| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
-Subunit Gene in MA-10 Leydig Tumor Cells
Population Council (Z.-M.F., A.Z.W., C.-L.C.C.) and The Rockefeller University (C.-L.C.C.) New York, New York 10021
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
-subunit gene in a mouse testicular
Leydig tumor cell line, MA-10, depends upon a 67-bp DNA fragment at the
position of -163 to -97. Within this promoter region two GATA motifs
were observed. In this study, we investigated the possible role of
GATA-binding proteins in the regulation of inhibin -subunit gene
transcription in testicular cells. Northern blot and RT-PCR analyses
showed that mRNAs encoding GATA-binding proteins, GATA-1 and GATA-4,
were detected in mouse and rat testis and in MA-10 and rat Sertoli
cells. Testis-specific GATA-1 mRNA, which is transcribed from a
promoter 8 kb upstream to the erythroid exon I of mouse GATA-1 gene,
was also identified in MA-10 cells. Mutations of GATA sequences in
-subunit promoter markedly decreased the transcriptional activity of
-subunit gene when measured by their ability of transient expression
of a bacterial reporter gene, chloramphenicol acetyltransferase (CAT),
in MA-10 cells. Cotransfection of CAT chimeric construct with cDNA
expression plasmid coding for mouse GATA-1 or GATA-4 protein revealed
that GATA-1 but not GATA-4 can transactivate -subunit promoter in a
dose-dependent manner. The transactivation by GATA-1 was inhibited if
GATA sequences in -subunit promoter were mutated. Furthermore,
electrophoretic mobility shift assay demonstrated that GATA-binding
proteins present in nuclear extracts of MA-10 cells and rat testis
interacted with the GATA motifs in -subunit promoter, and the GATA-1
in these nuclear extracts formed a supershifted immunocomplex with
antibody raised against mouse GATA-1 protein. We therefore concluded
that the basal transcription of inhibin -subunit gene in testicular
MA-10 cells is up-regulated by testicular GATA-1 but not GATA-4 through
its interaction with the GATA motifs in -subunit promoter. In
summary, we have provided the first evidence of the functional role of
a GATA-binding protein in the regulation of testicular gene expression. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
-subunit was shown to be
a tumor-suppressor gene for gonadal and adrenal cell proliferation
(5, 6, 7).
Inhibins and activins were characterized to be dimeric glycoproteins
sharing a common ß-subunit linked by disulfide bonds. Inhibin
contains an inhibin-specific -subunit and one of the closely related
ß-subunits, ß-A and ß-B, whereas activin is a homo- or
heterodimer of the two ß-subunits. The two ß-subunits were shown to
be members of transforming growth factor-ß (TGFß) superfamily (for
reviews, see Refs. 8 and 9). Recently, cDNAs encoding other new
ß-subunits, ßC (10, 11, 12), ßE (13, 14), and Xenopus
laevis ßD (15) were also demonstrated. The genes encoding
inhibin and activin subunits were isolated and characterized from many
species (for reviews, see Refs. 12, 14, and 16). All the inhibin and
activin subunit genes contain one intron within their precursor region,
except ß-A-subunit gene in which two introns were identified in rat
(16) and human (17). The two species (4.8 and 3.7 kb) of the
ß-B-subunit mRNAs are derived from transcription at different
initiation sites (18, 19). The promoter regions required for the
transcription of the inhibin/activin subunit genes in testicular and
ovarian cells were determined by transient transfection studies (16, 18, 19, 20, 21, 22, 23). In our laboratory, we demonstrated that a 67-bp -subunit
DNA at -163 to -97 is essential for basal transcription as well as
cAMP stimulation of the rat -subunit gene in MA-10, a testicular
Leydig tumor cell line (23). Within this promoter region, one cAMP
response element (CRE) and two GATA motifs, which are the recognition
sites for GATA-binding proteins, were identified.
Members of the GATA-binding protein family recognize a consensus sequence (T/A)GATA(A/G) and share conserved zinc fingers in their DNA-binding domains. However, the tissue distribution of the expression of each GATA-binding protein is distinct (24, 25). The GATA-1 factor was originally identified exclusively in cells of erythroid lineage and was demonstrated to play a crucial role in the activation of the transcription of the globin genes and other erythroid-specific genes (26, 27, 28, 29). In addition to erythroid cells, GATA-2 was found in chicken embryonic brain, liver, and cardiac muscle (24), and in human endothelial cells (30). GATA-3 is also expressed in many tissues including definitive erythrocytes, T lymphocytes, embryonic tissues, and placenta (24, 31), and GATA-4, GATA-5, and GATA-6 factors were identified in heart, intestine, and gut (32, 33, 34).
Recently, a testis-specific GATA-1 was observed in mouse (35). The
testicular GATA-1 mRNA is transcribed from a promoter 8 kb upstream to
that in erythroid cells. However, the remaining exons that encode the
GATA-1 protein are commonly used by both testis and erythroid
transcripts (35, 36). In addition to GATA-1, GATA-4 gene was also
identified in gonads (32, 33). The immunoreactive GATA-1 protein
observed in mouse Sertoli cells occurs in an age- and spermatogenic
cycle-specific manner (35, 37), a pattern similar to that previously
shown in the testicular inhibin/activin - and ß-B-subunit genes
(38, 39, 40, 41). The coordinated expression of GATA-1 and inhibin/activin
subunit genes in the testis and the identification of two GATA motifs
in the 67-bp basal promoter region of the inhibin -subunit gene (20, 42) suggest a possibility that GATA-binding protein(s) may be involved
in the regulation of inhibin -subunit gene expression in the testis.
