Molecular Endocrinology 12 (3): 364-377
Copyright © 1998 by The Endocrine Society
Multiple Factors Interacting at the GATA Sites of the Gonadotropin-Releasing Hormone Neuron-Specific Enhancer Regulate Gene Expression
Mark A. Lawson,
Abigail R. Buhain,
Jocelyn C. Jovenal and
Pamela L. Mellon
Departments of Reproductive Medicine (M.A.L., A.R.B., J.C.J.,
P.L.M.) and Neuroscience (P.L.M.) Center for Molecular Genetics
University of California, San Diego La Jolla, California
92093-0674
 |
ABSTRACT
|
|---|
Neuron-specific expression of the GnRH gene is
dependent on an upstream multicomponent enhancer. This enhancer is
functional in a small population of GnRH-producing hypothalamic neurons
which, through the secretion of GnRH, mediates central nervous system
control of reproductive function. GnRH enhancer function requires
activation by the GATA family of transcription factors that act through
tandem consensus GATA-binding motifs, GATA-A and GATA-B. Here we show
that two newly identified DNA-binding factors, termed GBF-A1/A2
and GBF-B1, bind the GnRH enhancer at sites overlapping the GATA
factor-binding motifs. In vitro bindings of GATA,
GBF-A1/A2, and GBF-B1 to the GnRH enhancer sequences are independent.
Specific mutation of either the consensus GATA motif or the GBF-B1 site
of GATA-B does not alter binding of the overlapping factor in
vitro. Utilizing a GnRH-expressing neuronal cell line as a model
system, we show by transient transfection that GBF-B1 is necessary for
enhancer activity and independently activates the GnRH promoter.
Transactivation of the GnRH enhancer in GT1 cells and in NIH 3T3 cells
by GATA-4 is modulated by GBF-B1 binding, suggesting GBF-B1 interferes
with GATA factor binding through a steric mechanism.
 |
INTRODUCTION
|
|---|
Terminal differentiation of developing cell lineages requires the
expression of gene products that manifest specialized cellular
function. A fundamental aspect of the regulation of differentiated
cellular function is the transcriptional activation of the
participating genes. Thus, it is essential to determine the
transcriptional mechanisms regulating cell type-restricted gene
expression to understand the development and maintenance of
differentiated cellular phenotypes.
The highly specialized GnRH-secreting neurons of the mammalian
hypothalamus mediate central nervous system (CNS) control of the
endocrine axis regulating reproductive function (1). The population of
GnRH-producing neurons in the CNS is estimated to consist of less than
800 cells and is distributed throughout the medial preoptic area and
the anterior hypothalamus (2). The GnRH neurons are unique in that they
migrate to the hypothalamus from the olfactory placode, where they
arise about day 11 post coitus in the developing mouse (3). Although
the expression of GnRH, the principal marker of GnRH neuron
differentiation, has been the subject of much study, little is
understood of the molecular mechanisms directing GnRH neuron
differentiation (4). Understanding the transcriptional mechanisms
regulating neuron-specific expression of the GnRH gene will therefore
provide valuable insight into the differentiation of this unique
population of hypothalamic neurons.
Using a cultured cell model system of the rare GnRH neurons, GT1 cells
(5, 6), we have identified a neuron-specific enhancer in the rat GnRH
gene which, in conjunction with the 173-bp promoter, recapitulates the
cell type-specific expression of the GnRH gene directed by a
full-length 3-kb 5'-regulatory region (7). Transient transfection
assays of reporter plasmids bearing both the GnRH enhancer and promoter
or the GnRH enhancer and a heterologous promoter demonstrated that
activity was limited to GT1 cells. No significant enhancer activity was
demonstrated in other neuronal and nonneuronal cell types. Sites of
temporal regulation of GnRH gene expression in response to activation
of second messenger signaling pathways have also been identified in
both the promoter and enhancer regions (8, 9, 10). It is therefore likely
that the principal cis-acting DNA elements regulating GnRH
gene expression are contained within the enhancer and promoter
regions.
Analysis of the GnRH gene enhancer by deoxyribonuclease I (DNase I)
protection assay demonstrated multiple regions bound by GT1 cell
nuclear proteins. Mutational analysis of these regions has shown that
several regions are important in conferring full activity to the GnRH
enhancer, indicating that the GnRH enhancer is composed of multiple
regulatory elements (7). Two consensus motifs recognized by the GATA
family of zinc-finger DNA-binding proteins, termed GATA-A and GATA-B,
are present in the enhancer. The GATA-B element was demonstrated to be
important for full enhancer activity (11). The (A/T)GATA(A/G) sequence
is bound by a class of tissue-restricted zinc-finger proteins termed
GATA factors. Although both GATA-2 and GATA-4 mRNAs can be detected in
GT1 cells, only GATA-4 can be demonstrated to interact with the GnRH
GATA-binding motifs (11). Moreover, transient transfection assays of
GnRH enhancer-containing reporter gene plasmids into GT1 cells with
cotransfected dominant-negative GATA-3 demonstrated that GATA factors
regulate GnRH gene expression.
In addition to GATA factors, other complexes were identified, with
oligonucleotide probes representing the extended sequences containing
both GnRH enhancer GATA-binding motifs (11). The contribution of these
non-GATA factors to GnRH enhancer activity was not made clear by these
previous studies. Here we report that the factors forming these
alternative non-GATA complexes recognize sequences in the GnRH enhancer
that overlap with the GATA-binding sites and are present in a wide
variety of cell types. Further, we demonstrate that one of these
factors is necessary for GnRH enhancer activity and that its presence
alters the ability of GATA factors to activate transcription through
the GnRH enhancer. The interaction of multiple factors at a single site
in the GnRH enhancer contributes additional complexity to enhancer
function and may participate in determining transcriptional specificity
of the GnRH gene in a highly select population of neurons.
 |
RESULTS
|
|---|
The Factors Binding the GnRH Enhancer GATA Motifs Are Present in
Multiple Cell Lines
The GATA factor-binding sequences in the GnRH enhancer occur in
regions previously shown to be protected by GT1 cell nuclear proteins
in a DNase I protection assay (Fig. 1A
).
In addition, oligonucleotide probes representing extended sequences
surrounding the GnRH enhancer GATA-binding motifs (GATA-A and GATA-B in
Fig. 1B
) were found to bind additional factors that were not GATA
family members. This was demonstrated by the inability of a control
GATA-binding oligonucleotide probe to interfere with formation of the
unique complexes in an electrophoretic mobility shift assay (EMSA) or
by the lack of interaction with antiserum directed against GATA-2 or
GATA-4, the two GATA family members identified in GT1 cells (11). To
determine whether the non-GATA factors binding the GnRH enhancer at the
GATA-A and GATA-B sites are unique to GT1 cells and/or contribute to
GnRH gene expression, we investigated the cell type distribution of the
additional binding factors (Fig. 2
).
Using oligonucleotide probes representing the GnRH enhancer GATA-A and
GATA-B regions (Fig. 1B
), EMSAs were performed using crude nuclear
extracts prepared from the hypothalamic GnRH neuron cell line GT1, the
fibroblast cell line NIH/3T3, the pituitary gonadotrope cell line
T3, the catecholaminergic CNS neuronal cell line CATH.a, and the
teratocarcinoma cell line F9 differentiated into visceral endoderm. All
of these cell lines are of murine origin. In addition, extracts were
prepared from the human peripheral neuronal cell line IMR-32 (12) and
the human placental trophoblast-derived cell line JEG-3 (13). The
A1 and A2 complexes formed with the GATA-A probe and GT1 cell nuclear
extract are also detected in reactions using the other murine-derived
cell lines (Fig. 2
, lanes 15). Nuclear proteins isolated from the
human cell lines formed a similar complex to A2 but did not show strong
complex formation similar to A1 (Fig. 2
, lanes 6 and 7), suggesting
that the factor or factors forming the A1 complex may differ
significantly between mouse and human. The EMSAs performed with both
the murine- and human-derived cell lines and the GnRH GATA-B probe
indicated that the B1 complex is common to all the cell lines tested
(Fig. 2
, lanes 814). However, the GATA-specific complex, which has
been previously determined to contain GATA-4 or a related factor in GT1
cells (11), is not equivalent between the murine (Fig. 2
, lanes 812)
and human cell types (Fig. 2
, lanes 13 and 14). All of the murine cell
lines except CATH.a have been previously determined to contain either
GATA-2 or a GATA-4/5/6 subfamily member (11, 14, 15, 16). The human
neuronal cell line IMR-32 has not been characterized with respect to
GATA factor complement. The JEG-3 cell line has been shown to contain
GATA-2 (17), and GATA-3 (15). It is therefore likely that all of the
complexes that migrate similarly to the B2 complex contain a
GATA-binding factor. These results suggest the factors forming the A1,
A2, and B1 complexes with the GnRH GATA-A and -B probes are either
widely distributed or are members of a broad family of DNA-binding
proteins.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 1. Sequence of the Rat GnRH Enhancer Containing the
GATA-A and GATA-B Sites
A, Regions footprinted by GT17 cell nuclear proteins are
boxed. The canonical GATA-binding motif (A/T)GATA(A/G)
in each site (boldface type) and the direction of the
binding sequence (arrow) are indicated. The
numbers indicate base pair positions relative to the
transcriptional start of the rat GnRH gene. B, The oligonucleotides
used as EMSA probes and for site-directed mutagenesis of the enhancer
are also shown with the GATA motif indicated as described above. The
asterisks indicate mutated bases with respect to the
wild-type sequence. Oligonucleotides containing mutations are
designated by the sequence replacing the consensus motif of either the
GATA-A or GATA-B site or that replacing the binding sites for GBF-A1/A2
or GBF-B1.
|
|

View larger version (76K):
[in this window]
[in a new window]
|
Figure 2. Cell Type Distribution of Complexes Formed by
Oligonucleotide Probes Representing the GATA-A and GATA-B Sites of the
GnRH Enhancer
GATA-A (lanes 17) and GATA-B (lanes 814) oligonucleotide probes
described in Fig. 1 were used in an EMSA with nuclear proteins isolated
from the following cell types: GT1 mouse hypothalamic GnRH neuron cell
line (lanes 1 and 8), NIH 3T3 mouse fibroblast cell line (lanes 2 and
9), T3 mouse pituitary gonadotrope cell line (lanes 3 and 10),
CATH.a mouse neuronal cell line (lanes 4 and 11), F9 mouse
teratocarcinoma cell line (lanes 5 and 12), IMR-32 human peripheral
neuronal cell line (lanes 6 and 13), and JEG-3 human placental
trophoblast cell line (lanes 7 and 14). The A1- and A2-specific
complexes formed by the GATA-A probe and the B1- and GATA-specific
complexes formed by the GATA-B probe are indicated in the panel.
|
|
The A1- and A2-Binding Factors Recognize a Unique Sequence
Overlapping the GATA-A Site
To determine the binding sequence recognized by the factors
forming the A1 and A2 complexes, methylation interference analysis of
the sequences necessary for formation of the A1 and A2 complexes was
performed with GT1 cell nuclear extract. The cleavage products obtained
are displayed in Fig. 3A
. The pattern of
interference obtained from the analysis of the A1 complex reveals a
binding sequence 5' to and overlapping with the consensus GATA motif.
This pattern was distinct from that reported for interference by known
GATA factors (14, 18, 19, 20). Identical data were obtained upon analysis
of the A2 complex (data not shown). The sequence recognized by the
factors forming the A1 and A2 complexes does not show significant
similarity to sites recognized by other known DNA-binding proteins as
determined by search of the TRANSFAC database (21); furthermore,
oligonucleotides representing sites determined by the database to be
similar to the GnRH GATA-A site did not form equivalent complexes in an
EMSA nor were they capable of eliminating A1 and A2 complex formation
when present in high molar excess with GATA-A probe (data not shown).
The exact identity of the A1 and A2 factors remains unknown. Because
both complexes recognize the same sequence it is possible that the A1
and A2 factors are differently modified versions of the same factor or
closely related members of the same family of DNA-binding proteins.
Alternatively, the A1 and A2 factors may be heteromeric complexes of
differing composition. The A1/A2-binding factors will be referred to as
GnRH enhancer binding factor A1/A2, or GBF-A1/A2.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 3. Methylation Interference and Missing-Contact
Probing of Complexes Formed by GT17 Cell Nuclear Protein and the GnRH
Enhancer GATA-A and GATA-B Sites
A, Methylation interference pattern of the GATA-A oligonucleotide probe
described in Fig. 1 bound by the A1 complex and from unbound probe (B
and F, respectively). The sequence of the top and bottom strands
appears beside the respective cleavage products. The canonical
GATA-binding motif appears boxed in each sequence. The
lines indicate bases showing interference in the A1
complex. Identical data were obtained with probe isolated from the A2 complex (data
not shown). B, Pattern of contacted bases in the B1 complex and in
unbound probe (B and F, respectively) as determined by missing-contact
probing of the GATA-B site using the oligonucleotide probe described in
Fig. 1 . The sequence of the top and bottom strands appears beside the
respective cleavage products. The canonical GATA-binding motif appears
boxed. The lines indicate bases requiring
contact in the B1 complex.
|
|
The B1-Binding Factor Recognizes a Unique Sequence
Overlapping the GATA-B Site
Previous analysis of the GnRH enhancer GATA-B site by EMSA showed
that the B1 complex was specific to the GATA-B oligonucleotide probe
(11). To determine the exact sequence bound by the B1 complex,
methylation interference analysis of GATA-B probe binding was
conducted. No significant interference of B1 complex binding by probe
methylation was detected. However, analysis of B1 complex binding by
missing-contact probing using depyrimidated GATA-B probe demonstrated a
strong dependence for binding on sequences overlapping with the
GATA-binding motif (Fig. 3B
). The TRANSFAC database did not identify
any known factors that may recognize the extended site bound by the
B1-binding activity, suggesting that the B1 complex is formed by an
undescribed DNA-binding factor. This factor will be referred to as GnRH
enhancer binding factor B1, or GBF-B1.
GBF-A1/A2 Does Not Influence GATA Factor Binding
Interaction of a GATA-binding factor with the GATA-A site has not
been demonstrated in vitro. To determine whether the
presence of GBF-A1/A2 prevents GATA factor binding the GATA-A site, or
that visualization of a GATA-specific complex is occluded by
comigration of a GBF-A1/A2 complex, double-stranded oligonucleotide
probes representing the GATA-A site with specific mutations exclusively
in the consensus GATA-binding sequence (GACC-A, Fig. 1B
) or in the
GBF-A1/A2-binding sequence (TTAA-A, Fig. 1B
) were generated. These
radiolabeled probes were used in an EMSA with GT1 cell nuclear
proteins. In comparison to the formation of the A1/A2 complex by the
wild-type GATA-A oligonucleotide probe (Fig. 4A
, lane 1), the GACC-A probe formed less
A1/A2 complex (Fig. 4A
, lane 2). This suggests that GBF-A1/A2 binding
is influenced by sequences encompassing the entire GATA-binding site in
addition to those indicated by the methylation interference assay
above. The TTAA-A probe could not form any A1/A2 complex but did form a
new complex of slightly greater mobility than the A1 complex (Fig. 4A
, lane 3). This new complex did not contain a GATA factor as determined
by competition with the PPET GATA consensus oligonucleotide (not
shown). Neither the GACC-A nor the TTAA-A oligonucleotide could
eliminate GBF-A1/A2 complex formation by radiolabeled GATA-A probe
(Fig. 4A
, lanes 6 and 7), providing further evidence that GBF-A1/A2
requires sequences encompassing the GATA-binding sequence. In agreement
with the determination of the GBF-A1/A2-binding sequences, an
oligonucleotide probe representing the GATA factor-binding site of the
human preproendothelin-1 gene (PPET) was unable to eliminate GBF-A1/A2
binding when present in high molar excess in an EMSA (Fig. 4A
, lane 8).
This indicates that the GBF-A1/A2 requires sequences other than GATA
for recognition of the GATA-A site of the GnRH enhancer.

View larger version (49K):
[in this window]
[in a new window]
|
Figure 4. Specific Mutation of the GATA- or GBF-Binding Sites
Alters GBF and GATA Factor Interaction Independently
A, EMSA analysis of complexes formed with GT1 cell nuclear protein by
wild-type and mutant GATA-A site oligonucleotide probes (lanes 13).
EMSA analysis of GBF-A1/A2 complex formation on the GATA-A probe alone
or in the presence of 100-fold molar excess of unlabeled wild-type or
mutant GATA-A oligonucleotide probes and an oligonucleotide probe
representing the GATA-binding site of the human PPET gene (lanes 48).
EMSA analysis of the PPET probe alone or in the presence of 100-fold
molar excess of the PPET probe and wild-type or mutant GATA-A probe
(lanes 913). B, EMSA analysis of complexes formed with GT1 cell
nuclear protein and wild-type and mutant GATA-B probes (lanes 13).
EMSA analysis of GBF-B1 complex formation by the GATA-B probe alone or
in the presence of 100-fold molar excess of unlabeled wild-type or
mutant GATA-B oligonucleotide probe and the PPET probe (lanes 48).
EMSA analysis of the PPET probe alone or in the presence of 100-fold
molar excess of the PPET probe and wild-type or mutant GATA-B probe
(lanes 913). C, EMSA analysis of altered GATA-factor interaction by
mutant GATA-A and GATA-B oligonucleotide probes. EMSA reaction
incubated in the presence of purified nonimmune rabbit IgG (lanes 14)
or IgG purified from rabbit antiserum directed against glutathione
S-transferase-linked mouse GATA-4 (lanes 512). Reactions were
incubated in the presence of nuclear proteins isolated from GT1 cells
(lanes 18) or from GT1 cells overexpressing mouse GATA-4 (lanes
912). Oligonucleotides used as probes or as competitors (COMPET.) of
complex formation are described in the legend to Fig. 1 . The PPET
oligonucleotide probe is described in Materials and
Methods. -, No competitor. Arrow, Complex super
shifted by anti-GATA-4 IgG.
|
|
To determine the effects of the mutations on GATA factor interaction,
the PPET oligonucleotide probe described above was used in EMSAs with
GT1-cell nuclear proteins (Fig. 4A
, lane 9). Both the wild-type PPET
and GATA-A unlabeled oligonucleotide probes were capable of preventing
GATA factor complex formation when present in high molar excess with
radiolabeled PPET probe (Fig. 4A
, lanes 10 and 11, respectively). As
expected, inclusion of excess GACC-A oligonucleotide did not affect
GATA-specific complex formation by the PPET probe (Fig. 4A
, lane 12),
whereas inclusion of the TTAA-A oligonucleotide did (Fig. 4A
, lane 13).
These observations suggest that the GATA-A site represents a
low-affinity GATA-binding sequence that may interact with a GATA factor
when present at high concentration. It has been shown that only the GAT
portion of the canonical GATA-binding motif is strictly required for
in vitro binding of GATA factors to DNA (22). However, the
GATA-A site does not interact with a GATA factor efficiently in
vitro, and the presence of GBF-A1/A2 does not influence
GATA-factor interaction.
Both GATA and GBF-B1 Independently Bind the GATA-B Site
To verify that both GATA and GBF-B1 can be specifically eliminated
by mutations in their respective recognition sites, double-stranded
oligonucleotide probes representing the wild-type GATA-B sequence or
the GATA-B sequence containing mutations in either the GATA (GACC-B,
Fig. 1B
) or GBF-B1 (TCAG-B, Fig. 1B
) sites alone were included in EMSAs
with GT1 cell nuclear extract. In comparison to the wild-type GATA-B
probe (Fig. 4B
, lane 1), the GACC-B GATA mutant probe could only form
the B1 complex (Fig. 4B
, lane 2), indicating specific elimination of
GATA factor interaction. Conversely, the TCAG-B GBF-B1 mutant probe was
capable of only GATA factor complex formation (Fig. 4B
, lane 3),
indicating specific elimination of GBF-B1 binding. To further
demonstrate the exclusive elimination of either the GATA or B1 complex
formation by the GACC-B and TCAG-B mutations, EMSAs were performed with
radiolabeled GATA-B probe and either unlabeled GACC-B or TCAG-B probe
at high molar excess. Whereas the inclusion of excess unlabeled
wild-type GATA-B oligonucleotide eliminates formation of both the
GBF-B1- and GATA-specific complexes (Fig. 4B
, lanes 4 and 5), inclusion
of excess unlabeled GACC-B oligonucleotide eliminates only the B1
complex (Fig. 4B
, lane 6). This observation indicates that only GATA
factor interaction was altered by the GACC-B mutation. Conversely, the
inclusion of excess TCAG-B oligonucleotide eliminates only the
GATA-specific complex (Fig. 4B
, lane 7), indicating that only GBF-B1
interaction was affected by the TCAG-B mutation.
As a control for GATA factor-specific interaction of the wild-type
GATA-B probe, the PPET oligonucleotide probe was also included at high
molar excess in an EMSA with radiolabeled GATA-B probe. As shown in
Fig. 4B
, lane 8, only the formation of the GATA-specific complex was
affected by the presence of the PPET probe. Further, when the wild-type
GATA-B, the mutant GACC-B, or the mutant TCAG-B oligonucleotides are
included in excess in an EMSA with radiolabeled PPET probe (Fig. 4B
, lanes 1113), only the GACC-B mutant is affected in its ability to
eliminate formation of the GATA-specific complex (Fig. 4B
, lane 12).
These observations and the lack of any higher ordered complexes
affected by both the GBF-B1 and GATA-specific mutations suggest that
the factor or factors forming the GATA-specific and B1 complexes do not
require interaction with each other to bind the GnRH enhancer GATA-B
site. We therefore conclude that GBF-B1 and GATA bind independently to
the GATA-B site of the GnRH enhancer.
The GATA-A- and GATA-B-derived probes showed specific complexes of
increased intensity when mutated. The increased intensity of the TTAA-A
complex may be due to the increased presence of a GATA factor.
Supershift of the resultant GATA-specific complexes with purified
rabbit IgG directed against mouse GATA-4 (16, 23, 24, 25) was performed
with radiolabeled GATA-A, TTAA-A, GATA-B, or TCAG-B probe and with GT1
cell nuclear extract. In comparison to EMSAs treated with nonimmune
rabbit IgG (Fig. 4C
, lanes 14), it can be seen that the increase in
the TTAA-A-specific complex is not attributed to increased GATA factor
interaction. In contrast, the TCAG-B GATA-specific complex can be
entirely attributed to the presence of GATA-binding protein (Fig. 4C
, lanes 412). Additionally, we have been unable to detect a difference
in affinity of the TCAG-B probe for GATA binding in comparison to the
wild-type GATA-B sequence (data not shown). It is unlikely that the
TCAG-B mutation would result in increased affinity for GATA factors, as
the mutation occurs in the -2 position relative to the required GATA
sequence, and this position has been demonstrated to play no
significant role in GATA factor interaction with DNA (22, 26). We
conclude that the GATA-A site does not efficiently interact with a GATA
factor even in the absence of GBF-A1/A2 binding, but that the GATA-B
site retains the ability to interact with a GATA factor in the absence
of GBF-B1 binding.
Both GATA and GBF-B1 Are Necessary for GnRH Enhancer Activity
The above analysis of the GATA, GBF-A1/A2, and GBF-B1 DNA-binding
activities suggests that they act independently in conferring activity
to the GnRH enhancer. To determine the role of each factor in GnRH
enhancer activity, the GACC-A, TTAA-A, GACC-B, and TCAG-B
oligonucleotides were used to generate site-specific mutations in the
GnRH enhancer. The mutated enhancers were incorporated into the GnRH
reporter gene plasmid ENH-173 and subsequently transfected into GT1
cells. Activities of the mutant reporter plasmids were compared with
the wild-type ENH-173 reporter plasmid, and the results are summarized
in Fig. 5
. Mutation of the GATA-A-binding
site (GACC-A) results in an approximately 35% reduction of activity of
the enhancer, suggesting that in context of the entire enhancer the
GATA-A site may be functional. Mutation of the A1/A2-binding site alone
(TTAA-A) has no significant effect on enhancer activity. Mutation of
the GATA- or B1-binding site (GACC-B and TCAG-B, respectively) results
in a 65%75% decrease in activity of the enhancer. The lack of
observed increase in activity as a result of the TCAG-B mutation
further suggests that this mutation does not affect GATA factor
binding, but rather affects a separate, positive acting DNA-binding
activity. These data indicate that both GATA and GBF-B1 activate the
GnRH enhancer.

View larger version (57K):
[in this window]
[in a new window]
|
Figure 5. Effect of GATA- and GBF-Specific Mutations on GnRH
Enhancer Activity
Site-specific mutations of the GATA-A, GBF-A1/A2.GATA-B, or GBF-B1
sites of the GnRH enhancer were engineered in the CAT reporter plasmid
ENH-173 and transfected into GT17 cells along with a TK-luciferase
internal control plasmid. After 48 h of incubation, cells were
harvested and assayed for CAT and luciferase activity. The activity of
the wild-type GnRH enhancer-promoter plasmid ENH-173, normalized to the
activity of the cotransfected TK-luciferase internal control, was
arbitrarily set at 100. The values for the mutant plasmids are reported
normalized to the activity of cotransfected internal control and
relative to the value of ENH-173. The error bars
represent the SEM of at least three replicates.
Asterisks represent P < 0.05 by
Students t test.
|
|
GBF-B1 and GATA-4 Independently Activate the GnRH Promoter
The observation that GBF-B1 is necessary for full enhancer
activity suggests that it may activate in the absence of other
enhancer-binding factors. To test the ability of GATA and GBF-B1 to act
independently through the GATA-B site, reporter plasmids containing a
multimerized wild-type GATA-B site, the GATA-binding mutant (GACC-B),
or the GBF-B1-binding mutant (TCAG-B) upstream of the thymidine kinase
(TK) or GnRH promoter were engineered and subsequently transfected into
GT1 cells. All of the sites showed moderate 1.5- to 1.8-fold
stimulation of the heterologous TK promoter (Fig. 6A
) and strong 5- to 6-fold stimulation
of the GnRH promoter (Fig. 6B
). Mutation of either binding site did not
significantly affect activation of either promoter. These data support
the role of both factors as independent activators of GnRH gene
expression.

View larger version (41K):
[in this window]
[in a new window]
|
Figure 6. Effect of GATA-B Site Mutations on TK and GnRH
Promoter Activity
A, Luciferase reporter gene plasmids under the control of the TK
promoter alone (TK-LUC) or with addition of the multimerized wild-type
GATA-B (GATA-B4), GATA-specific mutant (GACC-B4), or GBF-B1-specific
mutant (TCAG-B4) binding sites engineered upstream of the promoter
sequences were transfected into GT1 cells. Transfections included a
TK-ß-galactosidase reporter plasmid as an internal control for
transfection efficiency. After 48 h of incubation, cells were
harvested and assayed for luciferase and ß-galactosidase activity.
The activity of the TK-LUC control, normalized to the activity of the
cotransfected internal control, was arbitrarily set at 100. The values
for the reporter plasmids bearing the additional wild-type and mutant
GATA- or GBF-B1-binding sites are reported normalized to the
cotransfected internal control and relative to the activity of TK-LUC.
Error bars represent the SEM of at least
seven replicates. Asterisks represent significant
difference of the means (P < 0.05) by the method
of Fisher. B, Luciferase reporter gene plasmids under the control of
the GnRH promoter alone (-173-LUC) or with addition of the
multimerized wild-type GATA-B (GATA-B4), GATA-specific mutant
(GACC-B4), or GBF-B1-specific mutant (TCAG-B4) binding sites inserted
upstream of the promoter sequences were transfected into GT1 cells.
Transfections included a TK-ß-galactosidase reporter plasmid as an
internal control for transfection efficiency. After 48 h of
incubation, cells were harvested and assayed for luciferase and
ß-galactosidase activity. The activity of the -173-LUC control,
normalized to the activity of the cotransfected internal control, was
arbitrarily set at 100. The values for the reporter plasmids bearing
the additional wild-type and mutant GATA- and GBF-B1-binding sites are
reported normalized to the cotransfected internal control and relative
to the activity of -173-LUC. Error bars represent the
SEM of at least four replicates. Asterisks
represent (P < 0.05) by the method of Fisher.
|
|
GBF-B1 Limits GATA Factor Interaction with the GATA-B Site
The above analysis of independent stimulation of TK and GnRH
promoter activity without additive or synergistic activation suggests
that GBF-B1 and GATA may mutually interfere with each other. To test
this, the reporter gene plasmids containing the multimerized wild-type
and mutant GATA-B sites were cotransfected into GT1 cells with a
plasmid expressing the cDNA encoding mouse GATA-4. Both the TK-LUC
(Fig. 7A
) and the -173-LUC (Fig. 7B
)
reporter plasmids containing the multimerized GATA-B site were
activated about 2.5-fold over reporter plasmid cotransfected with the
null expression plasmid. No significant increase in TK promoter
activity was observed with the reporter plasmid containing the GATA
site-specific mutation GACC (Fig. 7A
). Additionally, because the
internal control plasmid for this and all other analyses also bears a
TK promoter and an identical plasmid background, activation is not a
result of nonspecific stimulation of reporter activity. Previous
analysis of mutations that eliminate both GATA and GBF-B1 binding also
eliminate response to exogenously expressed GATA factors (11). An
approximately 50% decrease in GATA mutant GACC-B reporter activity was
observed in the presence of exogenously expressed mouse GATA-4 (Fig. 7B
). The promoter alone also exhibits some decrease in activity in the
presence of excess GATA-4 (Fig. 7B
). Most significantly, reporter
plasmids containing the GATA-B site bearing the B1-specific mutation
TCAG showed a 3.5- to 4.0-fold activation of the TK (Fig. 6B
) and GnRH
(Fig. 7B
) promoters, respectively, in the presence of exogenously
expressed GATA-4. The increased level of promoter activation observed
in reporter plasmids containing the B1-specific mutation suggests that
GBF-B1 interferes with GATA-factor activity at the GATA-B site. The
increase in GATA factor transactivation of the reporter plasmids is not
due to altered affinity for GATA factors by the TCAG mutation.
EMSAs using the PPET control oligonucleotide as probe and
increasing amounts of unlabeled PPET, GATA-B, or TCAG-B
oligonucleotides show that the TCAG-B mutation does not result in a
significant alteration of affinity for GATA binding (Fig. 7C
). This is
consistent with previous results indicating that the -2 site of the
GATA-binding sequence, which is the site of the TCAG-B mutation, has
little influence on GATA factor interaction (22, 26).

View larger version (21K):
[in this window]
[in a new window]
|
Figure 7. Effect of GATA-B Site Mutations on Transactivation
by GATA-4
TK-LUC reporter plasmids (A) or -173 LUC reporter plasmids (B)
containing the multimerized wild-type (GATA-B4), GATA-specific mutant
(GACC-B4), or GBF-B1-specific mutant (TCAG-B4) sites and a
TK-ß-galactosidase internal control plasmid were transfected into
GT17 cells with a null expression plasmid (-) or expression plasmid
bearing the cDNA encoding mouse GATA-4 (+). After 48 h of
incubation, cells were harvested and assayed for luciferase activity
and ß-galactosidase activity. The activity of the wild-type
GATA-B4 plasmid cotransfected with the null expression
plasmid, normalized to the activity of the internal control, was
arbitrarily set at 100. All other values are normalized to the activity
of the internal control and reported relative to the activity of the
GATA-B4 control. Error bars represent the
SEM of at least three replicates. Asterisk
represents significant difference (P < 0.05)
between GATA-4 induction of wild-type and the TCAG-B mutant reporter
plasmids as measured by two-factor ANOVA. C, EMSAs using GT17 cell
nuclear extract, radiolabeled PPET oligonucleotide as a probe, and
increasing amounts of unlabeled PPET, GATA-B, or TCAG-B oligonucleotide
were analyzed by densitometry. The amount of probe appearing in a
GATA-specific complex is reported as a percent of total input probe and
plotted with respect to amount of unlabeled competitor oligonucleotide
included in the reaction. Error bars represent the
SD of three independent measurements.
|
|
To confirm that GBF-B1 limits GATA-factor activation in the context of
the GnRH enhancer, the GATA- and B1-specific mutations of the GATA-B
site were incorporated into the reporter plasmid ENHTK. This reporter
was chosen to allow examination in NIH 3T3 cells, in which the GnRH
promoter is inactive. Reporter gene plasmids were cotransfected into
GT1 or NIH 3T3 cells with a GATA-4 expression plasmid or control null
expression plasmid. Activation of the ENHTK plasmid and B1-binding
mutant TCAG-B reporter plasmid relative to control cotransfection with
the null expression plasmid is shown in Fig. 8
. Cotransfection of the ENHTK reporter
plasmid with a mouse GATA-4 expression plasmid into GT1 cells (Fig. 8A
)
or NIH 3T3 cells (Fig. 8B
) resulted in an approximately 1.8-fold
increase in reporter activity, similar to previously reported results
(11). The activity of the GBF-B1-binding mutation TCAG-B was increased
approximately 3-fold in both GT1 cells and NIH 3T3 cells overexpressing
GATA-4. The increase in GATA factor-mediated activation of GnRH
enhancer activity in the absence of B1-binding activity demonstrates
that in the context of the GnRH enhancer, GBF-B1 modulates GATA factor
interaction with the GnRH enhancer.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 8. Effect of GATA-Specific and GBF-B1-Specific
Mutations of the GATA-B Site on Transactivation of the GnRH Enhancer by
GATA-4
The wild-type GnRH enhancer CAT reporter plasmid ENHTK or reporter
plasmids bearing GATA-specific (GACC-B) or GBF-B1-specific (TCAG-B)
mutations at the GATA-B site of the GnRH enhancer and the TK-LUC
internal control plasmid were cotransfected into GT17 cells (A) or
into NIH 3T3 cells (B) with a null expression plasmid (-) or with an
expression plasmid bearing the cDNA encoding mouse GATA-4 (+). After
48 h of incubation, cells were harvested and assayed for CAT and
luciferase activity. The activity of the wild-type ENHTK plasmid
cotransfected with the null expression plasmid, normalized to the
activity of the internal control, was arbitrarily set at 100. All other
values are reported normalized to the activity of the internal control
and relative to the ENH control. Error bars represent
the SEM of at least three replicates.
Asterisks represent significant difference
(P < 0.05) between GATA-4 induction of wild-type
and the TCAG-B mutant reporter plasmids by two-factor ANOVA of paired
experiments.
|
|
 |
DISCUSSION
|
|---|
The GnRH neuron-specific enhancer is a complex regulatory region
composed of multiple protein-binding elements. We have previously shown
that two sites of the enhancer, termed GATA-A and GATA-B, contain
consensus motifs recognized by the GATA family of zinc-finger
DNA-binding proteins. However, detailed analysis of these sites has
shown that only one of the two, GATA-B, interacts with a GATA-binding
factor in vitro. The GATA-A site has not been demonstrated
to bind a GATA-factor in vitro, although some evidence for
GATA factor interaction in a transient transfection assay has been
presented (11). In addition to GATA factor interaction, at least two
other factors bind the GnRH enhancer at the GATA-A and GATA-B
sites. Here we show that these new factors, termed GBF-A1/A2 and
GBF-B1, bind the GnRH enhancer at the GATA-A and GATA-B sites,
respectively. These factors bind unique sequences that overlap the
consensus GATA-binding motifs, but show no strong similarity to sites
recognized by known DNA-binding proteins. Additionally, these factors
are present in a wide variety of cell types indicating that they may be
generally expressed or members of a widely expressed family of
factors.
The role of GBF-A1/A2 in expression of GnRH is as yet undefined. We
have clearly shown that any effect of GATA-A site mutation can be
attributed to the GATA consensus site, and not the GBF-A1/A2 site. The
GBF-A1/A2-binding site overlaps considerably with the consensus
GATA-binding motif, as evidenced by the weakened A1/A2 complex formed
by the GATA-specific mutant EMSA probe. However, mutation of the
GBF-A1/A2-binding site, which does not affect GATA factor interaction,
does not alter transactivation by overexpressed GATA-4 (M. A.
Lawson, unpublished observations). It is of interest that GBF-A1/A2
appears to be dispensable for GnRH gene expression. Previous results
from mutational analysis of the GnRH enhancer in which the entire
GATA-A site is altered (7), in addition to the more specific analysis
presented here, have failed to demonstrate a role for this factor in
GnRH gene expression. This inability to demonstrate a role for
GBF-A1/A2 may be due to functional redundancy in the GnRH enhancer. The
GnRH enhancer also shows evidence of functional redundancy in POU
homeodomain-binding sites. Although two strongly footprinted regions in
the enhancer flanking the GATA sites can be shown to bind the
transcription factor Oct-1, only one of these sites is necessary for
full enhancer activity (4). Alternatively, GBF-A1/A2 may perform a role
in GnRH gene expression not used by the cultured GnRH neuron cell line
used in these studies, but may be of greater significance in the
developmental precursor to the GnRH neuron or to
nonreplicating, fully differentiated GnRH neurons. Interestingly,
GATA-specific mutation of the GATA-A site does moderately affect
enhancer activity, suggesting that GATA factors may indeed act through
the GATA-A site in the context of the enhancer. This conclusion is
supported by previous data showing the necessity of mutating both
GATA-A and GATA-B to completely eliminate any response to exogenously
expressed GATA-factors (11). It has been suggested by others that GATA
factor action may indeed occur through sites demonstrating low affinity
for factor binding in vitro (26) or that regulation of
specific genes by GATA factors may occur through altered levels of
factors present in differentiating cells (27, 28, 29). Such a model of GATA
factor regulation of target genes may apply to the GATA-A site of the
GnRH enhancer.
The role of GBF-B1 in regulating GnRH gene expression is clearly
demonstrable. Both GATA and GBF-B1, in the context of the GnRH
enhancer, are necessary for full enhancer activity. Both factors are
also capable of activating the GnRH promoter or a heterologous
promoter independently. However, GBF-B1 exhibits the additional
property of interfering with GATA factor interaction, probably through
a simple steric hindrance mechanism. Both direct and indirect
modulation of GATA-factor activation by other DNA-binding factors has
been reported (30, 31). Here we report that the factor modulating GATA
transactivation of the GnRH enhancer is also necessary for full
enhancer activity. Further evidence of the positive action of GBF-B1
can be derived from the activity of the GACC-B mutant reporter in Fig. 7B
, wherein the lower levels of reporter plasmid used (one fifth that
in Fig. 6
) results in basal activity higher than that observed for the
wild-type control. The absence of any complex containing both GATA-4
and GBF-B1 bound to the GATA-B site in an EMSA even in the presence of
increased GATA-4 strongly supports the interpretation that only one of
these factors can occupy the GATA-B site.
GATA-binding factors may play a role in the differentiation of the GnRH
neuron. The expression pattern of GATA-1 in the developing mouse
erythropoietic system may prove to be an appropriate analogy for the
ontogeny of the GnRH neurons. Expression of GATA-1, an essential factor
in erythrocyte development, peaks at the onset of adult ß-hemoglobin
expression at about day 14 postcoitus and declines after the
establishment of ß-hemoglobin expression (29). This is thought to
indicate that increased GATA-1 expression potentiates differential gene
activation. In the developing mouse, embryonic expression of GATA-4 in
visceral and parietal endoderm (16) precedes by several days the
expression of GnRH, at day 11 postcoitus (3, 32). Therefore GATA-4
alone is not sufficient for targeting expression of GnRH to the
appropriate cell type. It has been shown that GATA-4 is highly
expressed in the developing mouse, including nasopharyngeal tissues,
which eventually give rise to GnRH neurons (33). Both GATA-4 and GATA-2
mRNAs are not highly expressed in the cultured GT1-cell GnRH neuron
cell line relative to levels found in the murine teratocarcinoma cell
line F9 and MEL cells (11). It is thought that the GT1 cell model
system represents the GnRH neuron at a highly differentiated state (6).
GATA factors may then play a role in the onset of GnRH gene expression,
as indicated by the activation of transcription by overexpressed
GATA-4, but other factors such as GBF-B1 may play a role in the
maintenance of GnRH gene expression in the absence of high levels of
GATA-4. Further studies examining the expression of GATA factors
and GnRH during neurogenesis in the olfactory placode of the
developing mouse will directly address this possibility. To date, none
of the enhancer-binding factors reported here or elsewhere (4) can be
designated as a GnRH neuron-specific factor. It is likely that a
combination of more widely expressed factors specify expression of the
GnRH gene to the appropriate neuron population. Such a model of
targeting gene expression supports the role of GBF-B1 in contributing
to the specificity of GnRH gene expression.
In summary, we have identified two factors, GBF-A1/A2 and GBF-B1,
that bind the neuron-specific GnRH enhancer at sites overlapping
consensus GATA factor-binding sites. One of these factors, GBF-B1, is
essential for full enhancer activity and modulates GATA factor-mediated
activation of GnRH gene transcription. The activity of the GnRH
enhancer is dependent on widely expressed transcription factors. The
contribution of GBF-B1 to GnRH enhancer activity provides additional
complexity to GnRH gene transcriptional regulation, thereby
contributing to the specificity of GnRH gene expression.
 |
MATERIALS AND METHODS
|
|---|
Plasmids
Construction of the chloramphenicol acetyl transferase (CAT)
gene reporter plasmid pSS<ML-173CAT, termed ENH-173, containing the
rat GnRH enhancer and 173-bp promoter, and the reporter plasmid
pSS<TKCAT, termed ENHTK, has been described (7). Site-directed
mutations in the enhancer sequences were constructed using the
plasmid-based heteroduplex method (34) or by PCR mutagenesis (35) with
the oligonucleotides presented in Fig. 1
. The eukaryotic expression
plasmids pMT2 and pMT2mGATA4 (encoding the
mouse GATA-4 cDNA) have also been described (16). The expression
plasmid pcmGATA-4 was constructed by inserting the 1.8-kb
EcoRI fragment of pMT2mGATA4 containing the
mouse GATA-4 cDNA into the EcoRI site of the eukaryotic
expression plasmid pcDNAI (Invitrogen, San Diego, CA). The plasmids
p(GATA-B)4TK and p(GATA-B)4 -173, which contain
four copies of the GATA-B oligonucleotide upstream of the herpesvirus
TK promoter [-105 to +51 from pBLCATII (36)] or the 173-bp rat GnRH
promoter were engineered in the reporter vector pGL3-basic (Promega,
Madison, WI) as follows. The GATA-B, GACC-B, or TCAG-B double-stranded
oligonucleotide was ligated into pBSK+ (Stratagene, La
Jolla, CA) that had been digested with SpeI and
XbaI and filled in with the Klenow fragment of DNA
polymerase I. The insertion of the oligonucleotide regenerated both
restriction sites. The oligonucleotide insert was then multimerized by
digestion with XmnI and either SpeI or
XbaI and religation of the insert-containing fragments. This
process was repeated after transformation into Escherichia
coli and preparation of new plasmid DNA containing two copies
of the inserted oligonucleotide. The resulting tetramerized
oligonucleotides were then inserted into SacI and
SmaI sites of pGL3-basic. The
BamHI-BglII fragment containing the TK promoter
from the plasmid pSS<TKCAT (7) or the XmaI-BglII
fragment from pSS<ML-173CAT (7) containing the 173-bp GnRH promoter
fragment was then inserted into the BglII- digested or
XmaI-BglII-digested plasmids containing the
multimerized sites. The resulting plasmids containing the wild-type or
mutated GATA-B sites upstream of either promoter were verified by
dideoxy sequencing of the plasmid DNA before use in transient
transfection assays.
EMSAs
The preparation of crude nuclear extract, EMSA reaction
conditions, and antibody supershift reaction conditions have been
described previously (11, 37). Reactions were resolved by
electrophoresis on 5% 30:1 acrylamide-N, N'-methylene
bisacrylamide gels at 10 V/cm. Autoradiograms of the gels were made by
exposing dried gels to XAR-5 film (Kodak, Rochester, NY). The
double-stranded oligonucleotide probes representing the GATA-A and
GATA-B sites of the GnRH enhancer used in the EMSA and site-directed
mutagenesis of the GnRH enhancer are illustrated in Fig. 1
. The
double-stranded oligonucleotide probe representing the GATA-binding
site of the human preproendothelin-1 gene used as a control for GATA
factor binding contained the sequence GGCCTGGCCTTATCTCCGGCTGAT and its
complement (14). Preparation of radiolabeled probe used in EMSA
reactions has been described (11). Densitometry of EMSA reactions
was performed with a Molecular Imager (Bio-Rad, Richmond, CA) and
analyzed with Molecular Analyst 1.5 software (Bio-Rad).
Methylation Interference and Missing Contact Analysis
Single-stranded oligonucleotide representing either the top or
bottom strands of the GATA-A site was labeled by incubation with T4
polynucleotide kinase in the presence of [
32P]ATP
(6000 Ci/mmol, New England Nuclear, Boston, MA), as described above for
the preparation of the double-stranded EMSA probe. After purification
the labeled oligonucleotide was annealed to the complementary strand
oligonucleotide that had been phosphorylated in the presence of
nonradioactive ATP. The concentration of the final double-stranded
oligonucleotide probe was determined by measurement of specific
activity and adjusted to 10 pmol/µl in buffer of Tris-Cl 10
mM (pH 7.4) at 25 C, 1 mM EDTA, and 50
mM NaCl. Methylation reactions were performed in a 200 µl
volume with 100 pmol of labeled probe as described (38). Methylated
probe was resuspended in a buffer containing 10 mM Tris-Cl
(pH 7.4) at 25 C, 1 mM EDTA, and 50 mM NaCl at
approximately 2 fmol/µl as determined by measurement of specific
activity.
Depyrimidation of double-stranded GATA-B oligonucleotide probe for
missing-contact probing was performed according to a previously
described method (39) and resuspended as above. The EMSA reactions for
both analyses were carried out as above in a volume of 100 µl with 30
fmol of probe. Bound and unbound probe was visualized by
autoradiography of the gel, and the bands were excised, electrophoresed
onto activated NA-45 membrane (Schleicher & Schuell, Keene, NH), and
eluted according to the manufacturers protocol. Ten micrograms of
yeast tRNA were added to the eluate followed by three extractions with
an equal volume of 1:1 phenol-chloroform and ethanol precipitation.
Cleavage was carried out by resuspension of the dried pellet in 100
µl of 1 M piperidine and incubation at 90 C for 30 min.
The cleaved probe was then precipitated by the addition of 10 volumes
of butanol and pelleted. The pellet was resuspended in 100 µl of
water and reprecipitated with butanol, washed with 100% ethanol, and
dried in vacuo. Products were quantitated by measurement of
Cerenkov radiation and resuspended in a buffer containing 80%
formamide, 1 mM EDTA, such that bound and unbound probe
cleavage products were at equivalent concentration. The cleavage
pattern was visualized by electrophoresis on 12%
acrylamide-N,N' methylene bis-acrylamide (40:2) gels,
drying, and autoradiography.
Cell Culture and Transfection Assays
The GT17 clone of GT1 cells (5), NIH/3T3,
T3 (40), CATH.a
(41), F9, IMR-32, and JEG3 cells were maintained in DMEM (GIBCO/BRL,
Gaithersburg, MD) supplemented with 10% FBS, 4.5 mg/ml glucose, 100
µ/ml of penicillin, and 0.1 mg/ml streptomycin in a humidified
atmosphere of 5% CO2. The F9 cells were differentiated
into visceral endoderm by aggregation and addition of
2.10-7 M retinoic acid as previously described
(42).
Transient transfection assays were performed as previously described
(11). Cells were transfected by the calcium phosphate method (43) for
1216 h, washed twice with PBS, and incubated in fresh medium for a
total of 48 h. Cells were harvested by scraping into a buffer of
150 mM NaCl, 1 mM EDTA, and 40 mM
Tris-Cl (pH 7.4) at 25 C. Harvested cells were extracted by pelleting
and resuspension in 100 µl of 250 mM Tris-Cl (pH 7.8) at
25 C followed by subjection to three cycles of freeze/thawing (44).
Alternatively, cells were lysed in a buffer of 100 mM
potassium phosphate (pH 8.0) at 25 C, 0.2% Triton X-100. Cell extracts
were clarified by centrifugation for 5 min in an Eppendorf 5415C
centrifuge and assayed immediately for luciferase activity (Analytical
Luminescence, San Diego, CA) and ß-galactosidase activity (Tropix,
Bedford, MA) using an AutoLumat 953 or MicroLumat 96P luminometer (EG&G
Berthold, Gaithersburg, MD), or for CAT activity using a modified
organic phase extraction method (45, 46). Results are reported as a
mean of at least three experiments corrected for the activity of the
cotransfected internal control. Error is reported as
SEM.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Simon Lee, Teri Banks, and Brian Powl for excellent
technical assistance. We also thank Adrienne Harris, Shelly Nelson, and
Kerry Barnhart for thoughtful discussion and suggestions.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Mark A. Lawson, Department of Reproductive Medicine, 0674, University of California, San Diego, 9500 Gilman Drive, La Jolla, California 92093-0674.
M.A.L. is supported by NIH Grant R03 DK-52284. P.L.M. is supported by
Grant NIH R01 DK-44838.
Received for publication June 27, 1997.
Revision received October 17, 1997.
Accepted for publication December 15, 1997.
 |
REFERENCES
|
|---|
-
Silverman RC, Silverman AJ, Gibson MJ 1989 Identification
of gonadotropin releasing hormone (GnRH) neurons projecting to the
median eminence from third ventricular preoptic area grafts in
hypogonadal mice. Brain Res 501:260268[CrossRef][Medline]
-
Wray S, Grant P, Gainer H 1989 Evidence that cells expressing
luteinizing hormone-releasing hormone mRNA in the mouse are derived
from progenitor cells in the olfactory placode. Proc Natl Acad Sci USA 86:81328136[Abstract/Free Full Text]
-
Schwanzel-Fukuda M, Pfaff DW 1989 Origin of luteinizing
hormone-releasing hormone neurons. Nature 338:161164[CrossRef][Medline]
-
Clark ME, Mellon PL 1995 The POU homeodomain transcription
factor Oct-1 is essential for activity of the
gonadotropin-releasing hormone neuron-specific enhancer. Mol Cell
Biol 15:61696177[Abstract]
-
Mellon PL, Windle JJ, Goldsmith P, Pedula C, Roberts J,
Weiner RI 1990 Immortalization of hypothalamic GnRH neurons by
genetically targeted tumorigenesis. Neuron 5:110[CrossRef][Medline]
-
Mellon PL, Eraly SA, Belsham DD, Lawson MA, Clark ME, Whyte
DB, Windle JJ 1995 An immortal cell culture model of hypothalamic
gonadotropin-releasing hormone neurons. Methods: A Companion to Methods
in Enzymology 7:303310
-
Whyte DB, Lawson MA, Belsham DD, Eraly SA, Bond CT, Adelman
JP, Mellon PL 1995 A neuron-specific enhancer targets expression of the
gonadotropin-releasing hormone gene to hypothalamic neurosecretory
neurons. Mol Endocrinol 9:467477[Abstract/Free Full Text]
-
Eraly SA, Mellon PL 1995 Regulation of GnRH transcription by
protein kinase C is mediated by evolutionarily conserved,
promoter-proximal elements. Mol Endocrinol 9:848859[Abstract/Free Full Text]
-
Belsham DD, Wetsel WC, Mellon PL 1996 NMDA and nitric oxide
act through the cGMP signal transduction pathway to repress
hypothalamic gonadotropin-releasing hormone gene expression. EMBO J 15:538547[Medline]
-
Wetsel WC, Eraly SA, Whyte DB, Mellon PL 1993 Regulation of
gonadotropin-releasing hormone by protein kinases A and C in
immortalized hypothalamic neurons. Endocrinology 132:23602370[Abstract/Free Full Text]
-
Lawson MA, Whyte DB, Mellon PL 1996 GATA factors are essential
for activity of the neuron-specific enhancer of the
gonadotropin-releasing hormone gene. Mol Cell Biol 16:35963605[Abstract]
-
Tumilowicz JJ, Nichols WW, Cholon JJ, Greene AE 1970 Definition of a continuous human cell line derived from neuroblastoma.
Cancer Res 30:21102118[Abstract/Free Full Text]
-
Kohler PO, Bridson WE 1971 Isolation of hormone-producing
clonal lines of human choriocarcinoma. J Clin Endocrinol 32:683687[Abstract/Free Full Text]
-
Wilson DB, Dorfman DM, Orkin SH 1990 A nonerythroid
GATA-binding protein is required for function of the human
preproendothelin-1 promoter in endothelial cells. Mol Cell Biol 10:48544862[Abstract/Free Full Text]
-
Steger DJ, Büscher M, Hecht JH, Mellon PL 1993 Coordinate control of the
- and ß-subunit genes of human chorionic
gonadotropin by trophoblast-specific element binding protein, TSEB. Mol
Endocrinol 7:15791588[Abstract/Free Full Text]
-
Arceci RJ, King AAJ, Simon MC, Orkin SH, Wilson DB 1993 Mouse
GATA-4: a retinoic acid-inducible GATA-binding transcription factor
expressed in endodermally derived tissues and heart. Mol Cell Biol 13:22352246[Abstract/Free Full Text]
-
Lee M-E, Temizer DH, Clifford JA, Quertermous T 1991 Cloning
of the GATA-binding protein that regulates endothelin-1 gene expression
in endothelial cells. J Biol Chem 266:1618816192[Abstract/Free Full Text]
-
Martin DIK, Orkin SH 1990 Transcriptional activation and DNA
binding by the erythroid factor GF-1/NF-E1/Eryf 1. Genes Dev 4:18861898[Abstract/Free Full Text]
-
Tsai S-F, Martin DI, Zon LI, DAndrea AD, Wong GG, Orkin SH 1989 Cloning of cDNA for the major DNA-binding protein of the erythroid
lineage through expression in mammalian cells. Nature 339:446451[CrossRef][Medline]
-
Tsai S-F, Strauss E, Orkin SH 1991 Functional analysis and
in vivo footprinting implicate the erythroid transcription
factor GATA-1 as a positive regulator of its own promoter. Genes Dev 5:919931[Abstract/Free Full Text]
-
Quandt K, Frech K, Karas H, Wingender E, Werner T 1995 MatInd
and MatInspector: new fast and versatile tools for detection of
consensus matches in nucleotide consensus data. Nucleic Acids Res 23:48784884[Abstract/Free Full Text]
-
Merika M, Orkin SH 1993 DNA-binding specificity of GATA family
transcription factors. Mol Cell Biol 13:39994010[Abstract/Free Full Text]
-
Ip HS, Wilson DB, Heikinheimo M, Tang Z, Ting C-N, Simon MC,
Leiden JM, Parmacek S 1994 The GATA-4 transcription factor
transactivates the cardiac muscle-specific troponin C promoter-enhancer
in nonmuscle cells. Mol Cell Biol 14:75177526[Abstract/Free Full Text]
-
Molkentin JD, Kalvakolanu DV, Markham BE 1994 Transcription
factor GATA-4 regulates cardiac muscle-specific expression of the
myosin heavy-chain gene. Mol Cell Biol 14:49474957[Abstract/Free Full Text]
-
Morrisey EE, Ip HS, Lu MM, Parmacek MS 1996 GATA-6: A zinc
finger transcription factor that is expressed in multiple cell lineages
derived from lateral mesoderm. Dev Biol 177:309322[CrossRef][Medline]
-
Ko LJ, Engel D 1993 DNA-binding specificities of the GATA
transcription factor family. Mol Cell Biol 13:40114022[Abstract/Free Full Text]
-
Minie M, Kimura T, Felsenfeld G 1992 The developmental switch
in embryonic
-globin expression is correlated with erythroid
lineage-specific differences in transcription factor levels.
Development 115:11491164[Abstract]
-
Leonard MW, Lim KC, Engel JD 1993 Expression of the chicken
GATA factor family during early erythroid development and
differentiation. Development 119:519531[Abstract]
-
Whitelaw E, Tsai S-F, Hogben P, Orkin SH 1990 Regulated
expression of globin chains and the erythroid transcription factor
GATA-1 during erythropoiesis in the developing mouse. Mol Cell Biol 10:65966606[Abstract/Free Full Text]
-
Chang T-J, Cher BM, Waxman S, Sher W 1993 Inhibition of mouse
GATA-1 function by the glucocorticoid receptor: possible mechanism of
steroid inhibition of erythroleukemia cell differentiation. Mol
Endocrinol 7:528542[Abstract/Free Full Text]
-
Rahuel C, Vinit M-A, Lemarchandel V, Cartron J-P, Romeo
P-H 1992 Erythroid-specific activity of the glycophorin B promoter
requires GATA-1 mediated displacement of a repressor. EMBO J 11:40954102[Medline]
-
Schwanzel-Fukuda M, Jorgenson KL, Bergen HT, Weesner GD, Pfaff
DW 1992 Biology of normal luteinizing hormone-releasing hormone neurons
during and after their migration from olfactory placode. Endocr Rev 13:623634[Abstract/Free Full Text]
-
Heikenheimo M, Scandrett JM, Wilson DB 1994 Localization of
transcription factor GATA-4 to regions of the mouse embryo involved in
cardiac development. Dev Biol 164:361373[CrossRef][Medline]
-
Inouye S, Inouye M 1987 Oligonucleotide-directed site-specific
mutagenesis using double-stranded plasmid DNA. In: Narang SA (ed)
Synthesis and Applications of DNA and RNA. Academic Press, New York, pp
181206
-
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith
JA, Struhl K 1987 Current Protocols in Molecular Biology. John Wiley &
Sons, New York
-
Luckow B, Schütz G 1987 CAT constructions with multiple
unique restriction sites for the analysis of eukaryotic promoters and
regulatory elements. Nucleic Acids Res 15:5490[Free Full Text]
-
Lee KAW, Bindereif A, Green MR 1988 A small-scale procedure
for preparation of nuclear extracts that support efficient
transcription and pre-mRNA splicing. Gene Anal Technol 5:2231
-
Siebenlist U, Gilbert W 1980 Contacts between E.
coli RNA polymerase and an early promoter of phage T7. Proc Natl
Acad Sci USA 77:122126[Abstract/Free Full Text]
-
Brunelle A, Schleif RF 1987 Missing contact probing of DNA
protein interactions. Proc Natl Acad Sci USA 84:66736676[Abstract/Free Full Text]
-
Windle JJ, Weiner RI, Mellon PL 1990 Cell lines of the
pituitary gonadotrope lineage derived by targeted oncogenesis in
transgenic mice. Mol Endocrinol 4:597603[Abstract/Free Full Text]
-
Suri C, Fung BP, Tischler AS, Chikaraishi DM 1993 Catecholaminergic cell lines from the brain and adrenal glands of
tyrosine hydroxylase-SV40 T antigen transgenic mice. J Neurosci 13:12801291[Abstract]
-
Darrow AL, Rickles RJ, Strickland S 1990 Maintenance and use
of F9 teratocarcinoma cells. Methods Enzymol 190:110117[CrossRef][Medline]
-
Graham FL, van der Eb AJ 1973 A new technique for the assay of
infectivity of human adenovirus 5 DNA. Virology 52:456467[CrossRef][Medline]
-
Gorman C 1985 High efficiency gene transfer into mammalian
cells. In: Glover DM (ed) DNA Cloning: A Practical Approach. IRL Press,
Oxford, U.K., vol II:143190
-
Seed B, Sheen JY 1988 A simple phase-extraction assay for
chloramphenicol acyltransferase activity. Gene 67:271277[CrossRef][Medline]
-
Crabb DW, Dixon JE 1987 A method for increasing the
sensitivity of chloramphenicol acetyltransferase assays in extracts of
transfected cultured cells. Anal Biochem 163:8892[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
Q. Tang, M. Mazur, and P. L. Mellon
The Protein Kinase C Pathway Acts through Multiple Transcription Factors to Repress Gonadotropin-Releasing Hormone Gene Expression in Hypothalamic GT1-7 Neuronal Cells
Mol. Endocrinol.,
November 1, 2005;
19(11):
2769 - 2779.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. L. Sedlmeyer, C. L. Pearce, J. A. Trueman, J. L. Butler, T. Bersaglieri, A. P. Read, P. E. Clayton, L. N. Kolonel, B. E. Henderson, J. N. Hirschhorn, et al.
Determination of Sequence Variation and Haplotype Structure for the Gonadotropin-Releasing Hormone (GnRH) and GnRH Receptor Genes: Investigation of Role in Pubertal Timing
J. Clin. Endocrinol. Metab.,
February 1, 2005;
90(2):
1091 - 1099.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Rave-Harel, M. L. Givens, S. B. Nelson, H. A. Duong, D. Coss, M. E. Clark, S. B. Hall, M. P. Kamps, and P. L. Mellon
TALE Homeodomain Proteins Regulate Gonadotropin-releasing Hormone Gene Expression Independently and via Interactions with Oct-1
J. Biol. Chem.,
July 16, 2004;
279(29):
30287 - 30297.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. G. Kelley, M. L. Givens, N. Rave-Harel, S. B. Nelson, S. Anderson, and P. L. Mellon
Neuron-Restricted Expression of the Rat Gonadotropin-Releasing Hormone Gene Is Conferred by a Cell-Specific Protein Complex that Binds Repeated CAATT Elements
Mol. Endocrinol.,
November 1, 2002;
16(11):
2413 - 2425.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. H. Kim, A. Wolfe, G. R. Smith, S. A. Tobet, and S. Radovick
Promoter Sequences Targeting Tissue-specific Gene Expression of Hypothalamic and Ovarian Gonadotropin-releasing Hormone in Vivo
J. Biol. Chem.,
February 8, 2002;
277(7):
5194 - 5202.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. E. Laitinen, M. Anttonen, I. Ketola, D. B. Wilson, O. Ritvos, R. Butzow, and M. Heikinheimo
Transcription Factors GATA-4 and GATA-6 and a GATA Family Cofactor, FOG-2, Are Expressed in Human Ovary and Sex Cord-Derived Ovarian Tumors
J. Clin. Endocrinol. Metab.,
September 1, 2000;
85(9):
3476 - 3483.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. B. Nelson, M. A. Lawson, C. G. Kelley, and P. L. Mellon
Neuron-Specific Expression of the Rat Gonadotropin-Releasing Hormone Gene Is Conferred by Interactions of a Defined Promoter Element with the Enhancer in GT1-7 Cells
Mol. Endocrinol.,
September 1, 2000;
14(9):
1509 - 1522.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D.R. Corley, X. Li, Z.M. Lei, and Ch.V. Rao
Potential regulation of GnRH gene by a steroidogenic factor-1-like protein
Mol. Hum. Reprod.,
August 1, 2000;
6(8):
671 - 676.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Ketola, N. Rahman, J. Toppari, M. Bielinska, S. B. Porter-Tinge, J. S. Tapanainen, I. T. Huhtaniemi, D. B. Wilson, and M. Heikinheimo
Expression and Regulation of Transcription Factors GATA-4 and GATA-6 in Developing Mouse Testis
Endocrinology,
March 1, 1999;
140(3):
1470 - 1480.
[Abstract]
[Full Text]
|
 |
|