Molecular Endocrinology 12 (2): 207-219
Copyright © 1998 by The Endocrine Society
Glucose Rapidly and Reversibly Decreases INS-1 Cell Insulin Gene Transcription via Decrements in STF-1 and C1 Activator Transcription Factor Activity
L. Karl Olson,
Jin Qian and
Vincent Poitout
Department of Physiology (L.K.O., J.Q.) Michigan State
University East Lansing, Michigan 48824-1101
INSERM U341
(V.P.) Service de Diabetologie, Hôtel Dieu 75004 Paris,
France
 |
ABSTRACT
|
|---|
We have reported that chronic exposure of HIT-T15
cells to supraphysiological concentrations of glucose over many months
leads to decreased insulin gene transcription and decreased binding
activities of two ß-cell-specific transcription factors, STF-1 and C1
activators, and have postulated that these events may provide a
mechanism for glucose toxicity on ß-cell function. We now report that
culturing the highly differentiated rat insulinoma cell line, INS-1, in
glucose concentrations above 8.0 mM caused a
marked decrease in insulin mRNA levels within 24 h. The decrease
in insulin mRNA levels was reversed by further incubation of the cells
in 4.0 mM glucose. Transient transfection of a
chloramphenicol acetyltransferase reporter gene regulated by the
5'-regulatory sequences of the human insulin gene showed that elevated
glucose concentrations caused a large decrease in insulin gene promoter
activity. The decrease in insulin gene promoter activity was associated
with reductions in the binding activities of both STF-1 and C1
activator, and these were partially reversed by lowering the glucose
concentration. The decrease in STF-1 binding activity was associated
with decreased STF-1 mRNA and occurred independently of changes in
STF-1 promoter activity, suggesting a posttranscriptional regulatory
mechanism. Furthermore, the decrease in insulin gene expression was
found to occur independently of changes in cell proliferation. We
conclude that physiologically relevent elevations in glucose can
reversibly diminish insulin gene transcription by reducing the
expression and/or binding activity of two critical ß-cell
transcription factors.
 |
INTRODUCTION
|
|---|
Insulin gene expression is highly restricted in adult mammals to
pancreatic ß-cells residing in the islets of Langerhans.
Tissue-specific transcription of the insulin gene is regulated by DNA
sequences residing 5' to the insulin gene transcription start site
(reviewed in Refs. 1 and 2). Several transcription factors have been
identified that bind and regulate discrete insulin gene
cis-acting promoter elements. The names of these promoter
elements have been recently simplified (3), and the new nomenclature
will be used throughout this manuscript. One of these cis
elements includes the highly conserved E1 element [previously termed
NIR box or insulin control element (ICE) (3)] which binds insulin
enhancer factor 1 (IEF1) (4), a heterodimer of two helix-loop-helix
factors, including the ubiquitously expressed proteins E12/E47 (5) and
a ß-cell-specific factor likely to be BETA2 (6) and/or INSAF (7).
Within the rat insulin 1 gene there is an additional distal E box
element, termed the E2 element, that also binds IEF1. However, the E2
element is poorly conserved in the rat insulin II and human insulin
genes. Two A-T-rich elements termed the A1 and A3 elements [previously
termed the CT1 and CT2 motifs (3)] are highly conserved among all
characterized mammalian genes (8, 9, 10, 11). The gene encoding the
predominant ß-cell binding activity to the A1 and A3 elements has
recently been isolated by three independent laboratories and is termed
STF-1 (12), IPF1 (13), and IDX-1 (14). STF-1 is a homeotic
transcription factor expressed selectively in cells of the pancreas and
duodenum (14, 15). In the adult islet, STF-1 protein staining is
predominant in the nuclei of insulin-producing ß-cells (11, 16).
STF-1 has been shown to regulate insulin gene promoter activity (13, 17), and this regulation is dependent upon an intact E1 element (18)
and functional synergism with the helix-loop-helix factor, E47 (16). In
addition to IEF1- and STF-1-binding sites, insulin gene transcription
requires a highly conserved, mutationally sensitive regulatory element
termed the C1 element [previously termed RIPE3b1 (3)], which binds a
poorly described protein termed here C1 activator (RIPE3b1)
(19, 20, 21).
We have previously reported that prolonged exposure over many months of
the ß-cell line, the HIT-T15 cell (22), to supraphysiological
concentrations of glucose caused decreased insulin content, insulin
mRNA levels, and insulin gene promoter activity (23, 24). These
phenotypic changes could be prevented, but not completely reversed, by
chronically culturing this cell line in more physiological
concentrations of glucose (23, 24). The reduction in insulin gene
transcription was associated with reduced binding of two
ß-cell-specific transcription factors, STF-1 and C1 activator (25, 26). The mechanism whereby chronic exposure of HIT cells to elevated
glucose reduced STF-1 binding activity appeared to involve a reduction
in STF-1 mRNA levels resulting from a posttranscriptional mechanism
(25). Our observations in HIT cells suggested that one potential
mechanism whereby chronic hyperglycemia can adversely affect pancreatic
ß-cell function is by decreasing insulin gene transcription.
A highly differentiated rat insulinoma cell line, INS-1 cell, has been
described that secretes insulin in response to changes in glucose
concentrations with an ED50 similar to that of the
pancreatic islet (27, 28). Incubation of INS-1 cells in elevated
glucose concentrations has been shown to induce mRNA levels for GLUT2
(29), pyruvate kinase (30), and acetyl-coenzyme A (CoA) carboxylase
(31). Glucose induction of pyruvate kinase (30), acetyl-CoA carboxylase
(32), and GLUT2 (29) mRNA resulted from increased gene transcription.
In contrast, elevated glucose concentrations have been reported to
paradoxically decrease insulin gene transcription in INS-1 cells (30).
Studies described herein were performed to determine whether the
glucose-induced reduction in insulin gene transcription involved
alterations in STF-1-, C1 activator-, and/or IEF1-binding activities,
and, if so, the mechanism for diminished STF-1 binding.
 |
RESULTS
|
|---|
The Effect of Elevated Glucose Concentrations on Insulin mRNA
Levels
INS-1 cells were incubated in 4.0, 10.0, or 16.7 mM
glucose for the indicated lengths of time, after which insulin mRNA
levels were determined by Northern analysis. INS-1 cells incubated in
16.7 mM glucose for 48 or 96 h had an approximately
80% decrease in insulin mRNA levels compared with control INS-1 cells
incubated in 4.0 mM glucose (Fig. 1
, compare lanes 1 and 2 to lanes 6 and
8). INS-1 cells incubated in 10 mM glucose for 48 h
had greater than a 50% decrease in insulin mRNA levels compared with
control cells (Fig. 1
, compare lanes 1 and 2 to lanes 3 and 5). When
INS-1 cells that were previously incubated for 48 h in either 10.0
or 16.7 mM glucose were further incubated for an additional
48 h in 4.0 mM glucose, insulin mRNA levels increased
(Fig. 1
, compare lanes 45 and lanes 78), indicating that the
decreases in insulin mRNA levels were readily reversible. The various
glucose conditions and incubation times had no apparent effect on
levels of ß-actin mRNA.

View larger version (50K):
[in this window]
[in a new window]
|
Figure 1. Effect of Different Glucose Concentrations on
Insulin mRNA Levels in INS-1 Cells
INS-1 cells were cultured in RPMI-1640 containing either 4.0
mM (lanes 1 and 2), 10.0 mM (lanes 3 and 5), or
16.7 mM (lanes 6 and 8) glucose for 48 h (lanes 1, 3,
and 6) or 96 h (lanes 2, 5, and 8). INS-1 cells were also
incubated in 10.0 mM (lane 4) or 16.7 mM (lane
7) glucose for 48 h and then incubated for an additional 48 h
in 4.0 mM glucose. Total RNA was then isolated,
fractionated by denaturing electrophoresis, transferred to nylon, and
hybridized with both 32P-labeled Syrian hamster
preproinsulin and human ß-actin probes. This is a representative
Northern blot from three identical experiments that yield similar
results.
|
|
The glucose concentration- and time-dependence for the decrease in
insulin mRNA levels in INS-1 cells was determined by slot blot
analysis. INS-1 cells incubated in either 4.0 or 6.0 mM
glucose for 448 h demonstrated no change in insulin mRNA levels (Fig. 2
). In contrast, cells incubated in 8.0
mM glucose showed a small decrease in insulin mRNA levels
that became apparent after 24 h. INS-1 cells incubated in 10.0,
12.0, or 14.0 mM glucose showed even further decreases in
insulin mRNA levels that were also apparent after 24 h.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 2. Time Course and Glucose Concentration Dependence
for the Reduction of Insulin mRNA Levels in INS-1 Cells
INS-1 cells were cultured in either 4.0, 6.0, 8.0, 10.0, 12.0, or 14.0
mM glucose for the indicated lengths of time. Total RNA was
isolated and transferred to a nylon hybridization membrane by
slot-blot. Identically loaded membranes were then hybridized with
either 32P-labeled Syrian hamster preproinsulin or human
ß-actin probes. Insulin and ß-actin mRNA levels were then
quantitated using a PhosphoImager. Data are expressed as the ratio of
insulin mRNA to ß-actin mRNA normalized to 4.0 mM
glucose. Values are the mean ± SD of four individual
experiments.
|
|
Effect of Elevated Glucose Concentrations on Insulin Gene Promoter
Activity
To assess insulin promoter activity INS-1 cells were transiently
transfected with an insulin CAT reporter gene (INSCAT) in which
chloramphenicol acetyl transferase (CAT) gene expression is regulated
by the human insulin promoter/enhancer sequences -326 to +30 (24).
INS-1 cells incubated in 16.7 mM glucose showed a 80%
reduction in INSCAT expression compared with INS-1 cells incubated in
4.0 mM glucose (Fig. 3A
).
Elevated glucose concentrations also repressed the expression of a rat
insulin II promoter-regulated reporter gene (data not shown),
suggesting that this glucose effect is not unique to sequences
contained in the human insulin promoter.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 3. The Effect of Glucose on Insulin (Panel A) or
Pyruvate Kinase (Panel B) Promoter Activity in INS-1 Cells
INS-1 cells were subcultured in 11.1 mM glucose for 2 days
and then transiently transfected with an insulin CAT reporter gene
(INSCAT) or a pyruvate kinase CAT reporter gene (PKCAT) in 4.0
mM glucose for 4.0 h. The cells were then incubated
for 30 h in either 4.0 mM glucose, 16.7 mM
glucose, or 16.7 mM glucose plus 16.7 mM
mannoheptulose. Cells were then harvested and assayed for CAT activity.
Data are normalized to the level of reporter gene expression measured
in cells treated with 4.0 mM glucose. Values are the
mean ± SE of three individual experiments.
|
|
To examine whether the repression of INSCAT expression was a
generalized or selective repression, we tested whether the pyruvate
kinase promoter sequences -197 to +12 could be activated by glucose in
INS-1 cells transiently transfected with pyruvate kinase CAT reporter
gene (PKCAT). Expression of similar pyruvate kinase reporter gene has
previously been shown to be induced by glucose in INS-1 cells (30).
INS-1 cells incubated in 16.7 mM glucose showed a 10-fold
induction in PKCAT expression compared with cells incubated in 4.0
mM glucose (Fig. 3B
). Both the inhibition of INSCAT and the
activation of PKCAT by glucose were blocked by the addition of
mannoheptulose (Fig. 3
), indicating that glucose phosphorylation is
required for these events to occur.
Effect of Elevated Glucose Concentrations on the Binding Activities
of C1, A3, and E1 Activators
We have shown previously that decreased STF-1 and C1 activator
binding is associated with decreased insulin promoter activity in HIT
cells chronically cultured in a supraphysiological glucose
concentration (24, 25, 26). Thus, we tested whether a similar decrease in
binding activity of these two transcription factors was associated
with the loss of insulin promoter activity in INS-1 cells. Nuclear
extracts isolated from INS-1 cells cultured in 16.7 mM
glucose for 48 h had greater than a 50% reduction in C1 (Fig. 4A
, compare lanes 1 and 2) and A3 binding
activity compared with cells incubated in 4.0 mM glucose
(Fig. 4A
, compare lanes 6 and 7). Incubating the cells in 16.7
mM glucose for an additional 48 h led to a further
reduction in C1 binding (Fig. 4A
, compare lanes 2 and 5). A3 binding
was also lower in cells treated with 16.7 mM glucose for
96 h than in cells treated in 4.0 mM glucose for
96 h (Fig. 4A
, compare lanes 8 and 10). In contrast, incubating
cells in 16.7 mM glucose increased E1 binding activity by
approximately 1.25-fold compared with cells incubated in 4.0
mM glucose for 48 and 96 h (Fig. 4A
, lanes 1115).
When INS-1 cells that were previously incubated for 48 h in 16.7
mM glucose were further incubated for 48 h in 4.0
mM glucose, there was nearly complete recovery in binding
activity of the A3 activator (Fig. 4A
, compare lanes 9 and 10). In
addition, C1 element binding increased when cells were switched from
16.7 mM glucose to 4.0 mM glucose for 48 h
(Fig. 4A
, compare lanes 4 and 5); however, the reduction in binding was
not completely reversed. Specificity of the C1- and A3-binding
complexes were analyzed by oligodeoxynucleotide competition (Fig. 4B
).
Extracts isolated from INS-1 cells incubated in 4.0 mM
glucose showed binding to both the C1 and A3 oligodeoxynucleotide
probes. These binding activities were shown to be specific because they
were readily competed by an excess of the appropriate unlabeled probe,
whereas the binding activities were not displaced by probes containing
mutated binding sites.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 4. Effect of Glucose on the Binding Activities of C1,
A3, and E1 Activators in INS-1 Cells
Panel A, Equal concentrations of INS-1 cells nuclear extracts were
analyzed by EMSA for binding to C1, A3, and E1 containing
32P-labeled probes. INS-1 cells cultured in RPMI-1640
containing either 4.0 mM (lanes 1, 3, 6, 8, 11, and 13) or
16.7 mM (lanes 2, 5, 7, 10, 12, and 15) glucose for 48
h (lanes 1, 2, 6, 7, 11, and 12) or 96 h (lanes 3, 5, 8, 10, 13,
and 15). INS-1 cells were incubated in 16.7 mM glucose for
48 h and then incubated for an additional 48 h in 4.0
mM glucose (lanes 4, 9, and 14). EMSA with C1 (lanes 15),
A3 (lanes 610), and E1 (lanes 1115) probes. Arrows
indicate the position of the specific complexes. Panel B, Competition analysis of C1- and
A3-binding complexes. Equal amounts of INS-1 nuclear extracts isolated
from cells incubated in 4.0 mM glucose for 48 h were
added. EMSA with C1 (lanes 13) and A3 (lanes 46) elements.
Competition with a 100-fold molar excess of unlabeled wild-type (WT) C1
(lane 2) or mutant (M) C1 (lane 3) or wild-type A3 (lane 5), or mutant
A3 (lane 6). Panel C, Supershift of the A3- binding complex with
affinity-purified anti-N-terminal XIHbox8 antibodies. Equal
concentrations (5 µg) of nuclear extract isolated from INS-1 cells
incubated for 48 h in 4.0 mM (lanes 1 and 3) or 16.7
mM glucose (lanes 2 and 4) were analyzed for A3 binding in
the absence (lanes 1 and 2) or presence (lanes 3 and 4) of 2 µl
anti-N-terminal XIHbox8 antibodies. The supershifted complex is
indicated with an asterisk.
|
|
The binding characteristics of the A3-binding complex suggest that it
consists of the ß-cell transcription factor, STF-1 (25). To determine
whether the A3-binding complex corresponded to STF-1, we tested the
effect of adding an affinity-purified antiserum against the N-terminal
region of the XIHbox8 protein. This anti-N-terminal XIHbox8 antiserum
was raised against amino acids 1 through 75 of the XIHbox8 protein, and
this region is highly conserved within the STF-1 protein (11). Previous
studies have shown that the anti-N-terminal XIHbox8 antiserum
specifically supershifts the STF-1 protein-DNA complex using HIT cell
nuclear extracts (11, 25). Gel shift analyses were performed using
nuclear extracts from INS-1 cells cultured in 4.0 mM or
16.7 mM glucose for 48 h. As described above, the
A3-binding complex was significantly reduced in cells incubated with
16.7 mM glucose compared with 4.0 mM glucose
(Fig. 4C
, lanes 1 and 2). Addition of XIHbox8 N-terminal antibodies to
INS-1 nuclear extracts supershifted the A3-binding complex (Fig. 4C
, lanes 3 and 4). In contrast, addition of USF-1 antibodies had no effect
on the A3-binding complex (data not shown). Overall these results
suggest that the A3-binding complex contains the STF-1 protein and that
the binding activity is markedly reduced in INS-1 cells cultured in
16.7 mM glucose.
In contrast to INS-1 cells, incubation of early passages (P70s) HIT
cells for 30 h in 16.7 mM glucose increased the
expression of the INSCAT reporter gene by 1.35 ± 0.07-fold
(mean ± SE, n = 3) compared with cells incubated
in 0.8 mM glucose (Fig. 5A
).
Nuclear extracts isolated from HIT cells incubated for 48 h in 0.8
mM, 4.0 mM, or 16.7 mM glucose had
no significant differences in binding activities to the A3 DNA probe
(Fig. 5B
). However, nuclear extracts isolated from HIT cells incubated
in either 4.0 mM or 16.7 mM glucose had
increased binding activities to the C1 DNA probe.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 5. Effect of Glucose on Insulin Promoter Activity and
A3- and C1-Binding Activities in HIT-T15 Cells
Panel A, HIT-T15 cells were subcultured in 0.8 mM glucose
for 2 days and then transiently transfected with INSCAT for 4.0 h.
The cells were then incubated for 30 h in either 0.8
mM, 4.0 mM, or 16.7 mM glucose.
Cells were then harvested and assayed for CAT activity. Values are the
mean ± SE of three individual experiments. Panel B,
HIT-T15 cells were incubated in 0.8 mM, 4.0 mM,
or 16.7 mM glucose for 48 h, and nuclear extracts were
prepared. Equal concentrations of nuclear extracts were then analyzed
by EMSA for binding to A3 and C1 containing 32P-labeled
probes.
|
|
Effect of Elevated Glucose Concentrations on STF-1 mRNA Levels and
STF-1 Promoter Activity
We have shown previously that decreased STF-1 binding in HIT cells
chronically cultured in an elevated glucose concentration is associated
with a posttranscriptional reduction in STF-1 mRNA levels (25). Thus,
we tested whether the reduction of STF-1 binding in INS-1 cells in
response to elevated glucose concentrations was also associated with
decreased STF-1 RNA levels and STF-1 promoter activity. As shown for
insulin mRNA, incubation of INS-1 cells in 16.7 mM glucose
for 48 or 96 h reduced the expression of STF-1 mRNA (
1.9-kb
hybridizing species) to 27.8 ± 3.3% (n = 3) or 30.7 ±
5.6% (n = 3), respectively, of that observed in control cells
incubated in 4.0 mM glucose (Fig. 6
, compare lanes 1 and 2 to lanes 3 and
5). STF-1 mRNA levels were completely restored (1.15 ±
0.192-fold, n = 3) when cells that had been incubated for 48
h in 16.7 mM glucose were incubated for an additional
48 h in 4.0 mM glucose (Fig. 6
, compare lanes 4 to 5).
As observed with the 1.9-kb STF-1 hybridizing mRNA species, a large
(
7 kb) STF-1 hybridizing RNA species was shown to be glucose
sensitive (Fig. 6
). Incubation of INS-1 cells in 16.7 mM
glucose reduced the expression of this STF-1 hybridizing species to
15.0 ± 3.8% or 17.1 ± 9.5% in 48 h or 96 h,
respectively (Fig. 6
, compare lanes 1 and 2 to lanes 3 and 5). Changing
the glucose concentration from 16.7 mM to 4.0
mM glucose also led to a complete recovery (1.36 ±
0.43-fold, n = 3) of this large STF-1 hybridizing species.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 6. Effect of Different Glucose Concentrations on STF-1
mRNA Levels in INS-1 Cells
INS-1 cells were cultured in RPMI-1640 containing either 4.0
mM (lanes 1 and 2) or 16.7 mM (lanes 3 and 7)
glucose for 48 h (lanes 1 and 3) or 96 h (lanes 2 and 5).
INS-1 cells were also incubated in 16.7 mM (lane 4) glucose
for 48 h and then incubated for an additional 48 h in 4.0
mM glucose. Total RNA was then isolated, fractionated by
denaturing gel electrophoresis, transferred to nylon, and hybridized
with a 32P-labeled rat STF-1 probe. The Northern blot was
then stripped and reprobed for ß-actin (lower panel)
to ensure even loading. Northern blots were visualized by
autoradiography and quantitated with a PhosphoImager. This is a
representative Northern blot from three identical experiments that
yield similar results.
|
|
STF-1 promoter activity was assessed using two luciferase
reporter genes regulated by STF-1 sequences -6500 to +68 (STF-1[-6.5
kb]LUC) or -190 to +78 (STF-1[-190]LUC). STF-1[-6.5 kb]LUC
contains sufficient STF-1 promoter sequences for ß-cell-specific
expression of this reporter gene (33). INS-1 cells were transfected
with either STF-1[-6.5 kb]LUC or STF-1[-190]LUC and then
incubated for 24 h in 4.0 or 16.7 mM glucose. The
expression of STF-1[-6.5 kb]LUC was
10-fold higher than the
expression of STF-1[-190]LUC in INS-1 cells irrespective of the
glucose concentration (Fig. 7A
). The
reduced expression of STF-1[-190]LUC compared with STF[-6.5
kb]LUC in INS-1 cells is consistent with observations in HIT cells
demonstrating that islet-specific expression of the STF-1 promoter is
regulated by a distal enhancer sequence (33). Interestingly, there was
no difference in the expression of either STF-1[-190]LUC or
STF-1[-6.5 kb]LUC when cells were treated with either 4.0
mM or 16.7 mM glucose (Fig. 7
). To verify that
16.7 mM glucose can reduce insulin promoter activity while
not affecting STF-1 promoter activity, we simultaneously measured
INSCAT and STF-1[-190]LUC or STF-1[-6.5 kb]LUC expression in
cotransfected INS-1 cells. Elevated glucose concentrations for 24
h or 48 h had no effect or a slight stimulatory effect on
expression of either STF-1[-190]LUC or STF-1[-6.5 kb]LUC (Fig. 7B
). In contrast, incubation of these same cells in 16.7 mM
glucose for 24 h or 48 h reduced INSCAT expression by
60%
and
85%, respectively (Fig. 7B
). Overall, these data suggest that
the reduction in STF-1 RNA levels results from a change in
posttranscriptional processing.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 7. The Effect of Glucose on STF-1 Promoter Activity in
INS-1 Cells
Panel A, Cells were transiently transfected with STF-1 reporter genes
regulated by sequences -190 to +78 (STF-1[-190]LUC) or -6500 to
+68 (STF-1[-6.5 kb]LUC) and then incubated for 24 h in 4.0
mM glucose or 16.7 mM glucose. Data are
normalized to STF-1[-190]LUC expression in cells incubated in 4.0
mM glucose. Values are the mean ± SD of
12 individual experiments. Panel B, Cells were cotransfected with
either STF-1[-190]LUC or STF-1[-6.5 kb]LUC and INSCAT and then
incubated for 24 or 48 h in 4.0 mM or 16.7
mM glucose. Data are normalized to expression level for
each reporter gene in cells incubated in 4.0 mM glucose for
24 h or 48 h.
|
|
Decreased Insulin Gene Expression in INS-1 Cells Incubated in
Elevated Glucose Concentrations Is Independent of Changes in Cellular
Proliferation
It has been reported that culturing INS-1 cells in elevated
glucose concentrations markedly increased DNA synthesis and cellular
proliferation (34). We have also found that culturing INS-1 cells in
16.7 mM glucose for 24 h causes a 1.23 ±
0.06-fold (mean ± SD, n = 7) increase in cell
number compared with cells cultured in 4.0 mM glucose. In
addition, incubating INS-1 cells in 16.7 mM glucose
markedly alters the cell cycle distribution as determined by propidium
staining and flow cytometry. When INS-1 cells were incubated in 4.0
mM glucose for 24 h, 85.07 ± 1.10%, 10.77
± 0.47%, and 4.17 ± 0.81% of the cells were in the G1, S, and
G2 phases of the cell cycle, respectively. In contrast, when INS-1
cells were incubated in 16.7 mM glucose for 24 h, the
cell cycle distribution changed to 65.90 ± 0.28%, 24.2 ±
0.85%, and 9.85 ± 0.64% of the cells in G1, S, and G2 phases,
respectively.
The ability of glucose to increase INS-1 cell proliferation raised the
concern that the observed decrease in insulin gene expression was a
direct result of enhanced cellular proliferation. To examine this
possibility, we arrested INS-1 cell proliferation by overexpressing the
cyclin-dependent protein kinase inhibitor, p21Cip1/WAF1
(35, 36, 37, 38, 39), using a recombinant adeno-virus, termed AdCMV-p21. The
major function of p21Cip1/WAF1 is to mediate the G1
checkpoint in the cell cycle (40, 41, 42). Infection of INS-1 cells with
AdCMV-p21 led to a large increase in p21Cip1/WAF1 protein
levels compared with uninfected cells or cells infected with a control
adenovirus that expresses ß-galactosidase (AdCMV-ßGAL) (Fig. 8A
). When AdCMV-ßGAL-infected INS-1
cells were incubated in 4.0 mM glucose for 24 h,
70.9%, 22.3%, and 6.9% of the cells were in the G1, S, and G2 phases
of the cell cycle, respectively (Fig. 8B
). When AdCMV-ßGAL-infected
INS-1 cells were incubated in 16.7 mM glucose for 24
h, the cell cycle distribution changed to 42.4%, 36.3%, and 21.3% of
the cells in G1, S, and G2 phases, respectively. In sharp contrast,
16.7 mM glucose did not alter the cell cycle distribution
of AdCMV-p21-infected INS-1 cells (Fig. 8B
). In fact, in both 4.0
mM and 16.7 mM glucose, greater than 90% of
the AdCMV-p21-infected cells were arrested in G1 phase. Although nearly
all the AdCMV-p21-infected cells were in G1 arrest, incubation of cells
with 16.7 mM glucose for 24 h still led to a marked
reduction in insulin mRNA levels when compared with cells incubated in
4.0 mM glucose (Fig. 8C
). Overall, these results indicate
that the changes in insulin gene expression brought about by exposure
of INS-1 cells to elevated glucose concentrations are independent of
changes in cellular proliferation.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 8. Decreased Insulin Gene Expression in INS-1 Cultured
in Elevated Glucose Concentrations Is Independent of Changes in
Cellular Proliferation
Panel A, Western analysis for p21Cip1/WAF1 protein
expression in INS-1 cells infected with AdCMV-p21. INS-1 cells were
preincubated in 4.0 mM glucose for 24 h and then
infected with no virus or AdCMV-ßGAL or AdCMV-p21 adenoviruses (>50
pfu per cell) for 2 h. Cells were then incubated for 24 h,
and cellular extracts were prepared and analyzed by Western analysis.
Lane 1, Control cells; lane 2, AdCMV-p21-infected cells; and lane 3,
AdCMV-ßGAL-infected cells. Panel B, Cell cycle analysis of cells
infected with either AdCMV-ßGAL or AdCMV-p21. INS-1 cells
were preincubated in 4.0 mM glucose for 24 h and then
infected with no virus or AdCMV-ßGAL or AdCMV-p21 adenoviruses (>50
pfu/cell) for 2 h. The cells were then incubated for an additional
16 h in 4.0 mM glucose. Cells were then incubated in
either 4.0 mM or 16.7 mM glucose for 24 h.
Cells were then harvested for flow cytometric analysis. Panel C,
Northern analysis for insulin gene expression in cells infected with no
virus or AdCMV-ßGAL or AdCMV-p21 adenoviruses. Cells were treated as
described for panel B and harvested for Northern analysis. Lanes 1 and
2, Control cells; lanes 3 and 4, AdCMV-ßGAL-infected cells, lanes 5
and 6, AdCMV-p21-infected cells. Lanes 1, 3, and 5, Cells incubated in
4.0 mM glucose; lanes 2, 4, and 6, cells incubated in 16.7
mM glucose.
|
|
 |
DISCUSSION
|
|---|
The results reported herein demonstrate that elevations in glucose
concentration can alter the phenotypic behavior of the INS-1 cell.
Elevations in glucose concentrations above 8.0 mM glucose
led to a rapid (within 24 h) decrease in insulin mRNA levels in
INS-1 cells. The decrease in insulin mRNA levels was due, in
part, to a rapid decrease in insulin promoter activity
that likely reflects a reduction in insulin gene transcription. These
results are in agreement with Marie et al. (30) who has
previously described that 33.0 mM glucose can repress
endogenous insulin gene transcription in INS-1 cells. The reduction in
insulin promoter activity was associated with a decrease in the binding
activities of STF-1 and C1 activator. The reductions of insulin mRNA
levels, insulin promoter activity, and binding activities of the two
transcription factors were reversible when the glucose concentrations
in which the cells were incubated was switched to 4.0
mM.
Elevations in ambient glucose concentrations generally increase insulin
biosynthesis by increasing insulin translation, insulin mRNA stability,
and insulin gene transcription (reviewed in Ref.43). Regulatory sites
within the insulin gene promoter involved in acute glucose-induced
insulin gene transcription include the E1 and E2 elements (44, 45), the
C1 element (45), and the A3 element (46). Enhanced binding activity to
the E2 (44), C1 (45), and A3 elements (46) in response to elevated
glucose concentrations have been reported. The enhanced binding
activity to the E2 element contains E12/E47 (44) and is likely to
contain the ß-cell-specific factor BETA2 (6) or INSAF (7), while the
enhanced binding activity to the A3 element has been shown to be STF-1
(47). The enhanced binding of STF-1 in response to elevated glucose
requires glucose metabolism and is dependent on phosphorylation (47).
The time-dependent and reversible loss of insulin gene promoter
activity in response to glucose elevations in INS-1 cells is seemingly
paradoxical, but it is noteworthy that it involves two of the binding
factors (STF-1 and C1 activator) important in the acute regulation of
insulin gene transcription by glucose.
The mechanism whereby elevations in glucose concentration decrease the
binding of STF-1 involves decreased expression of STF-1 mRNA.
Interestingly, the reduction in STF-1 mRNA is associated with no change
in the promoter activity of STF-1. The STF-1[-6.5 kb]LUC reporter
gene contains sufficient regulatory information such that it is
expressed in a ß-cell-specific manner (33); therefore, we believe
that expression of this reporter gene directly reflects endogenous
STF-1 transcription and that our data suggest that the reduction in
STF-1 mRNA levels occurs through a posttranscriptional mechanism. A
large STF-1-hybridizing RNA species (
7 kb) was also detected in
INS-1 cells. A similar sized STF-1 RNA-hybridizing species has also
been identified in HIT (25) and ßTC6 cells and isolated mouse and rat
islets (L. K. Olson and R. Stein, unpublished observation). Levels
of this large STF-1-hybridizing RNA also decreased in response to
elevated glucose concentrations. Although the nature of this large
STF-1-hybridizing RNA still remains to be determined, it is detectable
by STF-1 probes containing sequences +331 to +717, +714 to +1182, and
+946 to +1182, suggesting that it is related to STF-1. It is noteworthy
that chronic passaging of HIT cells in elevated glucose concentrations
also reduced STF-1 mRNA levels without altering endogenous STF-1 gene
transcription. Thus, posttranscriptional regulation of STF-1 mRNA
appears to play an important role in maintenance of the insulinoma
phenotype; however, this regulatory mechanism of STF-1 expression
in vivo has yet to be established. Elucidation of the
mechanism whereby elevated glucose decreases the binding of C1
activator must await cloning of the gene responsible for synthesis of
this factor.
The results presented here also provide important insight into the
relative importance of various regulatory factors known to regulate the
insulin promoter. We show that elevated glucose concentration decreases
both the binding of STF-1 and C1 activator. In contrast, elevated
glucose increased the binding activity of E1 activator (IEF1). The
observation that elevated glucose increases E1 activator binding in
INS-1 is in agreement with the observation by German and Wang (44) that
elevated glucose concentrations increased binding to E2 element in
isolated adult islets. Although we observed enhanced E1 element binding
in response to elevated glucose, this is insufficient to support
insulin promoter activity in the absence of STF-1 and C1 activator.
This provides additional evidence that STF-1 and C1 activator are
critical for insulin gene promoter activity; however, we cannot exclude
the possibility that elevations in glucose concentrations are reducing
binding activities of other required factors. This is also consistent
with the recent report that glucagonoma cells that express the E1
activator do not express the insulin gene, whereas overexpression of
STF-1 within this cell line, but not cell lines devoid of the E1
activator, induces endogenous insulin gene expression (48). It is
noteworthy that the reduction of insulin mRNA levels in INS-1 cell by
elevated glucose concentrations is rapidly reversed by lowering the
glucose concentration and that the increase in insulin mRNA levels
temporally coincides with increased STF-1 binding activity and STF-1
mRNA levels, but not with C1 activator-binding activity. These data may
suggest that the insulin-producing phenotype of INS-1 cells is more
sensitive to the loss of STF-1 levels than to C1 activator levels. It
is, however, important to point out that transient transfection of
STF-1 expression vectors is not sufficient to significantly
reconstitute insulin promoter activity in INS-1 cells incubated in
elevated glucose concentrations (L. K. Olson, unpublished
observation). The inability of STF-1 to reconstitute insulin promoter
activity is likely due to the decrease in C1 activator-binding activity
or to altered expression of other regulatory factors.
Although the mechanism whereby glucose alters the insulin-producing
phenotype of the INS-1 cell is uncertain, it is doubtful that it
results from a general defect in glucose signaling because we observed
that the pyruvate kinase gene promoter activity is still markedly
glucose-responsive in INS-1 cells cultured in supraphysiological
glucose concentrations. Because mannoheptulose is capable of inhibiting
the glucose-induced changes in INS-1 phenotype, it is likely that a
glucose metabolite is required for the effect. Frodin et al.
(34) reported previously that elevations in glucose concentrations
increase INS-1 cell proliferation. We have also observed that
elevations in glucose increase INS-1 cell proliferation. This has
raised the concern that elevated glucose concentrations decrease
insulin gene expression by directly increasing cell proliferation.
However, overexpression of the cyclin-dependent protein kinase
inhibitor, p21Cip1/WAF1, which arrested the majority of the
INS-1 cells in the G1 phase of the cell cycle, had no effect on the
ability of elevated glucose to decrease insulin gene expression. This
observation strongly supports the notion that the glucose-induced
changes in INS-1 phenotype are unrelated to changes in cellular
proliferation.
We suggested previously that one potential mechanism whereby chronic
hyperglycemia can exacerbate pancreatic ß-cell defects in type II
diabetic patients is by decreasing the rate of insulin gene
transcription. This proposal is based on our observations that chronic
exposure of HIT cells to an elevated glucose concentration (11.1
mM) decreased insulin mRNA levels and promoter activity
(23, 24). However, several distinctions exist between the
glucose-induced phenotypic changes in INS-1 cells and HIT cells. In HIT
cells, the reduction in insulin gene transcription and the associated
decrease in STF-1 and C1 activator binding required many months of
glucose exposure (24, 25, 26) and were only slightly reversed by lowering
the glucose concentration (49). In contrast, these events occurred in
INS-1 cells within 48 h of glucose exposure and were readily
reversed. In both cell lines, the reduction in STF-1-binding activity
was associated with decreased STF-1 mRNA levels that occurred via a
posttranscriptional mechanism (25). In HIT cells the reduction in STF-1
mRNA levels was associated with an accumulation of a large
STF-1-hybridizing RNA species (25). Although we also observed this
large STF-1-hybridizing RNA species in INS-1 cells, its relative
abundance diminished in response to elevated glucose. Finally, the
changes in insulin gene expression that occurred in HIT (23) and INS-1
cells cultured in elevated glucose were independent of changes in cell
proliferation. Overall, we interpret the observations made in HIT and
INS-1 cells to represent a mechanism whereby elevations in glucose can
mediate dysfunctional regulation of insulin gene expression by markedly
decreasing the binding activities of two ß-cell-specific
transcription factors. The loss of STF-1 expression has also been
implicated in diminished insulin biosynthesis observed in 90%
pancreatectomized rats (50). The involvement of STF-1 and C1 activator
in mediating the glucotoxic effects on insulin gene expression in
genetic rodent models of type II diabetes is currently under
investigation.
 |
MATERIALS AND METHODS
|
|---|
Cell Cultures
INS-1 cells (27) (a gift from C. Wollheim, Geneva, Switzerland)
were routinely grown at 5% CO2-95% air at 37 C in
RPMI-1640 containing 11.1 mM glucose and supplemented with
10% FBS, 1 mM pyruvate, 10 mM HEPES, 50
µM 2-mercaptoethanol, 100 U penicillin/ml, and 100 µg
streptomycin/ml. In all the experiments described the RPMI-1640 medium
contained the supplements described above. Cells were passaged weekly
after trypsin-EDTA detachment. All studies were performed on INS-1
passages between 70 and 84.
RNA Isolation and Northern and Slot Blot Analysis
Cells were plated at a density of 5 x 106
cells per 60-mm dish in RPMI-1640 containing 11.1 mM
glucose. The following day the cells were incubated with RPMI-1640
containing various glucose concentrations and lengths of time as
indicated in the figure legends. Total cellular RNA was isolated by the
guanidinium isothiocyanate method (51). Northern blots were performed
as described previously (23), in which 1015 µg total RNA were
fractionated on a 1.5% agarose gel containing 6.7% formaldehyde and
electrotransferred onto a nylon membrane (Micron Separation Inc.
Westbro, MA). Slot blot analysis were performed as described previously
(52), in which 2.5 µg total RNA were transferred directly to a nylon
membrane using a bio-dot apparatus (Bio-Rad, Hercules, CA) and UV
cross-linked. Membranes were hybridized in 50% formamide, 5x
NaCl-sodium citrate (SSC), 2x Denhardts, 50 mM sodium
phosphate, and 0.1 mg/ml denatured salmon sperm DNA at 42 C with
32P-labeled cDNA probes. The membranes were washed three
times at room temperature in 2x SSC and 0.1% SDS and then twice at 65
C in 0.2x SSC and 0.1% SDS. The blots were probed with cDNAs isolated
from pHFßA-1 [human ß-actin cDNA clone (53)], pshi1 [Syrian
hamster preproinsulin cDNA clone (54)], and pSK900 [rat STF-1 cDNA
clone (12)] that had been labeled with [
32P]dCTP by
random priming (55). The STF-1 cDNA probe contained an N-terminal STF-1
cDNA sequence +331 to +717. Insulin Northern blots were quantitated
using an AGFA Arcus II scanning densitometer (AGFA-Gevaert N. V.,
Belgium) and NIH image software. Slot blots and STF-1 Northern blots
were quantitated using a Molecular Dynamics PhosphoImager (Molecular
Dynamics, Sunnyvale, CA).
Reporter Genes
The plasmid INSCAT contains the CAT gene under transcriptional
regulation by the human insulin gene sequences -326 to +30 as
previously described (24). The plasmid PKCAT contains the CAT gene
under transcriptional regulation by the rat pyruvate kinase gene
sequences -197 to +12 and has previously been shown to be glucose
responsive in primary hepatocytes (56). The plasmids STF-1[-6.5
kb]LUC and STF-1[-190]LUC (a gift from Dr. Montminy, Joslin
Diabetes Center, Harvard Medical School, Boston, MA) contain the
luciferase gene under transcriptional regulation by the rat STF-1 gene
sequences -6500 to +68 and -190 to +78, respectively (33).
Cell Transfections and CAT Assays
INS-1 cells were subcultured at a density of 1.8 x
106 cells per well (diameter 3.5 cm) in RPMI-1640
containing 11.1 mM glucose 2 days before transfection.
Cells were transfected with 2 µg reporter vector DNA for 4 h at
37 C by a liposome-mediated method as described previously (24). All
transfections were performed in FBS-free RPMI-1640 containing 2.8 or
4.0 mM glucose. The transfection medium was then replaced
with RPMI-1640 containing 10% FBS and the indicated glucose
concentrations. Twenty four to 48 h after transfection, cells were
harvested and CAT or luciferase activity was assayed as previously
described (24, 26)
Nuclear Extracts and Electrophoretic Mobility Shift Assays
(EMSAs)
Nuclear extracts were made from INS-1 and HIT-T15 cells
according to the method described by Schreiber et al. (57).
Double-stranded oligodeoxynucleotide probes to the human insulin gene
A3 element [previously termed the CT2 motif (3); -230
CCCCTGGTTAAGACTCTAATGACCCGCTGG -201], rat insulin II gene E1 element
[previously termed the ICE (3); -104 TCTGGCCATCTGCTGGATCCT -85] and
rat insulin II gene C1 element [previously termed the RIPE3b1 element
(3); -126 TGGAAACTGCAGCTTCAGCCCCTCT -101] were labeled with
[
32P]dCTP by filling in overhanging 5'-end with the
large fragment of DNA polymerase 1. Binding reactions (10 µg/lane)
and electrophoresis were performed as described by Shih and Towle (58)
except that 0.12 µg/µl of poly(deoxyinosinic-deoxycytidylic)acid
was added to the binding buffer. Competition experiments were performed
using double-stranded oligodeoxynucleotides containing a mutated
C1-binding site (-126 TGGAAACTGCAGCTCGAGCCCCTCT -101) and
mutated A3-binding site (-230
CCCCTGGTTAAGACTACGCGTACCCGCTGGTCC -201). The
underlined nucleotides indicate mutations within the C1 (20, 45) and A3 elements (24) that block binding in EMSAs and reduce
expression of insulin reporter genes in vivo. Supershift
analysis were performed by the addition of 2 µl of anti-N-terminal
XIHbox8 antibodies that specifically recognize STF-1 [from Dr.
Christopher Wright, Vanderbilt University, Nashville, TN (11)].
Preparation and Use of Recomibant Adenovirus Containing the cDNA
Encoding p21Cip1/WAF1
A recombinant adenovirus containing the cDNA encoding human
p12Cip1/WAF1 was prepared by the method of Becker et
al. (59). The recombinant adenovirus, AdCMV-p21, was prepared by
insertion of the human p21 cDNA sequences (from Dr. Bert Vogelstein,
John Hopkins University, Baltimore, MD) into the plasmid pACCMV.pL.pA
adjacent to the CMV promoter. pACCMV.pL.pA containing the
p21Cip1/WAF1 cDNA was cotransfected with pJM17 plasmid into
293 cells. The resultant recombinant virus was amplified in 293 cells
and titered by plaque assay (59). INS-1 cells were uninfected or
infected with
50 plaque-forming units (pfu) per cell AdCMV-p21 or
control virus containing the ß-galactosidase gene (AdCMV-ßGAL, from
Dr. Chris Newgard, University of Texas, Southwestern, Dallas, TX) for
2 h. The viral incubation media were replaced with RPMI-1640 media
containing 4.0 mM glucose and supplemented as described
above for 16 h. Media were then replaced with media containing
either 4.0 mM or 16.7 mM glucose as described
in the figure legends.
Western Blot Analysis for p21Cip1/WAF1
Expression
INS-1 cells were scraped and homogenized in ice-cold lysis
buffer containing 50 mM Tris-HCl, pH 7.5, 250
mM NaCl, 0.5% NP-40, 50 mM NaF, 1
mM sodium orthovanadate, 1 mM dithiothreitol, 1
mM phenylmethylsulfonyl fluoride, 25 µg/ml aprotinin, and
25 µg/ml leupeptin. Cell debris was removed by centrifugation at
13,000 x g for 5 min. Cell extracts (25 µg) were
resolved by electrophoresis through a 10% SDS-polyacrylamide gel.
Resolved proteins were then transferred to nitrocellulose membranes,
and p21 immunoreactivity was detected with a 1:2000 dilution of a p21
polyclonal antibody (H-164, Santa Cruz Biotechnology, Inc., Santa Cruz,
CA) and visualized by chemiluminescence (Pierce Chemical Co., Rockford,
IL).
Cell Cycle Analysis
Cells were plated at a density of 1.8 x 106
cells per well (3.5 cm diameter) in RPMI-1640 containing 11.1
mM glucose for 24 h. Cells were then incubated in 4.0
mM glucose for 24 h. Cells were then infected with no
virus or AdCMV-ßGAL or AdCMV-p21 and incubated for an additional
16 h in 4.0 mM glucose. Cells were then incubated in
either 4.0 mM or 16.7 mM glucose-containing
media as described in the figure legends. Cells were detached by
trypsin-EDTA, washed twice with PBS, and fixed in 80% ethanol. After
fixation, cells were washed twice with PBS and stained for 30 min in
PBS containing 50 µg/ml propidium iodide and 0.01% ribonuclease.
Relative distribution of cells in G1, G2, and S phases of the cell
cycle was determined by flow cytometry on a Becton Dickinson FACS
Vantage (Becton Dickinson, Franklin Lakes, NJ).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Howard Towle, University of Minnesota, for
providing the pyruvate kinase reporter gene, Dr. Marc Montminy, Joslin
Diabetes Center, for providing the STF-1 reporter genes and genomic
clones, and Dr. Christopher Newgard, University of Texas, Southwestern,
for helping us generate the AdCMV-p21 adenovirus and for providing the
AdCMV-ßGAL adenovirus. We also thank R. Paul Robertson for critical
review and helpful discussions.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Dr. Karl Olson, Department of Physiology, Michigan State University, East Lansing, Michigan 48824-1101.
This work was supported by an American Diabetes Association research
grant (to L.K.O.), a Michigan State University grant (to L.K.O.), the
Association de Langue Francaise Pour L Etude du Diabete et des
Maladies Metaboliques (to V.P.), and NIH Grant DK-38325 (to R. Paul
Robertson).
Received for publication November 13, 1996.
Revision received November 5, 1997.
Accepted for publication November 10, 1997.
 |
REFERENCES
|
|---|
-
Stein R 1993 Factors regulating insulin gene
transcription. Trends Endocrinol Metab 4:96100[Medline]
-
Docherty K, Clark A 1995 The regulation of insulin gene
transcription. In: Leslie R, Robbins D (eds) Diabetes: Clinical Science
in Practise. Cambridge University Press, Cambridge, U.K.
-
German M, Ashcroft S, Docherty K, Edlund H, Edlund T,
Goodison S, Imura, H, Kennedy G, Madsen O, Melloul D, Moss L, Olson K,
Permutt MA, Philippe J, Robertson RP, Rutter WJ, Serup P, Stein R,
Steiner D, Tsai M-J, Walker MD 1995 The insulin gene promoter: a
simplified nomenclature. Diabetes 44:10021004[Medline]
-
Ohlsson H, Karlsson O, Edlund T 1988 A beta-cell-specific
protein binds to the two major regulatory sequences of the insulin gene
enhancer. Proc Natl Acad Sci USA 85:42284231[Abstract/Free Full Text]
-
Nelson C, Shen L-P, Meister A, Fodor E, Rutter W 1990 Pan: a
transcriptional regulator that binds chymotrypsin, insulin, and AP-4
enhancer motifs. Genes Dev 4:10351043[Abstract/Free Full Text]
-
Naya FJ, Stellrecht CMM, Tsai M-J 1995 Tissue-specific
regulation of the insulin gene by a novel basic helix-loop-helix
transcription factor. Genes Dev 9:10091019[Abstract/Free Full Text]
-
Robinson GLWG, Cordle SR, Henderson E, Weil PA, Teitelman G,
Stein R 1994 Isolation and characterization of a novel transcription
factor that binds to and activates insulin control element-mediated
expression. Mol Cell Biol 14:67046714[Abstract/Free Full Text]
-
Boam DSW, Docherty K 1989 A tissue-specific nuclear factor
binds to multiple sites in the human insulin-gene enhancer. Biochem J 264:233239[Medline]
-
German MS, Moss LG, Wang J, Rutter WJ 1992 The insulin and
islet amyloid polypeptide genes contain similar cell-specific promoter
elements that bind identical ß-cell nuclear complexes. Mol Cell Biol 12:17771788[Abstract/Free Full Text]
-
Karlsson O, Edlund T, Moss J, Rutter W, Walker M 1987 A
mutational analysis of the insulin gene transcription control region:
expression in beta cells is dependent on two related sequences within
the enhancer. Proc Natl Acad Sci USA 84:88198823[Abstract/Free Full Text]
-
Peshavaria M, Gamer L, Henderson E, Teitelman G, Wright CVE,
Stein R 1994 XIHbox 8, an endoderm-specific Xenopus
homeodomain protein, is closely related to a mammalian insulin gene
transcription factor. Mol Endocrinol 8:806816[Abstract]
-
Leonard J, Peers B, Johnson T, Ferrere K, Lee S, Montminy M 1993 Characterization of somatostatin transactivating factor 1, a novel
homeobox factor that stimulates somatostatin expression in pancreatic
islet cells. Mol Endocrinol 7:12751283[Abstract]
-
Ohlsson H, Karlsson K, Edlund T 1993 IPF-1, a
homeodomain-containing transactivator of the insulin gene. EMBO J 12:42514259[Medline]
-
Miller CP, McGehee Jr RE, Habener JF 1994 IDX-1: a new
homeodomain transcription factor expressed in rat pancreatic islets and
duodenum that transactivates the somatostatin gene. EMBO J 13:11451156[Medline]
-
Guz Y, Montminy MR, Stein R, Leonard J, Gamer LW, Wright CVE,
Teitelman G 1995 Expression of murine STF-1, a putative insulin gene
transcription factor, in ß-cells of pancreas, duodenal epithelium and
pancreatic exocrine and endocrine progenitors during ontogeny.
Development 121:1118[Abstract]
-
Peers B, Leonard J, Sharma S, Teitelman G, Montminy M 1994 Insulin expression in pancreatic islet cells relies on cooperative
interactions between helix loop helix factor E47 and the homeobox
factor STF-1. Mol Endocrinol 8:17981806[Abstract]
-
Petersen H, Serup P, Leonard J, Michelsen B, Madsen O 1994 Transcriptional regulation of the human insulin gene is dependent on
the homeodomain protein STF1/IPF1 acting through the CT boxes. Proc
Natl Acad Sci USA 91:1046510469[Abstract/Free Full Text]
-
Serup P, Petersen H, Pedersen E, Edlund H, Leonard J, Petersen
J, Larsson L-I, Madsen O 1995 The homeodomain protein IPF-1/STF-1 is
expressed in a subset of islet cells and promotes rat insulin 1 gene
expression dependent on a intact E1 helix-loop-helix factor binding
site. Biochem J 310:9971003
-
Crowe DT, Tsai M-J 1989 Mutagenesis of the rat insulin II
5'-flanking region defines sequences important for expression in HIT
cells. Mol Cell Biol 9:17841789[Abstract/Free Full Text]
-
Shieh S-Y, Tsai M-J 1991 Cell-specific and ubiquitous factors
are responsible for enhancer activity of the rat insulin II gene.
J Biol Chem 266:1670816714[Abstract/Free Full Text]
-
Whelan J, Poon D, Weil PA, Stein R 1989 Pancreatic
ß-cell-specific expression of the rat insulin II gene is controlled
by positive and negative transcriptional elements. Mol Cell Biol 9:32533259[Abstract/Free Full Text]
-
Santerre RF, Cook RA, Crisel RMD, Sharp JD, Schmidt RJ,
Williams DC, Wilson CP 1981 Insulin synthesis in a clonal cell line of
simian virus 40-transformed hamster pancreatic beta cells. Proc Natl
Acad Sci USA 78:43394343[Abstract/Free Full Text]
-
Robertson RP, Zhang H-Z, Pyzdrowski KL, Walseth TF 1992 Preservation of insulin mRNA levels and insulin secretion in HIT cells
by avoidance of chronic exposure to high glucose concentrations. J
Clin Invest 90:320325
-
Olson LK, Redmon JB, Towle HC, Robertson RP 1993 Chronic
exposure of HIT cells to high glucose concentrations paradoxically
decreases insulin gene transcription and alters binding of insulin gene
regulatory protein. J Clin Invest 92:514519
-
Olson LK, Sharma A, Peshavaria M, Wright CVE, Towle HC,
Robertson RP, Stein R 1995 Reduction of insulin gene transcription in
HIT-T15 ß cells chronically exposed to a supraphysiological glucose
concentration is associated with loss of STF-1 transcription factor
expression. Proc Natl Acad Sci USA 92:91279131[Abstract/Free Full Text]
-
Sharma A, Olson L, Robertson RP, Stein R 1995 The reduction of
insulin gene transcription in HIT-T15 cells chronically exposed to high
glucose concentration is associated with the loss of RIPE3b1 and STF-1
transcription factor expression. Mol Endocrinol 9:11271134[Abstract]
-
Asfari M, Janjic D, Meda P, Li G, Halban PA, Wollheim CB 1992 Establishment of 2-mercaptoethanol-dependent differentiated
insulin-secreting cell lines. Endocrinology 130:167178[Abstract]
-
Janjic D, Wollheim C 1992 Effect of 2-mercaptoethanol on
glutathione levels, cystine uptake and insulin secretion in insulin
secreting cells. Eur J Biochem 210:297304[Medline]
-
Waeber G, Thompson N, Haefliger J, Nicod P 1994 Characterization of the murine high Km glucose transporter gene and its
transcriptional regulation by glucose in a differentiated
insulin-secreting cell line. J Biol Chem 269:2691226919[Abstract/Free Full Text]
-
Marie S, Diaz-Guerra M-J, Miquerol L, Kahn A, Iynedjian PB 1993 The pyruvate kinase gene as a model for studies of
glucose-dependent regulation of gene expression in the endocrine
pancreatic ß-cell type. J Biol Chem 268:2388123890[Abstract/Free Full Text]
-
Brun T, Roche E, Kim K-H, Prentki M 1993 Glucose regulates
acetyl-CoA carboxylase gene expression in a pancreatic ß-cell line
(INS-1). J Biol Chem 268:1890518911[Abstract/Free Full Text]
-
Zhang S, Kim K-H 1995 Glucose activation of acetyl-CoA
carboxylase in association with insulin secretion in a pancreatic
ß-cell line. J Endocrinol 147:3341[Abstract]
-
Sharma S, Leonard J, Lee S, Chapman H, Leiter E, Montminy M 1996 Pancreatic islet expression of the homeobox factor STF-1 relies on
an E-box motif that binds USF. J Biol Chem 271:22942299[Abstract/Free Full Text]
-
Frodin M, Sekine N, Roche E, Filloux C, Prentki M, Wollheim C,
Obberghen E 1995 Glucose, other secretagogues, and nerve growth factor
stimulate mitogen-activated protein kinase in the insulin-secreting
ß-cell line, INS-1. J Biol Chem 270:78827889[Abstract/Free Full Text]
-
Gu Y, Turck C, Morgan D 1993 Inhibition of CDK2 activity
in vivo by an associated 20K regulatory subunit. Nature 366:707710[CrossRef][Medline]
-
Harper J, Adami G, Wei N, Keyomarsi K, Elledge S 1993 The p21
cdk-interacting protein Cip 1 is a potent inhibitor of G1
cyclin-dependent kinases. Cell 75:805816[CrossRef][Medline]
-
Noda A, Ning Y, Venable S, Pereira-Smith O, Smith J 1994 Cloning of senescent cell-derived inhibitors of DNA synthesis using an
expression screen. Exp Cell Res 211:9098[CrossRef][Medline]
-
Xiong Y, Hannon G, Zhang H, Casso D, Kobayashi R, Beach D 1993 p21 is a universal inhibitor of cyclin kinases. Nature 366:701704[CrossRef][Medline]
-
El-Diery W, Tokino T, Velculescu V, Levy D, Parsons R, Trent
J, Lin D, Mercer E, Kinzler K, Vogelstein B 1993 WAF1, a potential
mediator of p53 tumor suppression. Cell 817825
-
El-Deiry W, Harper J, OConnor P, Velculescu V, Canman C,
Jackman J, Pietenpol J, Burrell M, Hill D, Wang Y, Wiman K, Mercer W,
Kastan M, Kohn K, Elledge S, Kinzler K, Vogelstein B 1994 WAF1/CIP1 is
induced in p53-mediated G1 arrest and apoptosis. Cancer Res 54:11691174[Abstract/Free Full Text]
-
Di Leonardo A, Linke S, Clarkin K, Wahl G 1994 DNA damage
triggers a prolonged p53-dependent G1 arrest and long-term induction of
Cip1 in normal human fibroblasts. Genes Dev 8:2540[Abstract/Free Full Text]
-
Dulic V, Kaufman W, Wilson S, Tisty T, Lees E, Harper J,
Elledge S, Reed S 1994 p53-dependent inhibition of cyclin-dependent
kinase activities in human fibroblasts during radiation-induced G1
arrest. Cell 76:10131023[CrossRef][Medline]
-
Docherty K, Clark AR 1994 Nutrient regulation of insulin gene
expression. FASEB J 8:2027[Abstract]
-
German MS, Wang J 1994 The insulin gene contains multiple
transcriptional elements that respond to glucose. Mol Cell Biol 14:40674075[Abstract/Free Full Text]
-
Sharma A, Stein R 1994 Glucose-induced transcription of the
insulin gene is mediated by factors required for ß-cell-type-specific
expression. Mol Cell Biol 14:871879[Abstract/Free Full Text]
-
Melloul D, Ben-Neriah Y, Cerasi E 1993 Glucose modulates the
binding of an islet-specific factor to a conserved sequence within the
rat 1 and the human insulin promoters. Proc Natl Acad Sci USA 90:38653869[Abstract/Free Full Text]
-
MacFarlane WM, Read ML, Gilligan M, Bujalska I, Docherty K 1994 Glucose modulates the binding activity of the ß-cell
transcription factor IUF1 in a phosphorylation-dependent manner.
Biochem J 303:625631
-
Serup P, Jensen J, Andersen F, Jorgensen M, Blume N, Holst J,
Madsen O 1996 Induction of insulin and islet amyloid polypeptide
production in pancreatic islet glucagonoma cells by insulin promoter
factor 1. Proc Natl Acad Sci USA 93:90159020[Abstract/Free Full Text]
-
Moran A, Zhang H-J, Olson L, Harmon J, Poitout V, Robertson R 1997 Differentiation of glucose toxicity from beta cell exhaustion
during the evolution of defective insulin gene expression in the
pancreatic islet cell line, HIT-T15. J Clin Invest 99:534539[Medline]
-
Zangen D, Bonner-Weir S, Lee C, Latimer J, Miller C, Habener
J, Weir G 1997 Reduced insulin, GLUT2, and IDX-1 in beta-cells after
partial pancreatectomy. Diabetes 46:258264[Abstract]
-
Chomczynski P, Sacchi N 1987 Single step method of RNA
isolation by acid guanidium thiocynate-phenol-chloroform extraction.
Anal Biochem 162:156159[Medline]
-
Zhang H-J, Petersen B, Robertson RP 1994 Variable regulation
by insulin of insulin gene expression in HIT-T15 cells. Diabetologia 37:559566[Medline]
-
Gunning P, Ponte P, Okayama H, Engel J, Blau H, Kedes L 1983 Isolation and characterization of full-length cDNA clones for human
-, ß- and
-actin mRNAs: skeletal but not cytoplsmic actins have
an amino-terminal cysteine that is subsequently removed. Mol Cell Biol 3:787795[Abstract/Free Full Text]
-
Bell GI, Sanchez-Pescador R 1984 Sequence of a cDNA encoding
Syrain hamster preproinsulin. Diabetes 33:297300[Abstract]
-
Feinberg AP, Vogelstein B 1984 A technique for radiolabeling
DNA restriction endonuclease fragments to high specific activity. Anal
Biochem 137:266267[CrossRef][Medline]
-
Thompson K, Towle HC 1991 Localization of the carbohydrate
response element of the rat L-type pyruvate kinase gene. J Biol
Chem 266:86798682[Abstract/Free Full Text]
-
Schreiber E, Matthias P, Muller MM, Schaffner W 1989 Rapid
detection of octamer binding proteins with mini extracts, prepared
from a small number of cells. Nucleic Acids Res 17:6419[Free Full Text]
-
Shih H-M, Towle HC 1992 Definition of the carbohydrate
response element of the rat S14 gene. Evidence for a common factor
required for carbohydrate regulation of hepatic genes. J Biol Chem 267:1322213228[Abstract/Free Full Text]
-
Becker T, Noel R, Coats W, Gomez-Foix A, Alam T, Gerard R,
Newgard C 1994 In: Roth M (ed) Protein Expression in Animal Cells.
Academic Press, Inc., San Diego, CA, vol. 43:161189
This article has been cited by other articles:

|
 |

|
 |
 
V. Poitout and R. P. Robertson
Glucolipotoxicity: Fuel Excess and {beta}-Cell Dysfunction
Endocr. Rev.,
May 1, 2008;
29(3):
351 - 366.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Dubois, P. Vacher, B. Roger, D. Huyghe, B. Vandewalle, J. Kerr-Conte, F. Pattou, N. Moustaid-Moussa, and J. Lang
Glucotoxicity Inhibits Late Steps of Insulin Exocytosis
Endocrinology,
April 1, 2007;
148(4):
1605 - 1614.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-G. Park, K.-M. Lee, H.-Y. Seo, J.-H. Suh, H.-S. Kim, L. Wang, K.-C. Won, H.-W. Lee, J.-Y. Park, K.-U. Lee, et al.
Glucotoxicity in the INS-1 Rat Insulinoma Cell Line Is Mediated by the Orphan Nuclear Receptor Small Heterodimer Partner
Diabetes,
February 1, 2007;
56(2):
431 - 437.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ubeda, J. M. Rukstalis, and J. F. Habener
Inhibition of Cyclin-dependent Kinase 5 Activity Protects Pancreatic Beta Cells from Glucotoxicity
J. Biol. Chem.,
September 29, 2006;
281(39):
28858 - 28864.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Z. Ye, M.-H. Tai, K. D. Linning, C. Szabo, and L. K. Olson
MafA Expression and Insulin Promoter Activity Are Induced by Nicotinamide and Related Compounds in INS-1 Pancreatic {beta}-Cells
Diabetes,
March 1, 2006;
55(3):
742 - 750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Kawamori, H. Kaneto, Y. Nakatani, T.-a. Matsuoka, M. Matsuhisa, M. Hori, and Y. Yamasaki
The Forkhead Transcription Factor Foxo1 Bridges the JNK Pathway and the Transcription Factor PDX-1 through Its Intracellular Translocati |