Since the possible role of a GATA-binding protein in the control of
testicular gene expression has not been investigated, we therefore used
inhibin -subunit gene to examine the function(s) of GATA-1 and
GATA-4 transcription factors in the testis. In this study, we
demonstrated that inhibin -subunit gene can be selectively
transactivated by testicular GATA-1 through GATA motifs in MA-10
cells.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
using full-length cDNAs coding for
mouse GATA-1 (28) and GATA-4 (32) as hybridization probes. A 2.0-kb
GATA-1 mRNA (Fig. 1A) and a 3.5-kb GATA-4 mRNA (Fig. 1B) were detected
in mouse and rat testis, 18-day-old rat Sertoli cells, and MA-10
cells.
|
). The
possibility of the expression of such a testis-specific GATA-1 mRNA in
a mouse testicular cell line, MA-10, was next analyzed by RT-PCR. When
Primers 2 and 3, which are derived from exon II and IV, respectively,
and are commonly used by mouse testicular and erythroid cells (Fig. 2A)
(35), were used for RT-PCR analysis, GATA-1 mRNA was detected in mouse
spleen, in the testis of mouse and rat, and in MA-10 and rat Sertoli
cells (Fig. 2Ba). A GATA-1 cDNA product with expected size of 632 bp
was obtained. A low level of GATA-1 mRNA was also detected in rat
ovary. However, when Primer 1 derived from mouse testis-specific exon I
(IT) was used for RT-PCR analysis (Fig. 2Bb), a 750-bp cDNA product was
detected in mouse testis and in mouse testicular MA-10 cell line, but
not in the testis or the Sertoli cells isolated from rat. This is
because nucleotide sequences are quite different between mouse and rat
GATA-1 gene at the region where primer 1 was generated (35, 36).
Sequence analysis of a GATA-1 cDNA clone isolated from rat testicular
cDNA library confirmed the presence of testis-specific exon I in rat
(Z. Zhang and C.-L. C. Chen, unpublished data). Interestingly, a
low level of testis-specific GATA-1 mRNA was also observed in mouse
spleen (Fig. 2Bb).
|
-Subunit
Promoter-subunit gene in MA-10 cells was analyzed by its ability of
transient expression of a bacterial reporter gene, chloramphenicol
acetyltransferase (CAT) (23). ABstCAT, which contains -163 to +65
of the -subunit genomic DNA, was shown to exert highest CAT activity
(Fig. 3). Deletion of a 67-bp DNA
fragment, -163 to -97, from ABstCAT construct completely abolished
the promoter activity of -subunit gene (23). Within this 67-bp basal
promoter, two GATA motifs at -147 and -114 were identified. The
effects of these GATA motifs on the transcription of -subunit gene
were investigated by mutation of the GATA sequences in ABstCAT
construct and analysis of their changes in the transient expression of
CAT gene (Fig. 3A). Mutation of either one of the two GATA motifs
caused a marked decrease (30–70%) in CAT activity. In general,
mutations of GATA motif at -147 (referred to as 5'-GATA) caused a
greater reduction than those at -114 (referred to as 3'-GATA). If
mutations were made at both GATA motifs, a further decrease in CAT
activity to only 10–15% of that driven by normal unmutated promoter
was observed (Fig. 3A), suggesting the possible involvement of 5'- and
3'-GATA motifs in the regulation of -subunit promoter in MA-10
cells.
|
-subunit promoter activity
in testicular cells can be markedly elevated by treatment with cAMP
through acting at a putative CRE in the 67-bp basal promoter (23).
Since this putative CRE is located between two GATA motifs, the effect
of GATA mutations on the cAMP-induced stimulation of -subunit
promoter activity was examined (Fig. 3B
). Mutations of GATA sequences
at any position did not significantly change the fold of induction of
-subunit promoter activity by cAMP in MA-10 cells, although CAT
activities driven by GATA-mutated CAT constructs were always lower
than those driven by normal promoter.
Transactivation of -Subunit Promoter by GATA-1 but not GATA-4
Factor
Since GATA-1 and GATA-4 mRNA are expressed in MA-10 cells (Figs. 1 and 2), we next examined whether GATA-1 and/or GATA-4 can transactivate
-subunit promoter through GATA motifs. This was studied by
cotransfection of ABstCAT construct with cDNA expression plasmid
encoding mouse GATA-1 (28) or mouse GATA-4 (32) (Fig. 4A). A 5- to 6-fold increase in CAT
activity was observed in the cells cotransfected with GATA-1 expression
plasmid. However, cotransfection with GATA-4 expression plasmid did not
significantly affect -subunit promoter activity, even when a higher
amount of GATA-4 plasmid DNA (8 µg) was used.
|
). CAT activity
in the ßB3.7(-139)CAT construct was not affected by cotransfection
with either of the two GATA-binding proteins. The specificity of GATA-1
factor on the transactivation of -subunit promoter was further
examined by using a GATA-1 expression plasmid, Rev.GATA-1, in that the
mouse GATA-1 cDNA was placed in opposite orientation (Fig. 5A). Our results showed that -subunit
promoter was not activated by cotransfection with a reversed form of
GATA-1. As expected, neither mGATA-1 nor rev.GATA-1 regulates the
activity of the GATA-less ßB3.7(-139)CAT (Fig. 5B).
|
-subunit gene through
interaction with GATA motifs in the promoter, mouse GATA-1 cDNA
expression plasmid was cotransfected with CAT constructs containing
mutated GATA sequences (Fig. 6). Mutation
of one of the two GATA motifs markedly decreased the ability of
-subunit gene promoter to be transactivated by GATA-1. If both GATA
motifs were mutated, the effect of GATA-1 on the transactivation of
-subunit promoter was completely abolished.
|
-Subunit Promoter, lane 2). In some experiments, one
minor band with faster mobility was also detected. These shifted bands
can compete their bindings with the 67-bp -subunit promoter DNA,
(-163/-97) (lane 4). When antibody against mGATA-1 was added to
the nuclear extracts, a further shifted band (indicated by an
open arrow) was observed (lane 3), indicating the presence
of GATA-1 protein in MA-10 cells. The supershifted band became more
evident under longer exposure of the autoradiogram (data not shown).
However, this supershifted band was not detected if antibody against
GATA-2 factor or preimmune serum (provided by Dr. S. Orkin) was added
(data not shown).
|
-subunit basal promoter at -163 to -97, or with one
of the two GATA motifs in the 5'- and 3'-portion of the -subunit
promoter at -163 to -134 and -133 to -97, respectively, was next
investigated by EMSA (Fig. 7, lanes 6–18). A shifted band (indicated
by a solid arrow) with mobility similar to that binding to
wGATA (lane 2) was detected when 30-bp (-163/-134), 37-bp
(-133/-97), and 67-bp (-163/-97)(band III) in lanes 7, 12 and
16, respectively, were used for binding analysis. The binding of the
protein(s) in this band can be competed by adding excess of
nonradioactive GATA-containing -subunit promoter DNA fragments or
wGATA oligonucleotide (lanes 9, 13, and 17). The competition of the
binding to band III can be prevented if GATA sequences in -subunit
promoter DNA fragments were mutated (lanes 10, 14, and 18). In lane 14,
the inhibition of the binding competition by mutated GATA sequence was
more evident if smaller amounts (50 fold) of GATA-mutated
(-163/-127) DNA were used for competition analysis (data not
shown). These observations indicated that the GATA-binding protein(s)
present in MA-10 nuclear extracts interacts with the GATA motifs in the
-subunit promoter.
In addition to GATA-binding protein(s), two shifted bands (bands I and
II) were found to bind (-133/-97) and (-163/-97) but not
(-163/-134) DNA fragment in the nuclear extracts prepared from
MA-10 cells (lanes 7, 12, and 16). One additional band (band IV, lane
16) was found to interact only with 67-bp -subunit promoter DNA, but
not with 30-bp (-163/-134) or 37-bp (-133/-97).
To determine whether GATA-1 is one of the GATA-binding proteins in
MA-10 nuclear extracts interacting with the GATA motifs in -subunit
promoter, antibody against GATA-1 protein was added to the EMSA
reaction containing 30-bp (-163/-134) DNA (Fig. 7, lane 8 and Fig. 8, lane 6). A further shifted band
(indicated by an open arrow) which is at the position
closely above band I was observed.
|
-subunit promoter was further analyzed by using nuclear extracts
prepared from MA-10 cells that had been transfected with mGATA-1
expression plasmid (Fig. 8, lanes 2–4 and Fig. 9A, lanes 3–7). The
GATA-1 protein expressed in the transfected cells comigrates with the
GATA-1 endogenously expressed in MA-10 cells (Fig. 8, lanes 5–7) and
can be supershifted by GATA-1 antiserum. When high dose (10 µg or
more) of mGATA-1 expression plasmid was transfected to MA-10 cells
(Fig. 9A, lanes 5–7), one slowly migrating band containing GATA-1 was
also observed between bands I and II (lane 5), suggesting that the
overexpressed GATA-1 protein can bind to the -subunit promoter in a
dimeric or multimeric form (44). The GATA-1 in this band competed the
binding with nonradioactive wGATA oligonucleotide (lane 6) and formed
another supershifted band with GATA-1 antibody (lane 7, above the
complex labeled by an open arrow). However, such slowly
migrating GATA-1/DNA complex was observed only in the cells with high
levels of overexpressed protein.
|
, lanes 14–16, and Fig. 9A, lanes
8–9). A band containing GATA-binding protein was observed in rat
testicular nuclear extracts (Fig. 8, lanes 8–10) and can compete its
binding with wGATA. However, a faint band with slow mobility observed
in all three lanes containing testicular extracts appeared to be due to
a nonspecific binding, since this band can not be competed by
nonradioactive wGATA or supershifted by GATA-1 antibody. A supershifted
band with weak intensity was detected above the nonspecific binding
band (lane 9) when GATA-1 antibody was added. Similar signals were
observed in the nuclear extracts of rat Sertoli cells (data not shown).
Although GATA-binding protein was also found in rat kidney as shown in
lanes 11–13 (Fig. 8), this is not GATA-1 factor since no supershifted
band can be detected by addition of GATA-1 antiserum. As expected,
mouse fibroblast 3T3 cells do not express GATA-1 protein (Fig. 8, lanes
17–19) (29).
The dose response of GATA-1 protein on the transactivation of
-subunit promoter activity was examined (Fig. 9) by cotransfection
of ABstCAT construct with increasing amounts of GATA-1 expression
vector. The abilities of the GATA-1 protein overexpressed in the
cotransfected cells to interact and transactivate the -subunit
promoter were analyzed by EMSA (panel A) and CAT assay (panel B),
respectively. Our results indicated that GATA-1 protein exerts a
dose-dependent increase in the binding to the GATA motifs in
-subunit promoter (panel A). GATA-1 protein was verified by the
abilities of competition of the binding with nonradioactive wGATA (lane
6) and of formation of a supershifted immunocomplex with GATA-1
antibody (lane 7). The increase of GATA-1 binding to the -subunit
promoter was accompanied by a dose-dependent increase in CAT activity
driven by -subunit promoter (panel B), confirming that GATA-1
protein transactivates -subunit promoter through its interaction
with GATA motifs in the -subunit gene.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
-subunit gene in
testicular cells. The GATA-1 factor transactivates -subunit gene
through interaction with the GATA motifs in the 67-bp basal promoter
region. Mutation analysis suggested that these GATA motifs are involved
in controlling both basal and GATA-1-mediated transcription of
-subunit gene. The mechanisms involved in the interaction and
transactivation of a gene by GATA-1 have been studied in many
erythroid-specific genes, such as globin genes (29, 45, 46). However,
the mechanisms by which GATA-1 regulates the transcription of a
testicular gene have not been reported. Our demonstration that inhibin
-subunit gene can be transactivated selectively by GATA-1 and not by
other GATA-binding proteins, such as GATA-4, another testicular
expressed GATA-binding protein, and GATA-2 and GATA-3 (our unpublished
observations) in MA-10 cells suggests that -subunit gene may serve
as a model system for studying the actions of GATA-1 in the testis.
GATA-1 factor regulates most of erythroid-specific genes. However, this
factor does not transactivate erythroid genes in testicular cells.
Similarly, inhibin -subunit gene can be transactivated by GATA-1,
while this gene is not expressed in erythroid cells. Although the
transcription of testis-specific GATA-1 mRNA is initiated at 8 kb
upstream from the erythroid-specific start site, the two GATA-1
proteins are identical since they are derived from the same exons of
the gene (35). Other protein factor(s) may be involved in the
GATA-1-induced transactivation of globin and -subunit gene in
erythroid and testicular cells, respectively. The expression of
erythroid-specific human glycophorin B gene requires GATA-1-mediated
displacement of an ubiquitous repressor protein (47). The repression of
rat platelet factor (PF4) expression in nonmegakaryocytes is mediated,
in part, by competition between GATA-binding proteins and TATA-binding
protein of TFIID binding to the core promoter (48). Whether such
protein factor(s) is responsible for the cell-specific transactivation
of -subunit gene in testicular cells remains to be determined.
It was shown that one mGATA-1 factor binds a pair of closely spaced
GATA motifs (separated by 5 bp) in mGATA-1 upstream promoter region
(43) or in human A
-globin promoter (separated by 15 bp) (29) in an
asymmetric fashion. GATA-1 can also interact with both GATA motifs (at
-65 and -33) in hematopoiesis tal-1 gene in a
sequence-specific fashion, but with different efficiencies (49). The
two GATA motifs in the -subunit promoter are located 32 bp apart.
Our results from EMSA study showed that GATA-1 protein interacts with
the GATA motif in mGATA-1 gene, the 5'- and 3'-GATA motif in the 30-bp
(-163/-134) and the 37-bp (-133/-97), respectively, and the
67-bp (-163/-97) DNA fragment. One major shifted band with similar
mobility was detected even though one or two GATA motifs were present
in the DNA fragments used for binding reactions. Although mutation
analysis indicated that both 5'- and 3'-GATA sequences may be involved
in up-regulating -subunit promoter activity, the 5'-GATA motif
consistently exerted more evident effects. In addition, although homo-
and heterodimers of GATA-1 interact with GATA-dependent globin gene
promoters (44), the slowly migrating GATA-1/-subunit promoter DNA
complex shown in Fig. 9A was only observed in MA-10 cells transfected
with high levels of GATA-1 expression plasmid. These observations may
suggest that monomeric GATA-1 protein interacts preferentially with the
5'-GATA motif in the 67-bp basal promoter region of the -subunit
gene. Analysis of the pattern of GATA-1 protein binding to the
-subunit promoter is in progress in our laboratory.
The binding of nuclear proteins in band III to the GATA motifs of
-subunit promoter can mostly be competed by addition of excess
nonradiolabeled GATA-containing oligonucleotides, indicating that the
protein(s) in this band is predominantly GATA-binding protein(s). When
antibody against mGATA-1 was added to EMSA reaction, a supershifted
band was detected. However, the intensity in band III was never
completely abolished by adding increased amounts of antibody against
mGATA-1. These observations suggest that MA-10 cells and rat testis may
contain other GATA-binding protein(s), which is not GATA-1, interacting
with -subunit promoter. Using antibody against GATA-2 or GATA-3 for
EMSAs, neither of these proteins was shown to bind -subunit promoter
DNA. Although GATA-4 can not transactivate -subunit gene, this
protein was able to bind the GATA sequence in this promoter analyzed by
EMSA (our unpublished data), suggesting that GATA-4 may be a non-GATA-1
GATA-binding protein observed in band III. Alternatively, a new
GATA-binding protein interacting with -subunit promoter may be
present in the testis. These possibilities await verification.
MA-10 cells were used for all the transfection studies presented here.
Although Sertoli cells are the primary sites of expressing inhibin and
activin in the testis (for a review, see Ref.9), it is known that
normal Leydig cells and several Leydig tumor-derived cell lines
including MA-10 cells also produce immunoreactive inhibin,
inhibin-related proteins and activin, and the mRNAs coding for these
peptides (50, 51, 52, 53, 54). MA-10 cells expressed both - and ß-B-subunit
genes (50) and secreted immunoreactive and bioactive inhibin protein
(51) in a fashion similar to that in normal Leydig and Sertoli cells
(9, 51, 52). Furthermore, the differential regulation of - and
ß-B-subunit gene expression by gonadotropins and cAMP observed in
normal Leydig and Sertoli cells was also demonstrated in MA-10 cells
(38, 39, 50, 51, 52). These observations suggested that MA-10 cells provide
a valuable system for studying the mechanisms involved in controlling
the expression of inhibin/activin - and ß-B-subunit genes in the
testis.
The possible role of GATA-1 in controlling the basal transcriptional
activity of -subunit gene in Sertoli cells has not been
investigated. However, based on the facts that -subunit mRNA and
protein are expressed and regulated in similar manners in MA-10 cells
and rat Sertoli cells (38, 39, 50), and comparable results were
obtained from transfection studies performed in these cells (19, 23),
we suggest that GATA-1 factor may probably be involved in regulating
-subunit promoter in Sertoli cells. This suggestion was supported by
our preliminary data that GATA-1 transactivated -subunit promoter
activity in a mouse Sertoli cell line, MSC-1, derived from transgenic
mice which displays features characteristic of normal Sertoli cells
(55) (our unpublished observations).
Our recent studies demonstrated that GATA-1 mRNA was also expressed in
three Leydig tumor cell lines, MA-10 (Figs. 1 and 2), I-10 and R2C
(56), where high levels of -subunit mRNA were observed (50). Since
the basal and cAMP-regulated expressions of -subunit mRNA (50) and
the production of immuno- and bioactive inhibin protein (51) in MA-10
cells are in good agreement with those reported in normal rat Leydig
cell cultures (52, 53), it is possible that GATA-1 regulates
-subunit gene transcription in normal Leydig cells. The effect of
GATA-1 factor on the regulation of -subunit gene transcription in
primary cultures of rat Sertoli and Leydig cells is being studied in
the laboratory.
The basal and cAMP-stimulated transcription of -subunit gene in
MA-10 cells was dependent upon a 67-bp DNA fragment at -163 to -97
(23), where two GATA motifs and one CRE were identified. Our
observations in Fig. 3B indicated that mutations of GATA motifs did not
apparently affect the stimulatory effect of cAMP on -subunit gene
transcription. Mutation of CRE sequences was shown to markedly decrease
both basal and cAMP-stimulated transcription of -subunit gene in
ovarian granulosa cells (20). Whether CRE also plays a role in
regulating the basal promoter activity of -subunit gene in
testicular cells is being investigated in our laboratory. In addition,
whether CREB or other CRE-binding protein(s) interacts with GATA-1 to
transactivate basal promoter activity of -subunit gene without cAMP
treatment will be analyzed.
GATA-1 and inhibin -subunit genes are coordinately expressed in the
testis in age- and spermatogenic stage-specific manners. Our
demonstration of the up-regulation of inhibin -subunit promoter
activity by GATA-1 in MA-10 cells supported the notion that GATA-1 is
one of the key factors that controls the basal transcription of inhibin
-subunit gene in the testis. Whether GATA-1 factor interacts and
activates testicular -subunit gene promoter in a way similar to that
for globin genes is currently under investigation.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Identification of GATA-1 mRNA by RT-PCR
The RT-PCR was carried out using the procedure described
previously (19, 57). Briefly, reverse transcription was performed using
1 µg each poly(A) RNA or 5 µg each total PNA isolated from tissues
or cultured cells, 1 µM each primer, and 15 U RT (Promega
Biotech, Madison, WI) at 42 C. After denaturing at 95 C for 5 min and
addition of Taq DNA polymerase at 85 C, the cDNAs were
amplified 25–30 cycles by PCR at 94 C for 1 min, 55 C for 2 min, and
72 C for 2 min in each amplification cycle.
Two forward primers, primer 1 and 2, and one reverse primer, primer 3
(Fig. 2), was used for the analysis of GATA-1 mRNA by RT-PCR. Primer 1
(CCGAATTCCGTGAAGCGAGACCATCGTC, 28-mer) contains 20 nucleotides of mouse
testis-specific exon I (35), and primer 2 (CAGGGATCCCATGGATTTTCCTGGTC,
26-mer) includes 16 nucleotides of the common coding sequence from
translation initiation codon of the mGATA-1 gene (28, 35). Primer 3
(TCCACAGTTCACACACTCTCTGGC, 24-mer) contains sequence complementary to
amino acid 201–209 of the zinc finger domain of mGATA-1 gene (28). An
aliquot of the RT-PCR products was subjected to agarose gel
electrophoresis followed by transferring to Nytran membrane. GATA-1
mRNA was verified by hybridization to a radiolabeled mGATA-1 cDNA probe
prepared from pXM/GATA-1.
Transfection Procedure and CAT Assay
The procedure for the transfection of plasmid DNA into
MA-10 cells was described previously (19, 23). Briefly, MA-10 cells
were split at a density of 1.2–1.5 x 106 cells the
day before transfection. The purified plasmid DNA was introduced into
cells by the calcium phosphate precipitation method (61). The
precipitate added to each dish contained 12–16 µg of test plasmid
and 2 µg SV-ß-galactosidase plasmid DNA (Promega, Madison, WI),
which serves as an internal control. Five hours after DNA precipitate
was added, the cells were shocked with 15% glycerol for 2 min and were
harvested 50 h later. For the study of cAMP effect, the
transfected cells were supplemented with 1 mM 8-bromo-cAMP
5 h before harvest. For the transactivation study, ABstCAT (23)
and ßB3.7CAT (19) plasmid DNA were coprecipitated with DNA containing
expression plasmid encoding mGATA-1 (pXM/GATA-1) (28) or mGATA-4
(pMT2-mGATA-4)(32), and the precipitates were then transfected into
MA-10 cells. Promoterless CAT construct (pA0CAT) and pXM and pMT2
plasmids without cDNA inserts for mGATA-1 and mGATA-4, respectively,
were included as negative controls.
Cell lysates were prepared by repeated freezing in dry ice/ethanol bath and thawing at 37 C for 5 min each of the transfected cells in 100 µl of 0.25 M Tris, pH 7.5, protein concentrations (62), and the activities of ß-galactosidase and CAT in cell lysates were determined as described previously (19, 23). Four micrograms each of the cellular protein were applied for the measurement of ß-galactosidase activity (63, 64) using chlorophenol red-ß-D-galactopyranoside as a substrate. The CAT activity was measured using a diffusion method (65, 66). One hundred micrograms each of the heated cellular protein in 50 µl of 100 mM Tris-HCl, pH 7.8, was placed in a 7-ml scintillation vial, and 200 µl freshly prepared CAT reaction mixture containing 25 µl 1 M Tris (pH 7.8), 10 µl 25 mM chloramphenicol, 5 µl of 1:30 diluted [3H]acetyl coenzyme A (200 mCi/mmol and 12.5 Ci/ml, New England Nuclear, Boston, MA) and 160 µl water were added. After overlaying 5 ml of water-immiscible scintillation fluid (Econofluor, NEN), the reaction mixture was incubated at 37 C. At various times, the amount of radioactivity diffused to the scintillation fluid was counted. The CAT activities were then normalized by the activity of ß-galactosidase. The results were collected from five to eight experiments.
Preparation of GATA-Mutated CAT Constructs and Other Plasmids
for Transfection Studies
ABstCAT was constructed in pGEM-3Z plasmid as described
previously (23) by fusing a 228-bp rat inhibin -subunit genomic
DNA fragment at -163 to +65 bp to a promoter-less CAT expression
vector, pA0CAT. Various mutations of one or both of the two GATA motifs
in the -subunit basal promoter, as indicated in Fig. 3, were
prepared by PCR method using primers containing mutated sequences at
GATA motifs. The 67-bp BstXI/NcoI fragment in the
ABstCAT construct was replaced by the PCR-generated DNA fragment
with mutations at GATA motifs.
Expression vector containing a reversed form of mGATA-1 cDNA, Rev.GATA-1, was constructed from pXM/GATA-1 plasmid (28) by inverting the cDNA insert and was used as a negative control for transactivation study. ßB3.7CAT was prepared by insertion to the CAT construct of a ß-B-subunit genomic fragment at -139 to +60 from the transcription initiation site for the 3.7-kb ß-B-subunit mRNA (19).
Preparation of Nuclear Extracts
Nuclear extracts were prepared from MA-10 and rat Sertoli cells
as described (67). Briefly, nuclear proteins were extracted by dropwise
addition of high-salt buffer (20 mM HEPES, pH 7.9, 1.2
M KCl, 1.5 mM MgCl2, 0.2
mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride,
0.5 mM dithiothreitol, and 25% glycerol) to the isolated
nuclei in a buffer as described above with 20 mM KCl. After
dialysis against the above buffer containing 100 mM KCl,
protein concentration in the extracts was determined (62) by using
Bio-Rad Protein Assay (Richmond, CA). Nuclear proteins from MA-10 cells
transfected with GATA-1 or GATA-4 expression plasmid were prepared as
described by Andrews and Faller (68) with a modification that a
high-salt buffer containing 420 mM KCl (instead of NaCl)
was employed for extraction. Nuclear extracts of rat testis and kidney
were obtained as described previously (67) by centrifugation of nuclei
through sucrose gradient, and nuclear proteins were obtained by
precipitation with 0.33 g/ml of powdered ammonium sulfate. Nuclear
extracts of untreated K562 cells derived from human chronic myelogenous
leukemia and 3T3 cells derived from mouse normal fibroblasts were
purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).
Aliquots of nuclear extracts were stored at -70 C until use.
EMSA
Double-stranded oligonucleotides or DNA fragments were
radiolabeled with [-32P]ATP and polynucleotide kinase
and were incubated at a concentration of 1–2 x 104
cpm in 0.1–2 ng DNA with nuclear extracts (0.5–1 µg) prepared from
cultured cells or rat tissues in a final volume of 15 µl containing
10 mM Tris·HCl, pH 7.5, 25 mM KCl, 1
mM EDTA, 1 mM dithiothreitol, and 15%
glycerol. One microgram of poly(deoxyinosinic/deoxycytidylic)acid was
added as a nonspecific competitor. The binding reactions were performed
at room temperature for 30 min and on ice for another 30 min. Specific
DNA competitors or antisera were added to the reactions as indicated.
Antisera against mGATA-1 or mGATA-2 protein (provided by Dr. Stuart
Orkin or purchased from Santa Cruz Biotechnology, Inc.) were added
before the incubation for 30 min on ice. For competition analysis,
200-fold excess of nonradiolabeled double-stranded oligonucleotides
containing GATA motif(s) or the mutated sequences was added along with
radiolabeled oligonucleotides to the reaction mixtures. The binding
reactions were analyzed on 6 or 7% polyacrylamide gels in TGE (25
mM Tris·HCl, 200 mM glycine, 1 mM
EDTA) buffer at 230 V and 4 C for 2–3 h (48). The gels were dried and
exposed to x-ray films at -70 C.
Radiolabeled oligonucleotides used for binding analysis are wGATA
(GTCCATCTGATAAGACTTAT), 20 mer from mGATA-1 gene (28); -163/-97,
67-bp -subunit basal promoter; and -163/-134 and -133/-97 which
are derived from 30-bp 5' half and 37-bp 3' half of the -subunit
promoter fragment, respectively. Oligonucleotides used for competition
analysis also included (-163/-127)m5–1, 37-bp 5' region of the
-subunit basal promoter with mutation of GATA motif to
CATA; (-132/-97)m3–3, 35-bp 3'-region of the -subunit
basal promoter with mutation of GATA motif to
CAGA; and (-163/-97)m5,3 where both of the GATA
motifs were mutated to CAGA.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
This work was supported by NIH Grants DK-34449 (to C.-L.C.) and HD-13541. Dr. Feng was partially supported by the Andrew W. Mellon Foundation.
Received for publication August 26, 1997. Revision received December 5, 1997. Accepted for publication December 16, 1997.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
inhibin is a tumor-suppressor gene with gonadal specificity in mice.
Nature 360:313–319[CrossRef][Medline]
inhibin gene by cyclic adenosine
3',5'-monophosphate after transfection into rat granulosa cells. Mol
Endocrinol 5:521–534
gene and its promoter. Biochem Biophys Res Commun 186:293–300[CrossRef][Medline]
- subunit gene expression in rat Sertoli cells
by 9-bromo-3',5'-cyclic-adenosine monophosphate. Mol Endocrinol 7:469–476-subunit promoter in MA-10 Leydig tumor cells. J Mol Endocrinol 13:39–47-subunit gene in vivo
and in vitro. Mol Endocrinol 3:29–35- and ß-B-subunit genes suggests two different
regulatory mechanisms. Mol Endocrinol 3:1914–1925-subunits, whereas
Leydig cell tumors can secrete bioactive inhibin. Mol Cell Endocrinol 83:105–115[CrossRef][Medline]
-subunit expression in rat Leydig cell cultures. Mol Cell Endocrinol 66:119–122[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  S. Mithraprabhu and K. L Loveland Control of KIT signalling in male germ cells: what can we learn from other systems? Reproduction, November 1, 2009; 138(5): 743 - 757. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Qamar, E. Park, E.-Y. Gong, H. J. Lee, and K. Lee ARR19 (Androgen Receptor Corepressor of 19 kDa), an Antisteroidogenic Factor, Is Regulated by GATA-1 in Testicular Leydig Cells J. Biol. Chem., July 3, 2009; 284(27): 18021 - 18032. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. S. Viger, S. M. Guittot, M. Anttonen, D. B. Wilson, and M. Heikinheimo Role of the GATA Family of Transcription Factors in Endocrine Development, Function, and Disease Mol. Endocrinol., April 1, 2008; 22(4): 781 - 798. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bielinska, E. Genova, I. Boime, H. Parviainen, S. Kiiveri, J. Leppaluoto, N. Rahman, M. Heikinheimo, and D. B. Wilson Gonadotropin-Induced Adrenocortical Neoplasia in NU/J Nude Mice Endocrinology, September 1, 2005; 146(9): 3975 - 3984. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Jarvis, D. J. Elliott, D. Morgan, R. Winston, and C. Readhead Molecular markers for the assessment of postnatal male germ cell development in the mouse Hum. Reprod., January 1, 2005; 20(1): 108 - 116. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. S. Viger, H. Taniguchi, N. M. Robert, and J. J. Tremblay The 25th Volume: Role of the GATA Family of Transcription Factors in Andrology J Androl, July 1, 2004; 25(4): 441 - 452. [Full Text] [PDF]
|
|
|
|
|
|
H.-J. Shi, A. Z. Wu, M. Santos, Z.-M. Feng, L. Huang, Y.-M. Chen, K. Zhu, and C.-L. C. Chen Cloning and Characterization of Rat Spermatid Protein SSP411: A Thioredoxin-Like Protein J Androl, July 1, 2004; 25(4): 479 - 493. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Akiyama, N. Watkins, H. Suzuki, K.-W. Jair, M. van Engeland, M. Esteller, H. Sakai, C.-Y. Ren, Y. Yuasa, J. G. Herman, et al. GATA-4 and GATA-5 Transcription Factor Genes and Potential Downstream Antitumor Target Genes Are Epigenetically Silenced in Colorectal and Gastric Cancer Mol. Cell. Biol., December 1, 2003; 23(23): 8429 - 8439. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. A. LaVoie The Role of GATA in Mammalian Reproduction Exp Biol Med, December 1, 2003; 228(11): 1282 - 1290. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Lindeboom, N. Gillemans, A. Karis, M. Jaegle, D. Meijer, F. Grosveld, and S. Philipsen A tissue-specific knockout reveals that Gata1 is not essential for Sertoli cell function in the mouse Nucleic Acids Res., September 15, 2003; 31(18): 5405 - 5412. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. M. Gummow, J. N. Winnay, and G. D. Hammer Convergence of Wnt Signaling and Steroidogenic Factor-1 (SF-1) on Transcription of the Rat Inhibin {alpha} Gene J. Biol. Chem., July 11, 2003; 278(29): 26572 - 26579. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. B. Billiar, N. C. Zachos, M. G. Burch, E. D. Albrecht, and G. J. Pepe Up-Regulation of {alpha}-Inhibin Expression in the Fetal Ovary of Estrogen-Suppressed Baboons Is Associated with Impaired Fetal Ovarian Folliculogenesis Biol Reprod, June 1, 2003; 68(6): 1989 - 1996. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Ketola, J. Toppari, T. Vaskivuo, R. Herva, J. S. Tapanainen, and M. Heikinheimo Transcription Factor GATA-6, Cell Proliferation, Apoptosis, and Apoptosis-Related Proteins Bcl-2 and Bax in Human Fetal Testis J. Clin. Endocrinol. Metab., April 1, 2003; 88(4): 1858 - 1865. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. M. Robert, J. J. Tremblay, and R. S. Viger Friend of GATA (FOG)-1 and FOG-2 Differentially Repress the GATA-Dependent Activity of Multiple Gonadal Promoters Endocrinology, October 1, 2002; 143(10): 3963 - 3973. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Zhang, A. Z. Wu, Z.-M. Feng, D. Mruk, C. Y. Cheng, and C.-L. C. Chen Gonadotropins, via cAMP, Negatively Regulate GATA-1 Gene Expression in Testicular Cells Endocrinology, March 1, 2002; 143(3): 829 - 836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. B. Hales Editorial: Gonadal-Specific Transcription Factors--GATA (Go) 4 It! Endocrinology, March 1, 2001; 142(3): 974 - 976. [Full Text] [PDF]
|
|
|
|
|
|
J. J. Tremblay and R. S. Viger GATA Factors Differentially Activate Multiple Gonadal Promoters through Conserved GATA Regulatory Elements Endocrinology, March 1, 2001; 142(3): 977 - 986. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z.-M. Feng, A. Z. Wu, Z. Zhang, and C.-L. C. Chen GATA-1 and GATA-4 Transactivate Inhibin/Activin {beta}-B-Subunit Gene Transcription in Testicular Cells Mol. Endocrinol., November 1, 2000; 14(11): 1820 - 1835. [Abstract] [Full Text]
|
|
|
|
 |
|
 G. T. G. Chang, M. Steenbeek, E. Schippers, L. J. Blok, W. M. van Weerden, D. C. J. G. van Alewijk, B. H. J. Eussen, G. J. van Steenbrugge, and A. O. Brinkmann Characterization of a Zinc-Finger Protein and Its Association With Apoptosis in Prostate Cancer Cells J Natl Cancer Inst, September 6, 2000; 92(17): 1414 - 1421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. R. Wooton-Kee and B. J. Clark Steroidogenic Factor-1 Influences Protein-Deoxyribonucleic Acid Interactions within the Cyclic Adenosine 3',5'-Monophosphate-Responsive Regions of the Murine Steroidogenic Acute Regulatory Protein Gene Endocrinology, April 1, 2000; 141(4): 1345 - 1355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Wang, X. Wang, and M. L. Adamo Two Putative GATA Motifs in the Proximal Exon 1 Promoter of the Rat Insulin-Like Growth Factor I Gene Regulate Basal Promoter Activity Endocrinology, March 1, 2000; 141(3): 1118 - 1126. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Teixeira, D. J. Kehas, R. Antun, and P. K. Donahoe Transcriptional regulation of the rat Mullerian inhibiting substance type II receptor in rodent Leydig cells PNAS, November 23, 1999; 96(24): 13831 - 13838. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Reinhart, S. C. Williams, B. J. Clark, and D. M. Stocco SF-1 (Steroidogenic Factor-1) and C/EBP{beta} (CCAAT/Enhancer Binding Protein-{beta}) Cooperate to Regulate the Murine StAR (Steroidogenic Acute Regulatory) Promoter Mol. Endocrinol., May 1, 1999; 13(5): 729 - 741. [Abstract] [Full Text]
|
|
|
|
|
|
I. Ketola, N. Rahman, J. Toppari, M. Bielinska, S. B. Porter-Tinge, J. S. Tapanainen, I. T. Huhtaniemi, D. B. Wilson, and M. Heikinheimo Expression and Regulation of Transcription Factors GATA-4 and GATA-6 in Developing Mouse Testis Endocrinology, March 1, 1999; 140(3): 1470 - 1480. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
