| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Geriatric Research, Educational and Clinical Center and Medical Service Veterans Affairs Palo Alto Health Care System and Division of Endocrinology Department of Medicine Stanford University Palo Alto, California 94304
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Several imprinted genes are aggregated in subregions of chromosomes (11). The clustered distribution of Igf2 (12), H19 (13), Mash 2 (14), KIP2 (15), and insulin 2 (16) in the distal region of mouse chromosome 7 is a typical example. Interestingly, these imprinted genes, although closely clustered, do not necessarily share similar patterns of allelic expression. For example, Igf2 is expressed exclusively from its paternal allele, while the adjacent H19 is expressed only from the maternal copy of the gene.
The insulin-like growth factor II receptor (Igf2r), also known as the cation-independent mannose-6-phosphate receptor, was mapped to mouse chromosome 17 in the vicinity of Tme (the T-associated maternal effect). Igf2r expression was detectable only in those mice that inherit the deletion of Tme locus from the paternal allele, but no Igf2r expression was observed when Tme was maternally inherited (17), suggesting that the Igf2r gene is paternally imprinted. The requirement for the transcription of the maternal allele of Igf2r in embryonic growth was further confirmed by the specific deletion of Igf2r (18). Mice carrying the maternally transmitted mutant Igf2r allele generally die at birth (18, 19).
The underlying mechanism for the regulation of genomic imprinting is still poorly defined. Among the approximately two dozen imprinted genes identified, Igf2r is an attractive candidate for exploring the molecular mechanism for genomic imprinting because it is imprinted in mouse (17) but not imprinted in the majority of human tissues (20, 21). Two regions of the mouse Igf2r gene are differentially methylated on the parental chromosomes. These regions have been explored to learn whether they serve as epigenetic marks regulating genomic imprinting (22). The first region (region 1) includes the Igf2r promoter and is methylated only on the suppressed paternal allele. The other modified region is located in intron 2 of Igf2r (region 2), and it is preferentially methylated on the expressed maternal allele. Using interspecific mice as an animal model, we found that mouse Igf2r, which has always been considered to be imprinted, is biallelically expressed throughout the central nervous system (CNS) and monoallelically expressed in peripheral tissues. The differential genomic imprinting of Igf2r between CNS and all other tissues correlates with patterns of DNA methylation in the promoter region of the gene, suggesting a direct role for DNA methylation in region 1 in regulating the allelic expression of Igf2r. Differential imprinting of Igf2r between CNS and peripheral tissues may provide a useful model for further investigation aimed at understanding the underlying mechanisms of allelic expression of imprinted genes.
| RESULTS |
|---|
|
|
|---|
|
Biallelic expression of Igf2r was also observed in the CNS
of informative backcross newborns and embryos (Fig. 1D
), in which
Igf2r expression is higher than in adult animals (23, 24).
Thus, the lack of Igf2r imprinting in the CNS was an very
early event in life, starting as early as embryo development and
extending to adult life. The absence of Igf2r imprinting in
CNS was also confirmed by using Scrf I, another polymorphism of
Igf2r reported by Villar et al. (25) (data not
shown).
DNA Methylation of Igf2r Promoter (Region 1) Is
Associated with Genomic Imprinting
Differential imprinting of Igf2r between CNS and
peripheral tissues in the same animal thus provides an ideal model to
study the molecular mechanisms underlying genomic imprinting. DNA
methylation at CpG dinucleotides is currently the best candidate for
cis-epigenetic modification that is associated with genomic
imprinting. Two GC-rich regions of Igf2r DNA (regions 1 and
2) have previously been identified (22). These two regions are
differentially methylated on parental chromosomes and are closely
related to the development of Igf2r imprinting in mice. We
thus focused on these two regions to determine whether there is any
correlation between DNA methylation and genomic imprinting. If DNA
methylation in these two regions accounts for the maintenance or
resetting of the imprint of Igf2r, we should see a different
pattern of DNA methylation between CNS and all other tissues.
To distinguish DNA methylation in the two parental alleles, we first treated genomic DNA with HphI, which specifically digests the M. musculus allele near the Igf2r promoter region. This HphI polymorphic site is not present in M. spretus due to a 16-bp deletion that covers the HphI and several other restriction enzymes. HphI digestion of genomic DNA will yield a 1.5-kb fragment for the M. spretus allele, while the M. musculus allele will be digested into 1.2-kb and 0.3-kb fragments. We then used the following five methylation-sensitive restriction enzymes to digest genomic DNA: NotI, SalI, KspI, PmlI, and HpaII. The unmethylated DNA will be completely digested by these enzymes, while the methylated genomic DNA will be resistant to enzymatic digestion and will allow the parental DNA to remain intact.
DNA region 1 contains the Igf2r promoter and part of
Igf2r exon 1 (Fig. 2A
). Using Southern
blot hybridization, we found that, in liver and kidney, the paternal
M. spretus allele is completely methylated, as demonstrated
by the presence of the intact 1.5-kb band (Fig. 2B
). The 1.2-kb
maternal M. musculus band, however, was completely digested
by these restriction enzymes, indicating that the maternal allele of
Igf2r is hypomethylated in region 1. Thus, in region 1, the
imprinted paternal allele is hypermethylated, while the expressed
maternal allele is fully unmethylated.
|
Differential Methylation of Igf2r Intron 2 (Region 2)
We also used Southern hybridization to compare the status of DNA
methylation in region 2 of Igf2r (intron 2). By sequencing
genomic DNA in this region, we identified two restriction enzyme
polymorphisms: FokI in M. spretus and
XhoI in M. musculus, by which the methylation
status in the two parental alleles can be easily distinguished. We
first used FokI to digest genomic DNA to yield a 2.2-kb
fragment for the M. musculus allele and a 936-bp fragment
for the M. spretus allele in this region. The
FokI-digested DNAs were then subjected to digestion by four
methylation-sensitive restriction enzymes: XhoI,
KspI, HpaII, and MluI.
In liver and kidney, the maternal M. musculus allele is
fully methylated as demonstrated by the intact 2.2-kb band in all
samples treated with the four restriction enzymes (Fig. 3B
). The methylated maternal allele also
resists the digestion by XhoI, a unique polymorphic
restriction enzyme site in M. musculus (Fig. 3B
). The
paternal M. spretus allele, however, is unmethylated; the
936-bp bands were completely digested by methylation-sensitive
restriction enzymes, KspI, MluI, and
HpaII. (XhoI is not present in the paternal
M. musculus allele.) Thus, as reported by Stoger et
al. (22), Igf2r is differentially methylated in region
2 with preferential methylation on the maternal allele, which is
expressed in these tissues.
|
Relaxation of Igf2r Imprinting by 5-Azacytidine (5-axa-C)
In a previous study of cultured astrocytes, we found that
treatment of cells with the demethylating reagent, 5-aza-C, induced
global DNA demethylation and reactivation of the imprinted maternal
allele of Igf2 (26). We have also recently observed that, in
backcross mice, treatment with 5-aza-C induced a global DNA
demethylation and caused biallelic expression of Igf2 in
many peripheral tissues (27). To confirm the importance of DNA
methylation in the maintenance of the genomic imprint of
Igf2r, we assessed allelic expression of Igf2r in
backcross mice treated with 5-aza-C in vivo. Tissues were
collected from both control and treated mice, and cDNAs were prepared
and amplified by PCR. The PCR products from each parental allele were
distinguished by digestion with AvaII, which specifically
cuts the paternal M. spretus allele.
As expected, control backcross mice expressed Igf2r only
from the maternal allele in peripheral tissues (Fig. 4A
, lanes 410). However, after
treatment with the demethylating reagent 5-aza-C, mice demonstrated
loss of imprinting of Igf2r in some peripheral tissues (Fig. 4
, B and C, lanes 410), with both parental alleles being expressed to
varying degrees. These results thus demonstrate that DNA demethylation
with 5-aza-C induces loss of Igf2r imprinting in
vivo, confirming the importance of DNA methylation in the
maintenance of Igf2r imprinting. It should be noted that the
5-aza-C-induced biallelic expression of Igf2r is not
tissue-specific. The release of imprinting of Igf2r varied
among tissues in the same mouse and among the same tissues between
various mice. We also have observed a similar pattern of imprinting
changes for Igf2, the ligand of Igf2r (27).
|
|
| DISCUSSION |
|---|
|
|
|---|
The unexpected finding that Igf2r is monoallelically expressed in peripheral tissues and biallelically expressed in the CNS provides the second example of CNS-specific relaxation of imprinting. We (28) and others (12, 29) have previously reported that the Igf2 gene of mouse and rat shows absence of genomic imprinting in CNS. In every CNS region examined, all three promoters of Igf2 are expressed from both parental alleles (28). It is not clear why both Igf2 and its receptor (Igf2r) are expressed biallelically in CNS but monoallelically elsewhere. Other imprinted genes, such as H19 and Snrpn, do not exhibit this tissue-specific imprint pattern in mice (data not shown). The coincidence of lack of imprinting of both ligand and receptor in CNS suggests that Igf2 and Igf2r may function in an autocrine pathway to maintain the normal growth of CNS, which is isolated from exogenous IGF-II produced by liver and other tissues by the blood-brain barrier. The Igf2 gene, a critical embryonic growth factor (30), may be biallelically expressed in CNS (12, 28) as a requirement for normal growth, while the Igf2r, whose gene product degrades IGF-II, is also biallelically expressed in CNS as a dosage compensation effect to keep the growth factor activity in balance. Fetal mice with the null Igf2r genotype exhibit a 2530% increase in body size (31, 18) because of the excess IGF-II, and it has been suggested that the opposing patterns of Igf2 (maternal) and Igf2r (paternal) imprinting regulate the growth of the fetus.
The tissue-specific imprinting of Igf2r in mouse thus provides an excellent model for investigating the molecular mechanisms of imprinting. Currently, little is known about how imprinted genes are regulated such that one of the parental alleles is expressed while the other is totally suppressed. There is substantial evidence that methylation of DNA at specific regions of imprinted genes may act in cis as an imprinting signal to regulate allelic expression of the gene. DNA methylation at CpG dinucleotides at these selective positions, established either in the gametes or shortly after fertilization, guides the establishment and thereafter the maintenance of the genomic imprint (22, 32). The importance of DNA methylation in development has been demonstrated by the knock-out mutant mice that lack DNA MTase (33), the only identified mammalian enzyme that specifically methylates DNA by using hemimethylated DNA as substrate. Global hypomethylation of DNA in these mutant embryos directly induced alteration of allelic expression of several imprinted genes, including Igf2, H19, and Igf2r (33).
It is thus interesting to compare the DNA methylation pattern of the Igf2r gene between the nonimprinted CNS and the imprinted peripheral tissues, as identification of DNA regions that are differentially modified in these tissues may provide a direct insight into the molecular control of Igf2r genomic imprinting. If DNA methylation in a specific region correlates with the imprinting of Igf2r, we should be able to detect a differential methylation pattern between CNS peripheral tissues. Differential DNA methylation of the two parental alleles has been reported in two specific regions of Igf2r (22). Region 1, which includes the Igf2r promoter, is methylated exclusively on the suppressed paternal allele and is unmethylated on the expressed maternal allele. The other differentially modified region is located in intron 2 of Igf2r (region 2). In contrast to region 1, the CpG dinucleotides in region 2 are preferentially methylated on the expressed maternal allele and are unmethylated on the suppressed paternal allele.
In this study, we examined DNA methylation in these two regions with
several methylation-sensitive restriction enzymes. The genomic DNAs
from the F1 hybrid mice were first digested with polymorphic
restriction enzymes that specifically cut only one of the two
parental alleles. With the aid of these polymorphic restriction
enzymes, the two parental alleles are distinguished for the subsequent
digestion by methylation-sensitive restriction enzymes. In peripheral
tissues, where Igf2r is expressed from the maternal allele
and suppressed from the paternal allele (Fig. 1
), Southern blotting
clearly showed that DNA at region 1 is methylated on the paternal
allele and unmethylated on the maternal allele (Fig. 2
). Interestingly,
in CNS where both parental alleles of Igf2r are expressed,
the paternal allele, which is methylated in peripheral tissues, is here
demethylated. These results suggest that, as in the case of
H19 (34, 35, 36, 37), hypermethylation of DNA at the promoter region
blocks expression of the gene from the paternal allele. The
unmethylated maternal allele of Igf2r is free to access the
transcriptional machinery and is thus efficiently expressed. In CNS,
hypomethylation of the DNA of the paternal allele releases the
imprinting of Igf2r, leading to biallelic expression of the
gene. The importance of DNA methylation in the maintenance of the
Igf2r imprint was confirmed by the fact that
Igf2r was biallelically expressed (Fig. 4
) when neonatal
mice were treated with the DNA demethylating reagent, 5-aza-C, which is
known to block DNA methylation (38, 39).
In agreement with the finding by Stoger et al. (22), we also
found that DNA at region 2 (Igf2r intron 2) is
differentially methylated on the two parental alleles. However, we
failed to find any differences in DNA methylation patterns between CNS
and peripheral tissues. In both CNS and the peripheral tissues, the
expressed maternal allele of Igf2r is completely methylated,
and the suppressed paternal allele is totally unmethylated (Fig. 3
).
The fact that no differences in DNA methylation patterns were observed
at region 2 between the imprinted peripheral and the nonimprinted CNS
argues against the importance of DNA modification at this region in the
maintenance of genomic imprinting as previously proposed (22). It is
also noteworthy that the human IGF2R, which is biallelically expressed
(20, 21), also exhibits the same DNA methylation pattern in its homolog
of mouse region 2 (40). Thus, the differential methylation in region 2
does not correlate with allelic expression of the human IGF2R gene. A
detailed examination of DNA methylation at two HpaII sites
in this region of the mouse Igf2r (41, 32) also indicates
that differential methylation is achieved by a dynamic process, rather
than by a simple copy from the gametes. Thus, taken together, DNA
methylation at region 2 may not be as important as previously assumed
(22) in maintaining or initiating the genomic imprint of
Igf2r.
Alternatively, the epigenetic modification in region 2 may participate
in the establishment of the imprint of Igf2r as addressed
(22), but may not be important in the maintenance of the imprint of the
gene. There is evidence that the establishment and the maintenance of
genomic imprinting may be two independent processes that are regulated
by different cellular mechanisms, although both are closely linked by
DNA methylation. In knock-out mice that are deficient in DNA MTase
activity, the normally active paternal allele of Igf2 and
the normally active maternal allele of Igf2r are repressed
(33), suggesting that DNA methylation is required for normal allelic
expression of both mouse genes. In this study, however, we found that
DNA methylation correlates with the repression of the imprinted allele.
The paternal allele of Igf2r, which is imprinted in
peripheral tissues, is fully methylated in the promoter region (Fig. 2
). In mice treated with 5-aza-C, the normally silent paternal allele
of Igf2r becomes active (Fig. 4
). In a previous study in
astrocytes (26), we reported that DNA demethylation with 5-aza-C
efficiently removes the suppression of the Igf2 maternal
allele and induced biallelic expression of three Igf2
promoters. Treatment with 5-aza-C induced global DNA demethylation and
relaxation of Igf2 imprinting in mice (27). These studies
indicate that DNA methylation is required for the maintenance of normal
imprinting of both Igf2 and Igf2r. Thus, DNA
methylation may play different roles in establishing and maintaining
the imprint of these two imprinted genes. The concept that the
establishment and the maintenance of the imprint are functionally
separate has been further strengthened by a recent finding that the
introduction of a wild-type DNA MTase into MTase-negative mutant ES
cells does not restore the normal allelic expression of the imprinted
genes, including Igf2, Igf2r, and H19,
unless the cells are first passaged through the germ-line (42). Thus,
it may be likely that methylation of DNA region 2 functions as an
epigenetic mark to guide the establishment of the Igf2r
imprint after fertilization (22), while DNA methylation in region 1 is
important in maintaining the imprint of the gene in late life.
It will be important to search for the mechanisms that account for the
differential DNA methylation at region 1 between CNS and peripheral
tissues. Possible mechanisms include: 1) an absence of DNA MTase
activity in CNS, which maintains the DNA methylation status; 2) DNA
methylation at the paternal allele had not been established during
early embryo development; or 3) the methylation pattern established
after fertilization was lost later in life. As a first step in
understanding how this differential DNA methylation is established, we
examined the expression of DNA MTase. As seen in Fig. 5
, DNA MTase was
expressed ubiquitously in all tissues, including the CNS. There was no
difference in mRNA expression between CNS and the periphery. Thus, the
hypomethylated DNA at region 1 in CNS is likely not due to the lack of
activity of DNA MTase activity.
In contrast to the mouse Igf2r gene, the human IGF2R is not
imprinted in most tissues (20, 21). It has been shown recently that the
human IGF2R is also differentially methylated in region 2, but
unmethylated in region 1 (40), just like the case in mouse CNS (Figs. 2
and 3
). Results from the human IGF2R thus also suggest that
differential DNA methylation in region 1 may be important in the
establishment and/or maintenance of Igf2r imprinting.
By digesting genomic DNA with several methylation-sensitive restriction enzymes, we have identified a 1.5-kb fragment in region 1 that is differentially methylated on the two parental alleles and that correlates with Igf2r imprinting. In this region, there are in total of 11 HpaII sites and several sites for other restriction enzymes. It is not clear which specific methylated cytosines in this region are related to the Igf2r imprint. Neither is it certain if these differentially methylated CpGs in region 1 act as an imprint signal that marks the parental alleles and guides the establishment of Igf2r imprinting after fertilization. Using similar methylation-sensitive restriction enzymes, Stoger et al. (22) found that region 1 is not methylated in sperm DNA, or in E15 embryo DNA. However, DNAs of postnatal and adult mice are fully methylated in this region. Clearly, the pattern of DNA methylation in region 1 must have been established during the developmental period between embryonal day 15 (E15) and neonatal life. It is not certain when the imprint of the mouse Igf2r is established. There is evidence that monoallelic expression of Igf2r probably occurs in the early stages of embryo development (see Refs. 43 and 44 for reviews). Thus, DNA methylation in region 1 may act merely as an epigenetic mark to preserve the imprint of Igf2r, rather than to guide the establishment of the imprint. Another possibility is that a short stretch of DNA fragments in this region, which are not digested by the restriction enzymes used (22), contain the imprint signal to mark the paternal allele for DNA methylation that is established after fertilization. The extensive methylation of the paternal DNA in region 1, specifically in the Igf2r promoter, would suppress the expression of Igf2r from the paternal allele. The expression from the unmethylated maternal allele of Igf2r will not be affected. This imprinting element should be specifically modified by methylation in peripheral tissues but not in the CNS. A comparison of genomic sequencing of DNA methylation in region 1 between CNS and peripheral tissues in different stages of development could elucidate this issue.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Backcross mice (F1 females x M. musculus males) were also used to study changes of the imprint of Igf2r by 5-aza-C. Mice were injected ip with 5-aza-C (2.5 µg/g body weight), a dose at which no adverse effects have been reported by other laboratories (45, 46). Mice were treated twice with 5-aza-C at day 11 and at day 14. Control mice were injected with PBS. Tissues were collected at day 25 of life for DNA and RNA analysis.
The animal experiments were approved by the Animal Care and Use Committee of the Veterans Affairs Medical Center and were conducted in accord with the procedures in "Guidelines for Care and Use of Experimental Animals."
DNA and cDNA Preparation
Genomic DNA and total RNA were extracted from tissues of F1 mice
by TRI-REAGENT (Sigma, St. Louis, MO), according to the manufacturers
guide. To eliminate DNA contamination in cDNA synthesis, RNA samples
were first treated with deoxyribonuclease I (DNase I), and cDNA was
synthesized with RNA reverse transcriptase (28, 26). In a typical
reaction mixture, aliquots of 2.0 µl RNA (300 µg/ml), under the
evaporation barrier of 12 µl of liquid wax (MJ Research, Inc.,
Watertown, MA), were treated with 1.0 µl of 0.4 U DNase I
(Stratagene, La Jolla, CA) in 25 mM Tris (pH 8.0), 25
mM NaCl, 5 mM MgCl2, and 0.15 U
ribonuclease (RNase) inhibitor (5'Prime-3'Prime, Boulder, CO) at 37 C
for 15 min, followed by enzyme denaturing at 75 C for 10 min. After DNA
digestion, RNAs were reverse-transcribed into cDNAs with murine
leukemia reverse transcriptase (GIBCO BRL, Gaithersburg, MD) in the
presence of random hexamers at 37 C for 25 min, followed by five cycles
(50 C, 20 sec, and 37 C, 5 min) (28, 47).
Polymorphism Sites for Distinguishing Parental Alleles
Genomic DNA and cDNA, prepared from the liver of a M.
spretus mouse, were amplified by PCR and sequenced to determine
the presence of polymorphic sites. Genomic DNA and primers were covered
with chill-out 14' liquid wax (MJ Research) and were heated to 95 C
for 2 min, then amplified for 32 cycles at 95 C for 20 sec and 65 C for
40 sec, followed by a 1.5-min extension at 72 C. The oligonucleotide
primers used include: 1) region 1: 6194 (5'-primer):
GTCCACCAGTCACCTTACATGCTGT, and 6195 (3'-primer):
AGCTGAACGGCCCGCATCGCGTGT; 2) region 2: 6187 (5'-primer):
CCTCGCGCAACTTGGCATAACCAGA, 6565 (3'-primer): GGGTTTACGGGCGATCTAGAGCAC;
3) exons 47 and 48: 6105 (5'-primer): CAGAAGAAGCTCGGGCGTGTCCTAC, and
6294 (3'-primer): CTCCGCTCCTCGGCCTGAGTGAACT.
The PCR products were cloned into PCR-Blunt vector (Invitrogen, San Diego, CA) and sequenced by ABI 373 Automatic Sequencer (Perkin Elmer/ABD, Norwalk, CT). The DNA sequences of M. spretus Igf2r were compared with those of M. musculus Igf2r (BALB/c) obtained from GenBank. A HaeIII polymorphism in M. spretus Igf2r was identified in exon 48 and was used for examining allelic expression. A FokI polymorphism in intron 2 (region 2) and a HphI polymorphism in the Igf2r promoter region (region 1) were used to distinguish allelic DNA methylation.
Allelic Expression of Igf2r
Genomic imprinting of Igf2r in F1 mice was assessed
by PCR primer set (Nos. 6105 and 6294), which crosses Igf2r
intron 47. By using this primer set, PCR DNA amplified from cDNA
samples can be distinguished from those derived from genomic DNA
contamination. The F1 cDNAs were amplified in a 2.5-µl reaction
mixture in the presence of 50 µM deoxynucleoside
triphosphate, 1 nM primer, 0.125 U Tfl DNA polymerase
(Epicentre Technologies, Madison, WI) with a hot-start PCR. The cDNAs
and primers were heated to 95 C for 2 min, then amplified by 35 cycles
at 95 C for 20 sec, 65 C for 40 sec, and 72 C for 20 sec. The 5'-primer
(6105) was end-labeled with [32P-
]ATP (Amersham Life
Science, Arlington Heights, IL). After PCR, the amplified DNAs were
diluted and digested with 1 U HaeIII (GIBCO BRL,
Gaithersburg, MD) in a 6-µl reaction and were electrophoresed on 5%
polyacrylamide-urea gel. To examine allelic expression in backcross
mice, PCR products were digested with 1 U AvaII, which
specifically cuts the M. musculus allele. After
electrophoresis, the gel was scanned by PhosphorImager Scanner
(Molecular Dynamics, Sunnyvale, CA).
Southern Analysis
Genomic DNAs (20 µg) from CNS (cerebrum and cerebellum),
liver, and kidney of F1 mice (2 months old) were digested overnight
with 20 U FokI (region 2) or 20 U HphI (region 1)
to distinguish M. spretus and M. musculus
alleles. The digested DNA was precipitated with ethanol and digested
with different methylation-sensitive restriction enzymes. After ethanol
precipitation, DNA samples were separated in 1.2% agarose gel,
transferred to Hydrobond-N filter (Amersham Life Science), and
hybridized with Igf2r probes labeled by a random-labeling
kit (GIBCO BRL) using [
-32P]dCTP (Amersham Life
Science ). The Southern blot probes were prepared by cloning PCR
products in PCR-Blunt vector (Invitrogen) as described above.
Expression of MTase and Igf2r
Expression of MTase and Igf2r was compared by the PCR
method previously described (26, 28). For comparison, ß-actin was
measured at the same time with Igf2r as an internal control.
PCR conditions were the same as for allelic expression of
Igf2r. The oligonucleotide primers used for PCR reaction
include: 1) MTase: No. 5021 (5'-primer):
GCTGGTCTAT(C)CAGATCTTT(C)GAC(T)ACT, and No. 5022 (3'-primer):
CAC(T)TTCCCACACTCAGGCTGCTGA; and 2) ß-actin: No. 774 (5'-primer):
GGGAATTCAAAACTGGAACGGTGAAGGG, No. 775 (3'-primer):
GGAAGCTTATCAAAGTCCTCGGCCACA. The primers for
Igf2r were the same as those used for assessing allelic
expression. The PCR products were separated on 5% polyacrylamide-urea
gel and scanned by PhosphorImager Scanner (Molecular Dynamics).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Supported by NIH Grant DK-36054 and by the Research Service of the Department of Veterans Affairs.
Received for publication August 13, 1997. Revision received November 4, 1997. Accepted for publication November 5, 1997.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. B. Samollow The opossum genome: Insights and opportunities from an alternative mammal Genome Res., August 1, 2008; 18(8): 1199 - 1215. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Wise and D. D. Pravtcheva Delayed Onset of Igf2-Induced Mammary Tumors in Igf2r Transgenic Mice Cancer Res., February 1, 2006; 66(3): 1327 - 1336. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yamasaki, T. Kayashima, H. Soejima, A. Kinoshita, K.-i. Yoshiura, N. Matsumoto, T. Ohta, T. Urano, H. Masuzaki, T. Ishimaru, et al. Neuron-specific relaxation of Igf2r imprinting is associated with neuron-specific histone modifications and lack of its antisense transcript Air Hum. Mol. Genet., September 1, 2005; 14(17): 2511 - 2520. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Gicquel, J Weiss, J Amiel, V Gaston, Y Le Bouc, and C D Scott Epigenetic abnormalities of the mannose-6-phosphate/IGF2 receptor gene are uncommon in human overgrowth syndromes J. Med. Genet., January 1, 2004; 41(1): e4 - 4. [Full Text] [PDF] |
||||
![]() |
Y. Yang, T. Li, T. H. Vu, G. A. Ulaner, J.-F. Hu, and A. R. Hoffman The Histone Code Regulating Expression of the Imprinted Mouse Igf2r Gene Endocrinology, December 1, 2003; 144(12): 5658 - 5670. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Killian, C. M. Nolan, A. A. Wylie, T. Li, T. H. Vu, A. R. Hoffman, and R. L. Jirtle Divergent evolution in M6P/IGF2R imprinting from the Jurassic to the Quaternary Hum. Mol. Genet., August 1, 2001; 10(17): 1721 - 1728. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Wutz, H. Theussl, J Dausman, R Jaenisch, D. Barlow, and E. Wagner Non-imprinted Igf2r expression decreases growth and rescues the Tme mutation in mice Development, January 5, 2001; 128(10): 1881 - 1887. [Abstract] [PDF] |
||||
![]() |
J.-F. Hu, J. Pham, I. Dey, T. Li, T. H. Vu, and A. R. Hoffman Allele-Specific Histone Acetylation Accompanies Genomic Imprinting of the Insulin-Like Growth Factor II Receptor Gene Endocrinology, December 1, 2000; 141(12): 4428 - 4435. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu, S. Yu, D. Litman, W. Chen, and L. S. Weinstein Identification of a Methylation Imprint Mark within the Mouse Gnas Locus Mol. Cell. Biol., August 15, 2000; 20(16): 5808 - 5817. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |