help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Feng, Z.-M.
Right arrow Articles by Chen, C.-L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Feng, Z.-M.
Right arrow Articles by Chen, C.-L. C.
Molecular Endocrinology 12 (3): 378-390
Copyright © 1998 by The Endocrine Society

Testicular GATA-1 Factor Up-Regulates the Promoter Activity of Rat Inhibin {alpha}-Subunit Gene in MA-10 Leydig Tumor Cells

Zong-Ming Feng, Ai Zhen Wu and Ching-Ling C. Chen

Population Council (Z.-M.F., A.Z.W., C.-L.C.C.) and The Rockefeller University (C.-L.C.C.) New York, New York 10021


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have previously demonstrated that the basal transcription of rat inhibin {alpha}-subunit gene in a mouse testicular Leydig tumor cell line, MA-10, depends upon a 67-bp DNA fragment at the position of -163 to -97. Within this promoter region two GATA motifs were observed. In this study, we investigated the possible role of GATA-binding proteins in the regulation of inhibin {alpha}-subunit gene transcription in testicular cells. Northern blot and RT-PCR analyses showed that mRNAs encoding GATA-binding proteins, GATA-1 and GATA-4, were detected in mouse and rat testis and in MA-10 and rat Sertoli cells. Testis-specific GATA-1 mRNA, which is transcribed from a promoter 8 kb upstream to the erythroid exon I of mouse GATA-1 gene, was also identified in MA-10 cells. Mutations of GATA sequences in {alpha}-subunit promoter markedly decreased the transcriptional activity of {alpha}-subunit gene when measured by their ability of transient expression of a bacterial reporter gene, chloramphenicol acetyltransferase (CAT), in MA-10 cells. Cotransfection of {alpha}CAT chimeric construct with cDNA expression plasmid coding for mouse GATA-1 or GATA-4 protein revealed that GATA-1 but not GATA-4 can transactivate {alpha}-subunit promoter in a dose-dependent manner. The transactivation by GATA-1 was inhibited if GATA sequences in {alpha}-subunit promoter were mutated. Furthermore, electrophoretic mobility shift assay demonstrated that GATA-binding proteins present in nuclear extracts of MA-10 cells and rat testis interacted with the GATA motifs in {alpha}-subunit promoter, and the GATA-1 in these nuclear extracts formed a supershifted immunocomplex with antibody raised against mouse GATA-1 protein. We therefore concluded that the basal transcription of inhibin {alpha}-subunit gene in testicular MA-10 cells is up-regulated by testicular GATA-1 but not GATA-4 through its interaction with the GATA motifs in {alpha}-subunit promoter. In summary, we have provided the first evidence of the functional role of a GATA-binding protein in the regulation of testicular gene expression.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Inhibins and activins were originally isolated from gonads based on their specific roles in suppression and stimulation, respectively, of pituitary FSH but not LH. In addition to their endocrine functions, inhibins and activins were shown to serve as paracrine and autocrine factors to modulate numerous functions within and outside of the reproductive system (for reviews, see Refs. 1–5). For instance, in gonads, inhibins and activins act locally to modulate spermatogenesis, oocyte maturation, and steroidogenic hormone production. In extragonadal tissues, these hormones regulate diverse physiological functions such as placental human (h)CG and progesterone production, hypothalamic oxytocin secretion, pituitary ACTH and GH synthesis, and erythropoiesis. Activins also play an important role in controlling embryonic development. Furthermore, inhibin {alpha}-subunit was shown to be a tumor-suppressor gene for gonadal and adrenal cell proliferation (5, 6, 7).

Inhibins and activins were characterized to be dimeric glycoproteins sharing a common ß-subunit linked by disulfide bonds. Inhibin contains an inhibin-specific {alpha}-subunit and one of the closely related ß-subunits, ß-A and ß-B, whereas activin is a homo- or heterodimer of the two ß-subunits. The two ß-subunits were shown to be members of transforming growth factor-ß (TGFß) superfamily (for reviews, see Refs. 8 and 9). Recently, cDNAs encoding other new ß-subunits, ßC (10, 11, 12), ßE (13, 14), and Xenopus laevis ßD (15) were also demonstrated. The genes encoding inhibin and activin subunits were isolated and characterized from many species (for reviews, see Refs. 12, 14, and 16). All the inhibin and activin subunit genes contain one intron within their precursor region, except ß-A-subunit gene in which two introns were identified in rat (16) and human (17). The two species (4.8 and 3.7 kb) of the ß-B-subunit mRNAs are derived from transcription at different initiation sites (18, 19). The promoter regions required for the transcription of the inhibin/activin subunit genes in testicular and ovarian cells were determined by transient transfection studies (16, 18, 19, 20, 21, 22, 23). In our laboratory, we demonstrated that a 67-bp {alpha}-subunit DNA at -163 to -97 is essential for basal transcription as well as cAMP stimulation of the rat {alpha}-subunit gene in MA-10, a testicular Leydig tumor cell line (23). Within this promoter region, one cAMP response element (CRE) and two GATA motifs, which are the recognition sites for GATA-binding proteins, were identified.

Members of the GATA-binding protein family recognize a consensus sequence (T/A)GATA(A/G) and share conserved zinc fingers in their DNA-binding domains. However, the tissue distribution of the expression of each GATA-binding protein is distinct (24, 25). The GATA-1 factor was originally identified exclusively in cells of erythroid lineage and was demonstrated to play a crucial role in the activation of the transcription of the globin genes and other erythroid-specific genes (26, 27, 28, 29). In addition to erythroid cells, GATA-2 was found in chicken embryonic brain, liver, and cardiac muscle (24), and in human endothelial cells (30). GATA-3 is also expressed in many tissues including definitive erythrocytes, T lymphocytes, embryonic tissues, and placenta (24, 31), and GATA-4, GATA-5, and GATA-6 factors were identified in heart, intestine, and gut (32, 33, 34).

Recently, a testis-specific GATA-1 was observed in mouse (35). The testicular GATA-1 mRNA is transcribed from a promoter 8 kb upstream to that in erythroid cells. However, the remaining exons that encode the GATA-1 protein are commonly used by both testis and erythroid transcripts (35, 36). In addition to GATA-1, GATA-4 gene was also identified in gonads (32, 33). The immunoreactive GATA-1 protein observed in mouse Sertoli cells occurs in an age- and spermatogenic cycle-specific manner (35, 37), a pattern similar to that previously shown in the testicular inhibin/activin {alpha}- and ß-B-subunit genes (38, 39, 40, 41). The coordinated expression of GATA-1 and inhibin/activin subunit genes in the testis and the identification of two GATA motifs in the 67-bp basal promoter region of the inhibin {alpha}-subunit gene (20, 42) suggest a possibility that GATA-binding protein(s) may be involved in the regulation of inhibin {alpha}-subunit gene expression in the testis. Since the possible role of a GATA-binding protein in the control of testicular gene expression has not been investigated, we therefore used inhibin {alpha}-subunit gene to examine the function(s) of GATA-1 and GATA-4 transcription factors in the testis. In this study, we demonstrated that inhibin {alpha}-subunit gene can be selectively transactivated by testicular GATA-1 through GATA motifs in MA-10 cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Identification of GATA-1 and GATA-4 mRNAs in Testicular Cells
The expression of GATA-binding protein(s) in MA-10 cells was investigated by Northern blot analysis as shown in Fig. 1Go using full-length cDNAs coding for mouse GATA-1 (28) and GATA-4 (32) as hybridization probes. A 2.0-kb GATA-1 mRNA (Fig. 1AGo) and a 3.5-kb GATA-4 mRNA (Fig. 1BGo) were detected in mouse and rat testis, 18-day-old rat Sertoli cells, and MA-10 cells.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 1. Northern Blot Analysis of (A) GATA-1 and (B) GATA-4 mRNA in the Testis

Ten micrograms each of poly(A) RNA were subjected to Northern blot analysis, and radiolabeled full-length cDNAs encoding mGATA-1 (28) and mGATA-4 (32) were used as hybridization probes. Samples in lanes 1–4 are poly(A) RNA isolated from mouse testis, rat testis, rat Sertoli cells, and MA-10 cells, respectively.

 
It was reported that testicular and erythroid mouse GATA-1 mRNAs contained tissue-specific exon I, IT, and IE, respectively, but shared identical exons II–VI (35, 36). The testis-specific mouse GATA-1 mRNA is transcribed from a promoter that is 8 kb upstream from the erythroid-specific exon I (Fig. 2AGo). The possibility of the expression of such a testis-specific GATA-1 mRNA in a mouse testicular cell line, MA-10, was next analyzed by RT-PCR. When Primers 2 and 3, which are derived from exon II and IV, respectively, and are commonly used by mouse testicular and erythroid cells (Fig. 2AGo) (35), were used for RT-PCR analysis, GATA-1 mRNA was detected in mouse spleen, in the testis of mouse and rat, and in MA-10 and rat Sertoli cells (Fig. 2BGoa). A GATA-1 cDNA product with expected size of 632 bp was obtained. A low level of GATA-1 mRNA was also detected in rat ovary. However, when Primer 1 derived from mouse testis-specific exon I (IT) was used for RT-PCR analysis (Fig. 2BGob), a 750-bp cDNA product was detected in mouse testis and in mouse testicular MA-10 cell line, but not in the testis or the Sertoli cells isolated from rat. This is because nucleotide sequences are quite different between mouse and rat GATA-1 gene at the region where primer 1 was generated (35, 36). Sequence analysis of a GATA-1 cDNA clone isolated from rat testicular cDNA library confirmed the presence of testis-specific exon I in rat (Z. Zhang and C.-L. C. Chen, unpublished data). Interestingly, a low level of testis-specific GATA-1 mRNA was also observed in mouse spleen (Fig. 2BGob).



View larger version (49K):
[in this window]
[in a new window]
 
Figure 2. Analysis of Testicular GATA-1 mRNA by RT-PCR

A, Schematic representation of the structure of the mGATA-1 gene expressed in mouse erythroid and testis (35). Exons I-VI are indicated in solid boxes, and exons IT and IE represent testis- and erythroid-specific exon I, respectively. Primers used for RT-PCR analysis are indicated below. B, Analysis of GATA-1 mRNA by RT-PCR. In panel a, primers 2 and 3 were used; and in panel b, primers 1 and 3 were employed for RT-PCR analysis. RNA samples used in lanes 1–6 are poly(A) RNA isolated from mouse spleen, mouse testis, rat testis, and PMSG-treated rat ovary as described in Materials and Methods, and total RNA from MA-10 and rat Sertoli cells, respectively. The RT-PCR products were analyzed by gel electrophoresis, and GATA-1 mRNA was identified by Southern blotting using mouse GATA-1 cDNA as a hybridization probe. The size markers (kb) are indicated on the left.

 
Mutation Analysis of the GATA Motifs in Inhibin {alpha}-Subunit Promoter
The promoter region responsible for the transcription of rat inhibin {alpha}-subunit gene in MA-10 cells was analyzed by its ability of transient expression of a bacterial reporter gene, chloramphenicol acetyltransferase (CAT) (23). A{alpha}BstCAT, which contains -163 to +65 of the {alpha}-subunit genomic DNA, was shown to exert highest CAT activity (Fig. 3Go). Deletion of a 67-bp DNA fragment, -163 to -97, from A{alpha}BstCAT construct completely abolished the promoter activity of {alpha}-subunit gene (23). Within this 67-bp basal promoter, two GATA motifs at -147 and -114 were identified. The effects of these GATA motifs on the transcription of {alpha}-subunit gene were investigated by mutation of the GATA sequences in A{alpha}BstCAT construct and analysis of their changes in the transient expression of CAT gene (Fig. 3AGo). Mutation of either one of the two GATA motifs caused a marked decrease (30–70%) in CAT activity. In general, mutations of GATA motif at -147 (referred to as 5'-GATA) caused a greater reduction than those at -114 (referred to as 3'-GATA). If mutations were made at both GATA motifs, a further decrease in CAT activity to only 10–15% of that driven by normal unmutated promoter was observed (Fig. 3AGo), suggesting the possible involvement of 5'- and 3'-GATA motifs in the regulation of {alpha}-subunit promoter in MA-10 cells.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Mutation Analysis of the GATA Motifs on {alpha}-Subunit Promoter Activity in MA-10 Cells

Left panel shows the A{alpha}CAT constructs containing {alpha}-subunit promoter DNA (-163 to +65 bp) used for transfection. The GATA motifs and their mutated sequences in the basal promoter region are indicated. The CAT activity normalized to ß-galactosidase activity was obtained from transfected MA-10 cells that had been (A) untreated or (B) treated with 1 mM cAMP for 5 h before harvest. The effect of mutated GATA motifs on {alpha}-subunit promoter activity was expressed as mean ± SEM relative to the activity of A{alpha}BstCAT without hormone treatment (designated as 100%).

 
We have previously demonstrated that the {alpha}-subunit promoter activity in testicular cells can be markedly elevated by treatment with cAMP through acting at a putative CRE in the 67-bp basal promoter (23). Since this putative CRE is located between two GATA motifs, the effect of GATA mutations on the cAMP-induced stimulation of {alpha}-subunit promoter activity was examined (Fig. 3BGo). Mutations of GATA sequences at any position did not significantly change the fold of induction of {alpha}-subunit promoter activity by cAMP in MA-10 cells, although CAT activities driven by GATA-mutated {alpha}CAT constructs were always lower than those driven by normal promoter.

Transactivation of {alpha}-Subunit Promoter by GATA-1 but not GATA-4 Factor
Since GATA-1 and GATA-4 mRNA are expressed in MA-10 cells (Figs. 1Go and 2Go), we next examined whether GATA-1 and/or GATA-4 can transactivate {alpha}-subunit promoter through GATA motifs. This was studied by cotransfection of A{alpha}BstCAT construct with cDNA expression plasmid encoding mouse GATA-1 (28) or mouse GATA-4 (32) (Fig. 4AGo). A 5- to 6-fold increase in CAT activity was observed in the cells cotransfected with GATA-1 expression plasmid. However, cotransfection with GATA-4 expression plasmid did not significantly affect {alpha}-subunit promoter activity, even when a higher amount of GATA-4 plasmid DNA (8 µg) was used.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 4. Analysis of the Transactivation of (A) {alpha}- and (B) ß-B-(3.7)-Subunit Promoter by GATA-1 and GATA-4 Factors

CAT construct containing (A) -163 bp of the {alpha}-subunit basal promoter, A{alpha}BstCAT, or (B) -139 bp of the promoter DNA for the 3.7-kb ß-B-subunit transcript, ßB3.7(-139)CAT, was cotransfected with cDNA expression plasmid encoding mGATA-1 or mGATA-4 factor into MA-10 cells. The normalized CAT activity was expressed as percent (mean ± SEM) relative to that in the cells without cotransfection (designated as 100%).

 
To determine whether the transactivation effect of GATA-1 is specific to GATA-containing genes, a gene promoter that lacks GATA sequences, such as the basal promoter for the 3.7-kb ß-B-subunit transcript (19), was included in the cotransfection study (Fig. 4BGo). CAT activity in the ßB3.7(-139)CAT construct was not affected by cotransfection with either of the two GATA-binding proteins. The specificity of GATA-1 factor on the transactivation of {alpha}-subunit promoter was further examined by using a GATA-1 expression plasmid, Rev.GATA-1, in that the mouse GATA-1 cDNA was placed in opposite orientation (Fig. 5AGo). Our results showed that {alpha}-subunit promoter was not activated by cotransfection with a reversed form of GATA-1. As expected, neither mGATA-1 nor rev.GATA-1 regulates the activity of the GATA-less ßB3.7(-139)CAT (Fig. 5BGo).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 5. Analysis of the Specificity of the Transactivation of {alpha}-Subunit Promoter by GATA-1 Factor

CAT construct containing (A) {alpha}-subunit promoter, A{alpha}BstCAT, or (B) ß-B-(3.7)-subunit promoter, ßB3.7(-139)CAT, was cotransfected into MA-10 cells with cDNA expression plasmid coding for mGATA-1 factor (GATA-1) or the reversed form of mGATA-1 (Rev.GATA-1) or with promoter-less CAT construct (A0CAT). The effects of mGATA-1 and its reversed form on the transactivation of {alpha}- or ß-B(3.7)-subunit promoter were determined by comparing the normalized CAT activity to that in the cells cotransfected with A0CAT, which was designated as 100%. The results were expressed as mean ± SEM.

 
To confirm that GATA-1 transactivates {alpha}-subunit gene through interaction with GATA motifs in the promoter, mouse GATA-1 cDNA expression plasmid was cotransfected with {alpha}CAT constructs containing mutated GATA sequences (Fig. 6Go). Mutation of one of the two GATA motifs markedly decreased the ability of {alpha}-subunit gene promoter to be transactivated by GATA-1. If both GATA motifs were mutated, the effect of GATA-1 on the transactivation of {alpha}-subunit promoter was completely abolished.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 6. Cotransfection of GATA-Mutated {alpha}-Subunit Promoter with GATA-1 Expression Plasmid

A{alpha}CAT constructs (12 µg each) containing GATA motifs or their mutated sequences in the promoter region as indicated in Fig. 3Go were cotransfected without (-) or with (+) mGATA-1 cDNA expression plasmid (6 µg). CAT activity was expressed as percent (mean ± SEM) relative to that of A{alpha}BstCAT without cotransfection (designated as 100%).

 
Electrophoretic Mobility Shift Analysis (EMSA) of GATA-1 Protein Interacting with {alpha}-Subunit Promoter
When a radiolabeled GATA-containing oligonucleotide, wGATA, from mouse GATA-1 gene promoter (43) was added to the nuclear extracts of MA-10 cells, one major shifted band (indicated by a solid arrow) binding to wGATA was observed as analyzed (Fig. 7Go, lane 2). In some experiments, one minor band with faster mobility was also detected. These shifted bands can compete their bindings with the 67-bp {alpha}-subunit promoter DNA, {alpha}(-163/-97) (lane 4). When antibody against mGATA-1 was added to the nuclear extracts, a further shifted band (indicated by an open arrow) was observed (lane 3), indicating the presence of GATA-1 protein in MA-10 cells. The supershifted band became more evident under longer exposure of the autoradiogram (data not shown). However, this supershifted band was not detected if antibody against GATA-2 factor or preimmune serum (provided by Dr. S. Orkin) was added (data not shown).



View larger version (79K):
[in this window]
[in a new window]
 
Figure 7. EMSA of GATA-Binding Proteins on {alpha}-Subunit Promoter

Nuclear extracts (1 µg each) prepared from MA-10 cells were added to radiolabeled wGATA (lanes 1–5), {alpha} (-163/-134) (lanes 6–10), {alpha}(-133/-97) (lanes 11–14), or {alpha}(-163/-97) (lanes 15–18) for binding analysis. Bands I–IV (labeled on the right) indicate the proteins with specific binding to the {alpha}-subunit promoter DNA. Nonradiolabeled oligonucleotides (200 fold in excess except lane 18 where 30-fold was used) and antibodies used for competition of binding are indicated: lanes 3 and 8, GATA-1 antiserum (1 µl); lanes 4 and 5, {alpha}(-163/-97) without or with GATA mutations, respectively; lanes 9 and 10, {alpha}(-133/-97) without or with mutation at GATA; lanes 13 and 14, {alpha}(-163/-134) without or with GATA mutation; lane 17, wGATA; and lane 18, mutated {alpha}(-163/-97). No nuclear extracts were added to lanes 1, 6, 11, and 15. Solid arrow indicates the band containing GATA-binding proteins; open arrow indicates the supershifted band by addition of GATA-1 antibody.

 
The interaction of testicular GATA-binding proteins with the GATA motifs in the {alpha}-subunit basal promoter at -163 to -97, or with one of the two GATA motifs in the 5'- and 3'-portion of the {alpha}-subunit promoter at -163 to -134 and -133 to -97, respectively, was next investigated by EMSA (Fig. 7Go, lanes 6–18). A shifted band (indicated by a solid arrow) with mobility similar to that binding to wGATA (lane 2) was detected when 30-bp {alpha}(-163/-134), 37-bp {alpha}(-133/-97), and 67-bp {alpha}(-163/-97)(band III) in lanes 7, 12 and 16, respectively, were used for binding analysis. The binding of the protein(s) in this band can be competed by adding excess of nonradioactive GATA-containing {alpha}-subunit promoter DNA fragments or wGATA oligonucleotide (lanes 9, 13, and 17). The competition of the binding to band III can be prevented if GATA sequences in {alpha}-subunit promoter DNA fragments were mutated (lanes 10, 14, and 18). In lane 14, the inhibition of the binding competition by mutated GATA sequence was more evident if smaller amounts (50 fold) of GATA-mutated {alpha}(-163/-127) DNA were used for competition analysis (data not shown). These observations indicated that the GATA-binding protein(s) present in MA-10 nuclear extracts interacts with the GATA motifs in the {alpha}-subunit promoter.

In addition to GATA-binding protein(s), two shifted bands (bands I and II) were found to bind {alpha}(-133/-97) and {alpha}(-163/-97) but not {alpha}(-163/-134) DNA fragment in the nuclear extracts prepared from MA-10 cells (lanes 7, 12, and 16). One additional band (band IV, lane 16) was found to interact only with 67-bp {alpha}-subunit promoter DNA, but not with 30-bp {alpha}(-163/-134) or 37-bp {alpha}(-133/-97).

To determine whether GATA-1 is one of the GATA-binding proteins in MA-10 nuclear extracts interacting with the GATA motifs in {alpha}-subunit promoter, antibody against GATA-1 protein was added to the EMSA reaction containing 30-bp {alpha}(-163/-134) DNA (Fig. 7Go, lane 8 and Fig. 8Go, lane 6). A further shifted band (indicated by an open arrow) which is at the position closely above band I was observed.



View larger version (87K):
[in this window]
[in a new window]
 
Figure 8. Analysis of GATA-1 Protein in Different Tissues by EMSA

Radiolabeled 30-bp {alpha}(-163/-134) oligonucleotide was incubated with nuclear proteins extracted from MA-10 cells (0.5 µg) with (lanes 2–4) or without (lanes 5–7) transfection of mGATA-1 expression plasmid, rat testis (1.25 µg, lanes 8–10), rat kidney (1.25 µg, lanes 11–13), human erythroleukemia K562 cells (0.5 µg, lanes 14–16), and mouse 3T3 cells (0.5 µg, lanes 17–19). GATA-1 antiserum (3 µl each) was added to lanes 3, 6, 9, 12, 15, and 18; and 200-fold excess of nonradiolabeled wGATA was added to lanes 4, 7, 10, 13, 16, and 19. Lane 1, No nuclear extracts were added. Solid arrow indicates the band containing GATA-1; open arrow indicates the supershifted band by GATA-1 antibody.

 
The interaction of GATA-1 protein with the GATA motifs in the {alpha}-subunit promoter was further analyzed by using nuclear extracts prepared from MA-10 cells that had been transfected with mGATA-1 expression plasmid (Fig. 8Go, lanes 2–4 and Fig. 9AGo, lanes 3–7). The GATA-1 protein expressed in the transfected cells comigrates with the GATA-1 endogenously expressed in MA-10 cells (Fig. 8Go, lanes 5–7) and can be supershifted by GATA-1 antiserum. When high dose (10 µg or more) of mGATA-1 expression plasmid was transfected to MA-10 cells (Fig. 9AGo, lanes 5–7), one slowly migrating band containing GATA-1 was also observed between bands I and II (lane 5), suggesting that the overexpressed GATA-1 protein can bind to the {alpha}-subunit promoter in a dimeric or multimeric form (44). The GATA-1 in this band competed the binding with nonradioactive wGATA oligonucleotide (lane 6) and formed another supershifted band with GATA-1 antibody (lane 7, above the complex labeled by an open arrow). However, such slowly migrating GATA-1/DNA complex was observed only in the cells with high levels of overexpressed protein.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 9. Analysis of the Dose-Dependent Increase in the (A) Binding and (B) Transactivation of {alpha}-Subunit Promoter by GATA-1 Factor

A{alpha}BstCAT construct (16 µg) was cotransfected with increased amounts of mGATA-1 expression plasmid into MA-10 cells. Panel A shows EMSA of the binding activity of {alpha}-subunit promoter DNA with the GATA-1 protein expressed in the cotransfected MA-10 cells. Radiolabeled {alpha}(-163/-97) fragment was incubated with nuclear extracts (0.5 µg each) obtained from MA-10 cells cotransfected with 2, 6, and 10 µg (lanes 3–7) of mGATA-1 expression plasmid as indicated, or with 2 µg of pXM expression vector containing no cDNA insert (lane 2). Excess (200-fold) nonradioactive wGATA and antibody (1 µg) against mGATA-1 were added to lanes 6 and 7, respectively, for competition analysis. In lanes 8–9, nuclear extracts (0.5 µg each) of K562 cells were incubated with radiolabeled {alpha}(-163/-97), and nonradioactive wGATA was added to lane 9. No nuclear extracts were added in lane 1. Panel B shows the changes in CAT activity driven by {alpha}-subunit promoter in the cells cotransfected with varied amounts of mGATA-1 expression plasmid and promoter-less CAT construct (A0CAT) as indicated. CAT activity was expressed as mean ± SEM relative to the activity observed in the cells transfected without mGATA-1 DNA (designated as 1).

 
The GATA-1 protein in MA-10 cells also comigrates with hGATA-1 in human erythroleukemia K562 cells (Fig. 8Go, lanes 14–16, and Fig. 9AGo, lanes 8–9). A band containing GATA-binding protein was observed in rat testicular nuclear extracts (Fig. 8Go, lanes 8–10) and can compete its binding with wGATA. However, a faint band with slow mobility observed in all three lanes containing testicular extracts appeared to be due to a nonspecific binding, since this band can not be competed by nonradioactive wGATA or supershifted by GATA-1 antibody. A supershifted band with weak intensity was detected above the nonspecific binding band (lane 9) when GATA-1 antibody was added. Similar signals were observed in the nuclear extracts of rat Sertoli cells (data not shown). Although GATA-binding protein was also found in rat kidney as shown in lanes 11–13 (Fig. 8Go), this is not GATA-1 factor since no supershifted band can be detected by addition of GATA-1 antiserum. As expected, mouse fibroblast 3T3 cells do not express GATA-1 protein (Fig. 8Go, lanes 17–19) (29).

The dose response of GATA-1 protein on the transactivation of {alpha}-subunit promoter activity was examined (Fig. 9Go) by cotransfection of A{alpha}BstCAT construct with increasing amounts of GATA-1 expression vector. The abilities of the GATA-1 protein overexpressed in the cotransfected cells to interact and transactivate the {alpha}-subunit promoter were analyzed by EMSA (panel A) and CAT assay (panel B), respectively. Our results indicated that GATA-1 protein exerts a dose-dependent increase in the binding to the GATA motifs in {alpha}-subunit promoter (panel A). GATA-1 protein was verified by the abilities of competition of the binding with nonradioactive wGATA (lane 6) and of formation of a supershifted immunocomplex with GATA-1 antibody (lane 7). The increase of GATA-1 binding to the {alpha}-subunit promoter was accompanied by a dose-dependent increase in CAT activity driven by {alpha}-subunit promoter (panel B), confirming that GATA-1 protein transactivates {alpha}-subunit promoter through its interaction with GATA motifs in the {alpha}-subunit gene.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have provided the first demonstration that GATA-1, a GATA-binding protein that is originally considered as an erythroid cell-specific transcription factor, plays an important role in up-regulating the transcription of inhibin {alpha}-subunit gene in testicular cells. The GATA-1 factor transactivates {alpha}-subunit gene through interaction with the GATA motifs in the 67-bp basal promoter region. Mutation analysis suggested that these GATA motifs are involved in controlling both basal and GATA-1-mediated transcription of {alpha}-subunit gene. The mechanisms involved in the interaction and transactivation of a gene by GATA-1 have been studied in many erythroid-specific genes, such as globin genes (29, 45, 46). However, the mechanisms by which GATA-1 regulates the transcription of a testicular gene have not been reported. Our demonstration that inhibin {alpha}-subunit gene can be transactivated selectively by GATA-1 and not by other GATA-binding proteins, such as GATA-4, another testicular expressed GATA-binding protein, and GATA-2 and GATA-3 (our unpublished observations) in MA-10 cells suggests that {alpha}-subunit gene may serve as a model system for studying the actions of GATA-1 in the testis.

GATA-1 factor regulates most of erythroid-specific genes. However, this factor does not transactivate erythroid genes in testicular cells. Similarly, inhibin {alpha}-subunit gene can be transactivated by GATA-1, while this gene is not expressed in erythroid cells. Although the transcription of testis-specific GATA-1 mRNA is initiated at 8 kb upstream from the erythroid-specific start site, the two GATA-1 proteins are identical since they are derived from the same exons of the gene (35). Other protein factor(s) may be involved in the GATA-1-induced transactivation of globin and {alpha}-subunit gene in erythroid and testicular cells, respectively. The expression of erythroid-specific human glycophorin B gene requires GATA-1-mediated displacement of an ubiquitous repressor protein (47). The repression of rat platelet factor (PF4) expression in nonmegakaryocytes is mediated, in part, by competition between GATA-binding proteins and TATA-binding protein of TFIID binding to the core promoter (48). Whether such protein factor(s) is responsible for the cell-specific transactivation of {alpha}-subunit gene in testicular cells remains to be determined.

It was shown that one mGATA-1 factor binds a pair of closely spaced GATA motifs (separated by 5 bp) in mGATA-1 upstream promoter region (43) or in human A{gamma}-globin promoter (separated by 15 bp) (29) in an asymmetric fashion. GATA-1 can also interact with both GATA motifs (at -65 and -33) in hematopoiesis tal-1 gene in a sequence-specific fashion, but with different efficiencies (49). The two GATA motifs in the {alpha}-subunit promoter are located 32 bp apart. Our results from EMSA study showed that GATA-1 protein interacts with the GATA motif in mGATA-1 gene, the 5'- and 3'-GATA motif in the 30-bp {alpha}(-163/-134) and the 37-bp {alpha}(-133/-97), respectively, and the 67-bp {alpha}(-163/-97) DNA fragment. One major shifted band with similar mobility was detected even though one or two GATA motifs were present in the DNA fragments used for binding reactions. Although mutation analysis indicated that both 5'- and 3'-GATA sequences may be involved in up-regulating {alpha}-subunit promoter activity, the 5'-GATA motif consistently exerted more evident effects. In addition, although homo- and heterodimers of GATA-1 interact with GATA-dependent globin gene promoters (44), the slowly migrating GATA-1/{alpha}-subunit promoter DNA complex shown in Fig. 9AGo was only observed in MA-10 cells transfected with high levels of GATA-1 expression plasmid. These observations may suggest that monomeric GATA-1 protein interacts preferentially with the 5'-GATA motif in the 67-bp basal promoter region of the {alpha}-subunit gene. Analysis of the pattern of GATA-1 protein binding to the {alpha}-subunit promoter is in progress in our laboratory.

The binding of nuclear proteins in band III to the GATA motifs of {alpha}-subunit promoter can mostly be competed by addition of excess nonradiolabeled GATA-containing oligonucleotides, indicating that the protein(s) in this band is predominantly GATA-binding protein(s). When antibody against mGATA-1 was added to EMSA reaction, a supershifted band was detected. However, the intensity in band III was never completely abolished by adding increased amounts of antibody against mGATA-1. These observations suggest that MA-10 cells and rat testis may contain other GATA-binding protein(s), which is not GATA-1, interacting with {alpha}-subunit promoter. Using antibody against GATA-2 or GATA-3 for EMSAs, neither of these proteins was shown to bind {alpha}-subunit promoter DNA. Although GATA-4 can not transactivate {alpha}-subunit gene, this protein was able to bind the GATA sequence in this promoter analyzed by EMSA (our unpublished data), suggesting that GATA-4 may be a non-GATA-1 GATA-binding protein observed in band III. Alternatively, a new GATA-binding protein interacting with {alpha}-subunit promoter may be present in the testis. These possibilities await verification.

MA-10 cells were used for all the transfection studies presented here. Although Sertoli cells are the primary sites of expressing inhibin and activin in the testis (for a review, see Ref.9), it is known that normal Leydig cells and several Leydig tumor-derived cell lines including MA-10 cells also produce immunoreactive inhibin, inhibin-related proteins and activin, and the mRNAs coding for these peptides (50, 51, 52, 53, 54). MA-10 cells expressed both {alpha}- and ß-B-subunit genes (50) and secreted immunoreactive and bioactive inhibin protein (51) in a fashion similar to that in normal Leydig and Sertoli cells (9, 51, 52). Furthermore, the differential regulation of {alpha}- and ß-B-subunit gene expression by gonadotropins and cAMP observed in normal Leydig and Sertoli cells was also demonstrated in MA-10 cells (38, 39, 50, 51, 52). These observations suggested that MA-10 cells provide a valuable system for studying the mechanisms involved in controlling the expression of inhibin/activin {alpha}- and ß-B-subunit genes in the testis.

The possible role of GATA-1 in controlling the basal transcriptional activity of {alpha}-subunit gene in Sertoli cells has not been investigated. However, based on the facts that {alpha}-subunit mRNA and protein are expressed and regulated in similar manners in MA-10 cells and rat Sertoli cells (38, 39, 50), and comparable results were obtained from transfection studies performed in these cells (19, 23), we suggest that GATA-1 factor may probably be involved in regulating {alpha}-subunit promoter in Sertoli cells. This suggestion was supported by our preliminary data that GATA-1 transactivated {alpha}-subunit promoter activity in a mouse Sertoli cell line, MSC-1, derived from transgenic mice which displays features characteristic of normal Sertoli cells (55) (our unpublished observations).

Our recent studies demonstrated that GATA-1 mRNA was also expressed in three Leydig tumor cell lines, MA-10 (Figs. 1Go and 2Go), I-10 and R2C (56), where high levels of {alpha}-subunit mRNA were observed (50). Since the basal and cAMP-regulated expressions of {alpha}-subunit mRNA (50) and the production of immuno- and bioactive inhibin protein (51) in MA-10 cells are in good agreement with those reported in normal rat Leydig cell cultures (52, 53), it is possible that GATA-1 regulates {alpha}-subunit gene transcription in normal Leydig cells. The effect of GATA-1 factor on the regulation of {alpha}-subunit gene transcription in primary cultures of rat Sertoli and Leydig cells is being studied in the laboratory.

The basal and cAMP-stimulated transcription of {alpha}-subunit gene in MA-10 cells was dependent upon a 67-bp DNA fragment at -163 to -97 (23), where two GATA motifs and one CRE were identified. Our observations in Fig. 3BGo indicated that mutations of GATA motifs did not apparently affect the stimulatory effect of cAMP on {alpha}-subunit gene transcription. Mutation of CRE sequences was shown to markedly decrease both basal and cAMP-stimulated transcription of {alpha}-subunit gene in ovarian granulosa cells (20). Whether CRE also plays a role in regulating the basal promoter activity of {alpha}-subunit gene in testicular cells is being investigated in our laboratory. In addition, whether CREB or other CRE-binding protein(s) interacts with GATA-1 to transactivate basal promoter activity of {alpha}-subunit gene without cAMP treatment will be analyzed.

GATA-1 and inhibin {alpha}-subunit genes are coordinately expressed in the testis in age- and spermatogenic stage-specific manners. Our demonstration of the up-regulation of inhibin {alpha}-subunit promoter activity by GATA-1 in MA-10 cells supported the notion that GATA-1 is one of the key factors that controls the basal transcription of inhibin {alpha}-subunit gene in the testis. Whether GATA-1 factor interacts and activates testicular {alpha}-subunit gene promoter in a way similar to that for globin genes is currently under investigation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Northern Blot Analysis
Testes were collected from 20-day-old Sprague-Dawley rats and adult C57 black mice purchased from Charles River Breeding Laboratories (Wilmington, MA). Spleen was obtained from the same adult mice. Ovaries were collected from female Sprague-Dawley rats that had been treated with 30 IU PMSG, sc, at 25 days of age for 72 h (57). MA-10 cells, a clonal strain of cultured mouse Leydig tumor cells, were generously provided by Dr. Mario Ascoli (University of Iowa) (58, 59). Sertoli cells were isolated from 18-day-old rat testes and cultured as reported previously (38, 39). Poly(A) RNAs isolated from tissues and cultured cells (50, 60) were subjected to Northern blot analysis. Expression plasmids containing full-length cDNAs encoding mouse GATA-1 (pXM/GATA-1)(28) and GATA-4 (pMT2-mGATA-4)(32) kindly provided by Dr. Stuart Orkin (Harvard Medical School, Boston, MA) and Dr. David Wilson (Washington University, St. Louis, MO), respectively, were used to prepare radioactive probes for the identification of GATA-1 and GATA-4 mRNA on the RNA blots.

Identification of GATA-1 mRNA by RT-PCR
The RT-PCR was carried out using the procedure described previously (19, 57). Briefly, reverse transcription was performed using 1 µg each poly(A) RNA or 5 µg each total PNA isolated from tissues or cultured cells, 1 µM each primer, and 15 U RT (Promega Biotech, Madison, WI) at 42 C. After denaturing at 95 C for 5 min and addition of Taq DNA polymerase at 85 C, the cDNAs were amplified 25–30 cycles by PCR at 94 C for 1 min, 55 C for 2 min, and 72 C for 2 min in each amplification cycle.

Two forward primers, primer 1 and 2, and one reverse primer, primer 3 (Fig. 2Go), was used for the analysis of GATA-1 mRNA by RT-PCR. Primer 1 (CCGAATTCCGTGAAGCGAGACCATCGTC, 28-mer) contains 20 nucleotides of mouse testis-specific exon I (35), and primer 2 (CAGGGATCCCATGGATTTTCCTGGTC, 26-mer) includes 16 nucleotides of the common coding sequence from translation initiation codon of the mGATA-1 gene (28, 35). Primer 3 (TCCACAGTTCACACACTCTCTGGC, 24-mer) contains sequence complementary to amino acid 201–209 of the zinc finger domain of mGATA-1 gene (28). An aliquot of the RT-PCR products was subjected to agarose gel electrophoresis followed by transferring to Nytran membrane. GATA-1 mRNA was verified by hybridization to a radiolabeled mGATA-1 cDNA probe prepared from pXM/GATA-1.

Transfection Procedure and CAT Assay
The procedure for the transfection of plasmid DNA into MA-10 cells was described previously (19, 23). Briefly, MA-10 cells were split at a density of 1.2–1.5 x 106 cells the day before transfection. The purified plasmid DNA was introduced into cells by the calcium phosphate precipitation method (61). The precipitate added to each dish contained 12–16 µg of test plasmid and 2 µg SV-ß-galactosidase plasmid DNA (Promega, Madison, WI), which serves as an internal control. Five hours after DNA precipitate was added, the cells were shocked with 15% glycerol for 2 min and were harvested 50 h later. For the study of cAMP effect, the transfected cells were supplemented with 1 mM 8-bromo-cAMP 5 h before harvest. For the transactivation study, A{alpha}BstCAT (23) and ßB3.7CAT (19) plasmid DNA were coprecipitated with DNA containing expression plasmid encoding mGATA-1 (pXM/GATA-1) (28) or mGATA-4 (pMT2-mGATA-4)(32), and the precipitates were then transfected into MA-10 cells. Promoterless CAT construct (pA0CAT) and pXM and pMT2 plasmids without cDNA inserts for mGATA-1 and mGATA-4, respectively, were included as negative controls.

Cell lysates were prepared by repeated freezing in dry ice/ethanol bath and thawing at 37 C for 5 min each of the transfected cells in 100 µl of 0.25 M Tris, pH 7.5, protein concentrations (62), and the activities of ß-galactosidase and CAT in cell lysates were determined as described previously (19, 23). Four micrograms each of the cellular protein were applied for the measurement of ß-galactosidase activity (63, 64) using chlorophenol red-ß-D-galactopyranoside as a substrate. The CAT activity was measured using a diffusion method (65, 66). One hundred micrograms each of the heated cellular protein in 50 µl of 100 mM Tris-HCl, pH 7.8, was placed in a 7-ml scintillation vial, and 200 µl freshly prepared CAT reaction mixture containing 25 µl 1 M Tris (pH 7.8), 10 µl 25 mM chloramphenicol, 5 µl of 1:30 diluted [3H]acetyl coenzyme A (200 mCi/mmol and 12.5 Ci/ml, New England Nuclear, Boston, MA) and 160 µl water were added. After overlaying 5 ml of water-immiscible scintillation fluid (Econofluor, NEN), the reaction mixture was incubated at 37 C. At various times, the amount of radioactivity diffused to the scintillation fluid was counted. The CAT activities were then normalized by the activity of ß-galactosidase. The results were collected from five to eight experiments.

Preparation of GATA-Mutated {alpha}CAT Constructs and Other Plasmids for Transfection Studies
A{alpha}BstCAT was constructed in pGEM-3Z plasmid as described previously (23) by fusing a 228-bp rat inhibin {alpha}-subunit genomic DNA fragment at -163 to +65 bp to a promoter-less CAT expression vector, pA0CAT. Various mutations of one or both of the two GATA motifs in the {alpha}-subunit basal promoter, as indicated in Fig. 3Go, were prepared by PCR method using primers containing mutated sequences at GATA motifs. The 67-bp BstXI/NcoI fragment in the A{alpha}BstCAT construct was replaced by the PCR-generated DNA fragment with mutations at GATA motifs.

Expression vector containing a reversed form of mGATA-1 cDNA, Rev.GATA-1, was constructed from pXM/GATA-1 plasmid (28) by inverting the cDNA insert and was used as a negative control for transactivation study. ßB3.7CAT was prepared by insertion to the CAT construct of a ß-B-subunit genomic fragment at -139 to +60 from the transcription initiation site for the 3.7-kb ß-B-subunit mRNA (19).

Preparation of Nuclear Extracts
Nuclear extracts were prepared from MA-10 and rat Sertoli cells as described (67). Briefly, nuclear proteins were extracted by dropwise addition of high-salt buffer (20 mM HEPES, pH 7.9, 1.2 M KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, and 25% glycerol) to the isolated nuclei in a buffer as described above with 20 mM KCl. After dialysis against the above buffer containing 100 mM KCl, protein concentration in the extracts was determined (62) by using Bio-Rad Protein Assay (Richmond, CA). Nuclear proteins from MA-10 cells transfected with GATA-1 or GATA-4 expression plasmid were prepared as described by Andrews and Faller (68) with a modification that a high-salt buffer containing 420 mM KCl (instead of NaCl) was employed for extraction. Nuclear extracts of rat testis and kidney were obtained as described previously (67) by centrifugation of nuclei through sucrose gradient, and nuclear proteins were obtained by precipitation with 0.33 g/ml of powdered ammonium sulfate. Nuclear extracts of untreated K562 cells derived from human chronic myelogenous leukemia and 3T3 cells derived from mouse normal fibroblasts were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Aliquots of nuclear extracts were stored at -70 C until use.

EMSA
Double-stranded oligonucleotides or DNA fragments were radiolabeled with [{gamma}-32P]ATP and polynucleotide kinase and were incubated at a concentration of 1–2 x 104 cpm in 0.1–2 ng DNA with nuclear extracts (0.5–1 µg) prepared from cultured cells or rat tissues in a final volume of 15 µl containing 10 mM Tris·HCl, pH 7.5, 25 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, and 15% glycerol. One microgram of poly(deoxyinosinic/deoxycytidylic)acid was added as a nonspecific competitor. The binding reactions were performed at room temperature for 30 min and on ice for another 30 min. Specific DNA competitors or antisera were added to the reactions as indicated. Antisera against mGATA-1 or mGATA-2 protein (provided by Dr. Stuart Orkin or purchased from Santa Cruz Biotechnology, Inc.) were added before the incubation for 30 min on ice. For competition analysis, 200-fold excess of nonradiolabeled double-stranded oligonucleotides containing GATA motif(s) or the mutated sequences was added along with radiolabeled oligonucleotides to the reaction mixtures. The binding reactions were analyzed on 6 or 7% polyacrylamide gels in TGE (25 mM Tris·HCl, 200 mM glycine, 1 mM EDTA) buffer at 230 V and 4 C for 2–3 h (48). The gels were dried and exposed to x-ray films at -70 C.

Radiolabeled oligonucleotides used for binding analysis are wGATA (GTCCATCTGATAAGACTTAT), 20 mer from mGATA-1 gene (28); -163/-97, 67-bp {alpha}-subunit basal promoter; and -163/-134 and -133/-97 which are derived from 30-bp 5' half and 37-bp 3' half of the {alpha}-subunit promoter fragment, respectively. Oligonucleotides used for competition analysis also included (-163/-127)m5–1, 37-bp 5' region of the {alpha}-subunit basal promoter with mutation of GATA motif to CATA; (-132/-97)m3–3, 35-bp 3'-region of the {alpha}-subunit basal promoter with mutation of GATA motif to CAGA; and (-163/-97)m5,3 where both of the GATA motifs were mutated to CAGA.


    ACKNOWLEDGMENTS
 
We wish to thank Dr. Nora Rosemblit for the preparation of nuclear extracts from rat testis and kidney, Dr. Mario Ascoli for providing MA-10 cells, Dr. Stuart Orkin for mGATA-1 expression plasmid and GATA-2 antiserum, and Dr. David Wilson for mGATA-4 expression plasmid.


    FOOTNOTES
 
Address requests for reprints to: Ching-Ling C. Chen, Ph.D., Population Council, Center for Biomedical Research, 1230 York Avenue, New York, New York 10021.

This work was supported by NIH Grants DK-34449 (to C.-L.C.) and HD-13541. Dr. Feng was partially supported by the Andrew W. Mellon Foundation.

Received for publication August 26, 1997. Revision received December 5, 1997. Accepted for publication December 16, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Chen C-LC 1993 Editorial: Inhibin and activin as paracrine/autocrine factors. Endocrinology 132:4–5[Free Full Text]
  2. Vale W, Bilezikjian LM, Rivier C 1994 Reproductive and other roles of inhibins and activins. In: Knobil E, Neill JD (eds) The Physiology of Reproduction. Raven Press, New York, pp 1861–1878
  3. Woodruff TK, Mather JP 1995 Inhibin, activin and the female reproductive axis. Annu Rev Physiol 57:219–244[CrossRef][Medline]
  4. Qu J, Thomas K 1995 Inhibin and activin production in human placenta. Endocr Rev 16:485–507[Abstract/Free Full Text]
  5. Matzuk MM, Shou W, Coerver KA, Lau AL, Behringer RR, Finegold MJ 1996 Transgenic models to study the roles of inhibins and activins in reproduction, oncogenesis, and development. Recent Prog Horm Res 51:123–157
  6. Matzuk MM, Finegold MJ, Su J-G, Hsueh AJW, Bradley A 1992 {alpha} inhibin is a tumor-suppressor gene with gonadal specificity in mice. Nature 360:313–319[CrossRef][Medline]
  7. Matzuk MM, Finegold MJ, Mishina Y, Bradley A, Behringer RR 1995 Synergistic effects of inhibins and Müllerian-inhibiting substance on testicular tumorigenesis. Mol Endocrinol 9:1337–1345[Abstract/Free Full Text]
  8. Vale W, Rivier C, Hsueh A, Campen C, Meunier H, Bicsak T, Vaughan J, Corrigan A, Bardin W, Sawchenko P, Petraglia F, Yu J, Plotsky P, Spiess J, Rivier J 1988 Chemical and biological characterization of the inhibin family of protein hormones. Recent Prog Horm Res 44:1–34
  9. Chen C-LC, Feng Z-M, Morris PL, Bardin CW 1992 Controls for inhibin subunit genes and their consequences in the testis. In: Spera G, Fabbrini L, Gnessi L, Bardin CW (eds) Molecular and Cellular Biology of Reproduction. Serono Symposia, Vol. 90. Raven Press, New York, pp 97–108
  10. Hötten G, Neidhardt H, Schneider C, Pohl J 1995 Cloning of a new member of the TGF-ß family: a putative new activin BC chain. Biochem Biophys Res Commun 206:608–613[CrossRef][Medline]
  11. Lau AL, Nishimori K, Matzuk MM 1996 Structural analysis of the mouse activin ßC gene. Biochim Biophys Acta 1307:145–148[Medline]
  12. Schmitt J, Hötten G, Jenkins NA, Gilbert DJ, Copeland NG, Pohl J, Schrewe H 1996 Structure, chromosomal localization, and expression analysis of the mouse inhibin/activin ßC (Inhbc) gene. Genomics 32:358–366[CrossRef][Medline]
  13. Fang J, Yin W, Smiley E, Wang SQ, Bonadio J 1996 Molecular cloning of the mouse activin ßE subunit gene. Biochem Biophys Res Commun 228:669–674[CrossRef][Medline]
  14. Fang J, Wang S-Q, Smiley E, Bonadio J 1997 Genes coding for mouse activin ßc and ßE are closely linked and exhibit a liver-specific expression pattern in adult tissues. Biochem Biophys Res Commun 231:655–661[CrossRef][Medline]
  15. Oda S, Nishimatsu S-I, Murakami K, Ueno N 1995 Molecular cloning and functional analysis of a new activin ß subunit: A dorsal mesoderm-inducing activity in Xenopus. Biochem Biophys Res Commun 210:581–588[CrossRef][Medline]
  16. Mayo KE 1994 Inhibin and activin. Molecular aspects of regulation and function. Trends Endocrinol Metab 5:407–415[CrossRef][Medline]
  17. Tanimoto K, Yoshida E, Mita S, Nibu Y, Murakami K, Fukamizu A 1996 Human activin ßA gene. Identification of novel 5' exon, functional promoter, and enhancers. J Biol Chem 271:32760–32769[Abstract/Free Full Text]
  18. Dykema JC, Mayo KE 1994 Two messenger ribonucleic acids encoding the common ßB-chain of inhibin and activin have distinct 5'-initiation sites and are differentially regulated in rat granulosa cells. Endocrinology 135:702–711[Abstract]
  19. Feng Z-M, Wu AZ, Chen C-LC 1995 Characterization and regulation of two testicular inhibin/activin ßB-subunit messenger ribonucleic acids which are transcribed from alternate initiation sites. Endocrinology 136:947–955[Abstract]
  20. Pei L, Dodson R, Schoderbek WE, Maurer RA, Mayo KE 1991 Regulation of the {alpha} inhibin gene by cyclic adenosine 3',5'-monophosphate after transfection into rat granulosa cells. Mol Endocrinol 5:521–534[Abstract/Free Full Text]
  21. Su J-G, Hsueh AJW 1992 Characterization of mouse inhibin {alpha} gene and its promoter. Biochem Biophys Res Commun 186:293–300[CrossRef][Medline]
  22. Najmabadi H, Rosenberg LA, Yuan QX, Bhatia N, Albiston AL, Burger H, Bhasin S 1993 Transcriptional and post-transcriptional regulation of inhibin {alpha}- subunit gene expression in rat Sertoli cells by 9-bromo-3',5'-cyclic-adenosine monophosphate. Mol Endocrinol 7:469–476[Abstract/Free Full Text]
  23. Feng Z-M, Chen C-LC 1994 Negative control of rat inhibin {alpha}-subunit promoter in MA-10 Leydig tumor cells. J Mol Endocrinol 13:39–47[Abstract/Free Full Text]
  24. Yamamoto M, Ko LJ, Leonard MW, Beug H, Orkin SH, Engel JD 1990 Activity and tissue-specific expression of the transcription factor NF-E1 multigene family. Genes Dev 4:1650–1662[Abstract/Free Full Text]
  25. Orkin SH 1992 GATA-binding transcription factors in hematopoietic cells. Blood 80:575–581[Free Full Text]
  26. Evans T, Reitman M, Felsenfeld G 1988 An erythroid-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes. Proc Natl Acad Sci USA 85:5976–5980[Abstract/Free Full Text]
  27. Wall L, deBoer E, Grosveld F 1988 The human ß-globin gene 3' enhancer contains multiple binding sites for an erythroid-specific protein. Genes Dev 2:1089–1100[Abstract/Free Full Text]
  28. Tsai S-F, Martin DI, Zon LI, D’Andrea AD, Wong GG, Orkin SH 1989 Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells. Nature 339:446–451[CrossRef][Medline]
  29. Martin DIK, Orkin SH 1990 Transcriptional activation and DNA binding by the erythroid factor GF-1/NF-E1/Eryf 1. Genes Dev 4:1886–1898[Abstract/Free Full Text]
  30. Lee M-E, Temizer DH, Clifford JA, Quertermous T 1991 Cloning of the GATA-binding protein that regulates endothelin-1 gene expression in endothelial cells. J Biol Chem 266:16188–16192[Abstract/Free Full Text]
  31. George KM, Leonard MW, Roth ME, Lieuw KH, Kiossis D, Grosveld F, Engel JD 199 Embryonic expression and cloning of the murine GATA-3 gene. Development 120:2673–2686
  32. Arceci RJ, King AAJ, Simon MC, Orkin SH, Wilson DB 1993 Mouse GATA-4: A retinoic acid-inducible GATA-binding transcription factor expressed in endodermally derived tissues and heart. Mol Cell Biol 13:2235–2246[Abstract/Free Full Text]
  33. Grepin C, Dagnino L, Robitaille L, Haberstroh L, Antakly T, Nemer M 1994 A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription. Mol Cell Biol 14:3115–3129[Abstract/Free Full Text]
  34. Laverriere AC, MacNeill C, Mueller C, Poelmann RE, Burch JBE, Evans T 1994 GATA-4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut. J Biol Chem 269:23177–23184[Abstract/Free Full Text]
  35. Ito E, Toki T, Ishihara H, Ohtani H, Gu L, Yokoyama M, Engel JD, Yamamoto M 1993 Erythroid transcription factor GATA-1 is abundantly transcribed in mouse testis. Nature 362:466–468[CrossRef][Medline]
  36. Onodera K, Yomogida K, Suwabe N, Takahashi S, Muraosa Y, Hayashi N, Ito E, Gu L, Rassoulzadegan M, Engel JD, Yamamoto M 1997 Conserved structure, regulatory elements, and transcriptional regulation from the GATA-1 gene testis promoter. J Biochem 121:251–263[Abstract/Free Full Text]
  37. Yomogida K, Ohtani H, Harigae H, Ito E, Nishimune Y, Engel JD, Yamamoto M 1994 Developmental stage- and spermatogenic cycle-specific expression of transcription factor GATA-1 in mouse Sertoli cells. Development 120:1759–1766[Abstract]
  38. Keinan D, Madigan MB, Bardin CW, Chen C-LC 1989 Expression and regulation of testicular inhibin {alpha}-subunit gene in vivo and in vitro. Mol Endocrinol 3:29–35[Abstract/Free Full Text]
  39. Feng ZM, Bardin CW, Chen C-LC 1989 Characterization and regulation of testicular inhibin ß-subunit messenger RNA. Mol Endocrinol 3:939–948[Abstract/Free Full Text]
  40. Krummen LA, Toppari J, Kim WH, Morelos BS, Ahmad N, Swerdloff RS, Ling N, Shimasaki S, Esch F, Bhasin S 1989 Regulation of testicular inhibin subunit messenger ribonucleic acid levels in vivo: Effects of hypophysectomy and selective follicle-stimulating hormone replacement. Endocrinology 125:1630–1637[Abstract/Free Full Text]
  41. Kaipia A, Penttila T-L, Shimasaki S, Ling N, Parvinen M, Toppari J 1992 Expression of inhibin ßA and ßB, follistatin and activin-A receptor mRNAs in the rat seminiferous epithelium. Endocrinology 131:2703–2710[Abstract/Free Full Text]
  42. Feng ZM, Li YP, Chen C-LC 1989 Analysis of the 5'-flanking regions of rat {alpha}- and ß-B-subunit genes suggests two different regulatory mechanisms. Mol Endocrinol 3:1914–1925[Abstract/Free Full Text]
  43. Tsai S-F, Strauss E, Orkin SH 1991 Functional analysis and in vivo footprinting implicate the erythroid transcription factor GATA-1 as a positive regulator of its own promoter. Genes Dev 5:919–931[Abstract/Free Full Text]
  44. Crossley M, Merika M, Orkin SH 1995 Self-association of the erythroid transcription factor GATA-1 mediated by its zinc finger domains. Mol Cell Biol 15:2448–2456[Abstract/Free Full Text]
  45. Yang H-Y, Evans T 1992 Distinct roles for the two cGATA-1 finger domains. Mol Cell Biol 12:4562–4570[Abstract/Free Full Text]
  46. Whyatt DJ, deBoer E, Grosveld F 1993 The two zinc finger-like domains of GATA-1 have different DNA binding specificities. EMBO J 12:4993–5005[Medline]
  47. Rahuel C, Vinit M-A, Lemarchandel V, Cartron J-P, Romeo P-H 1992 Erythroid-specific activity of the glycophorin B promoter requires GATA-1 mediated displacement of a repressor. EMBO J 11:4095–4102[Medline]
  48. Aird WC, Parvin JD, Sharp PA, Rosenberg RD 1994 The interaction of GATA-binding proteins and basal transcription factors with GATA box-containing core promoters. J Biol Chem 269:883–889[Abstract/Free Full Text]
  49. Lecointe N, Bernard O, Naert K, Joulin V, Larsen CJ, Romeo PH, Mathieu- Mahul D 1994 GATA- and SP1-binding sites are required for the full activity of the tissue-specific promoter of the tal-1 gene. Oncogene 9:2623–2632[Medline]
  50. Chen C-LC, Pignataro OP, Feng Z-M 1993 Inhibin/activin subunits and activin receptor are co-expressed in Leydig tumor cells. Mol Cell Endocrinol 94:137–143[CrossRef][Medline]
  51. de Winter JP, Timmerman MA, Vanderstichele HMJ, Klaij IA,Grootenhuis AJ, Rommerts FFG, de Jong FH 1992 Testicular Leydig cells in vitro secrete only inhibin {alpha}-subunits, whereas Leydig cell tumors can secrete bioactive inhibin. Mol Cell Endocrinol 83:105–115[CrossRef][Medline]
  52. Risbridger GP, Clements J, Robertson DM, Drummond AE, Muir J, Burger HG, de Kretser DM 1989 Immuno- and bioactive inhibin and inhibin {alpha}-subunit expression in rat Leydig cell cultures. Mol Cell Endocrinol 66:119–122[CrossRef][Medline]
  53. Roberts V, Meunier H, Sawchenko PE, Vale W 1989 Differential production and regulation of inhibin subunits in rat testicular cell types. Endocrinology 125:2350–2359[Abstract/Free Full Text]
  54. Lee W, Mason AJ, Schwall R, Szonyi E, Mather JP 1989 Secretion of activin by interstitial cells in the testis. Science 243:396–398[Abstract/Free Full Text]
  55. Peschon JJ, Behringer RR, Cate RL, Harwood KA, Idzerda RL, Brinster RL, Palmiter RD 1992 Directed expression of an oncogene to Sertoli cells in transgenic mice using Müllerian inhibiting substance regulatory sequences. Mol Endocrinol 6:1403–1411[Abstract/Free Full Text]
  56. Chen C-LC, Feng Z-M, Chung K, Boitani C, Bardin CW, GATA-1 and GATA-4 genes are co-expressed in the Sertoli cells and Leydig tumor cell lines of the testis. Program of the 78th Annual Meeting of The Endocrine Society, San Francisco, 1996 (Abstract P2–564)
  57. Feng Z-M, Madigan MB, Chen C-LC 1993 Expression of type II activin receptor genes in the male and female reproductive tissues of rat. Endocrinology 132:2593–2600[Abstract/Free Full Text]
  58. Ascoli M 1981 Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin receptors and steroidogenic responses. Endocrinology 108:88–95[Abstract/Free Full Text]
  59. Pignataro OP, Feng Z-M, Chen CL-C 1992 Cyclic AMP negatively regulates clusterin gene expression in Leydig tumor cell lines. Endocrinology 130:2745- 2750[Abstract/Free Full Text]
  60. Auffray C, Rougeon F 1980 Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur J Biochem 107:303–314[Medline]
  61. Gorman C, Moffat LF, Howard BH 1982 Recombinant genomes which express chloramphenical acetyltransferase in mammalian cells. Mol Cell Biol 2:1044- 1051[Abstract/Free Full Text]
  62. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  63. Herbomel P, Bourachot B, Yaniv M 1984 Two distinct enhancers with different cell specificities coexist in the regulatory region of polyoma. Cell 39:653–662[CrossRef][Medline]
  64. Hollon T, Yoshimura FK 1989 Variation in enzymatic transient gene expression assays. Anal Biochem 182:411–418[CrossRef][Medline]
  65. Neuman JR, Morency CA, Russian KO 1987 A novel rapid assay for chloramphenicol acetyltransferase gene expression. Biotechniques 5:444–447
  66. Seed B Sheen J-Y 1988 A simple phase-extraction assay for chloramphenical acetyltransferase activity. Gene 67:271–277[CrossRef][Medline]
  67. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  68. Andrews NC, Faller DV 1991 A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19:2494



This article has been cited by other articles:


Home page
ReproductionHome page
S. Mithraprabhu and K. L Loveland
Control of KIT signalling in male germ cells: what can we learn from other systems?
Reproduction, November 1, 2009; 138(5): 743 - 757.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Qamar, E. Park, E.-Y. Gong, H. J. Lee, and K. Lee
ARR19 (Androgen Receptor Corepressor of 19 kDa), an Antisteroidogenic Factor, Is Regulated by GATA-1 in Testicular Leydig Cells
J. Biol. Chem., July 3, 2009; 284(27): 18021 - 18032.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. S. Viger, S. M. Guittot, M. Anttonen, D. B. Wilson, and M. Heikinheimo
Role of the GATA Family of Transcription Factors in Endocrine Development, Function, and Disease
Mol. Endocrinol., April 1, 2008; 22(4): 781 - 798.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Bielinska, E. Genova, I. Boime, H. Parviainen, S. Kiiveri, J. Leppaluoto, N. Rahman, M. Heikinheimo, and D. B. Wilson
Gonadotropin-Induced Adrenocortical Neoplasia in NU/J Nude Mice
Endocrinology, September 1, 2005; 146(9): 3975 - 3984.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
S. Jarvis, D. J. Elliott, D. Morgan, R. Winston, and C. Readhead
Molecular markers for the assessment of postnatal male germ cell development in the mouse
Hum. Reprod., January 1, 2005; 20(1): 108 - 116.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
R. S. Viger, H. Taniguchi, N. M. Robert, and J. J. Tremblay
The 25th Volume: Role of the GATA Family of Transcription Factors in Andrology
J Androl, July 1, 2004; 25(4): 441 - 452.
[Full Text] [PDF]


Home page
J AndrolHome page
H.-J. Shi, A. Z. Wu, M. Santos, Z.-M. Feng, L. Huang, Y.-M. Chen, K. Zhu, and C.-L. C. Chen
Cloning and Characterization of Rat Spermatid Protein SSP411: A Thioredoxin-Like Protein
J Androl, July 1, 2004; 25(4): 479 - 493.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Akiyama, N. Watkins, H. Suzuki, K.-W. Jair, M. van Engeland, M. Esteller, H. Sakai, C.-Y. Ren, Y. Yuasa, J. G. Herman, et al.
GATA-4 and GATA-5 Transcription Factor Genes and Potential Downstream Antitumor Target Genes Are Epigenetically Silenced in Colorectal and Gastric Cancer
Mol. Cell. Biol., December 1, 2003; 23(23): 8429 - 8439.
[Abstract] [Full Text] [PDF]


Home page
Exp Biol MedHome page
H. A. LaVoie
The Role of GATA in Mammalian Reproduction
Exp Biol Med, December 1, 2003; 228(11): 1282 - 1290.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
F. Lindeboom, N. Gillemans, A. Karis, M. Jaegle, D. Meijer, F. Grosveld, and S. Philipsen
A tissue-specific knockout reveals that Gata1 is not essential for Sertoli cell function in the mouse
Nucleic Acids Res., September 15, 2003; 31(18): 5405 - 5412.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. M. Gummow, J. N. Winnay, and G. D. Hammer
Convergence of Wnt Signaling and Steroidogenic Factor-1 (SF-1) on Transcription of the Rat Inhibin {alpha} Gene
J. Biol. Chem., July 11, 2003; 278(29): 26572 - 26579.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. B. Billiar, N. C. Zachos, M. G. Burch, E. D. Albrecht, and G. J. Pepe
Up-Regulation of {alpha}-Inhibin Expression in the Fetal Ovary of Estrogen-Suppressed Baboons Is Associated with Impaired Fetal Ovarian Folliculogenesis
Biol Reprod, June 1, 2003; 68(6): 1989 - 1996.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Ketola, J. Toppari, T. Vaskivuo, R. Herva, J. S. Tapanainen, and M. Heikinheimo
Transcription Factor GATA-6, Cell Proliferation, Apoptosis, and Apoptosis-Related Proteins Bcl-2 and Bax in Human Fetal Testis
J. Clin. Endocrinol. Metab., April 1, 2003; 88(4): 1858 - 1865.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. M. Robert, J. J. Tremblay, and R. S. Viger
Friend of GATA (FOG)-1 and FOG-2 Differentially Repress the GATA-Dependent Activity of Multiple Gonadal Promoters
Endocrinology, October 1, 2002; 143(10): 3963 - 3973.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Z. Zhang, A. Z. Wu, Z.-M. Feng, D. Mruk, C. Y. Cheng, and C.-L. C. Chen
Gonadotropins, via cAMP, Negatively Regulate GATA-1 Gene Expression in Testicular Cells
Endocrinology, March 1, 2002; 143(3): 829 - 836.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. B. Hales
Editorial: Gonadal-Specific Transcription Factors--GATA (Go) 4 It!
Endocrinology, March 1, 2001; 142(3): 974 - 976.
[Full Text] [PDF]


Home page
EndocrinologyHome page
J. J. Tremblay and R. S. Viger
GATA Factors Differentially Activate Multiple Gonadal Promoters through Conserved GATA Regulatory Elements
Endocrinology, March 1, 2001; 142(3): 977 - 986.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Z.-M. Feng, A. Z. Wu, Z. Zhang, and C.-L. C. Chen
GATA-1 and GATA-4 Transactivate Inhibin/Activin {beta}-B-Subunit Gene Transcription in Testicular Cells
Mol. Endocrinol., November 1, 2000; 14(11): 1820 - 1835.
[Abstract] [Full Text]


Home page
JNCI J Natl Cancer InstHome page
G. T. G. Chang, M. Steenbeek, E. Schippers, L. J. Blok, W. M. van Weerden, D. C. J. G. van Alewijk, B. H. J. Eussen, G. J. van Steenbrugge, and A. O. Brinkmann
Characterization of a Zinc-Finger Protein and Its Association With Apoptosis in Prostate Cancer Cells
J Natl Cancer Inst, September 6, 2000; 92(17): 1414 - 1421.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. R. Wooton-Kee and B. J. Clark
Steroidogenic Factor-1 Influences Protein-Deoxyribonucleic Acid Interactions within the Cyclic Adenosine 3',5'-Monophosphate-Responsive Regions of the Murine Steroidogenic Acute Regulatory Protein Gene
Endocrinology, April 1, 2000; 141(4): 1345 - 1355.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Wang, X. Wang, and M. L. Adamo
Two Putative GATA Motifs in the Proximal Exon 1 Promoter of the Rat Insulin-Like Growth Factor I Gene Regulate Basal Promoter Activity
Endocrinology, March 1, 2000; 141(3): 1118 - 1126.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Teixeira, D. J. Kehas, R. Antun, and P. K. Donahoe
Transcriptional regulation of the rat Mullerian inhibiting substance type II receptor in rodent Leydig cells
PNAS, November 23, 1999; 96(24): 13831 - 13838.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. J. Reinhart, S. C. Williams, B. J. Clark, and D. M. Stocco
SF-1 (Steroidogenic Factor-1) and C/EBP{beta} (CCAAT/Enhancer Binding Protein-{beta}) Cooperate to Regulate the Murine StAR (Steroidogenic Acute Regulatory) Promoter
Mol. Endocrinol., May 1, 1999; 13(5): 729 - 741.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
I. Ketola, N. Rahman, J. Toppari, M. Bielinska, S. B. Porter-Tinge, J. S. Tapanainen, I. T. Huhtaniemi, D. B. Wilson, and M. Heikinheimo
Expression and Regulation of Transcription Factors GATA-4 and GATA-6 in Developing Mouse Testis
Endocrinology, March 1, 1999; 140(3): 1470 - 1480.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Feng, Z.-M.
Right arrow Articles by Chen, C.-L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Feng, Z.-M.
Right arrow Articles by Chen, C.-L. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals