help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lawson, M. A.
Right arrow Articles by Mellon, P. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lawson, M. A.
Right arrow Articles by Mellon, P. L.
Molecular Endocrinology 12 (3): 364-377
Copyright © 1998 by The Endocrine Society

Multiple Factors Interacting at the GATA Sites of the Gonadotropin-Releasing Hormone Neuron-Specific Enhancer Regulate Gene Expression

Mark A. Lawson, Abigail R. Buhain, Jocelyn C. Jovenal and Pamela L. Mellon

Departments of Reproductive Medicine (M.A.L., A.R.B., J.C.J., P.L.M.) and Neuroscience (P.L.M.) Center for Molecular Genetics University of California, San Diego La Jolla, California 92093-0674


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Neuron-specific expression of the GnRH gene is dependent on an upstream multicomponent enhancer. This enhancer is functional in a small population of GnRH-producing hypothalamic neurons which, through the secretion of GnRH, mediates central nervous system control of reproductive function. GnRH enhancer function requires activation by the GATA family of transcription factors that act through tandem consensus GATA-binding motifs, GATA-A and GATA-B. Here we show that two newly identified DNA-binding factors, termed GBF-A1/A2 and GBF-B1, bind the GnRH enhancer at sites overlapping the GATA factor-binding motifs. In vitro bindings of GATA, GBF-A1/A2, and GBF-B1 to the GnRH enhancer sequences are independent. Specific mutation of either the consensus GATA motif or the GBF-B1 site of GATA-B does not alter binding of the overlapping factor in vitro. Utilizing a GnRH-expressing neuronal cell line as a model system, we show by transient transfection that GBF-B1 is necessary for enhancer activity and independently activates the GnRH promoter. Transactivation of the GnRH enhancer in GT1 cells and in NIH 3T3 cells by GATA-4 is modulated by GBF-B1 binding, suggesting GBF-B1 interferes with GATA factor binding through a steric mechanism.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Terminal differentiation of developing cell lineages requires the expression of gene products that manifest specialized cellular function. A fundamental aspect of the regulation of differentiated cellular function is the transcriptional activation of the participating genes. Thus, it is essential to determine the transcriptional mechanisms regulating cell type-restricted gene expression to understand the development and maintenance of differentiated cellular phenotypes.

The highly specialized GnRH-secreting neurons of the mammalian hypothalamus mediate central nervous system (CNS) control of the endocrine axis regulating reproductive function (1). The population of GnRH-producing neurons in the CNS is estimated to consist of less than 800 cells and is distributed throughout the medial preoptic area and the anterior hypothalamus (2). The GnRH neurons are unique in that they migrate to the hypothalamus from the olfactory placode, where they arise about day 11 post coitus in the developing mouse (3). Although the expression of GnRH, the principal marker of GnRH neuron differentiation, has been the subject of much study, little is understood of the molecular mechanisms directing GnRH neuron differentiation (4). Understanding the transcriptional mechanisms regulating neuron-specific expression of the GnRH gene will therefore provide valuable insight into the differentiation of this unique population of hypothalamic neurons.

Using a cultured cell model system of the rare GnRH neurons, GT1 cells (5, 6), we have identified a neuron-specific enhancer in the rat GnRH gene which, in conjunction with the 173-bp promoter, recapitulates the cell type-specific expression of the GnRH gene directed by a full-length 3-kb 5'-regulatory region (7). Transient transfection assays of reporter plasmids bearing both the GnRH enhancer and promoter or the GnRH enhancer and a heterologous promoter demonstrated that activity was limited to GT1 cells. No significant enhancer activity was demonstrated in other neuronal and nonneuronal cell types. Sites of temporal regulation of GnRH gene expression in response to activation of second messenger signaling pathways have also been identified in both the promoter and enhancer regions (8, 9, 10). It is therefore likely that the principal cis-acting DNA elements regulating GnRH gene expression are contained within the enhancer and promoter regions.

Analysis of the GnRH gene enhancer by deoxyribonuclease I (DNase I) protection assay demonstrated multiple regions bound by GT1 cell nuclear proteins. Mutational analysis of these regions has shown that several regions are important in conferring full activity to the GnRH enhancer, indicating that the GnRH enhancer is composed of multiple regulatory elements (7). Two consensus motifs recognized by the GATA family of zinc-finger DNA-binding proteins, termed GATA-A and GATA-B, are present in the enhancer. The GATA-B element was demonstrated to be important for full enhancer activity (11). The (A/T)GATA(A/G) sequence is bound by a class of tissue-restricted zinc-finger proteins termed GATA factors. Although both GATA-2 and GATA-4 mRNAs can be detected in GT1 cells, only GATA-4 can be demonstrated to interact with the GnRH GATA-binding motifs (11). Moreover, transient transfection assays of GnRH enhancer-containing reporter gene plasmids into GT1 cells with cotransfected dominant-negative GATA-3 demonstrated that GATA factors regulate GnRH gene expression.

In addition to GATA factors, other complexes were identified, with oligonucleotide probes representing the extended sequences containing both GnRH enhancer GATA-binding motifs (11). The contribution of these non-GATA factors to GnRH enhancer activity was not made clear by these previous studies. Here we report that the factors forming these alternative non-GATA complexes recognize sequences in the GnRH enhancer that overlap with the GATA-binding sites and are present in a wide variety of cell types. Further, we demonstrate that one of these factors is necessary for GnRH enhancer activity and that its presence alters the ability of GATA factors to activate transcription through the GnRH enhancer. The interaction of multiple factors at a single site in the GnRH enhancer contributes additional complexity to enhancer function and may participate in determining transcriptional specificity of the GnRH gene in a highly select population of neurons.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Factors Binding the GnRH Enhancer GATA Motifs Are Present in Multiple Cell Lines
The GATA factor-binding sequences in the GnRH enhancer occur in regions previously shown to be protected by GT1 cell nuclear proteins in a DNase I protection assay (Fig. 1AGo). In addition, oligonucleotide probes representing extended sequences surrounding the GnRH enhancer GATA-binding motifs (GATA-A and GATA-B in Fig. 1BGo) were found to bind additional factors that were not GATA family members. This was demonstrated by the inability of a control GATA-binding oligonucleotide probe to interfere with formation of the unique complexes in an electrophoretic mobility shift assay (EMSA) or by the lack of interaction with antiserum directed against GATA-2 or GATA-4, the two GATA family members identified in GT1 cells (11). To determine whether the non-GATA factors binding the GnRH enhancer at the GATA-A and GATA-B sites are unique to GT1 cells and/or contribute to GnRH gene expression, we investigated the cell type distribution of the additional binding factors (Fig. 2Go). Using oligonucleotide probes representing the GnRH enhancer GATA-A and GATA-B regions (Fig. 1BGo), EMSAs were performed using crude nuclear extracts prepared from the hypothalamic GnRH neuron cell line GT1, the fibroblast cell line NIH/3T3, the pituitary gonadotrope cell line {alpha}T3, the catecholaminergic CNS neuronal cell line CATH.a, and the teratocarcinoma cell line F9 differentiated into visceral endoderm. All of these cell lines are of murine origin. In addition, extracts were prepared from the human peripheral neuronal cell line IMR-32 (12) and the human placental trophoblast-derived cell line JEG-3 (13). The A1 and A2 complexes formed with the GATA-A probe and GT1 cell nuclear extract are also detected in reactions using the other murine-derived cell lines (Fig. 2Go, lanes 1–5). Nuclear proteins isolated from the human cell lines formed a similar complex to A2 but did not show strong complex formation similar to A1 (Fig. 2Go, lanes 6 and 7), suggesting that the factor or factors forming the A1 complex may differ significantly between mouse and human. The EMSAs performed with both the murine- and human-derived cell lines and the GnRH GATA-B probe indicated that the B1 complex is common to all the cell lines tested (Fig. 2Go, lanes 8–14). However, the GATA-specific complex, which has been previously determined to contain GATA-4 or a related factor in GT1 cells (11), is not equivalent between the murine (Fig. 2Go, lanes 8–12) and human cell types (Fig. 2Go, lanes 13 and 14). All of the murine cell lines except CATH.a have been previously determined to contain either GATA-2 or a GATA-4/5/6 subfamily member (11, 14, 15, 16). The human neuronal cell line IMR-32 has not been characterized with respect to GATA factor complement. The JEG-3 cell line has been shown to contain GATA-2 (17), and GATA-3 (15). It is therefore likely that all of the complexes that migrate similarly to the B2 complex contain a GATA-binding factor. These results suggest the factors forming the A1, A2, and B1 complexes with the GnRH GATA-A and -B probes are either widely distributed or are members of a broad family of DNA-binding proteins.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 1. Sequence of the Rat GnRH Enhancer Containing the GATA-A and GATA-B Sites

A, Regions footprinted by GT1–7 cell nuclear proteins are boxed. The canonical GATA-binding motif (A/T)GATA(A/G) in each site (boldface type) and the direction of the binding sequence (arrow) are indicated. The numbers indicate base pair positions relative to the transcriptional start of the rat GnRH gene. B, The oligonucleotides used as EMSA probes and for site-directed mutagenesis of the enhancer are also shown with the GATA motif indicated as described above. The asterisks indicate mutated bases with respect to the wild-type sequence. Oligonucleotides containing mutations are designated by the sequence replacing the consensus motif of either the GATA-A or GATA-B site or that replacing the binding sites for GBF-A1/A2 or GBF-B1.

 


View larger version (76K):
[in this window]
[in a new window]
 
Figure 2. Cell Type Distribution of Complexes Formed by Oligonucleotide Probes Representing the GATA-A and GATA-B Sites of the GnRH Enhancer

GATA-A (lanes 1–7) and GATA-B (lanes 8–14) oligonucleotide probes described in Fig. 1Go were used in an EMSA with nuclear proteins isolated from the following cell types: GT1 mouse hypothalamic GnRH neuron cell line (lanes 1 and 8), NIH 3T3 mouse fibroblast cell line (lanes 2 and 9), {alpha}T3 mouse pituitary gonadotrope cell line (lanes 3 and 10), CATH.a mouse neuronal cell line (lanes 4 and 11), F9 mouse teratocarcinoma cell line (lanes 5 and 12), IMR-32 human peripheral neuronal cell line (lanes 6 and 13), and JEG-3 human placental trophoblast cell line (lanes 7 and 14). The A1- and A2-specific complexes formed by the GATA-A probe and the B1- and GATA-specific complexes formed by the GATA-B probe are indicated in the panel.

 
The A1- and A2-Binding Factors Recognize a Unique Sequence Overlapping the GATA-A Site
To determine the binding sequence recognized by the factors forming the A1 and A2 complexes, methylation interference analysis of the sequences necessary for formation of the A1 and A2 complexes was performed with GT1 cell nuclear extract. The cleavage products obtained are displayed in Fig. 3AGo. The pattern of interference obtained from the analysis of the A1 complex reveals a binding sequence 5' to and overlapping with the consensus GATA motif. This pattern was distinct from that reported for interference by known GATA factors (14, 18, 19, 20). Identical data were obtained upon analysis of the A2 complex (data not shown). The sequence recognized by the factors forming the A1 and A2 complexes does not show significant similarity to sites recognized by other known DNA-binding proteins as determined by search of the TRANSFAC database (21); furthermore, oligonucleotides representing sites determined by the database to be similar to the GnRH GATA-A site did not form equivalent complexes in an EMSA nor were they capable of eliminating A1 and A2 complex formation when present in high molar excess with GATA-A probe (data not shown). The exact identity of the A1 and A2 factors remains unknown. Because both complexes recognize the same sequence it is possible that the A1 and A2 factors are differently modified versions of the same factor or closely related members of the same family of DNA-binding proteins. Alternatively, the A1 and A2 factors may be heteromeric complexes of differing composition. The A1/A2-binding factors will be referred to as GnRH enhancer binding factor A1/A2, or GBF-A1/A2.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 3. Methylation Interference and Missing-Contact Probing of Complexes Formed by GT1–7 Cell Nuclear Protein and the GnRH Enhancer GATA-A and GATA-B Sites

A, Methylation interference pattern of the GATA-A oligonucleotide probe described in Fig. 1Go bound by the A1 complex and from unbound probe (B and F, respectively). The sequence of the top and bottom strands appears beside the respective cleavage products. The canonical GATA-binding motif appears boxed in each sequence. The lines indicate bases showing interference in the A1 complex. Identical data were obtained with probe isolated from the A2 complex (data not shown). B, Pattern of contacted bases in the B1 complex and in unbound probe (B and F, respectively) as determined by missing-contact probing of the GATA-B site using the oligonucleotide probe described in Fig. 1Go. The sequence of the top and bottom strands appears beside the respective cleavage products. The canonical GATA-binding motif appears boxed. The lines indicate bases requiring contact in the B1 complex.

 
The B1-Binding Factor Recognizes a Unique Sequence Overlapping the GATA-B Site
Previous analysis of the GnRH enhancer GATA-B site by EMSA showed that the B1 complex was specific to the GATA-B oligonucleotide probe (11). To determine the exact sequence bound by the B1 complex, methylation interference analysis of GATA-B probe binding was conducted. No significant interference of B1 complex binding by probe methylation was detected. However, analysis of B1 complex binding by missing-contact probing using depyrimidated GATA-B probe demonstrated a strong dependence for binding on sequences overlapping with the GATA-binding motif (Fig. 3BGo). The TRANSFAC database did not identify any known factors that may recognize the extended site bound by the B1-binding activity, suggesting that the B1 complex is formed by an undescribed DNA-binding factor. This factor will be referred to as GnRH enhancer binding factor B1, or GBF-B1.

GBF-A1/A2 Does Not Influence GATA Factor Binding
Interaction of a GATA-binding factor with the GATA-A site has not been demonstrated in vitro. To determine whether the presence of GBF-A1/A2 prevents GATA factor binding the GATA-A site, or that visualization of a GATA-specific complex is occluded by comigration of a GBF-A1/A2 complex, double-stranded oligonucleotide probes representing the GATA-A site with specific mutations exclusively in the consensus GATA-binding sequence (GACC-A, Fig. 1BGo) or in the GBF-A1/A2-binding sequence (TTAA-A, Fig. 1BGo) were generated. These radiolabeled probes were used in an EMSA with GT1 cell nuclear proteins. In comparison to the formation of the A1/A2 complex by the wild-type GATA-A oligonucleotide probe (Fig. 4AGo, lane 1), the GACC-A probe formed less A1/A2 complex (Fig. 4AGo, lane 2). This suggests that GBF-A1/A2 binding is influenced by sequences encompassing the entire GATA-binding site in addition to those indicated by the methylation interference assay above. The TTAA-A probe could not form any A1/A2 complex but did form a new complex of slightly greater mobility than the A1 complex (Fig. 4AGo, lane 3). This new complex did not contain a GATA factor as determined by competition with the PPET GATA consensus oligonucleotide (not shown). Neither the GACC-A nor the TTAA-A oligonucleotide could eliminate GBF-A1/A2 complex formation by radiolabeled GATA-A probe (Fig. 4AGo, lanes 6 and 7), providing further evidence that GBF-A1/A2 requires sequences encompassing the GATA-binding sequence. In agreement with the determination of the GBF-A1/A2-binding sequences, an oligonucleotide probe representing the GATA factor-binding site of the human preproendothelin-1 gene (PPET) was unable to eliminate GBF-A1/A2 binding when present in high molar excess in an EMSA (Fig. 4AGo, lane 8). This indicates that the GBF-A1/A2 requires sequences other than GATA for recognition of the GATA-A site of the GnRH enhancer.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 4. Specific Mutation of the GATA- or GBF-Binding Sites Alters GBF and GATA Factor Interaction Independently

A, EMSA analysis of complexes formed with GT1 cell nuclear protein by wild-type and mutant GATA-A site oligonucleotide probes (lanes 1–3). EMSA analysis of GBF-A1/A2 complex formation on the GATA-A probe alone or in the presence of 100-fold molar excess of unlabeled wild-type or mutant GATA-A oligonucleotide probes and an oligonucleotide probe representing the GATA-binding site of the human PPET gene (lanes 4–8). EMSA analysis of the PPET probe alone or in the presence of 100-fold molar excess of the PPET probe and wild-type or mutant GATA-A probe (lanes 9–13). B, EMSA analysis of complexes formed with GT1 cell nuclear protein and wild-type and mutant GATA-B probes (lanes 1–3). EMSA analysis of GBF-B1 complex formation by the GATA-B probe alone or in the presence of 100-fold molar excess of unlabeled wild-type or mutant GATA-B oligonucleotide probe and the PPET probe (lanes 4–8). EMSA analysis of the PPET probe alone or in the presence of 100-fold molar excess of the PPET probe and wild-type or mutant GATA-B probe (lanes 9–13). C, EMSA analysis of altered GATA-factor interaction by mutant GATA-A and GATA-B oligonucleotide probes. EMSA reaction incubated in the presence of purified nonimmune rabbit IgG (lanes 1–4) or IgG purified from rabbit antiserum directed against glutathione S-transferase-linked mouse GATA-4 (lanes 5–12). Reactions were incubated in the presence of nuclear proteins isolated from GT1 cells (lanes 1–8) or from GT1 cells overexpressing mouse GATA-4 (lanes 9–12). Oligonucleotides used as probes or as competitors (COMPET.) of complex formation are described in the legend to Fig. 1Go. The PPET oligonucleotide probe is described in Materials and Methods. -, No competitor. Arrow, Complex super shifted by anti-GATA-4 IgG.

 
To determine the effects of the mutations on GATA factor interaction, the PPET oligonucleotide probe described above was used in EMSAs with GT1-cell nuclear proteins (Fig. 4AGo, lane 9). Both the wild-type PPET and GATA-A unlabeled oligonucleotide probes were capable of preventing GATA factor complex formation when present in high molar excess with radiolabeled PPET probe (Fig. 4AGo, lanes 10 and 11, respectively). As expected, inclusion of excess GACC-A oligonucleotide did not affect GATA-specific complex formation by the PPET probe (Fig. 4AGo, lane 12), whereas inclusion of the TTAA-A oligonucleotide did (Fig. 4AGo, lane 13). These observations suggest that the GATA-A site represents a low-affinity GATA-binding sequence that may interact with a GATA factor when present at high concentration. It has been shown that only the GAT portion of the canonical GATA-binding motif is strictly required for in vitro binding of GATA factors to DNA (22). However, the GATA-A site does not interact with a GATA factor efficiently in vitro, and the presence of GBF-A1/A2 does not influence GATA-factor interaction.

Both GATA and GBF-B1 Independently Bind the GATA-B Site
To verify that both GATA and GBF-B1 can be specifically eliminated by mutations in their respective recognition sites, double-stranded oligonucleotide probes representing the wild-type GATA-B sequence or the GATA-B sequence containing mutations in either the GATA (GACC-B, Fig. 1BGo) or GBF-B1 (TCAG-B, Fig. 1BGo) sites alone were included in EMSAs with GT1 cell nuclear extract. In comparison to the wild-type GATA-B probe (Fig. 4BGo, lane 1), the GACC-B GATA mutant probe could only form the B1 complex (Fig. 4BGo, lane 2), indicating specific elimination of GATA factor interaction. Conversely, the TCAG-B GBF-B1 mutant probe was capable of only GATA factor complex formation (Fig. 4BGo, lane 3), indicating specific elimination of GBF-B1 binding. To further demonstrate the exclusive elimination of either the GATA or B1 complex formation by the GACC-B and TCAG-B mutations, EMSAs were performed with radiolabeled GATA-B probe and either unlabeled GACC-B or TCAG-B probe at high molar excess. Whereas the inclusion of excess unlabeled wild-type GATA-B oligonucleotide eliminates formation of both the GBF-B1- and GATA-specific complexes (Fig. 4BGo, lanes 4 and 5), inclusion of excess unlabeled GACC-B oligonucleotide eliminates only the B1 complex (Fig. 4BGo, lane 6). This observation indicates that only GATA factor interaction was altered by the GACC-B mutation. Conversely, the inclusion of excess TCAG-B oligonucleotide eliminates only the GATA-specific complex (Fig. 4BGo, lane 7), indicating that only GBF-B1 interaction was affected by the TCAG-B mutation.

As a control for GATA factor-specific interaction of the wild-type GATA-B probe, the PPET oligonucleotide probe was also included at high molar excess in an EMSA with radiolabeled GATA-B probe. As shown in Fig. 4BGo, lane 8, only the formation of the GATA-specific complex was affected by the presence of the PPET probe. Further, when the wild-type GATA-B, the mutant GACC-B, or the mutant TCAG-B oligonucleotides are included in excess in an EMSA with radiolabeled PPET probe (Fig. 4BGo, lanes 11–13), only the GACC-B mutant is affected in its ability to eliminate formation of the GATA-specific complex (Fig. 4BGo, lane 12). These observations and the lack of any higher ordered complexes affected by both the GBF-B1 and GATA-specific mutations suggest that the factor or factors forming the GATA-specific and B1 complexes do not require interaction with each other to bind the GnRH enhancer GATA-B site. We therefore conclude that GBF-B1 and GATA bind independently to the GATA-B site of the GnRH enhancer.

The GATA-A- and GATA-B-derived probes showed specific complexes of increased intensity when mutated. The increased intensity of the TTAA-A complex may be due to the increased presence of a GATA factor. Supershift of the resultant GATA-specific complexes with purified rabbit IgG directed against mouse GATA-4 (16, 23, 24, 25) was performed with radiolabeled GATA-A, TTAA-A, GATA-B, or TCAG-B probe and with GT1 cell nuclear extract. In comparison to EMSAs treated with nonimmune rabbit IgG (Fig. 4CGo, lanes 1–4), it can be seen that the increase in the TTAA-A-specific complex is not attributed to increased GATA factor interaction. In contrast, the TCAG-B GATA-specific complex can be entirely attributed to the presence of GATA-binding protein (Fig. 4CGo, lanes 4–12). Additionally, we have been unable to detect a difference in affinity of the TCAG-B probe for GATA binding in comparison to the wild-type GATA-B sequence (data not shown). It is unlikely that the TCAG-B mutation would result in increased affinity for GATA factors, as the mutation occurs in the -2 position relative to the required GATA sequence, and this position has been demonstrated to play no significant role in GATA factor interaction with DNA (22, 26). We conclude that the GATA-A site does not efficiently interact with a GATA factor even in the absence of GBF-A1/A2 binding, but that the GATA-B site retains the ability to interact with a GATA factor in the absence of GBF-B1 binding.

Both GATA and GBF-B1 Are Necessary for GnRH Enhancer Activity
The above analysis of the GATA, GBF-A1/A2, and GBF-B1 DNA-binding activities suggests that they act independently in conferring activity to the GnRH enhancer. To determine the role of each factor in GnRH enhancer activity, the GACC-A, TTAA-A, GACC-B, and TCAG-B oligonucleotides were used to generate site-specific mutations in the GnRH enhancer. The mutated enhancers were incorporated into the GnRH reporter gene plasmid ENH-173 and subsequently transfected into GT1 cells. Activities of the mutant reporter plasmids were compared with the wild-type ENH-173 reporter plasmid, and the results are summarized in Fig. 5Go. Mutation of the GATA-A-binding site (GACC-A) results in an approximately 35% reduction of activity of the enhancer, suggesting that in context of the entire enhancer the GATA-A site may be functional. Mutation of the A1/A2-binding site alone (TTAA-A) has no significant effect on enhancer activity. Mutation of the GATA- or B1-binding site (GACC-B and TCAG-B, respectively) results in a 65%–75% decrease in activity of the enhancer. The lack of observed increase in activity as a result of the TCAG-B mutation further suggests that this mutation does not affect GATA factor binding, but rather affects a separate, positive acting DNA-binding activity. These data indicate that both GATA and GBF-B1 activate the GnRH enhancer.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 5. Effect of GATA- and GBF-Specific Mutations on GnRH Enhancer Activity

Site-specific mutations of the GATA-A, GBF-A1/A2.GATA-B, or GBF-B1 sites of the GnRH enhancer were engineered in the CAT reporter plasmid ENH-173 and transfected into GT1–7 cells along with a TK-luciferase internal control plasmid. After 48 h of incubation, cells were harvested and assayed for CAT and luciferase activity. The activity of the wild-type GnRH enhancer-promoter plasmid ENH-173, normalized to the activity of the cotransfected TK-luciferase internal control, was arbitrarily set at 100. The values for the mutant plasmids are reported normalized to the activity of cotransfected internal control and relative to the value of ENH-173. The error bars represent the SEM of at least three replicates. Asterisks represent P < 0.05 by Student’s t test.

 
GBF-B1 and GATA-4 Independently Activate the GnRH Promoter
The observation that GBF-B1 is necessary for full enhancer activity suggests that it may activate in the absence of other enhancer-binding factors. To test the ability of GATA and GBF-B1 to act independently through the GATA-B site, reporter plasmids containing a multimerized wild-type GATA-B site, the GATA-binding mutant (GACC-B), or the GBF-B1-binding mutant (TCAG-B) upstream of the thymidine kinase (TK) or GnRH promoter were engineered and subsequently transfected into GT1 cells. All of the sites showed moderate 1.5- to 1.8-fold stimulation of the heterologous TK promoter (Fig. 6AGo) and strong 5- to 6-fold stimulation of the GnRH promoter (Fig. 6BGo). Mutation of either binding site did not significantly affect activation of either promoter. These data support the role of both factors as independent activators of GnRH gene expression.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 6. Effect of GATA-B Site Mutations on TK and GnRH Promoter Activity

A, Luciferase reporter gene plasmids under the control of the TK promoter alone (TK-LUC) or with addition of the multimerized wild-type GATA-B (GATA-B4), GATA-specific mutant (GACC-B4), or GBF-B1-specific mutant (TCAG-B4) binding sites engineered upstream of the promoter sequences were transfected into GT1 cells. Transfections included a TK-ß-galactosidase reporter plasmid as an internal control for transfection efficiency. After 48 h of incubation, cells were harvested and assayed for luciferase and ß-galactosidase activity. The activity of the TK-LUC control, normalized to the activity of the cotransfected internal control, was arbitrarily set at 100. The values for the reporter plasmids bearing the additional wild-type and mutant GATA- or GBF-B1-binding sites are reported normalized to the cotransfected internal control and relative to the activity of TK-LUC. Error bars represent the SEM of at least seven replicates. Asterisks represent significant difference of the means (P < 0.05) by the method of Fisher. B, Luciferase reporter gene plasmids under the control of the GnRH promoter alone (-173-LUC) or with addition of the multimerized wild-type GATA-B (GATA-B4), GATA-specific mutant (GACC-B4), or GBF-B1-specific mutant (TCAG-B4) binding sites inserted upstream of the promoter sequences were transfected into GT1 cells. Transfections included a TK-ß-galactosidase reporter plasmid as an internal control for transfection efficiency. After 48 h of incubation, cells were harvested and assayed for luciferase and ß-galactosidase activity. The activity of the -173-LUC control, normalized to the activity of the cotransfected internal control, was arbitrarily set at 100. The values for the reporter plasmids bearing the additional wild-type and mutant GATA- and GBF-B1-binding sites are reported normalized to the cotransfected internal control and relative to the activity of -173-LUC. Error bars represent the SEM of at least four replicates. Asterisks represent (P < 0.05) by the method of Fisher.

 
GBF-B1 Limits GATA Factor Interaction with the GATA-B Site
The above analysis of independent stimulation of TK and GnRH promoter activity without additive or synergistic activation suggests that GBF-B1 and GATA may mutually interfere with each other. To test this, the reporter gene plasmids containing the multimerized wild-type and mutant GATA-B sites were cotransfected into GT1 cells with a plasmid expressing the cDNA encoding mouse GATA-4. Both the TK-LUC (Fig. 7AGo) and the -173-LUC (Fig. 7BGo) reporter plasmids containing the multimerized GATA-B site were activated about 2.5-fold over reporter plasmid cotransfected with the null expression plasmid. No significant increase in TK promoter activity was observed with the reporter plasmid containing the GATA site-specific mutation GACC (Fig. 7AGo). Additionally, because the internal control plasmid for this and all other analyses also bears a TK promoter and an identical plasmid background, activation is not a result of nonspecific stimulation of reporter activity. Previous analysis of mutations that eliminate both GATA and GBF-B1 binding also eliminate response to exogenously expressed GATA factors (11). An approximately 50% decrease in GATA mutant GACC-B reporter activity was observed in the presence of exogenously expressed mouse GATA-4 (Fig. 7BGo). The promoter alone also exhibits some decrease in activity in the presence of excess GATA-4 (Fig. 7BGo). Most significantly, reporter plasmids containing the GATA-B site bearing the B1-specific mutation TCAG showed a 3.5- to 4.0-fold activation of the TK (Fig. 6BGo) and GnRH (Fig. 7BGo) promoters, respectively, in the presence of exogenously expressed GATA-4. The increased level of promoter activation observed in reporter plasmids containing the B1-specific mutation suggests that GBF-B1 interferes with GATA-factor activity at the GATA-B site. The increase in GATA factor transactivation of the reporter plasmids is not due to altered affinity for GATA factors by the TCAG mutation. EMSAs using the PPET control oligonucleotide as probe and increasing amounts of unlabeled PPET, GATA-B, or TCAG-B oligonucleotides show that the TCAG-B mutation does not result in a significant alteration of affinity for GATA binding (Fig. 7CGo). This is consistent with previous results indicating that the -2 site of the GATA-binding sequence, which is the site of the TCAG-B mutation, has little influence on GATA factor interaction (22, 26).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 7. Effect of GATA-B Site Mutations on Transactivation by GATA-4

TK-LUC reporter plasmids (A) or -173 LUC reporter plasmids (B) containing the multimerized wild-type (GATA-B4), GATA-specific mutant (GACC-B4), or GBF-B1-specific mutant (TCAG-B4) sites and a TK-ß-galactosidase internal control plasmid were transfected into GT1–7 cells with a null expression plasmid (-) or expression plasmid bearing the cDNA encoding mouse GATA-4 (+). After 48 h of incubation, cells were harvested and assayed for luciferase activity and ß-galactosidase activity. The activity of the wild-type GATA-B4 plasmid cotransfected with the null expression plasmid, normalized to the activity of the internal control, was arbitrarily set at 100. All other values are normalized to the activity of the internal control and reported relative to the activity of the GATA-B4 control. Error bars represent the SEM of at least three replicates. Asterisk represents significant difference (P < 0.05) between GATA-4 induction of wild-type and the TCAG-B mutant reporter plasmids as measured by two-factor ANOVA. C, EMSAs using GT1–7 cell nuclear extract, radiolabeled PPET oligonucleotide as a probe, and increasing amounts of unlabeled PPET, GATA-B, or TCAG-B oligonucleotide were analyzed by densitometry. The amount of probe appearing in a GATA-specific complex is reported as a percent of total input probe and plotted with respect to amount of unlabeled competitor oligonucleotide included in the reaction. Error bars represent the SD of three independent measurements.

 
To confirm that GBF-B1 limits GATA-factor activation in the context of the GnRH enhancer, the GATA- and B1-specific mutations of the GATA-B site were incorporated into the reporter plasmid ENHTK. This reporter was chosen to allow examination in NIH 3T3 cells, in which the GnRH promoter is inactive. Reporter gene plasmids were cotransfected into GT1 or NIH 3T3 cells with a GATA-4 expression plasmid or control null expression plasmid. Activation of the ENHTK plasmid and B1-binding mutant TCAG-B reporter plasmid relative to control cotransfection with the null expression plasmid is shown in Fig. 8Go. Cotransfection of the ENHTK reporter plasmid with a mouse GATA-4 expression plasmid into GT1 cells (Fig. 8AGo) or NIH 3T3 cells (Fig. 8BGo) resulted in an approximately 1.8-fold increase in reporter activity, similar to previously reported results (11). The activity of the GBF-B1-binding mutation TCAG-B was increased approximately 3-fold in both GT1 cells and NIH 3T3 cells overexpressing GATA-4. The increase in GATA factor-mediated activation of GnRH enhancer activity in the absence of B1-binding activity demonstrates that in the context of the GnRH enhancer, GBF-B1 modulates GATA factor interaction with the GnRH enhancer.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 8. Effect of GATA-Specific and GBF-B1-Specific Mutations of the GATA-B Site on Transactivation of the GnRH Enhancer by GATA-4

The wild-type GnRH enhancer CAT reporter plasmid ENHTK or reporter plasmids bearing GATA-specific (GACC-B) or GBF-B1-specific (TCAG-B) mutations at the GATA-B site of the GnRH enhancer and the TK-LUC internal control plasmid were cotransfected into GT1–7 cells (A) or into NIH 3T3 cells (B) with a null expression plasmid (-) or with an expression plasmid bearing the cDNA encoding mouse GATA-4 (+). After 48 h of incubation, cells were harvested and assayed for CAT and luciferase activity. The activity of the wild-type ENHTK plasmid cotransfected with the null expression plasmid, normalized to the activity of the internal control, was arbitrarily set at 100. All other values are reported normalized to the activity of the internal control and relative to the ENH control. Error bars represent the SEM of at least three replicates. Asterisks represent significant difference (P < 0.05) between GATA-4 induction of wild-type and the TCAG-B mutant reporter plasmids by two-factor ANOVA of paired experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The GnRH neuron-specific enhancer is a complex regulatory region composed of multiple protein-binding elements. We have previously shown that two sites of the enhancer, termed GATA-A and GATA-B, contain consensus motifs recognized by the GATA family of zinc-finger DNA-binding proteins. However, detailed analysis of these sites has shown that only one of the two, GATA-B, interacts with a GATA-binding factor in vitro. The GATA-A site has not been demonstrated to bind a GATA-factor in vitro, although some evidence for GATA factor interaction in a transient transfection assay has been presented (11). In addition to GATA factor interaction, at least two other factors bind the GnRH enhancer at the GATA-A and GATA-B sites. Here we show that these new factors, termed GBF-A1/A2 and GBF-B1, bind the GnRH enhancer at the GATA-A and GATA-B sites, respectively. These factors bind unique sequences that overlap the consensus GATA-binding motifs, but show no strong similarity to sites recognized by known DNA-binding proteins. Additionally, these factors are present in a wide variety of cell types indicating that they may be generally expressed or members of a widely expressed family of factors.

The role of GBF-A1/A2 in expression of GnRH is as yet undefined. We have clearly shown that any effect of GATA-A site mutation can be attributed to the GATA consensus site, and not the GBF-A1/A2 site. The GBF-A1/A2-binding site overlaps considerably with the consensus GATA-binding motif, as evidenced by the weakened A1/A2 complex formed by the GATA-specific mutant EMSA probe. However, mutation of the GBF-A1/A2-binding site, which does not affect GATA factor interaction, does not alter transactivation by overexpressed GATA-4 (M. A. Lawson, unpublished observations). It is of interest that GBF-A1/A2 appears to be dispensable for GnRH gene expression. Previous results from mutational analysis of the GnRH enhancer in which the entire GATA-A site is altered (7), in addition to the more specific analysis presented here, have failed to demonstrate a role for this factor in GnRH gene expression. This inability to demonstrate a role for GBF-A1/A2 may be due to functional redundancy in the GnRH enhancer. The GnRH enhancer also shows evidence of functional redundancy in POU homeodomain-binding sites. Although two strongly footprinted regions in the enhancer flanking the GATA sites can be shown to bind the transcription factor Oct-1, only one of these sites is necessary for full enhancer activity (4). Alternatively, GBF-A1/A2 may perform a role in GnRH gene expression not used by the cultured GnRH neuron cell line used in these studies, but may be of greater significance in the developmental precursor to the GnRH neuron or to nonreplicating, fully differentiated GnRH neurons. Interestingly, GATA-specific mutation of the GATA-A site does moderately affect enhancer activity, suggesting that GATA factors may indeed act through the GATA-A site in the context of the enhancer. This conclusion is supported by previous data showing the necessity of mutating both GATA-A and GATA-B to completely eliminate any response to exogenously expressed GATA-factors (11). It has been suggested by others that GATA factor action may indeed occur through sites demonstrating low affinity for factor binding in vitro (26) or that regulation of specific genes by GATA factors may occur through altered levels of factors present in differentiating cells (27, 28, 29). Such a model of GATA factor regulation of target genes may apply to the GATA-A site of the GnRH enhancer.

The role of GBF-B1 in regulating GnRH gene expression is clearly demonstrable. Both GATA and GBF-B1, in the context of the GnRH enhancer, are necessary for full enhancer activity. Both factors are also capable of activating the GnRH promoter or a heterologous promoter independently. However, GBF-B1 exhibits the additional property of interfering with GATA factor interaction, probably through a simple steric hindrance mechanism. Both direct and indirect modulation of GATA-factor activation by other DNA-binding factors has been reported (30, 31). Here we report that the factor modulating GATA transactivation of the GnRH enhancer is also necessary for full enhancer activity. Further evidence of the positive action of GBF-B1 can be derived from the activity of the GACC-B mutant reporter in Fig. 7BGo, wherein the lower levels of reporter plasmid used (one fifth that in Fig. 6Go) results in basal activity higher than that observed for the wild-type control. The absence of any complex containing both GATA-4 and GBF-B1 bound to the GATA-B site in an EMSA even in the presence of increased GATA-4 strongly supports the interpretation that only one of these factors can occupy the GATA-B site.

GATA-binding factors may play a role in the differentiation of the GnRH neuron. The expression pattern of GATA-1 in the developing mouse erythropoietic system may prove to be an appropriate analogy for the ontogeny of the GnRH neurons. Expression of GATA-1, an essential factor in erythrocyte development, peaks at the onset of adult ß-hemoglobin expression at about day 14 postcoitus and declines after the establishment of ß-hemoglobin expression (29). This is thought to indicate that increased GATA-1 expression potentiates differential gene activation. In the developing mouse, embryonic expression of GATA-4 in visceral and parietal endoderm (16) precedes by several days the expression of GnRH, at day 11 postcoitus (3, 32). Therefore GATA-4 alone is not sufficient for targeting expression of GnRH to the appropriate cell type. It has been shown that GATA-4 is highly expressed in the developing mouse, including nasopharyngeal tissues, which eventually give rise to GnRH neurons (33). Both GATA-4 and GATA-2 mRNAs are not highly expressed in the cultured GT1-cell GnRH neuron cell line relative to levels found in the murine teratocarcinoma cell line F9 and MEL cells (11). It is thought that the GT1 cell model system represents the GnRH neuron at a highly differentiated state (6). GATA factors may then play a role in the onset of GnRH gene expression, as indicated by the activation of transcription by overexpressed GATA-4, but other factors such as GBF-B1 may play a role in the maintenance of GnRH gene expression in the absence of high levels of GATA-4. Further studies examining the expression of GATA factors and GnRH during neurogenesis in the olfactory placode of the developing mouse will directly address this possibility. To date, none of the enhancer-binding factors reported here or elsewhere (4) can be designated as a GnRH neuron-specific factor. It is likely that a combination of more widely expressed factors specify expression of the GnRH gene to the appropriate neuron population. Such a model of targeting gene expression supports the role of GBF-B1 in contributing to the specificity of GnRH gene expression.

In summary, we have identified two factors, GBF-A1/A2 and GBF-B1, that bind the neuron-specific GnRH enhancer at sites overlapping consensus GATA factor-binding sites. One of these factors, GBF-B1, is essential for full enhancer activity and modulates GATA factor-mediated activation of GnRH gene transcription. The activity of the GnRH enhancer is dependent on widely expressed transcription factors. The contribution of GBF-B1 to GnRH enhancer activity provides additional complexity to GnRH gene transcriptional regulation, thereby contributing to the specificity of GnRH gene expression.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmids
Construction of the chloramphenicol acetyl transferase (CAT) gene reporter plasmid pSS<ML-173CAT, termed ENH-173, containing the rat GnRH enhancer and 173-bp promoter, and the reporter plasmid pSS<TKCAT, termed ENHTK, has been described (7). Site-directed mutations in the enhancer sequences were constructed using the plasmid-based heteroduplex method (34) or by PCR mutagenesis (35) with the oligonucleotides presented in Fig. 1Go. The eukaryotic expression plasmids pMT2 and pMT2mGATA4 (encoding the mouse GATA-4 cDNA) have also been described (16). The expression plasmid pcmGATA-4 was constructed by inserting the 1.8-kb EcoRI fragment of pMT2mGATA4 containing the mouse GATA-4 cDNA into the EcoRI site of the eukaryotic expression plasmid pcDNAI (Invitrogen, San Diego, CA). The plasmids p(GATA-B)4TK and p(GATA-B)4 -173, which contain four copies of the GATA-B oligonucleotide upstream of the herpesvirus TK promoter [-105 to +51 from pBLCATII (36)] or the 173-bp rat GnRH promoter were engineered in the reporter vector pGL3-basic (Promega, Madison, WI) as follows. The GATA-B, GACC-B, or TCAG-B double-stranded oligonucleotide was ligated into pBSK+ (Stratagene, La Jolla, CA) that had been digested with SpeI and XbaI and filled in with the Klenow fragment of DNA polymerase I. The insertion of the oligonucleotide regenerated both restriction sites. The oligonucleotide insert was then multimerized by digestion with XmnI and either SpeI or XbaI and religation of the insert-containing fragments. This process was repeated after transformation into Escherichia coli and preparation of new plasmid DNA containing two copies of the inserted oligonucleotide. The resulting tetramerized oligonucleotides were then inserted into SacI and SmaI sites of pGL3-basic. The BamHI-BglII fragment containing the TK promoter from the plasmid pSS<TKCAT (7) or the XmaI-BglII fragment from pSS<ML-173CAT (7) containing the 173-bp GnRH promoter fragment was then inserted into the BglII- digested or XmaI-BglII-digested plasmids containing the multimerized sites. The resulting plasmids containing the wild-type or mutated GATA-B sites upstream of either promoter were verified by dideoxy sequencing of the plasmid DNA before use in transient transfection assays.

EMSAs
The preparation of crude nuclear extract, EMSA reaction conditions, and antibody supershift reaction conditions have been described previously (11, 37). Reactions were resolved by electrophoresis on 5% 30:1 acrylamide-N, N'-methylene bisacrylamide gels at 10 V/cm. Autoradiograms of the gels were made by exposing dried gels to XAR-5 film (Kodak, Rochester, NY). The double-stranded oligonucleotide probes representing the GATA-A and GATA-B sites of the GnRH enhancer used in the EMSA and site-directed mutagenesis of the GnRH enhancer are illustrated in Fig. 1Go. The double-stranded oligonucleotide probe representing the GATA-binding site of the human preproendothelin-1 gene used as a control for GATA factor binding contained the sequence GGCCTGGCCTTATCTCCGGCTGAT and its complement (14). Preparation of radiolabeled probe used in EMSA reactions has been described (11). Densitometry of EMSA reactions was performed with a Molecular Imager (Bio-Rad, Richmond, CA) and analyzed with Molecular Analyst 1.5 software (Bio-Rad).

Methylation Interference and Missing Contact Analysis
Single-stranded oligonucleotide representing either the top or bottom strands of the GATA-A site was labeled by incubation with T4 polynucleotide kinase in the presence of [{gamma}32P]ATP (6000 Ci/mmol, New England Nuclear, Boston, MA), as described above for the preparation of the double-stranded EMSA probe. After purification the labeled oligonucleotide was annealed to the complementary strand oligonucleotide that had been phosphorylated in the presence of nonradioactive ATP. The concentration of the final double-stranded oligonucleotide probe was determined by measurement of specific activity and adjusted to 10 pmol/µl in buffer of Tris-Cl 10 mM (pH 7.4) at 25 C, 1 mM EDTA, and 50 mM NaCl. Methylation reactions were performed in a 200 µl volume with 100 pmol of labeled probe as described (38). Methylated probe was resuspended in a buffer containing 10 mM Tris-Cl (pH 7.4) at 25 C, 1 mM EDTA, and 50 mM NaCl at approximately 2 fmol/µl as determined by measurement of specific activity.

Depyrimidation of double-stranded GATA-B oligonucleotide probe for missing-contact probing was performed according to a previously described method (39) and resuspended as above. The EMSA reactions for both analyses were carried out as above in a volume of 100 µl with 30 fmol of probe. Bound and unbound probe was visualized by autoradiography of the gel, and the bands were excised, electrophoresed onto activated NA-45 membrane (Schleicher & Schuell, Keene, NH), and eluted according to the manufacturer’s protocol. Ten micrograms of yeast tRNA were added to the eluate followed by three extractions with an equal volume of 1:1 phenol-chloroform and ethanol precipitation. Cleavage was carried out by resuspension of the dried pellet in 100 µl of 1 M piperidine and incubation at 90 C for 30 min. The cleaved probe was then precipitated by the addition of 10 volumes of butanol and pelleted. The pellet was resuspended in 100 µl of water and reprecipitated with butanol, washed with 100% ethanol, and dried in vacuo. Products were quantitated by measurement of Cerenkov radiation and resuspended in a buffer containing 80% formamide, 1 mM EDTA, such that bound and unbound probe cleavage products were at equivalent concentration. The cleavage pattern was visualized by electrophoresis on 12% acrylamide-N,N' methylene bis-acrylamide (40:2) gels, drying, and autoradiography.

Cell Culture and Transfection Assays
The GT1–7 clone of GT1 cells (5), NIH/3T3, {alpha}T3 (40), CATH.a (41), F9, IMR-32, and JEG3 cells were maintained in DMEM (GIBCO/BRL, Gaithersburg, MD) supplemented with 10% FBS, 4.5 mg/ml glucose, 100 µ/ml of penicillin, and 0.1 mg/ml streptomycin in a humidified atmosphere of 5% CO2. The F9 cells were differentiated into visceral endoderm by aggregation and addition of 2.10-7 M retinoic acid as previously described (42).

Transient transfection assays were performed as previously described (11). Cells were transfected by the calcium phosphate method (43) for 12–16 h, washed twice with PBS, and incubated in fresh medium for a total of 48 h. Cells were harvested by scraping into a buffer of 150 mM NaCl, 1 mM EDTA, and 40 mM Tris-Cl (pH 7.4) at 25 C. Harvested cells were extracted by pelleting and resuspension in 100 µl of 250 mM Tris-Cl (pH 7.8) at 25 C followed by subjection to three cycles of freeze/thawing (44). Alternatively, cells were lysed in a buffer of 100 mM potassium phosphate (pH 8.0) at 25 C, 0.2% Triton X-100. Cell extracts were clarified by centrifugation for 5 min in an Eppendorf 5415C centrifuge and assayed immediately for luciferase activity (Analytical Luminescence, San Diego, CA) and ß-galactosidase activity (Tropix, Bedford, MA) using an AutoLumat 953 or MicroLumat 96P luminometer (EG&G Berthold, Gaithersburg, MD), or for CAT activity using a modified organic phase extraction method (45, 46). Results are reported as a mean of at least three experiments corrected for the activity of the cotransfected internal control. Error is reported as SEM.


    ACKNOWLEDGMENTS
 
We thank Simon Lee, Teri Banks, and Brian Powl for excellent technical assistance. We also thank Adrienne Harris, Shelly Nelson, and Kerry Barnhart for thoughtful discussion and suggestions.


    FOOTNOTES
 
Address requests for reprints to: Mark A. Lawson, Department of Reproductive Medicine, 0674, University of California, San Diego, 9500 Gilman Drive, La Jolla, California 92093-0674.

M.A.L. is supported by NIH Grant R03 DK-52284. P.L.M. is supported by Grant NIH R01 DK-44838.

Received for publication June 27, 1997. Revision received October 17, 1997. Accepted for publication December 15, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Silverman RC, Silverman AJ, Gibson MJ 1989 Identification of gonadotropin releasing hormone (GnRH) neurons projecting to the median eminence from third ventricular preoptic area grafts in hypogonadal mice. Brain Res 501:260–268[CrossRef][Medline]
  2. Wray S, Grant P, Gainer H 1989 Evidence that cells expressing luteinizing hormone-releasing hormone mRNA in the mouse are derived from progenitor cells in the olfactory placode. Proc Natl Acad Sci USA 86:8132–8136[Abstract/Free Full Text]
  3. Schwanzel-Fukuda M, Pfaff DW 1989 Origin of luteinizing hormone-releasing hormone neurons. Nature 338:161–164[CrossRef][Medline]
  4. Clark ME, Mellon PL 1995 The POU homeodomain transcription factor Oct-1 is essential for activity of the gonadotropin-releasing hormone neuron-specific enhancer. Mol Cell Biol 15:6169–6177[Abstract]
  5. Mellon PL, Windle JJ, Goldsmith P, Pedula C, Roberts J, Weiner RI 1990 Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis. Neuron 5:1–10[CrossRef][Medline]
  6. Mellon PL, Eraly SA, Belsham DD, Lawson MA, Clark ME, Whyte DB, Windle JJ 1995 An immortal cell culture model of hypothalamic gonadotropin-releasing hormone neurons. Methods: A Companion to Methods in Enzymology 7:303–310
  7. Whyte DB, Lawson MA, Belsham DD, Eraly SA, Bond CT, Adelman JP, Mellon PL 1995 A neuron-specific enhancer targets expression of the gonadotropin-releasing hormone gene to hypothalamic neurosecretory neurons. Mol Endocrinol 9:467–477[Abstract]
  8. Eraly SA, Mellon PL 1995 Regulation of GnRH transcription by protein kinase C is mediated by evolutionarily conserved, promoter-proximal elements. Mol Endocrinol 9:848–859[Abstract]
  9. Belsham DD, Wetsel WC, Mellon PL 1996 NMDA and nitric oxide act through the cGMP signal transduction pathway to repress hypothalamic gonadotropin-releasing hormone gene expression. EMBO J 15:538–547[Medline]
  10. Wetsel WC, Eraly SA, Whyte DB, Mellon PL 1993 Regulation of gonadotropin-releasing hormone by protein kinases A and C in immortalized hypothalamic neurons. Endocrinology 132:2360–2370[Abstract]
  11. Lawson MA, Whyte DB, Mellon PL 1996 GATA factors are essential for activity of the neuron-specific enhancer of the gonadotropin-releasing hormone gene. Mol Cell Biol 16:3596–3605[Abstract]
  12. Tumilowicz JJ, Nichols WW, Cholon JJ, Greene AE 1970 Definition of a continuous human cell line derived from neuroblastoma. Cancer Res 30:2110–2118[Abstract/Free Full Text]
  13. Kohler PO, Bridson WE 1971 Isolation of hormone-producing clonal lines of human choriocarcinoma. J Clin Endocrinol 32:683–687[Medline]
  14. Wilson DB, Dorfman DM, Orkin SH 1990 A nonerythroid GATA-binding protein is required for function of the human preproendothelin-1 promoter in endothelial cells. Mol Cell Biol 10:4854–4862[Abstract/Free Full Text]
  15. Steger DJ, Büscher M, Hecht JH, Mellon PL 1993 Coordinate control of the {alpha}- and ß-subunit genes of human chorionic gonadotropin by trophoblast-specific element binding protein, TSEB. Mol Endocrinol 7:1579–1588[Abstract]
  16. Arceci RJ, King AAJ, Simon MC, Orkin SH, Wilson DB 1993 Mouse GATA-4: a retinoic acid-inducible GATA-binding transcription factor expressed in endodermally derived tissues and heart. Mol Cell Biol 13:2235–2246[Abstract/Free Full Text]
  17. Lee M-E, Temizer DH, Clifford JA, Quertermous T 1991 Cloning of the GATA-binding protein that regulates endothelin-1 gene expression in endothelial cells. J Biol Chem 266:16188–16192[Abstract/Free Full Text]
  18. Martin DIK, Orkin SH 1990 Transcriptional activation and DNA binding by the erythroid factor GF-1/NF-E1/Eryf 1. Genes Dev 4:1886–1898[Abstract/Free Full Text]
  19. Tsai S-F, Martin DI, Zon LI, D’Andrea AD, Wong GG, Orkin SH 1989 Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells. Nature 339:446–451[CrossRef][Medline]
  20. Tsai S-F, Strauss E, Orkin SH 1991 Functional analysis and in vivo footprinting implicate the erythroid transcription factor GATA-1 as a positive regulator of its own promoter. Genes Dev 5:919–931[Abstract/Free Full Text]
  21. Quandt K, Frech K, Karas H, Wingender E, Werner T 1995 MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide consensus data. Nucleic Acids Res 23:4878–4884[Abstract/Free Full Text]
  22. Merika M, Orkin SH 1993 DNA-binding specificity of GATA family transcription factors. Mol Cell Biol 13:3999–4010[Abstract/Free Full Text]
  23. Ip HS, Wilson DB, Heikinheimo M, Tang Z, Ting C-N, Simon MC, Leiden JM, Parmacek S 1994 The GATA-4 transcription factor transactivates the cardiac muscle-specific troponin C promoter-enhancer in nonmuscle cells. Mol Cell Biol 14:7517–7526[Abstract/Free Full Text]
  24. Molkentin JD, Kalvakolanu DV, Markham BE 1994 Transcription factor GATA-4 regulates cardiac muscle-specific expression of the myosin heavy-chain gene. Mol Cell Biol 14:4947–4957[Abstract/Free Full Text]
  25. Morrisey EE, Ip HS, Lu MM, Parmacek MS 1996 GATA-6: A zinc finger transcription factor that is expressed in multiple cell lineages derived from lateral mesoderm. Dev Biol 177:309–322[CrossRef][Medline]
  26. Ko LJ, Engel D 1993 DNA-binding specificities of the GATA transcription factor family. Mol Cell Biol 13:4011–4022[Abstract/Free Full Text]
  27. Minie M, Kimura T, Felsenfeld G 1992 The developmental switch in embryonic {rho}-globin expression is correlated with erythroid lineage-specific differences in transcription factor levels. Development 115:1149–1164[Abstract]
  28. Leonard MW, Lim KC, Engel JD 1993 Expression of the chicken GATA factor family during early erythroid development and differentiation. Development 119:519–531[Abstract]
  29. Whitelaw E, Tsai S-F, Hogben P, Orkin SH 1990 Regulated expression of globin chains and the erythroid transcription factor GATA-1 during erythropoiesis in the developing mouse. Mol Cell Biol 10:6596–6606[Abstract/Free Full Text]
  30. Chang T-J, Cher BM, Waxman S, Sher W 1993 Inhibition of mouse GATA-1 function by the glucocorticoid receptor: possible mechanism of steroid inhibition of erythroleukemia cell differentiation. Mol Endocrinol 7:528–542[Abstract]
  31. Rahuel C, Vinit M-A, Lemarchandel V, Cartron J-P, Romeo P-H 1992 Erythroid-specific activity of the glycophorin B promoter requires GATA-1 mediated displacement of a repressor. EMBO J 11:4095–4102[Medline]
  32. Schwanzel-Fukuda M, Jorgenson KL, Bergen HT, Weesner GD, Pfaff DW 1992 Biology of normal luteinizing hormone-releasing hormone neurons during and after their migration from olfactory placode. Endocr Rev 13:623–634[CrossRef][Medline]
  33. Heikenheimo M, Scandrett JM, Wilson DB 1994 Localization of transcription factor GATA-4 to regions of the mouse embryo involved in cardiac development. Dev Biol 164:361–373[CrossRef][Medline]
  34. Inouye S, Inouye M 1987 Oligonucleotide-directed site-specific mutagenesis using double-stranded plasmid DNA. In: Narang SA (ed) Synthesis and Applications of DNA and RNA. Academic Press, New York, pp 181–206
  35. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K 1987 Current Protocols in Molecular Biology. John Wiley & Sons, New York
  36. Luckow B, Schütz G 1987 CAT constructions with multiple unique restriction sites for the analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res 15:5490[Free Full Text]
  37. Lee KAW, Bindereif A, Green MR 1988 A small-scale procedure for preparation of nuclear extracts that support efficient transcription and pre-mRNA splicing. Gene Anal Technol 5:22–31
  38. Siebenlist U, Gilbert W 1980 Contacts between E. coli RNA polymerase and an early promoter of phage T7. Proc Natl Acad Sci USA 77:122–126[Abstract/Free Full Text]
  39. Brunelle A, Schleif RF 1987 Missing contact probing of DNA protein interactions. Proc Natl Acad Sci USA 84:6673–6676[Abstract/Free Full Text]
  40. Windle JJ, Weiner RI, Mellon PL 1990 Cell lines of the pituitary gonadotrope lineage derived by targeted oncogenesis in transgenic mice. Mol Endocrinol 4:597–603[CrossRef][Medline]
  41. Suri C, Fung BP, Tischler AS, Chikaraishi DM 1993 Catecholaminergic cell lines from the brain and adrenal glands of tyrosine hydroxylase-SV40 T antigen transgenic mice. J Neurosci 13:1280–1291[Abstract]
  42. Darrow AL, Rickles RJ, Strickland S 1990 Maintenance and use of F9 teratocarcinoma cells. Methods Enzymol 190:110–117[CrossRef][Medline]
  43. Graham FL, van der Eb AJ 1973 A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52:456–467[CrossRef][Medline]
  44. Gorman C 1985 High efficiency gene transfer into mammalian cells. In: Glover DM (ed) DNA Cloning: A Practical Approach. IRL Press, Oxford, U.K., vol II:143–190
  45. Seed B, Sheen JY 1988 A simple phase-extraction assay for chloramphenicol acyltransferase activity. Gene 67:271–277[CrossRef][Medline]
  46. Crabb DW, Dixon JE 1987 A method for increasing the sensitivity of chloramphenicol acetyltransferase assays in extracts of transfected cultured cells. Anal Biochem 163:88–92[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
Q. Tang, M. Mazur, and P. L. Mellon
The Protein Kinase C Pathway Acts through Multiple Transcription Factors to Repress Gonadotropin-Releasing Hormone Gene Expression in Hypothalamic GT1-7 Neuronal Cells
Mol. Endocrinol., November 1, 2005; 19(11): 2769 - 2779.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. L. Sedlmeyer, C. L. Pearce, J. A. Trueman, J. L. Butler, T. Bersaglieri, A. P. Read, P. E. Clayton, L. N. Kolonel, B. E. Henderson, J. N. Hirschhorn, et al.
Determination of Sequence Variation and Haplotype Structure for the Gonadotropin-Releasing Hormone (GnRH) and GnRH Receptor Genes: Investigation of Role in Pubertal Timing
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1091 - 1099.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Rave-Harel, M. L. Givens, S. B. Nelson, H. A. Duong, D. Coss, M. E. Clark, S. B. Hall, M. P. Kamps, and P. L. Mellon
TALE Homeodomain Proteins Regulate Gonadotropin-releasing Hormone Gene Expression Independently and via Interactions with Oct-1
J. Biol. Chem., July 16, 2004; 279(29): 30287 - 30297.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. G. Kelley, M. L. Givens, N. Rave-Harel, S. B. Nelson, S. Anderson, and P. L. Mellon
Neuron-Restricted Expression of the Rat Gonadotropin-Releasing Hormone Gene Is Conferred by a Cell-Specific Protein Complex that Binds Repeated CAATT Elements
Mol. Endocrinol., November 1, 2002; 16(11): 2413 - 2425.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. H. Kim, A. Wolfe, G. R. Smith, S. A. Tobet, and S. Radovick
Promoter Sequences Targeting Tissue-specific Gene Expression of Hypothalamic and Ovarian Gonadotropin-releasing Hormone in Vivo
J. Biol. Chem., February 8, 2002; 277(7): 5194 - 5202.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. P. E. Laitinen, M. Anttonen, I. Ketola, D. B. Wilson, O. Ritvos, R. Butzow, and M. Heikinheimo
Transcription Factors GATA-4 and GATA-6 and a GATA Family Cofactor, FOG-2, Are Expressed in Human Ovary and Sex Cord-Derived Ovarian Tumors
J. Clin. Endocrinol. Metab., September 1, 2000; 85(9): 3476 - 3483.
[Abstract] [Full Text]