help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hu, J.-F.
Right arrow Articles by Hoffman, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hu, J.-F.
Right arrow Articles by Hoffman, A. R.
Molecular Endocrinology 12 (2): 220-232
Copyright © 1998 by The Endocrine Society

Tissue-Specific Imprinting of the Mouse Insulin-Like Growth Factor II Receptor Gene Correlates with Differential Allele-Specific DNA Methylation

Ji-Fan Hu, Haritha Oruganti, Thanh H. Vu and Andrew R. Hoffman

Geriatric Research, Educational and Clinical Center and Medical Service Veterans Affairs Palo Alto Health Care System and Division of Endocrinology Department of Medicine Stanford University Palo Alto, California 94304


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Imprinted genes may be expressed uniparentally in a tissue- and development-specific manner. The insulin-like growth factor II receptor gene (Igf2r), one of the first imprinted genes to be identified, is an attractive candidate for studying the molecular mechanism of genomic imprinting because it is transcribed monoallelically in the mouse but biallelically in humans. To identify the factors that control genomic imprinting, we examined allelic expression of Igf2r at different ages in interspecific mice. We found that Igf2r is not always monoallelically expressed. Paternal imprinting of Igf2r is maintained in peripheral tissues, including liver, kidney, heart, spleen, intestine, bladder, skin, bone, and skeletal muscle. However, in central nervous system (CNS), Igf2r is expressed from both parental alleles. Southern analysis of the Igf2r promoter (region 1) revealed that, outside of the CNS where Igf2r is monoallelically expressed, the suppressed paternal allele is fully methylated while the expressed maternal allele is completely unmethylated. In CNS, however, both parental alleles are unmethylated in region 1. The importance of DNA methylation in the maintenance of the genomic imprint was also confirmed by the finding that Igf2r imprinting was relaxed by 5-azacytidine treatment. The correlation between genomic imprinting and allelic Igf2r methylation in CNS and other tissues thus suggests that the epigenetic modification in the promoter region may function as one of the major factors in maintaining the monoallelic expression of Igf2r.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In the mammalian genome, there exists a subset of genes in which the two parental alleles are not equally expressed. Although both parental copies of the gene are present, only one of the parental alleles is expressed while the other is transcriptionally silent or imprinted. These imprinted genes usually have crucial roles in mammalian development, especially in fetal growth and viability, as seen by the failure of uniparental embryos to develop normally (1, 2). Abnormalities of genomic imprinting have been implicated in some human diseases, including Angelman syndrome, Prader-Willi syndrome (3, 4), Beckwith-Wiedemann syndrome (5), Wilms’ tumor (6, 7), and many other neoplasms (8, 9, 10).

Several imprinted genes are aggregated in subregions of chromosomes (11). The clustered distribution of Igf2 (12), H19 (13), Mash 2 (14), KIP2 (15), and insulin 2 (16) in the distal region of mouse chromosome 7 is a typical example. Interestingly, these imprinted genes, although closely clustered, do not necessarily share similar patterns of allelic expression. For example, Igf2 is expressed exclusively from its paternal allele, while the adjacent H19 is expressed only from the maternal copy of the gene.

The insulin-like growth factor II receptor (Igf2r), also known as the cation-independent mannose-6-phosphate receptor, was mapped to mouse chromosome 17 in the vicinity of Tme (the T-associated maternal effect). Igf2r expression was detectable only in those mice that inherit the deletion of Tme locus from the paternal allele, but no Igf2r expression was observed when Tme was maternally inherited (17), suggesting that the Igf2r gene is paternally imprinted. The requirement for the transcription of the maternal allele of Igf2r in embryonic growth was further confirmed by the specific deletion of Igf2r (18). Mice carrying the maternally transmitted mutant Igf2r allele generally die at birth (18, 19).

The underlying mechanism for the regulation of genomic imprinting is still poorly defined. Among the approximately two dozen imprinted genes identified, Igf2r is an attractive candidate for exploring the molecular mechanism for genomic imprinting because it is imprinted in mouse (17) but not imprinted in the majority of human tissues (20, 21). Two regions of the mouse Igf2r gene are differentially methylated on the parental chromosomes. These regions have been explored to learn whether they serve as epigenetic marks regulating genomic imprinting (22). The first region (region 1) includes the Igf2r promoter and is methylated only on the suppressed paternal allele. The other modified region is located in intron 2 of Igf2r (region 2), and it is preferentially methylated on the expressed maternal allele. Using interspecific mice as an animal model, we found that mouse Igf2r, which has always been considered to be imprinted, is biallelically expressed throughout the central nervous system (CNS) and monoallelically expressed in peripheral tissues. The differential genomic imprinting of Igf2r between CNS and all other tissues correlates with patterns of DNA methylation in the promoter region of the gene, suggesting a direct role for DNA methylation in region 1 in regulating the allelic expression of Igf2r. Differential imprinting of Igf2r between CNS and peripheral tissues may provide a useful model for further investigation aimed at understanding the underlying mechanisms of allelic expression of imprinted genes.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Igf2r Is Expressed Monoallelically in Peripheral Tissues but Is Biallelically Expressed in CNS
To examine the allelic expression of Igf2r, we first sequenced the region of Igf2r exons 47 and 48 and identified several polymorphic sites between M. spretus and M. musculus. A HaeIII site, located in exon 48, is specific for M. spretus, while an AvaII site is present only in M. musculus (Fig. 1AGo). To distinguish cDNA derived from the expressed mRNA from genomic DNA, a PCR primer set, which was designed to cross intron 47, was used to amplify cDNA of Igf2r.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. Allelic Expression of Igf2r in F1 Generation Mice

A, Scheme of detection of allelic expression of Igf2r by PCR. The [{gamma}-32P]ATP end-labeled primer (6105) was used to amplify the cDNA of F1 (male M. spretus x female M. musculus) mice in combination with the 3'-primer (6294). The PCR products were digested with the polymorphic HaeIII restriction enzyme to distinguish the two parental alleles. B, Allelic expression of Igf2r in peripheral tissues. Lane 1, 100-bp marker; lane 2, uncut PCR product; lane 3, M. musculus liver cDNA; lane 4, M. spretus liver cDNA; lanes 5–10, month 2 F1 mouse liver, kidney, heart, lung, spleen, and intestine; lanes 11–18, day 2 F1 mouse liver, muscle, kidney, bone, bladder, intestine, lung, and heart, respectively. Note the monoallelic expression of Igf2r from the maternal M. musculus allele in these peripheral tissues. C, Allelic expression of Igf2r in the CNS of F1 mice. Lane 1, 100-bp marker; lane 2, uncut PCR product; lane 3, M. musculus liver cDNA; lane 4, M. spretus liver cDNA; lanes 5–8, month 2 F1 mouse cerebral cortex, cerebellum, pons, and medulla; lane 9, day 2 F1 mouse whole brain; lane 10, day 3 F1 mouse whole brain; lanes 11–14, week 2 F1 mouse cerebral cortex, cerebellum, pons, and medulla, respectively. D, Allelic expression of Igf2r in the CNS of backcross newborns and embryos. Lane 1, 100-bp marker; lane 2, uncut PCR product; lane 3, M. musculus liver cDNA; lane 4, M. spretus liver cDNA; lanes 5–6: day 15 embryos; lanes 7–10, mouse No. 2 cerebral cortex, cerebellum, pons, and medulla; lanes 11–14, mouse No. 3 cerebral cortex, cerebellum, pons, and medulla; and lanes 15–18, mouse No. 8 cerebral cortex, cerebellum, pons, and medulla.

 
With the aid of the HaeIII polymorphism, we examined the allelic expression of Igf2r in F1 mice (female M. spretus x male M. musculus) at the ages of 2 days, 3 days, 14 days, and 2 months. As previously reported (13, 17), all peripheral tissues, including liver, kidney, lung, heart, spleen, intestine, and pancreas, exhibited monoallelic expression of Igf2r, with only the maternal M. musculus allele being transcribed while the paternal M. spretus allele was suppressed (Fig. 1BGo). On the other hand, we found biallelic expression of Igf2r in each region of the CNS (Fig. 1CGo), suggesting a pattern of the tissue-specific lack of Igf2r imprinting.

Biallelic expression of Igf2r was also observed in the CNS of informative backcross newborns and embryos (Fig. 1DGo), in which Igf2r expression is higher than in adult animals (23, 24). Thus, the lack of Igf2r imprinting in the CNS was an very early event in life, starting as early as embryo development and extending to adult life. The absence of Igf2r imprinting in CNS was also confirmed by using Scrf I, another polymorphism of Igf2r reported by Villar et al. (25) (data not shown).

DNA Methylation of Igf2r Promoter (Region 1) Is Associated with Genomic Imprinting
Differential imprinting of Igf2r between CNS and peripheral tissues in the same animal thus provides an ideal model to study the molecular mechanisms underlying genomic imprinting. DNA methylation at CpG dinucleotides is currently the best candidate for cis-epigenetic modification that is associated with genomic imprinting. Two GC-rich regions of Igf2r DNA (regions 1 and 2) have previously been identified (22). These two regions are differentially methylated on parental chromosomes and are closely related to the development of Igf2r imprinting in mice. We thus focused on these two regions to determine whether there is any correlation between DNA methylation and genomic imprinting. If DNA methylation in these two regions accounts for the maintenance or resetting of the imprint of Igf2r, we should see a different pattern of DNA methylation between CNS and all other tissues.

To distinguish DNA methylation in the two parental alleles, we first treated genomic DNA with HphI, which specifically digests the M. musculus allele near the Igf2r promoter region. This HphI polymorphic site is not present in M. spretus due to a 16-bp deletion that covers the HphI and several other restriction enzymes. HphI digestion of genomic DNA will yield a 1.5-kb fragment for the M. spretus allele, while the M. musculus allele will be digested into 1.2-kb and 0.3-kb fragments. We then used the following five methylation-sensitive restriction enzymes to digest genomic DNA: NotI, SalI, KspI, PmlI, and HpaII. The unmethylated DNA will be completely digested by these enzymes, while the methylated genomic DNA will be resistant to enzymatic digestion and will allow the parental DNA to remain intact.

DNA region 1 contains the Igf2r promoter and part of Igf2r exon 1 (Fig. 2AGo). Using Southern blot hybridization, we found that, in liver and kidney, the paternal M. spretus allele is completely methylated, as demonstrated by the presence of the intact 1.5-kb band (Fig. 2BGo). The 1.2-kb maternal M. musculus band, however, was completely digested by these restriction enzymes, indicating that the maternal allele of Igf2r is hypomethylated in region 1. Thus, in region 1, the imprinted paternal allele is hypermethylated, while the expressed maternal allele is fully unmethylated.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 2. Parental DNA Methylation of Igf2r at the Promoter Region (Region 1)

Panel A, Restriction enzyme map of Igf2r region 1 (not drawn to scale), based on the GenBank sequence of M. musculus (Access No. L06445). The region 1 DNA contains a total of 11 HpaII sites and several sites for other restriction enzymes. Partial sequencing of region 1 DNA (the portion covered by the probe) indicates that M. spretus has a 16-bp deletion that contains one HphI site and several other restriction enzyme sites in M. musculus. This HphI polymorphism (Hph I*) was used to distinguish the two parental alleles. There may be other polymorphisms in M. spretus in this region which has not been sequenced. H, HpaII; K, KspI; S, SalI; P, PmlI; N, NotI; Hp, HphI. Panel B, Allelic DNA methylation of region 1 in liver and kidney. Genomic DNAs were digested with HphI to separate the two parental alleles and were then cut by five different methylation-sensitive restriction enzymes. The digested DNAs were separated on 1.2% agarose gel and were blotted to a nylon filter for hybridization with the Igf2r probe. The methylated DNAs resist the digestion by methylation-sensitive restriction enzymes and will yield an intact fragment for the maternal M. musculus allele (1.2 kb) or for the paternal M. spretus allele (1.5 kb). In both liver and kidney, detection of the intact 1.5-kb fragment indicates that the paternal allele of Igf2r in this region is fully methylated, while the absence of 1.2-kb fragment demonstrates the hypomethylation of the maternal allele. Panel C, Allelic DNA methylation of region 1 in CNS (cerebral cortex and cerebellum). Using the same methylation-sensitive restriction enzymes as in Fig. 2BGo, it is clear that both parental alleles in this region are unmethylated as seen by the absence of intact 1.5- kb and 1.2-kb fragments.

 
We then used the same Southern hybridization method to examine the methylation status of both parental alleles in CNS. A completely different pattern of DNA methylation was observed in CNS, where no genomic imprinting of Igf2r was observed. In CNS, both the 1.5-kb paternal and the 1.2-kb maternal bands were completely digested by each of the five restriction enzymes, indicating that both parental alleles are unmethylated in region 1 (Fig. 2CGo). Thus, the absence of genomic imprinting of Igf2r in CNS may be related to demethylation of the paternal allele in Igf2r promoter region, which is usually hypermethylated in peripheral tissues in which the paternal allele of Igf2r is imprinted.

Differential Methylation of Igf2r Intron 2 (Region 2)
We also used Southern hybridization to compare the status of DNA methylation in region 2 of Igf2r (intron 2). By sequencing genomic DNA in this region, we identified two restriction enzyme polymorphisms: FokI in M. spretus and XhoI in M. musculus, by which the methylation status in the two parental alleles can be easily distinguished. We first used FokI to digest genomic DNA to yield a 2.2-kb fragment for the M. musculus allele and a 936-bp fragment for the M. spretus allele in this region. The FokI-digested DNAs were then subjected to digestion by four methylation-sensitive restriction enzymes: XhoI, KspI, HpaII, and MluI.

In liver and kidney, the maternal M. musculus allele is fully methylated as demonstrated by the intact 2.2-kb band in all samples treated with the four restriction enzymes (Fig. 3BGo). The methylated maternal allele also resists the digestion by XhoI, a unique polymorphic restriction enzyme site in M. musculus (Fig. 3BGo). The paternal M. spretus allele, however, is unmethylated; the 936-bp bands were completely digested by methylation-sensitive restriction enzymes, KspI, MluI, and HpaII. (XhoI is not present in the paternal M. musculus allele.) Thus, as reported by Stoger et al. (22), Igf2r is differentially methylated in region 2 with preferential methylation on the maternal allele, which is expressed in these tissues.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 3. Parental DNA Methylation of Igf2r in Igf2r Intron 2 (Region 2)

Panel A, Restriction enzyme map of Igf2r region 2 (not drawn to scale) based on the GenBank M. musculus sequence (access No. L06446). There are two polymorphic restriction enzyme sites for FokI (Fok I*) in M. spretus in this region for distinguishing the two parental alleles. One in the probe region was identified by sequencing, and the other was identified by restriction enzyme mapping. After treatment with FokI, genomic DNAs were subject to digestion with four methylation-sensitive restriction enzymes, XhoI, KspI, HpaII, and MluI. XhoI is also absent in M. spretus and thus serves as another polymorphic restriction enzyme to distinguish the parental alleles (XhoI*). There may be other polymorphisms in M. spretus in this region which has not been sequenced. F, FokI; X, XhoI; K, KspI; H, HpaII; M, MluI. Panel B, Allelic DNA methylation of region 2 in liver and kidney. Genomic DNAs were digested by FokI and then by three methylation-sensitive restriction enzymes. The maternal M. musculus allele of Igf2r in region 2 is methylated as seen by the intact 2.2-kb DNA fragment after enzyme digestion. The paternal M. spretus allele of Igf2r, however, is unmethylated in this region. Panel C, Allelic DNA methylation of region 2 in CNS (cerebral cortex and cerebellum). Note the same pattern of DNA methylation in CNS as in liver and kidney (Fig. 3BGo), i.e. the expressed maternal allele is methylated while the suppressed paternal allele is unmethylated.

 
However, we did not observe any differences in the pattern of DNA methylation between CNS and peripheral tissues. In liver and kidney, the expressed maternal allele is also hypermethylated in region 2 as it is in the CNS. However, the paternal allele, which is expressed only in CNS, is hypomethylated in all tissues examined (Fig. 3CGo). Since no differences in DNA methylation in region 2 were observed between CNS and peripheral tissues, one can exclude region 2 as an area involved in the maintenance of Igf2r imprinting.

Relaxation of Igf2r Imprinting by 5-Azacytidine (5-axa-C)
In a previous study of cultured astrocytes, we found that treatment of cells with the demethylating reagent, 5-aza-C, induced global DNA demethylation and reactivation of the imprinted maternal allele of Igf2 (26). We have also recently observed that, in backcross mice, treatment with 5-aza-C induced a global DNA demethylation and caused biallelic expression of Igf2 in many peripheral tissues (27). To confirm the importance of DNA methylation in the maintenance of the genomic imprint of Igf2r, we assessed allelic expression of Igf2r in backcross mice treated with 5-aza-C in vivo. Tissues were collected from both control and treated mice, and cDNAs were prepared and amplified by PCR. The PCR products from each parental allele were distinguished by digestion with AvaII, which specifically cuts the paternal M. spretus allele.

As expected, control backcross mice expressed Igf2r only from the maternal allele in peripheral tissues (Fig. 4AGo, lanes 4–10). However, after treatment with the demethylating reagent 5-aza-C, mice demonstrated loss of imprinting of Igf2r in some peripheral tissues (Fig. 4Go, B and C, lanes 4–10), with both parental alleles being expressed to varying degrees. These results thus demonstrate that DNA demethylation with 5-aza-C induces loss of Igf2r imprinting in vivo, confirming the importance of DNA methylation in the maintenance of Igf2r imprinting. It should be noted that the 5-aza-C-induced biallelic expression of Igf2r is not tissue-specific. The release of imprinting of Igf2r varied among tissues in the same mouse and among the same tissues between various mice. We also have observed a similar pattern of imprinting changes for Igf2, the ligand of Igf2r (27).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 4. Expression of Igf2r in Control (A) and 5-aza-C-Treated (B and C) Backcross Mice

Neonatal backcross mice were treated with either PBS or with 5-aza-C. The cDNA samples were amplified by PCR and subjected to digestion with AvaII, a polymorphic restriction enzyme site in M. musculus, for the examination of allelic expression of Igf2r. A, Control mouse 1: lane 1, 100 marker; lane 2, M. spretus liver cDNA; lane 3, M. musculus liver cDNA; lanes 4–10, cDNA samples from liver, kidney, lung, spleen, intestine, muscle, and pancreas. Panel B, Mouse 3: lane 1, 100 marker; lane 2, M. spretus liver cDNA; lane 3, M. musculus liver cDNA; lanes 4–10, cDNA samples from liver, kidney, lung, spleen, intestine, muscle, and pancreas. Panel C, mouse 6: lane 1, 100 marker; lane 2, M. spretus liver cDNA; lane 3, M. musculus liver cDNA; lanes 4–9, cDNA samples from liver, kidney, lung, spleen, intestine, and muscle. Note the detection of the 214-bp fragment from the paternal allele, indicating the relaxation of Igf2r imprinting after DNA demethylation by 5-aza-C.

 
No Correlation between Methyltransferase (MTase) and Igf2r Expression
We then asked whether the reduced DNA methylation in CNS could be caused by decreased expression of DNA MTase. We compared expression patterns of MTase and Igf2r in CNS and peripheral tissues. As seen in Fig. 5Go, both MTase and Igf2r are expressed in varying amounts in all tissues. There was no correlation in the expression of MTase and Igf2r between the imprinted peripheral and the nonimprinted CNS tissues. The ubiquitous presence of MTase in both CNS and the peripheral tissues makes it unlikely that the hypomethylation in region 1 in CNS was related to the lower activity of MTase, rather than to other factors that recognize and maintain DNA methylation differentially in the two parental alleles.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 5. Expression of DNA MTase (A) and Igf2r (B) in Tissues of a 2-Month-Old F1 Mouse

Lanes 1–10, cerebral cortex, cerebellum, pons, medulla, liver, kidney, heart, lung, intestine, and spleen. The 96-bp ß-actin was amplified simultaneously with either DNA MTase or Igf2r as an internal control.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
It has been known that Igf2r is imprinted in mouse, with only the maternal allele expressed (17). However, by using F1 generation mice derived from crossing M. spretus and M. musculus, we were surprised to find that Igf2r is biallelically expressed throughout the CNS, although it is imprinted in every other tissue. This tissue-specific difference in the genomic imprinting of Igf2r was confirmed in several F1 mice killed at different stages of development. We also observed this unique pattern of Igf2r imprinting in backcross mice (day 1 and embryos) derived from breeding female F1 mice with male M. musculus mice. Thus, the biallelic expression of Igf2r in CNS is not related to the abundance of gene expression because the lack of Igf2r imprinting is present both in F1 adult mice that manifest low expression of Igf2r and in backcross embryos that have the most abundant expression of Igf2r (23, 24).

The unexpected finding that Igf2r is monoallelically expressed in peripheral tissues and biallelically expressed in the CNS provides the second example of CNS-specific relaxation of imprinting. We (28) and others (12, 29) have previously reported that the Igf2 gene of mouse and rat shows absence of genomic imprinting in CNS. In every CNS region examined, all three promoters of Igf2 are expressed from both parental alleles (28). It is not clear why both Igf2 and its receptor (Igf2r) are expressed biallelically in CNS but monoallelically elsewhere. Other imprinted genes, such as H19 and Snrpn, do not exhibit this tissue-specific imprint pattern in mice (data not shown). The coincidence of lack of imprinting of both ligand and receptor in CNS suggests that Igf2 and Igf2r may function in an autocrine pathway to maintain the normal growth of CNS, which is isolated from exogenous IGF-II produced by liver and other tissues by the blood-brain barrier. The Igf2 gene, a critical embryonic growth factor (30), may be biallelically expressed in CNS (12, 28) as a requirement for normal growth, while the Igf2r, whose gene product degrades IGF-II, is also biallelically expressed in CNS as a dosage compensation effect to keep the growth factor activity in balance. Fetal mice with the null Igf2r genotype exhibit a 25–30% increase in body size (31, 18) because of the excess IGF-II, and it has been suggested that the opposing patterns of Igf2 (maternal) and Igf2r (paternal) imprinting regulate the growth of the fetus.

The tissue-specific imprinting of Igf2r in mouse thus provides an excellent model for investigating the molecular mechanisms of imprinting. Currently, little is known about how imprinted genes are regulated such that one of the parental alleles is expressed while the other is totally suppressed. There is substantial evidence that methylation of DNA at specific regions of imprinted genes may act in cis as an imprinting signal to regulate allelic expression of the gene. DNA methylation at CpG dinucleotides at these selective positions, established either in the gametes or shortly after fertilization, guides the establishment and thereafter the maintenance of the genomic imprint (22, 32). The importance of DNA methylation in development has been demonstrated by the knock-out mutant mice that lack DNA MTase (33), the only identified mammalian enzyme that specifically methylates DNA by using hemimethylated DNA as substrate. Global hypomethylation of DNA in these mutant embryos directly induced alteration of allelic expression of several imprinted genes, including Igf2, H19, and Igf2r (33).

It is thus interesting to compare the DNA methylation pattern of the Igf2r gene between the nonimprinted CNS and the imprinted peripheral tissues, as identification of DNA regions that are differentially modified in these tissues may provide a direct insight into the molecular control of Igf2r genomic imprinting. If DNA methylation in a specific region correlates with the imprinting of Igf2r, we should be able to detect a differential methylation pattern between CNS peripheral tissues. Differential DNA methylation of the two parental alleles has been reported in two specific regions of Igf2r (22). Region 1, which includes the Igf2r promoter, is methylated exclusively on the suppressed paternal allele and is unmethylated on the expressed maternal allele. The other differentially modified region is located in intron 2 of Igf2r (region 2). In contrast to region 1, the CpG dinucleotides in region 2 are preferentially methylated on the expressed maternal allele and are unmethylated on the suppressed paternal allele.

In this study, we examined DNA methylation in these two regions with several methylation-sensitive restriction enzymes. The genomic DNAs from the F1 hybrid mice were first digested with polymorphic restriction enzymes that specifically cut only one of the two parental alleles. With the aid of these polymorphic restriction enzymes, the two parental alleles are distinguished for the subsequent digestion by methylation-sensitive restriction enzymes. In peripheral tissues, where Igf2r is expressed from the maternal allele and suppressed from the paternal allele (Fig. 1Go), Southern blotting clearly showed that DNA at region 1 is methylated on the paternal allele and unmethylated on the maternal allele (Fig. 2Go). Interestingly, in CNS where both parental alleles of Igf2r are expressed, the paternal allele, which is methylated in peripheral tissues, is here demethylated. These results suggest that, as in the case of H19 (34, 35, 36, 37), hypermethylation of DNA at the promoter region blocks expression of the gene from the paternal allele. The unmethylated maternal allele of Igf2r is free to access the transcriptional machinery and is thus efficiently expressed. In CNS, hypomethylation of the DNA of the paternal allele releases the imprinting of Igf2r, leading to biallelic expression of the gene. The importance of DNA methylation in the maintenance of the Igf2r imprint was confirmed by the fact that Igf2r was biallelically expressed (Fig. 4Go) when neonatal mice were treated with the DNA demethylating reagent, 5-aza-C, which is known to block DNA methylation (38, 39).

In agreement with the finding by Stoger et al. (22), we also found that DNA at region 2 (Igf2r intron 2) is differentially methylated on the two parental alleles. However, we failed to find any differences in DNA methylation patterns between CNS and peripheral tissues. In both CNS and the peripheral tissues, the expressed maternal allele of Igf2r is completely methylated, and the suppressed paternal allele is totally unmethylated (Fig. 3Go). The fact that no differences in DNA methylation patterns were observed at region 2 between the imprinted peripheral and the nonimprinted CNS argues against the importance of DNA modification at this region in the maintenance of genomic imprinting as previously proposed (22). It is also noteworthy that the human IGF2R, which is biallelically expressed (20, 21), also exhibits the same DNA methylation pattern in its homolog of mouse region 2 (40). Thus, the differential methylation in region 2 does not correlate with allelic expression of the human IGF2R gene. A detailed examination of DNA methylation at two HpaII sites in this region of the mouse Igf2r (41, 32) also indicates that differential methylation is achieved by a dynamic process, rather than by a simple copy from the gametes. Thus, taken together, DNA methylation at region 2 may not be as important as previously assumed (22) in maintaining or initiating the genomic imprint of Igf2r.

Alternatively, the epigenetic modification in region 2 may participate in the establishment of the imprint of Igf2r as addressed (22), but may not be important in the maintenance of the imprint of the gene. There is evidence that the establishment and the maintenance of genomic imprinting may be two independent processes that are regulated by different cellular mechanisms, although both are closely linked by DNA methylation. In knock-out mice that are deficient in DNA MTase activity, the normally active paternal allele of Igf2 and the normally active maternal allele of Igf2r are repressed (33), suggesting that DNA methylation is required for normal allelic expression of both mouse genes. In this study, however, we found that DNA methylation correlates with the repression of the imprinted allele. The paternal allele of Igf2r, which is imprinted in peripheral tissues, is fully methylated in the promoter region (Fig. 2Go). In mice treated with 5-aza-C, the normally silent paternal allele of Igf2r becomes active (Fig. 4Go). In a previous study in astrocytes (26), we reported that DNA demethylation with 5-aza-C efficiently removes the suppression of the Igf2 maternal allele and induced biallelic expression of three Igf2 promoters. Treatment with 5-aza-C induced global DNA demethylation and relaxation of Igf2 imprinting in mice (27). These studies indicate that DNA methylation is required for the maintenance of normal imprinting of both Igf2 and Igf2r. Thus, DNA methylation may play different roles in establishing and maintaining the imprint of these two imprinted genes. The concept that the establishment and the maintenance of the imprint are functionally separate has been further strengthened by a recent finding that the introduction of a wild-type DNA MTase into MTase-negative mutant ES cells does not restore the normal allelic expression of the imprinted genes, including Igf2, Igf2r, and H19, unless the cells are first passaged through the germ-line (42). Thus, it may be likely that methylation of DNA region 2 functions as an epigenetic mark to guide the establishment of the Igf2r imprint after fertilization (22), while DNA methylation in region 1 is important in maintaining the imprint of the gene in late life.

It will be important to search for the mechanisms that account for the differential DNA methylation at region 1 between CNS and peripheral tissues. Possible mechanisms include: 1) an absence of DNA MTase activity in CNS, which maintains the DNA methylation status; 2) DNA methylation at the paternal allele had not been established during early embryo development; or 3) the methylation pattern established after fertilization was lost later in life. As a first step in understanding how this differential DNA methylation is established, we examined the expression of DNA MTase. As seen in Fig. 5Go, DNA MTase was expressed ubiquitously in all tissues, including the CNS. There was no difference in mRNA expression between CNS and the periphery. Thus, the hypomethylated DNA at region 1 in CNS is likely not due to the lack of activity of DNA MTase activity.

In contrast to the mouse Igf2r gene, the human IGF2R is not imprinted in most tissues (20, 21). It has been shown recently that the human IGF2R is also differentially methylated in region 2, but unmethylated in region 1 (40), just like the case in mouse CNS (Figs. 2Go and 3Go). Results from the human IGF2R thus also suggest that differential DNA methylation in region 1 may be important in the establishment and/or maintenance of Igf2r imprinting.

By digesting genomic DNA with several methylation-sensitive restriction enzymes, we have identified a 1.5-kb fragment in region 1 that is differentially methylated on the two parental alleles and that correlates with Igf2r imprinting. In this region, there are in total of 11 HpaII sites and several sites for other restriction enzymes. It is not clear which specific methylated cytosines in this region are related to the Igf2r imprint. Neither is it certain if these differentially methylated CpGs in region 1 act as an imprint signal that marks the parental alleles and guides the establishment of Igf2r imprinting after fertilization. Using similar methylation-sensitive restriction enzymes, Stoger et al. (22) found that region 1 is not methylated in sperm DNA, or in E15 embryo DNA. However, DNAs of postnatal and adult mice are fully methylated in this region. Clearly, the pattern of DNA methylation in region 1 must have been established during the developmental period between embryonal day 15 (E15) and neonatal life. It is not certain when the imprint of the mouse Igf2r is established. There is evidence that monoallelic expression of Igf2r probably occurs in the early stages of embryo development (see Refs. 43 and 44 for reviews). Thus, DNA methylation in region 1 may act merely as an epigenetic mark to preserve the imprint of Igf2r, rather than to guide the establishment of the imprint. Another possibility is that a short stretch of DNA fragments in this region, which are not digested by the restriction enzymes used (22), contain the imprint signal to mark the paternal allele for DNA methylation that is established after fertilization. The extensive methylation of the paternal DNA in region 1, specifically in the Igf2r promoter, would suppress the expression of Igf2r from the paternal allele. The expression from the unmethylated maternal allele of Igf2r will not be affected. This imprinting element should be specifically modified by methylation in peripheral tissues but not in the CNS. A comparison of genomic sequencing of DNA methylation in region 1 between CNS and peripheral tissues in different stages of development could elucidate this issue.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animals
F1 generation mice, derived from breeding M. musculus female mice with M. spretus male mice (purchased from Jackson Laboratories, Bar Harbor, ME), were used for this study. The F1 mice were killed at day 2, day 3, week 2, and month 2 of life. For day 2 and day 3 F1 generation mice, the whole brain was collected for RNA and DNA analyses. For week 2 and month 2 mice, the following CNS regions were dissected (28): cerebral cortex, cerebellum, pons, and medulla. To confirm the lack of Igf2r imprinting in the CNS, the whole brain from backcross newborns (day 1) and embryos (E15) were also collected for the analysis of Igf2 imprinting. In peripheral tissues, F1 mice, which were derived from M. musculus females and M. spretus males, express Igf2r from the M. musculus maternal allele; backcross newborns and embryos, which were derived from F1 females and M. musculus males, express Igf2r from the M. spretus maternal allele in peripheral tissues.

Backcross mice (F1 females x M. musculus males) were also used to study changes of the imprint of Igf2r by 5-aza-C. Mice were injected ip with 5-aza-C (2.5 µg/g body weight), a dose at which no adverse effects have been reported by other laboratories (45, 46). Mice were treated twice with 5-aza-C at day 11 and at day 14. Control mice were injected with PBS. Tissues were collected at day 25 of life for DNA and RNA analysis.

The animal experiments were approved by the Animal Care and Use Committee of the Veterans Affairs Medical Center and were conducted in accord with the procedures in "Guidelines for Care and Use of Experimental Animals."

DNA and cDNA Preparation
Genomic DNA and total RNA were extracted from tissues of F1 mice by TRI-REAGENT (Sigma, St. Louis, MO), according to the manufacturer’s guide. To eliminate DNA contamination in cDNA synthesis, RNA samples were first treated with deoxyribonuclease I (DNase I), and cDNA was synthesized with RNA reverse transcriptase (28, 26). In a typical reaction mixture, aliquots of 2.0 µl RNA (300 µg/ml), under the evaporation barrier of 12 µl of liquid wax (MJ Research, Inc., Watertown, MA), were treated with 1.0 µl of 0.4 U DNase I (Stratagene, La Jolla, CA) in 25 mM Tris (pH 8.0), 25 mM NaCl, 5 mM MgCl2, and 0.15 U ribonuclease (RNase) inhibitor (5'Prime-3'Prime, Boulder, CO) at 37 C for 15 min, followed by enzyme denaturing at 75 C for 10 min. After DNA digestion, RNAs were reverse-transcribed into cDNAs with murine leukemia reverse transcriptase (GIBCO BRL, Gaithersburg, MD) in the presence of random hexamers at 37 C for 25 min, followed by five cycles (50 C, 20 sec, and 37 C, 5 min) (28, 47).

Polymorphism Sites for Distinguishing Parental Alleles
Genomic DNA and cDNA, prepared from the liver of a M. spretus mouse, were amplified by PCR and sequenced to determine the presence of polymorphic sites. Genomic DNA and primers were covered with ’chill-out 14' liquid wax (MJ Research) and were heated to 95 C for 2 min, then amplified for 32 cycles at 95 C for 20 sec and 65 C for 40 sec, followed by a 1.5-min extension at 72 C. The oligonucleotide primers used include: 1) region 1: 6194 (5'-primer): GTCCACCAGTCACCTTACATGCTGT, and 6195 (3'-primer): AGCTGAACGGCCCGCATCGCGTGT; 2) region 2: 6187 (5'-primer): CCTCGCGCAACTTGGCATAACCAGA, 6565 (3'-primer): GGGTTTACGGGCGATCTAGAGCAC; 3) exons 47 and 48: 6105 (5'-primer): CAGAAGAAGCTCGGGCGTGTCCTAC, and 6294 (3'-primer): CTCCGCTCCTCGGCCTGAGTGAACT.

The PCR products were cloned into PCR-Blunt vector (Invitrogen, San Diego, CA) and sequenced by ABI 373 Automatic Sequencer (Perkin Elmer/ABD, Norwalk, CT). The DNA sequences of M. spretus Igf2r were compared with those of M. musculus Igf2r (BALB/c) obtained from GenBank. A HaeIII polymorphism in M. spretus Igf2r was identified in exon 48 and was used for examining allelic expression. A FokI polymorphism in intron 2 (region 2) and a HphI polymorphism in the Igf2r promoter region (region 1) were used to distinguish allelic DNA methylation.

Allelic Expression of Igf2r
Genomic imprinting of Igf2r in F1 mice was assessed by PCR primer set (Nos. 6105 and 6294), which crosses Igf2r intron 47. By using this primer set, PCR DNA amplified from cDNA samples can be distinguished from those derived from genomic DNA contamination. The F1 cDNAs were amplified in a 2.5-µl reaction mixture in the presence of 50 µM deoxynucleoside triphosphate, 1 nM primer, 0.125 U Tfl DNA polymerase (Epicentre Technologies, Madison, WI) with a hot-start PCR. The cDNAs and primers were heated to 95 C for 2 min, then amplified by 35 cycles at 95 C for 20 sec, 65 C for 40 sec, and 72 C for 20 sec. The 5'-primer (6105) was end-labeled with [32P-{gamma}]ATP (Amersham Life Science, Arlington Heights, IL). After PCR, the amplified DNAs were diluted and digested with 1 U HaeIII (GIBCO BRL, Gaithersburg, MD) in a 6-µl reaction and were electrophoresed on 5% polyacrylamide-urea gel. To examine allelic expression in backcross mice, PCR products were digested with 1 U AvaII, which specifically cuts the M. musculus allele. After electrophoresis, the gel was scanned by PhosphorImager Scanner (Molecular Dynamics, Sunnyvale, CA).

Southern Analysis
Genomic DNAs (20 µg) from CNS (cerebrum and cerebellum), liver, and kidney of F1 mice (2 months old) were digested overnight with 20 U FokI (region 2) or 20 U HphI (region 1) to distinguish M. spretus and M. musculus alleles. The digested DNA was precipitated with ethanol and digested with different methylation-sensitive restriction enzymes. After ethanol precipitation, DNA samples were separated in 1.2% agarose gel, transferred to Hydrobond-N filter (Amersham Life Science), and hybridized with Igf2r probes labeled by a random-labeling kit (GIBCO BRL) using [{alpha}-32P]dCTP (Amersham Life Science ). The Southern blot probes were prepared by cloning PCR products in PCR-Blunt vector (Invitrogen) as described above.

Expression of MTase and Igf2r
Expression of MTase and Igf2r was compared by the PCR method previously described (26, 28). For comparison, ß-actin was measured at the same time with Igf2r as an internal control. PCR conditions were the same as for allelic expression of Igf2r. The oligonucleotide primers used for PCR reaction include: 1) MTase: No. 5021 (5'-primer): GCTGGTCTAT(C)CAGATCTTT(C)GAC(T)ACT, and No. 5022 (3'-primer): CAC(T)TTCCCACACTCAGGCTGCTGA; and 2) ß-actin: No. 774 (5'-primer): GGGAATTCAAAACTGGAACGGTGAAGGG, No. 775 (3'-primer): GGAAGCTTATCAAAGTCCTCGGCCACA. The primers for Igf2r were the same as those used for assessing allelic expression. The PCR products were separated on 5% polyacrylamide-urea gel and scanned by PhosphorImager Scanner (Molecular Dynamics).


    ACKNOWLEDGMENTS
 
We thank Dr. Rosemary Broom and Ms. Marta Raygoza for their technical help in the animal breeding, and Dr. Nga Pham for valuable discussions.


    FOOTNOTES
 
Address requests for reprints to: Andrew R. Hoffman, M.D., Medical Service (111), Veterans Affairs Medical Center, 3801 Miranda Avenue, Palo Alto, California 94304.

Supported by NIH Grant DK-36054 and by the Research Service of the Department of Veterans Affairs.

Received for publication August 13, 1997. Revision received November 4, 1997. Accepted for publication November 5, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Surani MA, Barton SC, Norris ML 1984 Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis. Nature 308:548–550[CrossRef][Medline]
  2. McGrath J, Solter D 1984 Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell 37:179–183[CrossRef][Medline]
  3. Nicholls RD, Knoll JH, Butler MG, Karam S, Lalande M 1989 Genetic imprinting suggested by maternal heterodisomy in nondeletion Prader-Willi syndrome. Nature 342:281–285[CrossRef][Medline]
  4. Nicholls RD 1993 Genomic imprinting and uniparental disomy in Angelman and Prader-Willi syndromes: a review. Am J Med Genet 46:16–25[CrossRef][Medline]
  5. Weksberg R, Shen DR, Fei YL, Song QL, Squire J 1993 Disruption of insulin-like growth factor 2 imprinting in Beckwith-Wiedemann syndrome. Nat Genet 5:143–150[CrossRef][Medline]
  6. Ogawa O, Eccles MR, Szeto J, McNoe LA, Yun K, Maw MA, Smith PJ, Reeve AE 1993 Relaxation of insulin-like growth factor II gene imprinting implicated in Wilms’ tumour. Nature 362:749–751[CrossRef][Medline]
  7. Rainier S, Johnson LA, Dobry CJ, Ping AJ, Grundy PE, Feinberg AP 1993 Relaxation of imprinted genes in human cancer. Nature 362:747–749[CrossRef][Medline]
  8. Vu TH, Yballe C, Boonyanit S, Hoffman AR 1995 Insulin-like growth factor II in uterine smooth-muscle tumors: maintenance of genomic imprinting in leiomyomata and loss of imprinting in leiomyosarcomata. J Clin Endocrinol Metab 80:1670–1676[Abstract/Free Full Text]
  9. Zhan S, Shapiro DN, Helman LJ 1994 Activation of an imprinted allele of the insulin-like growth factor II gene implicated in rhabdomyosarcoma. J Clin Invest 94:445–448
  10. Yballe CM, Vu TH, Hoffman AR 1996 Imprinting and expression of insulin-like growth factor-II and H19 in normal breast tissue and breast tumor. J Clin Endocrinol Metab 81:1607–1612[Abstract]
  11. Nakao M, Sasaki H 1996 Genomic imprinting: significance in development and diseases and the molecular mechanisms. J Biochem (Tokyo) 120:467–473[Abstract/Free Full Text]
  12. DeChiara TM, Robertson EJ, Efstratiadis A 1991 Parental imprinting of the mouse insulin-like growth factor II gene. Cell 64:849–859[CrossRef][Medline]
  13. Bartolomei MS, Zemel S, Tilghman SM 1991 Parental imprinting of the mouse H19 gene. Nature 351:153–155[CrossRef][Medline]
  14. Guillemot F, Caspary T, Tilghman SM, Copeland NG, Gilbert DJ, Jenkins NA, Anderson DJ, Joyner AL, Rossant J, Nagy A 1995 Genomic imprinting of Mash2, a mouse gene required for trophoblast development. Nat Genet 9:235–242[CrossRef][Medline]
  15. Matsuoka S, Thompson JS, Edwards MC, Bartletta JM, Grundy P, Kalikin LM, Harper JW, Elledge SJ, Feinberg AP 1996 Imprinting of the gene encoding a human cyclin-dependent kinase inhibitor, p57KIP2, on chromosome 11p15. Proc Natl Acad Sci USA 93:3026–3030[Abstract/Free Full Text]
  16. Giddings SJ, King CD, Harman KW, Flood JF, Carnaghi LR 1994 Allele specific inactivation of insulin 1 and 2, in the mouse yolk sac, indicates imprinting. Nat Genet 6:310–313[CrossRef][Medline]
  17. Barlow DP, Stoger R, Hermann BG, Saito K, Schweifer N 1991 The mouse insulin-like growth factor type-2 receptor is imprinted and closely linked to the Tme locus. Nature 349:84–87[CrossRef][Medline]
  18. Wang ZQ, Fung MR, Barlow DP, Wagner EF 1994 Regulation of embryonic growth and lysosomal targeting by the imprinted Igf2/Mpr gene. Nature 372:464–467[CrossRef][Medline]
  19. Filson AJ, Louvi A, Efstratiadis A, Robertson EJ 1993 Rescue of the T-associated maternal effect in mice carrying null mutations in Igf-2 and Igf2r, two reciprocally imprinted genes. Development 118:731–736[Abstract]
  20. Kalscheuer VM, Mariman EC, Schepens MT, Rehder H, Ropers HH 1993 The insulin-like growth factor type-2 receptor gene is imprinted in the mouse but not in humans. Nat Genet 5:74–78[CrossRef][Medline]
  21. Ogawa O, McNoe LA, Eccles MR, Morison IM, Reeve AE 1993 Human insulin-like growth factor type I and type II receptors are not imprinted. Hum Mol Genet 2:2163–2165[Abstract/Free Full Text]
  22. Stoger R, Kubicka P, Liu CG, Kafri T, Razin A, Cedar H, Barlow DP 1993 Maternal-specific methylation of the imprinted mouse Igf2r locus identifies the expressed locus as carrying the imprinting signal. Cell 73:61–71[CrossRef][Medline]
  23. Sklar MM, Kiess W, Thomas CL, Nissley SP 1989 Developmental expression of the tissue insulin-like growth factor II/mannose 6-phosphate receptor in the rat. Measurement by quantitative immunoblotting. J Biol Chem 264:16733–16738[Abstract/Free Full Text]
  24. Sklar MM, Thomas CL, Municchi G, Roberts CTJ, LeRoith D, Kiess W, Nissley P 1992 Developmental expression of rat insulin-like growth factor-II/mannose 6-phosphate receptor messenger ribonucleic acid. Endocrinology 130:3484–3491[Abstract]
  25. Villar AJ, Eddy EM, Pedersen RA 1995 Developmental regulation of genomic imprinting during gametogenesis. Dev Biol 172:264–271[CrossRef][Medline]
  26. Hu JF, Vu TH, Hoffman AR 1996 Promoter-specific modulation of insulin-like growth factor II genomic imprinting by inhibitors of DNA methylation. J Biol Chem 271:18253–18262[Abstract/Free Full Text]
  27. Hu JF, Nguyen PH, Pham NV, Vu TH, Hoffman AR 1997 Modulation of Igf2 genomic imprinting in mice induced by 5-azacytidine, an inhibitor of DNA methylation. Mol Endocrinol 11:1891–1898[Abstract/Free Full Text]
  28. Hu J, Vu T, Hoffman A 1995 Differential biallelic activation of three insulin-like growth factor II promoters in the mouse central nervous system. Mol Endocrinol 9:628–636[Abstract]
  29. Pedone PV, Cosma MP, Ungaro P, Colantuoni V, Bruni CB, Zarrilli R, Riccio A 1994 Parental imprinting of rat insulin-like growth factor II gene promoters is coordinately regulated. J Biol Chem 269:23970–23975[Abstract/Free Full Text]
  30. DeChiara TM, Efstratiadis A, Robertson EJ 1990 A growth-deficiency phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature 345:78–80[CrossRef][Medline]
  31. Lau MM, Stewart CE, Liu Z, Bhatt H, Rotwein P, Stewart CL 1994 Loss of the imprinted IGF2/cation-independent mannose 6-phosphate receptor results in fetal overgrowth and perinatal lethality. Genes Dev 8:2953–2963[Abstract/Free Full Text]
  32. Brandeis M, Kafri T, Ariel M, Chaillet JR, McCarrey J, Rasin A, Ceder H 1993 The ontogeny of allele-specific methylation associated with imprinted genes in the mouse. EMBO J 12:3669–3677[Medline]
  33. Li E, Beard C, Jaenisch R 1993 Role for DNA methylation in genomic imprinting. Nature 366:362–365[CrossRef][Medline]
  34. Moulton T, Crenshaw T, Hao Y, Moosikasuwan J, Lin N, Dembitzer F, Hensle T, Weiss L, McMorrow L, et al. 1994 Epigenetic lesions at the H19 locus in Wilms’ tumour patients. Nat Genet 7:440–447[CrossRef][Medline]
  35. Tremblay KD, Saam JR, Ingram RS, Tilghman SM, Bartolomei MS 1995 A paternal-specific methylation imprint marks the alleles of the mouse H19 gene. Nat Genet 9:407–413[CrossRef][Medline]
  36. Feinberg AP 1993 Genomic imprinting and gene activation in cancer. Nat Genet 4:110–113[CrossRef][Medline]
  37. Taniguchi T, Sullivan MJ, Ogawa O, Reeve AE 1995 Epigenetic changes encompassing the IGF2/H19 locus associated with relaxation of IGF2 imprinting and silencing of H19 in Wilms tumor. Proc Natl Acad Sci USA 92:2159–2163[Abstract/Free Full Text]
  38. Jones PA, Taylor SM 1980 Cellular differentiation, cytidine analogs, and DNA methylation. Cell 20:85–93[CrossRef][Medline]
  39. Groudine M, Eisenman R, Weintraub H 1981 Chromatin structure of endogenous retroviral genes and activation by an inhibitor of DNA methylation. Nature 292:311–317[Medline]
  40. Smrzka OW, Fae I, Stoger R, Kurzbauer R, Fischer GF, Henn T, Weith A, Barlow DP 1995 Conservation of a maternal-specific methylation signal at the human IGF2R locus. Hum Mol Genet 4:1945–1952[Abstract/Free Full Text]
  41. Shemer R, Birger Y, Dean WL, Reik W, Riggs AD, Razin A 1996 Dynamic methylation adjustment and counting as part of imprinting mechanisms. Proc Natl Acad Sci USA 93:6371–6376[Abstract/Free Full Text]
  42. Tucker KL, Beard C, Dausmann J, Jackson GL, Laird PW, Lei H, Li E, Jaenisch R 1996 Germ-line passage is required for establishment of methylation and expression patterns of imprinted but not of nonimprinted genes. Genes Dev 10:1008–1020[Abstract/Free Full Text]
  43. Latham KE 1995 Stage-specific and cell type-specific aspects of genomic imprinting effects in mammals. Differentiation 59:269–282[Medline]
  44. Watanabe D, Barlow DP 1996 Random and imprinted monoallelic expression. Genes to Cells 1:795–802[Abstract]
  45. Jaenisch R, Schnieke A, Harbers K 1985 Treatment of mice with 5-azacytidine efficiently activates silent retroviral genomes in different tissues. Proc Natl Acad Sci USA 82:1451–1455[Abstract/Free Full Text]
  46. Carr BI, Reilly JG, Smith SS, Winberg C, Riggs A 1984 The tumorigenicity of 5-azacytidine in the male Fischer rat. Carcinogenesis 5:1583–1590[Abstract/Free Full Text]
  47. Vu TH, Hoffman AR 1994 Promoter-specific imprinting of the human insulin-like growth factor-II gene. Nature 371:714–717[CrossRef][Medline]



This article has been cited by other articles:


Home page
Genome ResHome page
P. B. Samollow
The opossum genome: Insights and opportunities from an alternative mammal
Genome Res., August 1, 2008; 18(8): 1199 - 1215.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. L. Wise and D. D. Pravtcheva
Delayed Onset of Igf2-Induced Mammary Tumors in Igf2r Transgenic Mice
Cancer Res., February 1, 2006; 66(3): 1327 - 1336.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Y. Yamasaki, T. Kayashima, H. Soejima, A. Kinoshita, K.-i. Yoshiura, N. Matsumoto, T. Ohta, T. Urano, H. Masuzaki, T. Ishimaru, et al.
Neuron-specific relaxation of Igf2r imprinting is associated with neuron-specific histone modifications and lack of its antisense transcript Air
Hum. Mol. Genet., September 1, 2005; 14(17): 2511 - 2520.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
C Gicquel, J Weiss, J Amiel, V Gaston, Y Le Bouc, and C D Scott
Epigenetic abnormalities of the mannose-6-phosphate/IGF2 receptor gene are uncommon in human overgrowth syndromes
J. Med. Genet., January 1, 2004; 41(1): e4 - 4.
[Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Yang, T. Li, T. H. Vu, G. A. Ulaner, J.-F. Hu, and A. R. Hoffman
The Histone Code Regulating Expression of the Imprinted Mouse Igf2r Gene
Endocrinology, December 1, 2003; 144(12): 5658 - 5670.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. K. Killian, C. M. Nolan, A. A. Wylie, T. Li, T. H. Vu, A. R. Hoffman, and R. L. Jirtle
Divergent evolution in M6P/IGF2R imprinting from the Jurassic to the Quaternary
Hum. Mol. Genet., August 1, 2001; 10(17): 1721 - 1728.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A Wutz, H. Theussl, J Dausman, R Jaenisch, D. Barlow, and E. Wagner
Non-imprinted Igf2r expression decreases growth and rescues the Tme mutation in mice
Development, January 5, 2001; 128(10): 1881 - 1887.
[Abstract] [PDF]


Home page
EndocrinologyHome page
J.-F. Hu, J. Pham, I. Dey, T. Li, T. H. Vu, and A. R. Hoffman
Allele-Specific Histone Acetylation Accompanies Genomic Imprinting of the Insulin-Like Growth Factor II Receptor Gene
Endocrinology, December 1, 2000; 141(12): 4428 - 4435.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Liu, S. Yu, D. Litman, W. Chen, and L. S. Weinstein
Identification of a Methylation Imprint Mark within the Mouse Gnas Locus
Mol. Cell. Biol., August 15, 2000; 20(16): 5808 - 5817.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar