.
The Estrogen-responsive B Box Protein Is a Novel Regulator of the Retinoid Signal
J. Biol. Chem., June 30, 2006; 281(26): 18246 - 18256.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Becker, A. Sommer, J. R. Kratzschmar, H. Seidel, H.-D. Pohlenz, and I. Fichtner
Distinct gene expression patterns in a tamoxifen-sensitive human mammary carcinoma xenograft and its tamoxifen-resistant subline MaCa 3366/TAM
Mol. Cancer Ther., January 1, 2005; 4(1): 151 - 170.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-D. Beer, C. Munding, N. Dubois, C. Mamie, D. Hohl, and S. Werner
The Estrogen-responsive B Box Protein. A NOVEL REGULATOR OF KERATINOCYTE DIFFERENTIATION
J. Biol. Chem., May 31, 2002; 277(23): 20740 - 20749.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. A. Zajchowski, M. F. Bartholdi, Y. Gong, L. Webster, H.-L. Liu, A. Munishkin, C. Beauheim, S. Harvey, S. P. Ethier, and P. H. Johnson
Identification of Gene Expression Profiles That Predict the Aggressive Behavior of Breast Cancer Cells
Cancer Res., July 1, 2001; 61(13): 5168 - 5178.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
B. S. Shoker, C. Jarvis, R. B. Clarke, E. Anderson, J. Hewlett, M. P. A. Davies, D. R. Sibson, and J. P. Sloane
Estrogen Receptor-Positive Proliferating Cells in the Normal and Precancerous Breast
Am. J. Pathol., December 1, 1999; 155(6): 1811 - 1815.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
P. Webb, P. Nguyen, C. Valentine, G. N. Lopez, G. R. Kwok, E. McInerney, B. S. Katzenellenbogen, E. Enmark, J.-A. Gustafsson, S. Nilsson, et al.
The Estrogen Receptor Enhances AP-1 Activity by Two Distinct Mechanisms with Different Requirements for Receptor Transactivation Functions
Mol. Endocrinol., October 1, 1999; 13(10): 1672 - 1685.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
D. A. Zajchowski, K. Kauser, D. Zhu, L. Webster, S. Aberle, F. A. White III, H.-L. Liu, R. Humm, J. MacRobbie, P. Ponte, et al.
Identification of Selective Estrogen Receptor Modulators by Their Gene Expression Fingerprints
J. Biol. Chem., May 19, 2000; 275(21): 15885 - 15894.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, H.-L. C.
Right arrow Articles by Zajchowski, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, H.-L. C.
Right arrow Articles by Zajchowski, D. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals