help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Olson, L. K.
Right arrow Articles by Poitout, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Olson, L. K.
Right arrow Articles by Poitout, V.
Molecular Endocrinology 12 (2): 207-219
Copyright © 1998 by The Endocrine Society

Glucose Rapidly and Reversibly Decreases INS-1 Cell Insulin Gene Transcription via Decrements in STF-1 and C1 Activator Transcription Factor Activity

L. Karl Olson, Jin Qian and Vincent Poitout

Department of Physiology (L.K.O., J.Q.) Michigan State University East Lansing, Michigan 48824-1101
INSERM U341 (V.P.) Service de Diabetologie, Hôtel Dieu 75004 Paris, France


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have reported that chronic exposure of HIT-T15 cells to supraphysiological concentrations of glucose over many months leads to decreased insulin gene transcription and decreased binding activities of two ß-cell-specific transcription factors, STF-1 and C1 activators, and have postulated that these events may provide a mechanism for glucose toxicity on ß-cell function. We now report that culturing the highly differentiated rat insulinoma cell line, INS-1, in glucose concentrations above 8.0 mM caused a marked decrease in insulin mRNA levels within 24 h. The decrease in insulin mRNA levels was reversed by further incubation of the cells in 4.0 mM glucose. Transient transfection of a chloramphenicol acetyltransferase reporter gene regulated by the 5'-regulatory sequences of the human insulin gene showed that elevated glucose concentrations caused a large decrease in insulin gene promoter activity. The decrease in insulin gene promoter activity was associated with reductions in the binding activities of both STF-1 and C1 activator, and these were partially reversed by lowering the glucose concentration. The decrease in STF-1 binding activity was associated with decreased STF-1 mRNA and occurred independently of changes in STF-1 promoter activity, suggesting a posttranscriptional regulatory mechanism. Furthermore, the decrease in insulin gene expression was found to occur independently of changes in cell proliferation. We conclude that physiologically relevent elevations in glucose can reversibly diminish insulin gene transcription by reducing the expression and/or binding activity of two critical ß-cell transcription factors.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Insulin gene expression is highly restricted in adult mammals to pancreatic ß-cells residing in the islets of Langerhans. Tissue-specific transcription of the insulin gene is regulated by DNA sequences residing 5' to the insulin gene transcription start site (reviewed in Refs. 1 and 2). Several transcription factors have been identified that bind and regulate discrete insulin gene cis-acting promoter elements. The names of these promoter elements have been recently simplified (3), and the new nomenclature will be used throughout this manuscript. One of these cis elements includes the highly conserved E1 element [previously termed NIR box or insulin control element (ICE) (3)] which binds insulin enhancer factor 1 (IEF1) (4), a heterodimer of two helix-loop-helix factors, including the ubiquitously expressed proteins E12/E47 (5) and a ß-cell-specific factor likely to be BETA2 (6) and/or INSAF (7). Within the rat insulin 1 gene there is an additional distal E box element, termed the E2 element, that also binds IEF1. However, the E2 element is poorly conserved in the rat insulin II and human insulin genes. Two A-T-rich elements termed the A1 and A3 elements [previously termed the CT1 and CT2 motifs (3)] are highly conserved among all characterized mammalian genes (8, 9, 10, 11). The gene encoding the predominant ß-cell binding activity to the A1 and A3 elements has recently been isolated by three independent laboratories and is termed STF-1 (12), IPF1 (13), and IDX-1 (14). STF-1 is a homeotic transcription factor expressed selectively in cells of the pancreas and duodenum (14, 15). In the adult islet, STF-1 protein staining is predominant in the nuclei of insulin-producing ß-cells (11, 16). STF-1 has been shown to regulate insulin gene promoter activity (13, 17), and this regulation is dependent upon an intact E1 element (18) and functional synergism with the helix-loop-helix factor, E47 (16). In addition to IEF1- and STF-1-binding sites, insulin gene transcription requires a highly conserved, mutationally sensitive regulatory element termed the C1 element [previously termed RIPE3b1 (3)], which binds a poorly described protein termed here C1 activator (RIPE3b1) (19, 20, 21).

We have previously reported that prolonged exposure over many months of the ß-cell line, the HIT-T15 cell (22), to supraphysiological concentrations of glucose caused decreased insulin content, insulin mRNA levels, and insulin gene promoter activity (23, 24). These phenotypic changes could be prevented, but not completely reversed, by chronically culturing this cell line in more physiological concentrations of glucose (23, 24). The reduction in insulin gene transcription was associated with reduced binding of two ß-cell-specific transcription factors, STF-1 and C1 activator (25, 26). The mechanism whereby chronic exposure of HIT cells to elevated glucose reduced STF-1 binding activity appeared to involve a reduction in STF-1 mRNA levels resulting from a posttranscriptional mechanism (25). Our observations in HIT cells suggested that one potential mechanism whereby chronic hyperglycemia can adversely affect pancreatic ß-cell function is by decreasing insulin gene transcription.

A highly differentiated rat insulinoma cell line, INS-1 cell, has been described that secretes insulin in response to changes in glucose concentrations with an ED50 similar to that of the pancreatic islet (27, 28). Incubation of INS-1 cells in elevated glucose concentrations has been shown to induce mRNA levels for GLUT2 (29), pyruvate kinase (30), and acetyl-coenzyme A (CoA) carboxylase (31). Glucose induction of pyruvate kinase (30), acetyl-CoA carboxylase (32), and GLUT2 (29) mRNA resulted from increased gene transcription. In contrast, elevated glucose concentrations have been reported to paradoxically decrease insulin gene transcription in INS-1 cells (30). Studies described herein were performed to determine whether the glucose-induced reduction in insulin gene transcription involved alterations in STF-1-, C1 activator-, and/or IEF1-binding activities, and, if so, the mechanism for diminished STF-1 binding.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Effect of Elevated Glucose Concentrations on Insulin mRNA Levels
INS-1 cells were incubated in 4.0, 10.0, or 16.7 mM glucose for the indicated lengths of time, after which insulin mRNA levels were determined by Northern analysis. INS-1 cells incubated in 16.7 mM glucose for 48 or 96 h had an approximately 80% decrease in insulin mRNA levels compared with control INS-1 cells incubated in 4.0 mM glucose (Fig. 1Go, compare lanes 1 and 2 to lanes 6 and 8). INS-1 cells incubated in 10 mM glucose for 48 h had greater than a 50% decrease in insulin mRNA levels compared with control cells (Fig. 1Go, compare lanes 1 and 2 to lanes 3 and 5). When INS-1 cells that were previously incubated for 48 h in either 10.0 or 16.7 mM glucose were further incubated for an additional 48 h in 4.0 mM glucose, insulin mRNA levels increased (Fig. 1Go, compare lanes 4–5 and lanes 7–8), indicating that the decreases in insulin mRNA levels were readily reversible. The various glucose conditions and incubation times had no apparent effect on levels of ß-actin mRNA.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 1. Effect of Different Glucose Concentrations on Insulin mRNA Levels in INS-1 Cells

INS-1 cells were cultured in RPMI-1640 containing either 4.0 mM (lanes 1 and 2), 10.0 mM (lanes 3 and 5), or 16.7 mM (lanes 6 and 8) glucose for 48 h (lanes 1, 3, and 6) or 96 h (lanes 2, 5, and 8). INS-1 cells were also incubated in 10.0 mM (lane 4) or 16.7 mM (lane 7) glucose for 48 h and then incubated for an additional 48 h in 4.0 mM glucose. Total RNA was then isolated, fractionated by denaturing electrophoresis, transferred to nylon, and hybridized with both 32P-labeled Syrian hamster preproinsulin and human ß-actin probes. This is a representative Northern blot from three identical experiments that yield similar results.

 
The glucose concentration- and time-dependence for the decrease in insulin mRNA levels in INS-1 cells was determined by slot blot analysis. INS-1 cells incubated in either 4.0 or 6.0 mM glucose for 4–48 h demonstrated no change in insulin mRNA levels (Fig. 2Go). In contrast, cells incubated in 8.0 mM glucose showed a small decrease in insulin mRNA levels that became apparent after 24 h. INS-1 cells incubated in 10.0, 12.0, or 14.0 mM glucose showed even further decreases in insulin mRNA levels that were also apparent after 24 h.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Time Course and Glucose Concentration Dependence for the Reduction of Insulin mRNA Levels in INS-1 Cells

INS-1 cells were cultured in either 4.0, 6.0, 8.0, 10.0, 12.0, or 14.0 mM glucose for the indicated lengths of time. Total RNA was isolated and transferred to a nylon hybridization membrane by slot-blot. Identically loaded membranes were then hybridized with either 32P-labeled Syrian hamster preproinsulin or human ß-actin probes. Insulin and ß-actin mRNA levels were then quantitated using a PhosphoImager. Data are expressed as the ratio of insulin mRNA to ß-actin mRNA normalized to 4.0 mM glucose. Values are the mean ± SD of four individual experiments.

 
Effect of Elevated Glucose Concentrations on Insulin Gene Promoter Activity
To assess insulin promoter activity INS-1 cells were transiently transfected with an insulin CAT reporter gene (INSCAT) in which chloramphenicol acetyl transferase (CAT) gene expression is regulated by the human insulin promoter/enhancer sequences -326 to +30 (24). INS-1 cells incubated in 16.7 mM glucose showed a 80% reduction in INSCAT expression compared with INS-1 cells incubated in 4.0 mM glucose (Fig. 3AGo). Elevated glucose concentrations also repressed the expression of a rat insulin II promoter-regulated reporter gene (data not shown), suggesting that this glucose effect is not unique to sequences contained in the human insulin promoter.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. The Effect of Glucose on Insulin (Panel A) or Pyruvate Kinase (Panel B) Promoter Activity in INS-1 Cells

INS-1 cells were subcultured in 11.1 mM glucose for 2 days and then transiently transfected with an insulin CAT reporter gene (INSCAT) or a pyruvate kinase CAT reporter gene (PKCAT) in 4.0 mM glucose for 4.0 h. The cells were then incubated for 30 h in either 4.0 mM glucose, 16.7 mM glucose, or 16.7 mM glucose plus 16.7 mM mannoheptulose. Cells were then harvested and assayed for CAT activity. Data are normalized to the level of reporter gene expression measured in cells treated with 4.0 mM glucose. Values are the mean ± SE of three individual experiments.

 
To examine whether the repression of INSCAT expression was a generalized or selective repression, we tested whether the pyruvate kinase promoter sequences -197 to +12 could be activated by glucose in INS-1 cells transiently transfected with pyruvate kinase CAT reporter gene (PKCAT). Expression of similar pyruvate kinase reporter gene has previously been shown to be induced by glucose in INS-1 cells (30). INS-1 cells incubated in 16.7 mM glucose showed a 10-fold induction in PKCAT expression compared with cells incubated in 4.0 mM glucose (Fig. 3BGo). Both the inhibition of INSCAT and the activation of PKCAT by glucose were blocked by the addition of mannoheptulose (Fig. 3Go), indicating that glucose phosphorylation is required for these events to occur.

Effect of Elevated Glucose Concentrations on the Binding Activities of C1, A3, and E1 Activators
We have shown previously that decreased STF-1 and C1 activator binding is associated with decreased insulin promoter activity in HIT cells chronically cultured in a supraphysiological glucose concentration (24, 25, 26). Thus, we tested whether a similar decrease in binding activity of these two transcription factors was associated with the loss of insulin promoter activity in INS-1 cells. Nuclear extracts isolated from INS-1 cells cultured in 16.7 mM glucose for 48 h had greater than a 50% reduction in C1 (Fig. 4AGo, compare lanes 1 and 2) and A3 binding activity compared with cells incubated in 4.0 mM glucose (Fig. 4AGo, compare lanes 6 and 7). Incubating the cells in 16.7 mM glucose for an additional 48 h led to a further reduction in C1 binding (Fig. 4AGo, compare lanes 2 and 5). A3 binding was also lower in cells treated with 16.7 mM glucose for 96 h than in cells treated in 4.0 mM glucose for 96 h (Fig. 4AGo, compare lanes 8 and 10). In contrast, incubating cells in 16.7 mM glucose increased E1 binding activity by approximately 1.25-fold compared with cells incubated in 4.0 mM glucose for 48 and 96 h (Fig. 4AGo, lanes 11–15). When INS-1 cells that were previously incubated for 48 h in 16.7 mM glucose were further incubated for 48 h in 4.0 mM glucose, there was nearly complete recovery in binding activity of the A3 activator (Fig. 4AGo, compare lanes 9 and 10). In addition, C1 element binding increased when cells were switched from 16.7 mM glucose to 4.0 mM glucose for 48 h (Fig. 4AGo, compare lanes 4 and 5); however, the reduction in binding was not completely reversed. Specificity of the C1- and A3-binding complexes were analyzed by oligodeoxynucleotide competition (Fig. 4BGo). Extracts isolated from INS-1 cells incubated in 4.0 mM glucose showed binding to both the C1 and A3 oligodeoxynucleotide probes. These binding activities were shown to be specific because they were readily competed by an excess of the appropriate unlabeled probe, whereas the binding activities were not displaced by probes containing mutated binding sites.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. Effect of Glucose on the Binding Activities of C1, A3, and E1 Activators in INS-1 Cells

Panel A, Equal concentrations of INS-1 cells nuclear extracts were analyzed by EMSA for binding to C1, A3, and E1 containing 32P-labeled probes. INS-1 cells cultured in RPMI-1640 containing either 4.0 mM (lanes 1, 3, 6, 8, 11, and 13) or 16.7 mM (lanes 2, 5, 7, 10, 12, and 15) glucose for 48 h (lanes 1, 2, 6, 7, 11, and 12) or 96 h (lanes 3, 5, 8, 10, 13, and 15). INS-1 cells were incubated in 16.7 mM glucose for 48 h and then incubated for an additional 48 h in 4.0 mM glucose (lanes 4, 9, and 14). EMSA with C1 (lanes 1–5), A3 (lanes 6–10), and E1 (lanes 11–15) probes. Arrows indicate the position of the specific complexes. Panel B, Competition analysis of C1- and A3-binding complexes. Equal amounts of INS-1 nuclear extracts isolated from cells incubated in 4.0 mM glucose for 48 h were added. EMSA with C1 (lanes 1–3) and A3 (lanes 4–6) elements. Competition with a 100-fold molar excess of unlabeled wild-type (WT) C1 (lane 2) or mutant (M) C1 (lane 3) or wild-type A3 (lane 5), or mutant A3 (lane 6). Panel C, Supershift of the A3- binding complex with affinity-purified anti-N-terminal XIHbox8 antibodies. Equal concentrations (5 µg) of nuclear extract isolated from INS-1 cells incubated for 48 h in 4.0 mM (lanes 1 and 3) or 16.7 mM glucose (lanes 2 and 4) were analyzed for A3 binding in the absence (lanes 1 and 2) or presence (lanes 3 and 4) of 2 µl anti-N-terminal XIHbox8 antibodies. The supershifted complex is indicated with an asterisk.

 
The binding characteristics of the A3-binding complex suggest that it consists of the ß-cell transcription factor, STF-1 (25). To determine whether the A3-binding complex corresponded to STF-1, we tested the effect of adding an affinity-purified antiserum against the N-terminal region of the XIHbox8 protein. This anti-N-terminal XIHbox8 antiserum was raised against amino acids 1 through 75 of the XIHbox8 protein, and this region is highly conserved within the STF-1 protein (11). Previous studies have shown that the anti-N-terminal XIHbox8 antiserum specifically supershifts the STF-1 protein-DNA complex using HIT cell nuclear extracts (11, 25). Gel shift analyses were performed using nuclear extracts from INS-1 cells cultured in 4.0 mM or 16.7 mM glucose for 48 h. As described above, the A3-binding complex was significantly reduced in cells incubated with 16.7 mM glucose compared with 4.0 mM glucose (Fig. 4CGo, lanes 1 and 2). Addition of XIHbox8 N-terminal antibodies to INS-1 nuclear extracts supershifted the A3-binding complex (Fig. 4CGo, lanes 3 and 4). In contrast, addition of USF-1 antibodies had no effect on the A3-binding complex (data not shown). Overall these results suggest that the A3-binding complex contains the STF-1 protein and that the binding activity is markedly reduced in INS-1 cells cultured in 16.7 mM glucose.

In contrast to INS-1 cells, incubation of early passages (P70s) HIT cells for 30 h in 16.7 mM glucose increased the expression of the INSCAT reporter gene by 1.35 ± 0.07-fold (mean ± SE, n = 3) compared with cells incubated in 0.8 mM glucose (Fig. 5AGo). Nuclear extracts isolated from HIT cells incubated for 48 h in 0.8 mM, 4.0 mM, or 16.7 mM glucose had no significant differences in binding activities to the A3 DNA probe (Fig. 5BGo). However, nuclear extracts isolated from HIT cells incubated in either 4.0 mM or 16.7 mM glucose had increased binding activities to the C1 DNA probe.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 5. Effect of Glucose on Insulin Promoter Activity and A3- and C1-Binding Activities in HIT-T15 Cells

Panel A, HIT-T15 cells were subcultured in 0.8 mM glucose for 2 days and then transiently transfected with INSCAT for 4.0 h. The cells were then incubated for 30 h in either 0.8 mM, 4.0 mM, or 16.7 mM glucose. Cells were then harvested and assayed for CAT activity. Values are the mean ± SE of three individual experiments. Panel B, HIT-T15 cells were incubated in 0.8 mM, 4.0 mM, or 16.7 mM glucose for 48 h, and nuclear extracts were prepared. Equal concentrations of nuclear extracts were then analyzed by EMSA for binding to A3 and C1 containing 32P-labeled probes.

 
Effect of Elevated Glucose Concentrations on STF-1 mRNA Levels and STF-1 Promoter Activity
We have shown previously that decreased STF-1 binding in HIT cells chronically cultured in an elevated glucose concentration is associated with a posttranscriptional reduction in STF-1 mRNA levels (25). Thus, we tested whether the reduction of STF-1 binding in INS-1 cells in response to elevated glucose concentrations was also associated with decreased STF-1 RNA levels and STF-1 promoter activity. As shown for insulin mRNA, incubation of INS-1 cells in 16.7 mM glucose for 48 or 96 h reduced the expression of STF-1 mRNA (~1.9-kb hybridizing species) to 27.8 ± 3.3% (n = 3) or 30.7 ± 5.6% (n = 3), respectively, of that observed in control cells incubated in 4.0 mM glucose (Fig. 6Go, compare lanes 1 and 2 to lanes 3 and 5). STF-1 mRNA levels were completely restored (1.15 ± 0.192-fold, n = 3) when cells that had been incubated for 48 h in 16.7 mM glucose were incubated for an additional 48 h in 4.0 mM glucose (Fig. 6Go, compare lanes 4 to 5). As observed with the 1.9-kb STF-1 hybridizing mRNA species, a large (~7 kb) STF-1 hybridizing RNA species was shown to be glucose sensitive (Fig. 6Go). Incubation of INS-1 cells in 16.7 mM glucose reduced the expression of this STF-1 hybridizing species to 15.0 ± 3.8% or 17.1 ± 9.5% in 48 h or 96 h, respectively (Fig. 6Go, compare lanes 1 and 2 to lanes 3 and 5). Changing the glucose concentration from 16.7 mM to 4.0 mM glucose also led to a complete recovery (1.36 ± 0.43-fold, n = 3) of this large STF-1 hybridizing species.



View larger version (75K):
[in this window]
[in a new window]
 
Figure 6. Effect of Different Glucose Concentrations on STF-1 mRNA Levels in INS-1 Cells

INS-1 cells were cultured in RPMI-1640 containing either 4.0 mM (lanes 1 and 2) or 16.7 mM (lanes 3 and 7) glucose for 48 h (lanes 1 and 3) or 96 h (lanes 2 and 5). INS-1 cells were also incubated in 16.7 mM (lane 4) glucose for 48 h and then incubated for an additional 48 h in 4.0 mM glucose. Total RNA was then isolated, fractionated by denaturing gel electrophoresis, transferred to nylon, and hybridized with a 32P-labeled rat STF-1 probe. The Northern blot was then stripped and reprobed for ß-actin (lower panel) to ensure even loading. Northern blots were visualized by autoradiography and quantitated with a PhosphoImager. This is a representative Northern blot from three identical experiments that yield similar results.

 
STF-1 promoter activity was assessed using two luciferase reporter genes regulated by STF-1 sequences -6500 to +68 (STF-1[-6.5 kb]LUC) or -190 to +78 (STF-1[-190]LUC). STF-1[-6.5 kb]LUC contains sufficient STF-1 promoter sequences for ß-cell-specific expression of this reporter gene (33). INS-1 cells were transfected with either STF-1[-6.5 kb]LUC or STF-1[-190]LUC and then incubated for 24 h in 4.0 or 16.7 mM glucose. The expression of STF-1[-6.5 kb]LUC was ~10-fold higher than the expression of STF-1[-190]LUC in INS-1 cells irrespective of the glucose concentration (Fig. 7AGo). The reduced expression of STF-1[-190]LUC compared with STF[-6.5 kb]LUC in INS-1 cells is consistent with observations in HIT cells demonstrating that islet-specific expression of the STF-1 promoter is regulated by a distal enhancer sequence (33). Interestingly, there was no difference in the expression of either STF-1[-190]LUC or STF-1[-6.5 kb]LUC when cells were treated with either 4.0 mM or 16.7 mM glucose (Fig. 7Go). To verify that 16.7 mM glucose can reduce insulin promoter activity while not affecting STF-1 promoter activity, we simultaneously measured INSCAT and STF-1[-190]LUC or STF-1[-6.5 kb]LUC expression in cotransfected INS-1 cells. Elevated glucose concentrations for 24 h or 48 h had no effect or a slight stimulatory effect on expression of either STF-1[-190]LUC or STF-1[-6.5 kb]LUC (Fig. 7BGo). In contrast, incubation of these same cells in 16.7 mM glucose for 24 h or 48 h reduced INSCAT expression by ~60% and ~85%, respectively (Fig. 7BGo). Overall, these data suggest that the reduction in STF-1 RNA levels results from a change in posttranscriptional processing.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 7. The Effect of Glucose on STF-1 Promoter Activity in INS-1 Cells

Panel A, Cells were transiently transfected with STF-1 reporter genes regulated by sequences -190 to +78 (STF-1[-190]LUC) or -6500 to +68 (STF-1[-6.5 kb]LUC) and then incubated for 24 h in 4.0 mM glucose or 16.7 mM glucose. Data are normalized to STF-1[-190]LUC expression in cells incubated in 4.0 mM glucose. Values are the mean ± SD of 12 individual experiments. Panel B, Cells were cotransfected with either STF-1[-190]LUC or STF-1[-6.5 kb]LUC and INSCAT and then incubated for 24 or 48 h in 4.0 mM or 16.7 mM glucose. Data are normalized to expression level for each reporter gene in cells incubated in 4.0 mM glucose for 24 h or 48 h.

 
Decreased Insulin Gene Expression in INS-1 Cells Incubated in Elevated Glucose Concentrations Is Independent of Changes in Cellular Proliferation
It has been reported that culturing INS-1 cells in elevated glucose concentrations markedly increased DNA synthesis and cellular proliferation (34). We have also found that culturing INS-1 cells in 16.7 mM glucose for 24 h causes a 1.23 ± 0.06-fold (mean ± SD, n = 7) increase in cell number compared with cells cultured in 4.0 mM glucose. In addition, incubating INS-1 cells in 16.7 mM glucose markedly alters the cell cycle distribution as determined by propidium staining and flow cytometry. When INS-1 cells were incubated in 4.0 mM glucose for 24 h, 85.07 ± 1.10%, 10.77 ± 0.47%, and 4.17 ± 0.81% of the cells were in the G1, S, and G2 phases of the cell cycle, respectively. In contrast, when INS-1 cells were incubated in 16.7 mM glucose for 24 h, the cell cycle distribution changed to 65.90 ± 0.28%, 24.2 ± 0.85%, and 9.85 ± 0.64% of the cells in G1, S, and G2 phases, respectively.

The ability of glucose to increase INS-1 cell proliferation raised the concern that the observed decrease in insulin gene expression was a direct result of enhanced cellular proliferation. To examine this possibility, we arrested INS-1 cell proliferation by overexpressing the cyclin-dependent protein kinase inhibitor, p21Cip1/WAF1 (35, 36, 37, 38, 39), using a recombinant adeno-virus, termed AdCMV-p21. The major function of p21Cip1/WAF1 is to mediate the G1 checkpoint in the cell cycle (40, 41, 42). Infection of INS-1 cells with AdCMV-p21 led to a large increase in p21Cip1/WAF1 protein levels compared with uninfected cells or cells infected with a control adenovirus that expresses ß-galactosidase (AdCMV-ßGAL) (Fig. 8AGo). When AdCMV-ßGAL-infected INS-1 cells were incubated in 4.0 mM glucose for 24 h, 70.9%, 22.3%, and 6.9% of the cells were in the G1, S, and G2 phases of the cell cycle, respectively (Fig. 8BGo). When AdCMV-ßGAL-infected INS-1 cells were incubated in 16.7 mM glucose for 24 h, the cell cycle distribution changed to 42.4%, 36.3%, and 21.3% of the cells in G1, S, and G2 phases, respectively. In sharp contrast, 16.7 mM glucose did not alter the cell cycle distribution of AdCMV-p21-infected INS-1 cells (Fig. 8BGo). In fact, in both 4.0 mM and 16.7 mM glucose, greater than 90% of the AdCMV-p21-infected cells were arrested in G1 phase. Although nearly all the AdCMV-p21-infected cells were in G1 arrest, incubation of cells with 16.7 mM glucose for 24 h still led to a marked reduction in insulin mRNA levels when compared with cells incubated in 4.0 mM glucose (Fig. 8CGo). Overall, these results indicate that the changes in insulin gene expression brought about by exposure of INS-1 cells to elevated glucose concentrations are independent of changes in cellular proliferation.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 8. Decreased Insulin Gene Expression in INS-1 Cultured in Elevated Glucose Concentrations Is Independent of Changes in Cellular Proliferation

Panel A, Western analysis for p21Cip1/WAF1 protein expression in INS-1 cells infected with AdCMV-p21. INS-1 cells were preincubated in 4.0 mM glucose for 24 h and then infected with no virus or AdCMV-ßGAL or AdCMV-p21 adenoviruses (>50 pfu per cell) for 2 h. Cells were then incubated for 24 h, and cellular extracts were prepared and analyzed by Western analysis. Lane 1, Control cells; lane 2, AdCMV-p21-infected cells; and lane 3, AdCMV-ßGAL-infected cells. Panel B, Cell cycle analysis of cells infected with either AdCMV-ßGAL or AdCMV-p21. INS-1 cells were preincubated in 4.0 mM glucose for 24 h and then infected with no virus or AdCMV-ßGAL or AdCMV-p21 adenoviruses (>50 pfu/cell) for 2 h. The cells were then incubated for an additional 16 h in 4.0 mM glucose. Cells were then incubated in either 4.0 mM or 16.7 mM glucose for 24 h. Cells were then harvested for flow cytometric analysis. Panel C, Northern analysis for insulin gene expression in cells infected with no virus or AdCMV-ßGAL or AdCMV-p21 adenoviruses. Cells were treated as described for panel B and harvested for Northern analysis. Lanes 1 and 2, Control cells; lanes 3 and 4, AdCMV-ßGAL-infected cells, lanes 5 and 6, AdCMV-p21-infected cells. Lanes 1, 3, and 5, Cells incubated in 4.0 mM glucose; lanes 2, 4, and 6, cells incubated in 16.7 mM glucose.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The results reported herein demonstrate that elevations in glucose concentration can alter the phenotypic behavior of the INS-1 cell. Elevations in glucose concentrations above 8.0 mM glucose led to a rapid (within 24 h) decrease in insulin mRNA levels in INS-1 cells. The decrease in insulin mRNA levels was due, in part, to a rapid decrease in insulin promoter activity that likely reflects a reduction in insulin gene transcription. These results are in agreement with Marie et al. (30) who has previously described that 33.0 mM glucose can repress endogenous insulin gene transcription in INS-1 cells. The reduction in insulin promoter activity was associated with a decrease in the binding activities of STF-1 and C1 activator. The reductions of insulin mRNA levels, insulin promoter activity, and binding activities of the two transcription factors were reversible when the glucose concentrations in which the cells were incubated was switched to 4.0 mM.

Elevations in ambient glucose concentrations generally increase insulin biosynthesis by increasing insulin translation, insulin mRNA stability, and insulin gene transcription (reviewed in Ref.43). Regulatory sites within the insulin gene promoter involved in acute glucose-induced insulin gene transcription include the E1 and E2 elements (44, 45), the C1 element (45), and the A3 element (46). Enhanced binding activity to the E2 (44), C1 (45), and A3 elements (46) in response to elevated glucose concentrations have been reported. The enhanced binding activity to the E2 element contains E12/E47 (44) and is likely to contain the ß-cell-specific factor BETA2 (6) or INSAF (7), while the enhanced binding activity to the A3 element has been shown to be STF-1 (47). The enhanced binding of STF-1 in response to elevated glucose requires glucose metabolism and is dependent on phosphorylation (47). The time-dependent and reversible loss of insulin gene promoter activity in response to glucose elevations in INS-1 cells is seemingly paradoxical, but it is noteworthy that it involves two of the binding factors (STF-1 and C1 activator) important in the acute regulation of insulin gene transcription by glucose.

The mechanism whereby elevations in glucose concentration decrease the binding of STF-1 involves decreased expression of STF-1 mRNA. Interestingly, the reduction in STF-1 mRNA is associated with no change in the promoter activity of STF-1. The STF-1[-6.5 kb]LUC reporter gene contains sufficient regulatory information such that it is expressed in a ß-cell-specific manner (33); therefore, we believe that expression of this reporter gene directly reflects endogenous STF-1 transcription and that our data suggest that the reduction in STF-1 mRNA levels occurs through a posttranscriptional mechanism. A large STF-1-hybridizing RNA species (~7 kb) was also detected in INS-1 cells. A similar sized STF-1 RNA-hybridizing species has also been identified in HIT (25) and ßTC6 cells and isolated mouse and rat islets (L. K. Olson and R. Stein, unpublished observation). Levels of this large STF-1-hybridizing RNA also decreased in response to elevated glucose concentrations. Although the nature of this large STF-1-hybridizing RNA still remains to be determined, it is detectable by STF-1 probes containing sequences +331 to +717, +714 to +1182, and +946 to +1182, suggesting that it is related to STF-1. It is noteworthy that chronic passaging of HIT cells in elevated glucose concentrations also reduced STF-1 mRNA levels without altering endogenous STF-1 gene transcription. Thus, posttranscriptional regulation of STF-1 mRNA appears to play an important role in maintenance of the insulinoma phenotype; however, this regulatory mechanism of STF-1 expression in vivo has yet to be established. Elucidation of the mechanism whereby elevated glucose decreases the binding of C1 activator must await cloning of the gene responsible for synthesis of this factor.

The results presented here also provide important insight into the relative importance of various regulatory factors known to regulate the insulin promoter. We show that elevated glucose concentration decreases both the binding of STF-1 and C1 activator. In contrast, elevated glucose increased the binding activity of E1 activator (IEF1). The observation that elevated glucose increases E1 activator binding in INS-1 is in agreement with the observation by German and Wang (44) that elevated glucose concentrations increased binding to E2 element in isolated adult islets. Although we observed enhanced E1 element binding in response to elevated glucose, this is insufficient to support insulin promoter activity in the absence of STF-1 and C1 activator. This provides additional evidence that STF-1 and C1 activator are critical for insulin gene promoter activity; however, we cannot exclude the possibility that elevations in glucose concentrations are reducing binding activities of other required factors. This is also consistent with the recent report that glucagonoma cells that express the E1 activator do not express the insulin gene, whereas overexpression of STF-1 within this cell line, but not cell lines devoid of the E1 activator, induces endogenous insulin gene expression (48). It is noteworthy that the reduction of insulin mRNA levels in INS-1 cell by elevated glucose concentrations is rapidly reversed by lowering the glucose concentration and that the increase in insulin mRNA levels temporally coincides with increased STF-1 binding activity and STF-1 mRNA levels, but not with C1 activator-binding activity. These data may suggest that the insulin-producing phenotype of INS-1 cells is more sensitive to the loss of STF-1 levels than to C1 activator levels. It is, however, important to point out that transient transfection of STF-1 expression vectors is not sufficient to significantly reconstitute insulin promoter activity in INS-1 cells incubated in elevated glucose concentrations (L. K. Olson, unpublished observation). The inability of STF-1 to reconstitute insulin promoter activity is likely due to the decrease in C1 activator-binding activity or to altered expression of other regulatory factors.

Although the mechanism whereby glucose alters the insulin-producing phenotype of the INS-1 cell is uncertain, it is doubtful that it results from a general defect in glucose signaling because we observed that the pyruvate kinase gene promoter activity is still markedly glucose-responsive in INS-1 cells cultured in supraphysiological glucose concentrations. Because mannoheptulose is capable of inhibiting the glucose-induced changes in INS-1 phenotype, it is likely that a glucose metabolite is required for the effect. Frodin et al. (34) reported previously that elevations in glucose concentrations increase INS-1 cell proliferation. We have also observed that elevations in glucose increase INS-1 cell proliferation. This has raised the concern that elevated glucose concentrations decrease insulin gene expression by directly increasing cell proliferation. However, overexpression of the cyclin-dependent protein kinase inhibitor, p21Cip1/WAF1, which arrested the majority of the INS-1 cells in the G1 phase of the cell cycle, had no effect on the ability of elevated glucose to decrease insulin gene expression. This observation strongly supports the notion that the glucose-induced changes in INS-1 phenotype are unrelated to changes in cellular proliferation.

We suggested previously that one potential mechanism whereby chronic hyperglycemia can exacerbate pancreatic ß-cell defects in type II diabetic patients is by decreasing the rate of insulin gene transcription. This proposal is based on our observations that chronic exposure of HIT cells to an elevated glucose concentration (11.1 mM) decreased insulin mRNA levels and promoter activity (23, 24). However, several distinctions exist between the glucose-induced phenotypic changes in INS-1 cells and HIT cells. In HIT cells, the reduction in insulin gene transcription and the associated decrease in STF-1 and C1 activator binding required many months of glucose exposure (24, 25, 26) and were only slightly reversed by lowering the glucose concentration (49). In contrast, these events occurred in INS-1 cells within 48 h of glucose exposure and were readily reversed. In both cell lines, the reduction in STF-1-binding activity was associated with decreased STF-1 mRNA levels that occurred via a posttranscriptional mechanism (25). In HIT cells the reduction in STF-1 mRNA levels was associated with an accumulation of a large STF-1-hybridizing RNA species (25). Although we also observed this large STF-1-hybridizing RNA species in INS-1 cells, its relative abundance diminished in response to elevated glucose. Finally, the changes in insulin gene expression that occurred in HIT (23) and INS-1 cells cultured in elevated glucose were independent of changes in cell proliferation. Overall, we interpret the observations made in HIT and INS-1 cells to represent a mechanism whereby elevations in glucose can mediate dysfunctional regulation of insulin gene expression by markedly decreasing the binding activities of two ß-cell-specific transcription factors. The loss of STF-1 expression has also been implicated in diminished insulin biosynthesis observed in 90% pancreatectomized rats (50). The involvement of STF-1 and C1 activator in mediating the glucotoxic effects on insulin gene expression in genetic rodent models of type II diabetes is currently under investigation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Cultures
INS-1 cells (27) (a gift from C. Wollheim, Geneva, Switzerland) were routinely grown at 5% CO2-95% air at 37 C in RPMI-1640 containing 11.1 mM glucose and supplemented with 10% FBS, 1 mM pyruvate, 10 mM HEPES, 50 µM 2-mercaptoethanol, 100 U penicillin/ml, and 100 µg streptomycin/ml. In all the experiments described the RPMI-1640 medium contained the supplements described above. Cells were passaged weekly after trypsin-EDTA detachment. All studies were performed on INS-1 passages between 70 and 84.

RNA Isolation and Northern and Slot Blot Analysis
Cells were plated at a density of 5 x 106 cells per 60-mm dish in RPMI-1640 containing 11.1 mM glucose. The following day the cells were incubated with RPMI-1640 containing various glucose concentrations and lengths of time as indicated in the figure legends. Total cellular RNA was isolated by the guanidinium isothiocyanate method (51). Northern blots were performed as described previously (23), in which 10–15 µg total RNA were fractionated on a 1.5% agarose gel containing 6.7% formaldehyde and electrotransferred onto a nylon membrane (Micron Separation Inc. Westbro, MA). Slot blot analysis were performed as described previously (52), in which 2.5 µg total RNA were transferred directly to a nylon membrane using a bio-dot apparatus (Bio-Rad, Hercules, CA) and UV cross-linked. Membranes were hybridized in 50% formamide, 5x NaCl-sodium citrate (SSC), 2x Denhardt’s, 50 mM sodium phosphate, and 0.1 mg/ml denatured salmon sperm DNA at 42 C with 32P-labeled cDNA probes. The membranes were washed three times at room temperature in 2x SSC and 0.1% SDS and then twice at 65 C in 0.2x SSC and 0.1% SDS. The blots were probed with cDNAs isolated from pHFßA-1 [human ß-actin cDNA clone (53)], pshi1 [Syrian hamster preproinsulin cDNA clone (54)], and pSK900 [rat STF-1 cDNA clone (12)] that had been labeled with [{alpha}32P]dCTP by random priming (55). The STF-1 cDNA probe contained an N-terminal STF-1 cDNA sequence +331 to +717. Insulin Northern blots were quantitated using an AGFA Arcus II scanning densitometer (AGFA-Gevaert N. V., Belgium) and NIH image software. Slot blots and STF-1 Northern blots were quantitated using a Molecular Dynamics PhosphoImager (Molecular Dynamics, Sunnyvale, CA).

Reporter Genes
The plasmid INSCAT contains the CAT gene under transcriptional regulation by the human insulin gene sequences -326 to +30 as previously described (24). The plasmid PKCAT contains the CAT gene under transcriptional regulation by the rat pyruvate kinase gene sequences -197 to +12 and has previously been shown to be glucose responsive in primary hepatocytes (56). The plasmids STF-1[-6.5 kb]LUC and STF-1[-190]LUC (a gift from Dr. Montminy, Joslin Diabetes Center, Harvard Medical School, Boston, MA) contain the luciferase gene under transcriptional regulation by the rat STF-1 gene sequences -6500 to +68 and -190 to +78, respectively (33).

Cell Transfections and CAT Assays
INS-1 cells were subcultured at a density of 1.8 x 106 cells per well (diameter 3.5 cm) in RPMI-1640 containing 11.1 mM glucose 2 days before transfection. Cells were transfected with 2 µg reporter vector DNA for 4 h at 37 C by a liposome-mediated method as described previously (24). All transfections were performed in FBS-free RPMI-1640 containing 2.8 or 4.0 mM glucose. The transfection medium was then replaced with RPMI-1640 containing 10% FBS and the indicated glucose concentrations. Twenty four to 48 h after transfection, cells were harvested and CAT or luciferase activity was assayed as previously described (24, 26)

Nuclear Extracts and Electrophoretic Mobility Shift Assays (EMSAs)
Nuclear extracts were made from INS-1 and HIT-T15 cells according to the method described by Schreiber et al. (57). Double-stranded oligodeoxynucleotide probes to the human insulin gene A3 element [previously termed the CT2 motif (3); -230 CCCCTGGTTAAGACTCTAATGACCCGCTGG -201], rat insulin II gene E1 element [previously termed the ICE (3); -104 TCTGGCCATCTGCTGGATCCT -85] and rat insulin II gene C1 element [previously termed the RIPE3b1 element (3); -126 TGGAAACTGCAGCTTCAGCCCCTCT -101] were labeled with [{alpha}32P]dCTP by filling in overhanging 5'-end with the large fragment of DNA polymerase 1. Binding reactions (10 µg/lane) and electrophoresis were performed as described by Shih and Towle (58) except that 0.12 µg/µl of poly(deoxyinosinic-deoxycytidylic)acid was added to the binding buffer. Competition experiments were performed using double-stranded oligodeoxynucleotides containing a mutated C1-binding site (-126 TGGAAACTGCAGCTCGAGCCCCTCT -101) and mutated A3-binding site (-230 CCCCTGGTTAAGACTACGCGTACCCGCTGGTCC -201). The underlined nucleotides indicate mutations within the C1 (20, 45) and A3 elements (24) that block binding in EMSAs and reduce expression of insulin reporter genes in vivo. Supershift analysis were performed by the addition of 2 µl of anti-N-terminal XIHbox8 antibodies that specifically recognize STF-1 [from Dr. Christopher Wright, Vanderbilt University, Nashville, TN (11)].

Preparation and Use of Recomibant Adenovirus Containing the cDNA Encoding p21Cip1/WAF1
A recombinant adenovirus containing the cDNA encoding human p12Cip1/WAF1 was prepared by the method of Becker et al. (59). The recombinant adenovirus, AdCMV-p21, was prepared by insertion of the human p21 cDNA sequences (from Dr. Bert Vogelstein, John Hopkins University, Baltimore, MD) into the plasmid pACCMV.pL.pA adjacent to the CMV promoter. pACCMV.pL.pA containing the p21Cip1/WAF1 cDNA was cotransfected with pJM17 plasmid into 293 cells. The resultant recombinant virus was amplified in 293 cells and titered by plaque assay (59). INS-1 cells were uninfected or infected with ~50 plaque-forming units (pfu) per cell AdCMV-p21 or control virus containing the ß-galactosidase gene (AdCMV-ßGAL, from Dr. Chris Newgard, University of Texas, Southwestern, Dallas, TX) for 2 h. The viral incubation media were replaced with RPMI-1640 media containing 4.0 mM glucose and supplemented as described above for 16 h. Media were then replaced with media containing either 4.0 mM or 16.7 mM glucose as described in the figure legends.

Western Blot Analysis for p21Cip1/WAF1 Expression
INS-1 cells were scraped and homogenized in ice-cold lysis buffer containing 50 mM Tris-HCl, pH 7.5, 250 mM NaCl, 0.5% NP-40, 50 mM NaF, 1 mM sodium orthovanadate, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 25 µg/ml aprotinin, and 25 µg/ml leupeptin. Cell debris was removed by centrifugation at 13,000 x g for 5 min. Cell extracts (25 µg) were resolved by electrophoresis through a 10% SDS-polyacrylamide gel. Resolved proteins were then transferred to nitrocellulose membranes, and p21 immunoreactivity was detected with a 1:2000 dilution of a p21 polyclonal antibody (H-164, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and visualized by chemiluminescence (Pierce Chemical Co., Rockford, IL).

Cell Cycle Analysis
Cells were plated at a density of 1.8 x 106 cells per well (3.5 cm diameter) in RPMI-1640 containing 11.1 mM glucose for 24 h. Cells were then incubated in 4.0 mM glucose for 24 h. Cells were then infected with no virus or AdCMV-ßGAL or AdCMV-p21 and incubated for an additional 16 h in 4.0 mM glucose. Cells were then incubated in either 4.0 mM or 16.7 mM glucose-containing media as described in the figure legends. Cells were detached by trypsin-EDTA, washed twice with PBS, and fixed in 80% ethanol. After fixation, cells were washed twice with PBS and stained for 30 min in PBS containing 50 µg/ml propidium iodide and 0.01% ribonuclease. Relative distribution of cells in G1, G2, and S phases of the cell cycle was determined by flow cytometry on a Becton Dickinson FACS Vantage (Becton Dickinson, Franklin Lakes, NJ).


    ACKNOWLEDGMENTS
 
We thank Dr. Howard Towle, University of Minnesota, for providing the pyruvate kinase reporter gene, Dr. Marc Montminy, Joslin Diabetes Center, for providing the STF-1 reporter genes and genomic clones, and Dr. Christopher Newgard, University of Texas, Southwestern, for helping us generate the AdCMV-p21 adenovirus and for providing the AdCMV-ßGAL adenovirus. We also thank R. Paul Robertson for critical review and helpful discussions.


    FOOTNOTES
 
Address requests for reprints to: Dr. Karl Olson, Department of Physiology, Michigan State University, East Lansing, Michigan 48824-1101.

This work was supported by an American Diabetes Association research grant (to L.K.O.), a Michigan State University grant (to L.K.O.), the Association de Langue Francaise Pour L’ Etude du Diabete et des Maladies Metaboliques (to V.P.), and NIH Grant DK-38325 (to R. Paul Robertson).

Received for publication November 13, 1996. Revision received November 5, 1997. Accepted for publication November 10, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Stein R 1993 Factors regulating insulin gene transcription. Trends Endocrinol Metab 4:96–100[Medline]
  2. Docherty K, Clark A 1995 The regulation of insulin gene transcription. In: Leslie R, Robbins D (eds) Diabetes: Clinical Science in Practise. Cambridge University Press, Cambridge, U.K.
  3. German M, Ashcroft S, Docherty K, Edlund H, Edlund T, Goodison S, Imura, H, Kennedy G, Madsen O, Melloul D, Moss L, Olson K, Permutt MA, Philippe J, Robertson RP, Rutter WJ, Serup P, Stein R, Steiner D, Tsai M-J, Walker MD 1995 The insulin gene promoter: a simplified nomenclature. Diabetes 44:1002–1004[Medline]
  4. Ohlsson H, Karlsson O, Edlund T 1988 A beta-cell-specific protein binds to the two major regulatory sequences of the insulin gene enhancer. Proc Natl Acad Sci USA 85:4228–4231[Abstract/Free Full Text]
  5. Nelson C, Shen L-P, Meister A, Fodor E, Rutter W 1990 Pan: a transcriptional regulator that binds chymotrypsin, insulin, and AP-4 enhancer motifs. Genes Dev 4:1035–1043[Abstract/Free Full Text]
  6. Naya FJ, Stellrecht CMM, Tsai M-J 1995 Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dev 9:1009–1019[Abstract/Free Full Text]
  7. Robinson GLWG, Cordle SR, Henderson E, Weil PA, Teitelman G, Stein R 1994 Isolation and characterization of a novel transcription factor that binds to and activates insulin control element-mediated expression. Mol Cell Biol 14:6704–6714[Abstract/Free Full Text]
  8. Boam DSW, Docherty K 1989 A tissue-specific nuclear factor binds to multiple sites in the human insulin-gene enhancer. Biochem J 264:233–239[Medline]
  9. German MS, Moss LG, Wang J, Rutter WJ 1992 The insulin and islet amyloid polypeptide genes contain similar cell-specific promoter elements that bind identical ß-cell nuclear complexes. Mol Cell Biol 12:1777–1788[Abstract/Free Full Text]
  10. Karlsson O, Edlund T, Moss J, Rutter W, Walker M 1987 A mutational analysis of the insulin gene transcription control region: expression in beta cells is dependent on two related sequences within the enhancer. Proc Natl Acad Sci USA 84:8819–8823[Abstract/Free Full Text]
  11. Peshavaria M, Gamer L, Henderson E, Teitelman G, Wright CVE, Stein R 1994 XIHbox 8, an endoderm-specific Xenopus homeodomain protein, is closely related to a mammalian insulin gene transcription factor. Mol Endocrinol 8:806–816[Abstract]
  12. Leonard J, Peers B, Johnson T, Ferrere K, Lee S, Montminy M 1993 Characterization of somatostatin transactivating factor 1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells. Mol Endocrinol 7:1275–1283[Abstract]
  13. Ohlsson H, Karlsson K, Edlund T 1993 IPF-1, a homeodomain-containing transactivator of the insulin gene. EMBO J 12:4251–4259[Medline]
  14. Miller CP, McGehee Jr RE, Habener JF 1994 IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO J 13:1145–1156[Medline]
  15. Guz Y, Montminy MR, Stein R, Leonard J, Gamer LW, Wright CVE, Teitelman G 1995 Expression of murine STF-1, a putative insulin gene transcription factor, in ß-cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121:11–18[Abstract]
  16. Peers B, Leonard J, Sharma S, Teitelman G, Montminy M 1994 Insulin expression in pancreatic islet cells relies on cooperative interactions between helix loop helix factor E47 and the homeobox factor STF-1. Mol Endocrinol 8:1798–1806[Abstract]
  17. Petersen H, Serup P, Leonard J, Michelsen B, Madsen O 1994 Transcriptional regulation of the human insulin gene is dependent on the homeodomain protein STF1/IPF1 acting through the CT boxes. Proc Natl Acad Sci USA 91:10465–10469[Abstract/Free Full Text]
  18. Serup P, Petersen H, Pedersen E, Edlund H, Leonard J, Petersen J, Larsson L-I, Madsen O 1995 The homeodomain protein IPF-1/STF-1 is expressed in a subset of islet cells and promotes rat insulin 1 gene expression dependent on a intact E1 helix-loop-helix factor binding site. Biochem J 310:997–1003
  19. Crowe DT, Tsai M-J 1989 Mutagenesis of the rat insulin II 5'-flanking region defines sequences important for expression in HIT cells. Mol Cell Biol 9:1784–1789[Abstract/Free Full Text]
  20. Shieh S-Y, Tsai M-J 1991 Cell-specific and ubiquitous factors are responsible for enhancer activity of the rat insulin II gene. J Biol Chem 266:16708–16714[Abstract/Free Full Text]
  21. Whelan J, Poon D, Weil PA, Stein R 1989 Pancreatic ß-cell-specific expression of the rat insulin II gene is controlled by positive and negative transcriptional elements. Mol Cell Biol 9:3253–3259[Abstract/Free Full Text]
  22. Santerre RF, Cook RA, Crisel RMD, Sharp JD, Schmidt RJ, Williams DC, Wilson CP 1981 Insulin synthesis in a clonal cell line of simian virus 40-transformed hamster pancreatic beta cells. Proc Natl Acad Sci USA 78:4339–4343[Abstract/Free Full Text]
  23. Robertson RP, Zhang H-Z, Pyzdrowski KL, Walseth TF 1992 Preservation of insulin mRNA levels and insulin secretion in HIT cells by avoidance of chronic exposure to high glucose concentrations. J Clin Invest 90:320–325
  24. Olson LK, Redmon JB, Towle HC, Robertson RP 1993 Chronic exposure of HIT cells to high glucose concentrations paradoxically decreases insulin gene transcription and alters binding of insulin gene regulatory protein. J Clin Invest 92:514–519
  25. Olson LK, Sharma A, Peshavaria M, Wright CVE, Towle HC, Robertson RP, Stein R 1995 Reduction of insulin gene transcription in HIT-T15 ß cells chronically exposed to a supraphysiological glucose concentration is associated with loss of STF-1 transcription factor expression. Proc Natl Acad Sci USA 92:9127–9131[Abstract/Free Full Text]
  26. Sharma A, Olson L, Robertson RP, Stein R 1995 The reduction of insulin gene transcription in HIT-T15 cells chronically exposed to high glucose concentration is associated with the loss of RIPE3b1 and STF-1 transcription factor expression. Mol Endocrinol 9:1127–1134[Abstract]
  27. Asfari M, Janjic D, Meda P, Li G, Halban PA, Wollheim CB 1992 Establishment of 2-mercaptoethanol-dependent differentiated insulin-secreting cell lines. Endocrinology 130:167–178[Abstract]
  28. Janjic D, Wollheim C 1992 Effect of 2-mercaptoethanol on glutathione levels, cystine uptake and insulin secretion in insulin secreting cells. Eur J Biochem 210:297–304[Medline]
  29. Waeber G, Thompson N, Haefliger J, Nicod P 1994 Characterization of the murine high Km glucose transporter gene and its transcriptional regulation by glucose in a differentiated insulin-secreting cell line. J Biol Chem 269:26912–26919[Abstract/Free Full Text]
  30. Marie S, Diaz-Guerra M-J, Miquerol L, Kahn A, Iynedjian PB 1993 The pyruvate kinase gene as a model for studies of glucose-dependent regulation of gene expression in the endocrine pancreatic ß-cell type. J Biol Chem 268:23881–23890[Abstract/Free Full Text]
  31. Brun T, Roche E, Kim K-H, Prentki M 1993 Glucose regulates acetyl-CoA carboxylase gene expression in a pancreatic ß-cell line (INS-1). J Biol Chem 268:18905–18911[Abstract/Free Full Text]
  32. Zhang S, Kim K-H 1995 Glucose activation of acetyl-CoA carboxylase in association with insulin secretion in a pancreatic ß-cell line. J Endocrinol 147:33–41[Abstract]
  33. Sharma S, Leonard J, Lee S, Chapman H, Leiter E, Montminy M 1996 Pancreatic islet expression of the homeobox factor STF-1 relies on an E-box motif that binds USF. J Biol Chem 271:2294–2299[Abstract/Free Full Text]
  34. Frodin M, Sekine N, Roche E, Filloux C, Prentki M, Wollheim C, Obberghen E 1995 Glucose, other secretagogues, and nerve growth factor stimulate mitogen-activated protein kinase in the insulin-secreting ß-cell line, INS-1. J Biol Chem 270:7882–7889[Abstract/Free Full Text]
  35. Gu Y, Turck C, Morgan D 1993 Inhibition of CDK2 activity in vivo by an associated 20K regulatory subunit. Nature 366:707–710[CrossRef][Medline]
  36. Harper J, Adami G, Wei N, Keyomarsi K, Elledge S 1993 The p21 cdk-interacting protein Cip 1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805–816[CrossRef][Medline]
  37. Noda A, Ning Y, Venable S, Pereira-Smith O, Smith J 1994 Cloning of senescent cell-derived inhibitors of DNA synthesis using an expression screen. Exp Cell Res 211:90–98[CrossRef][Medline]
  38. Xiong Y, Hannon G, Zhang H, Casso D, Kobayashi R, Beach D 1993 p21 is a universal inhibitor of cyclin kinases. Nature 366:701–704[CrossRef][Medline]
  39. El-Diery W, Tokino T, Velculescu V, Levy D, Parsons R, Trent J, Lin D, Mercer E, Kinzler K, Vogelstein B 1993 WAF1, a potential mediator of p53 tumor suppression. Cell 817–825
  40. El-Deiry W, Harper J, O’Connor P, Velculescu V, Canman C, Jackman J, Pietenpol J, Burrell M, Hill D, Wang Y, Wiman K, Mercer W, Kastan M, Kohn K, Elledge S, Kinzler K, Vogelstein B 1994 WAF1/CIP1 is induced in p53-mediated G1 arrest and apoptosis. Cancer Res 54:1169–1174[Abstract/Free Full Text]
  41. Di Leonardo A, Linke S, Clarkin K, Wahl G 1994 DNA damage triggers a prolonged p53-dependent G1 arrest and long-term induction of Cip1 in normal human fibroblasts. Genes Dev 8:2540[Abstract/Free Full Text]
  42. Dulic V, Kaufman W, Wilson S, Tisty T, Lees E, Harper J, Elledge S, Reed S 1994 p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest. Cell 76:1013–1023[CrossRef][Medline]
  43. Docherty K, Clark AR 1994 Nutrient regulation of insulin gene expression. FASEB J 8:20–27[Abstract]
  44. German MS, Wang J 1994 The insulin gene contains multiple transcriptional elements that respond to glucose. Mol Cell Biol 14:4067–4075[Abstract/Free Full Text]
  45. Sharma A, Stein R 1994 Glucose-induced transcription of the insulin gene is mediated by factors required for ß-cell-type-specific expression. Mol Cell Biol 14:871–879[Abstract/Free Full Text]
  46. Melloul D, Ben-Neriah Y, Cerasi E 1993 Glucose modulates the binding of an islet-specific factor to a conserved sequence within the rat 1 and the human insulin promoters. Proc Natl Acad Sci USA 90:3865–3869[Abstract/Free Full Text]
  47. MacFarlane WM, Read ML, Gilligan M, Bujalska I, Docherty K 1994 Glucose modulates the binding activity of the ß-cell transcription factor IUF1 in a phosphorylation-dependent manner. Biochem J 303:625–631
  48. Serup P, Jensen J, Andersen F, Jorgensen M, Blume N, Holst J, Madsen O 1996 Induction of insulin and islet amyloid polypeptide production in pancreatic islet glucagonoma cells by insulin promoter factor 1. Proc Natl Acad Sci USA 93:9015–9020[Abstract/Free Full Text]
  49. Moran A, Zhang H-J, Olson L, Harmon J, Poitout V, Robertson R 1997 Differentiation of glucose toxicity from beta cell exhaustion during the evolution of defective insulin gene expression in the pancreatic islet cell line, HIT-T15. J Clin Invest 99:534–539[Medline]
  50. Zangen D, Bonner-Weir S, Lee C, Latimer J, Miller C, Habener J, Weir G 1997 Reduced insulin, GLUT2, and IDX-1 in beta-cells after partial pancreatectomy. Diabetes 46:258–264[Abstract]
  51. Chomczynski P, Sacchi N 1987 Single step method of RNA isolation by acid guanidium thiocynate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  52. Zhang H-J, Petersen B, Robertson RP 1994 Variable regulation by insulin of insulin gene expression in HIT-T15 cells. Diabetologia 37:559–566[Medline]
  53. Gunning P, Ponte P, Okayama H, Engel J, Blau H, Kedes L 1983 Isolation and characterization of full-length cDNA clones for human {alpha}-, ß- and {gamma}-actin mRNAs: skeletal but not cytoplsmic actins have an amino-terminal cysteine that is subsequently removed. Mol Cell Biol 3:787–795[Abstract/Free Full Text]
  54. Bell GI, Sanchez-Pescador R 1984 Sequence of a cDNA encoding Syrain hamster preproinsulin. Diabetes 33:297–300[Abstract]
  55. Feinberg AP, Vogelstein B 1984 A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 137:266–267[CrossRef][Medline]
  56. Thompson K, Towle HC 1991 Localization of the carbohydrate response element of the rat L-type pyruvate kinase gene. J Biol Chem 266:8679–8682[Abstract/Free Full Text]
  57. Schreiber E, Matthias P, Muller MM, Schaffner W 1989 Rapid detection of octamer binding proteins with ’mini extracts’, prepared from a small number of cells. Nucleic Acids Res 17:6419[Free Full Text]
  58. Shih H-M, Towle HC 1992 Definition of the carbohydrate response element of the rat S14 gene. Evidence for a common factor required for carbohydrate regulation of hepatic genes. J Biol Chem 267:13222–13228[Abstract/Free Full Text]
  59. Becker T, Noel R, Coats W, Gomez-Foix A, Alam T, Gerard R, Newgard C 1994 In: Roth M (ed) Protein Expression in Animal Cells. Academic Press, Inc., San Diego, CA, vol. 43:161–189



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
V. Poitout and R. P. Robertson
Glucolipotoxicity: Fuel Excess and {beta}-Cell Dysfunction
Endocr. Rev., May 1, 2008; 29(3): 351 - 366.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Dubois, P. Vacher, B. Roger, D. Huyghe, B. Vandewalle, J. Kerr-Conte, F. Pattou, N. Moustaid-Moussa, and J. Lang
Glucotoxicity Inhibits Late Steps of Insulin Exocytosis
Endocrinology, April 1, 2007; 148(4): 1605 - 1614.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
K.-G. Park, K.-M. Lee, H.-Y. Seo, J.-H. Suh, H.-S. Kim, L. Wang, K.-C. Won, H.-W. Lee, J.-Y. Park, K.-U. Lee, et al.
Glucotoxicity in the INS-1 Rat Insulinoma Cell Line Is Mediated by the Orphan Nuclear Receptor Small Heterodimer Partner
Diabetes, February 1, 2007; 56(2): 431 - 437.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ubeda, J. M. Rukstalis, and J. F. Habener
Inhibition of Cyclin-dependent Kinase 5 Activity Protects Pancreatic Beta Cells from Glucotoxicity
J. Biol. Chem., September 29, 2006; 281(39): 28858 - 28864.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. Z. Ye, M.-H. Tai, K. D. Linning, C. Szabo, and L. K. Olson
MafA Expression and Insulin Promoter Activity Are Induced by Nicotinamide and Related Compounds in INS-1 Pancreatic {beta}-Cells
Diabetes, March 1, 2006; 55(3): 742 - 750.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Kawamori, H. Kaneto, Y. Nakatani, T.-a. Matsuoka, M. Matsuhisa, M. Hori, and Y. Yamasaki
The Forkhead Transcription Factor Foxo1 Bridges the JNK Pathway and the Transcription Factor PDX-1 through Its Intracellular Translocati