| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Reproductive Medicine and Neurosciences The Center for Molecular Genetic University of California, San Diego La Jolla, California 92037-0674
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
As a model of neuron-specific gene expression, we have investigated the mechanisms underlying the transcription of the hypothalamic factor GnRH in the GnRH-expressing hypothalamic cell-line, GT17. This cell line was created by targeted tumorigenesis in transgenic mice (4). Introduction of a hybrid gene composed of the rat GnRH 5'-flanking region coupled to the coding region for the SV40 T antigen oncogene into transgenic mice produced hypothalamic tumors from which the GT17 cell line was derived. This cell line is a clonal, differentiated, hypothalamic neuronal cell line that secretes GnRH. GnRH is the decapeptide hormone released from a small number of specialized neurons scattered throughout the hypothalamus that mediates central nervous system (CNS) control of reproduction. The GT1 cells are well suited as a model system for the study of the neuron-specific expression of the GnRH gene, since they have retained many characteristics of GnRH neurons in vivo, including distinct neuronal morphology (5), expression of differentiated neuronal markers (6), secretion of GnRH in response to appropriate signals (7, 8, 9, 10), and even pulsatile release of GnRH in cell culture (11, 12).
Transfection studies established that the precise activation of the rat GnRH gene in GT17 cells is dependent on two stretches of regulatory sequence: a 300-bp distal enhancer, located approximately 1.6 kb upstream of the transcription start site in the rat gene (13), and a proximal promoter sequence, located between -173 and -1 of the rat gene (14). The combination of these two sequences is sufficient to produce highly tissue-specific expression in transfections (13) and is sufficient to target expression to the small population of GnRH neurons in the anterior hypothalamus in vivo in transgenic mice (Mark A. Lawson and P. L. Mellon, unpublished observations). Both sequences are bound by multiple nuclear proteins that appear to cooperate in activating transcription of the GnRH gene. Several of these proteins have been detected in other cell lines (13); S. A. Eraly and P. L. Mellon, unpublished observations) indicating that expression of the GnRH gene may be controlled by multiple factors in combination rather than an individual cell type-specific factor.
Further investigations have demonstrated that the activity of the enhancer is critically dependent on the binding of the POU-homeodomain protein Oct-1 (15). The converse, however, does not hold: the binding of Oct-1 alone is not sufficient for the functioning of the enhancer. Oct-1 is known to be present in a variety of tissues and cell types (16) and is believed to participate in tissue-specific gene expression by virtue of interaction either with other transcription factors (17, 18) or with tissue-specific coactivators (19, 20). Thus, the function of Oct-1 in tissue-specific expression of GnRH might involve interactions with the other proteins binding the enhancer and promoter and/or with specific coactivators.
A large proportion of the proximal sequence (-175 to -13 of the rat gene) involved in the hypothalamic regulation of GnRH has been evolutionarily conserved, with approximately 80% of the nucleotides identical between rat, mouse, and human, while flanking sequences manifest scant homology. In human and other primates, an alternative promoter 579 bp upstream of the one identified in human hypothalamic mRNA is used in nonhypothalamic tissues that express GnRH mRNA, such as placenta, mammary gland, and gonads (21, 22). Transfections of the human 5'-flanking region into mouse GT17 hypothalamic cells did not provide evidence of activity from the upstream start site; only the proximal start site homologous to that in the rat and mouse genes was active (23). Furthermore, there is no evidence for the use of an upstream region of the mouse or rat genes as a promoter in any tissue, and it is not homologous to the upstream region of the human gene. Thus, the proximal region of the rat GnRH gene likely serves as the only promoter in rodent hypothalamic cells.
The promoter-proximal region of the GnRH gene plays a role not only in transcription of the GnRH gene in hypothalamic cells but is also a target for hormonal regulation. Down-regulation of kinase C activity by prolonged treatment with phorbol esters represses transcription of the rat GnRH gene (24). This effect is localized to the promoter region between -127 and -13 of the rat gene (14, 25, 26). Glucocorticoids also repress GnRH gene expression in GT17 cells (which contain glucocorticoid receptor) (27). This effect is mediated by two regions between -216 and -150 of the mouse gene that bind glucocorticoid receptor in vitro (28). Progesterone can also repress GnRH gene expression, but only with the cotransfection of a progesterone receptor expression vector, since progesterone receptors are not present in GT17 cells (29). This regulatory activity targets the region between -171 and -73 of the rat GnRH gene and progesterone receptor can bind to this region in vitro.
Our previous studies have shown that the evolutionarily conserved promoter-proximal region of the rat gene (-175 to -13) contains seven closely spaced binding sites, designated footprints 17 in accordance with their proximity to the transcription start site (14). Truncation of the promoter region to less than 173 bp decreases activity progressively (14, 27, 30). Furthermore, excision of an internal block of sequence containing footprints 5, 4, and 3 led to a 2-fold decrease in transcriptional activity, and internal deletion of footprint 2 led to a dramatic 20-fold decrease in activity, indicating the role of these sequences in maintaining optimal transcription of the GnRH gene (14). Thus, these promoter-proximal sequences appear to have been conserved due to their importance in GnRH expression.
In the present study we have undertaken a systematic mutagenesis of footprints 5, 4, 3, and 2, to identify the elements within them that are critical for activity. Analysis of protein binding to the mutated promoter reveals the presence of three overlapping, but independent, protein-binding sites within footprint 2. Mutations that abolish binding to any of the three sites within footprint 2 decrease transcription. Similarly, mutation of footprint 4, but not 5 or 3, leads to a decrease in GnRH transcription. Finally, we demonstrate that Oct-1 binds both footprint 4 and the 3'- region of footprint 2, but not mutated sequences, indicating that Oct-1 functions through both the distal enhancer and the proximal promoter in the regulation of the GnRH gene.
| RESULTS |
|---|
|
|
|---|
|
Footprint 2 occupies a 51-nucleotide stretch, from -76 to -26 (Fig. 1
), suggesting that it might encompass more than one protein-binding
site. The upstream half of footprint 2 contains an E box located at
-64 that conforms to the extended consensus recognition motif
GCAGGTGT, which has been described for the proneural subfamily of
helix-loop-helix proteins (including the Drosophila proteins
Achaete and Scute, and the mammalian proteins MASH-1 and -2) (32).
Footprint 2 also contains a CCAAT box located at -56, just 2 bases
from the 3'-terminus of the E box. However, it should be noted that
neither the E box nor the CCAAT box has been evolutionarily conserved
across the rat, mouse, and human species (14). The downstream half of
footprint 2 contains a potential octamer-binding site in the antisense
direction, between -47 and -40. Although this site, ATGAGGAA, is only
a four of eight match, it contains the highly conserved As at
positions 1 and 7 and is partially conserved between the rat, mouse,
and human GnRH genes. Footprint 2 is positioned very close to the
putative TATA box of the GnRH gene, which is only 7 bases downstream of
its 3'-terminus.
Seven block replacement mutations were designed within footprint 2,
replacing virtually every nucleotide within the footprint (Fig. 1
). The
placement of the mutations was guided by two considerations: first, to
target the potential transcription factor-binding sites described above
and second, to create evenly spaced mutations with substantial overlap,
ensuring disruption of all protein-binding sites in footprint 2. The
mutations were designated m2a through m2g according to their relative
position in the 5'- to 3'-direction (Fig. 1
). The 5'-most mutation,
m2a, replaces the first 3 bases of the E box. Mutations m2b and m2c are
located directly over the E box and CCAAT box, respectively. M2e
disrupts three of the four octamer consensus bases of the potential
octamer site, including the conserved A at position 1, but sparing the
A at position 7, while m2f mutates positions 1 and 2 of this site. M2g,
the 3'-most mutation, overlaps m2f and ends five nucleotides from the
3'-end of footprint 2.
Footprint 2 Contains at Least Three Independent Protein-Binding
Sites
Deoxyribonuclease I (DNase I) protection (footprinting) assays of
the footprint 2 mutants were performed using nuclear extracts from the
GnRH-expressing hypothalamic cell-line, GT17 (Fig. 2A
). If footprint 2 contains multiple,
independent binding sites, then individual mutations should
specifically disrupt individual elements. Thus, footprinting of the
mutants would delineate the boundaries of the remaining protein-binding
sites, and the collective analysis of the protection patterns of the
mutants would indicate the borders of individual component sites within
footprint 2. As expected, the placement of the mutations locally
altered the nucleotides preferentially cleaved by DNase I, so that the
protection pattern for each mutant had to be determined by comparison
with the cleavage pattern obtained for that mutant in the absence of
nuclear extract. The precise protection patterns of the mutants were
confirmed by additional footprinting experiments conducted under
varying conditions of DNase I cleavage and using different quantities
of nuclear extract (data not shown).
|
Thus, three binding sites are defined. The boundaries of the
upstream binding site are -76 and -53, those of the middle site are
-61 and -46, and those of the downstream site are -50 and -28. The
downstream site therefore encloses the four hypersensitive sites (at
-43 to -45 and at -33) that form on the wild-type sequence. The
upstream site contains the E box discussed earlier, while the middle
site contains the CCAAT box, and the downstream site contains the
octamer-like motif. While our results indicate that footprint 2
contains at least three independent protein-binding sites, further
experiments utilizing gel shift assays indicate the presence of more
than three proteins occupying these sites (see Fig. 4
and below),
suggesting either that some of the proteins interacting with footprint
2 might be dependent on one another binding (such that prevention of
binding at one site results in loss of binding to a distinct site), or
that multiple proteins bind to individual sites.
|
Each of the Three Binding Sites Within Footprint 2 Contributes to
GnRH Transcription
We had previously demonstrated that the presence of footprint 2 is
critical for transcription of the GnRH gene, as excision of this
51-bp sequence resulted in a 20-fold decrease in activity (14). Here we
have investigated the transcriptional activity of the block mutants to
identify the sequence elements important for the activity of footprint
2. As described earlier, the mutations were introduced into the
reporter-expression vector that contained the GnRH enhancer directing
transcription of the CAT reporter gene from the -173 GnRH promoter.
The resulting mutant plasmids were transfected along with the wild-type
expression plasmid into GT17 cultures for determination of
transcriptional activity (Fig. 3A
).
Mutations m2a and m2b, which both disrupt the upstream binding site in
footprint 2, cause very similar decreases in basal transcription,
decreasing activity approximately 55% relative to that of the
wild-type gene. Mutations m2c and m2d, which disrupt the middle site,
decrease activity to different degrees: mutation m2c causes the
greatest decrease in activity of all the mutations, 75%, while m2d
represses activity only 40%. While both mutations disrupt in
vitro binding to a similar degree, it is possible that m2c has a
greater effect in vivo. Alternatively, it is possible that
either mutation might have functional consequences in addition to
inactivation of the binding site for the proposed middle protein. For
example, m2c, while disrupting the middle site, could also be situated
in such a manner as to interfere with interactions between the proteins
bound to the intact upstream and downstream binding sites. In either
case, as discussed earlier, the finding that these mutations decrease
activity supports the existence of the proposed middle protein-binding
site. Mutations m2f and m2g, which disrupt the downstream site,
decrease activity 55% and 40%, respectively. Mutation m2e is the
least deleterious of the mutations, only decreasing activity 25%,
possibly because, as indicated by the footprints, m2e retains more
protein binding than m2f and m2g.
|
Oct-1 Binds to Footprint 2
Previous studies in our laboratory have demonstrated that
the POU-homeodomain factor, Oct-1, is present in GT17 cells, that
this protein binds two sequences in the GnRH upstream enhancer, and
that binding to one of these sites is critically required for
transcription of the GnRH gene (15). As noted earlier, the downstream
site in footprint 2 contains an octamer-like motif (-47 to -40). To
determine whether Oct-1 binds this promoter element, mobility shift
cross-competition and antibody shift experiments were performed (Fig. 4
).
An oligonucleotide probe representing the sequence from -63 to -33 (-63/-33) was synthesized, centered over the potential octamer motif that falls within the downstream site. The -63/-33 oligonucleotide includes the entire middle site as well as a significant portion of the downstream site. This extended sequence was chosen for the gel shift experiments because a shorter sequence containing only the octamer motif did not form specific complexes in preliminary experiments (data not shown), and the longer PCR-generated probe encompassing the entire length of footprint 2 (-82 to -22) used previously (14) led to difficulties in quantification of the competitor oligonucleotides. The -63 to -33 probe formed several complexes with GT17 nuclear extract, of which five (termed 1 to 5) are specific, as indicated by their ability to be effectively self-competed. Since this probe excludes the upstream site in footprint 2, the five complexes here (1 to 5) do not directly correspond to those designated C1 to C4 in the previous paper (14).
Cross-competition with an Oct-1 consensus oligonucleotide results in
the loss of complex 5, indicating the presence of an octamer-binding
protein within this complex (Fig. 4
, lane 3). Inclusion of an antibody
against Oct-1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) results
in the specific diminution of complex 5, whereas incubation with
nonspecific IgG has no effect. The other four complexes are not
specifically affected by the Oct-1 antibody. These data suggest that
Oct-1 is present in complex 5 and binds to the divergent octamer motif
within the downstream site of footprint 2. Additionally, an
oligonucleotide containing point mutations in the highly conserved
positions 1 and 7 of the potential octamer site (m2oct) forms a greatly
reduced complex 5, validating this sequence as a true octamer-binding
site. There is another possible octamer site at -54 to -47 in the
antisense direction; however, it is unlikely that this other site is
bound by an octamer family protein, since the only footprint 2 complex
that is competed by the octamer consensus sequence and disrupted by the
Oct-1 antibody is reduced by the mutation in m2oct, which leaves this
other site intact. The m2oct mutant forms a weaker complex 1, a band
that is not cross-competed with the octamer consensus oligonucleotide.
This complex thus likely represents a non-octamer protein that binds in
the same region as the octamer site (see below).
To determine which of the footprint 2 sites (middle or downstream) the remaining complexes (1 through 4) bind, we used mutant probes that lacked binding to either the middle site (m2c block mutation, described earlier) or to the downstream site (m2e block mutation). As expected, complex 5 (Oct-1) and complex 1 are greatly reduced by the m2e mutation, corroborating the binding of the corresponding proteins in the downstream site of footprint 2. Complex 4 is eliminated by the m2c mutation, indicating that it binds to the middle protein binding site. Complex 3 is eliminated by either block mutation (but not by the octamer point mutation). It is possible that the formation of this complex either involves protein-protein interactions necessitating the presence of intact contiguous binding sites or requires bases that overlap both the middle and downstream sites. Conversely, complex 2 is retained in both block mutations, suggesting that the corresponding protein either is equally capable of binding both middle and downstream sites or is held in place by protein-protein interactions even when its DNA recognition sequence has been disrupted.
Footprint 4 Contributes to GnRH Transcription
As noted above, excision of an internal block of sequence
containing footprints 5, 4, and 3 led to a 2-fold decrease in
transcriptional activity, indicating the role of these sequences in
maintaining optimal transcription of the GnRH gene (14). To assess the
role of each footprinted element individually, we tested the
transcriptional activity of the mutated promoter regions shown in Fig. 1
. First, to confirm that the mutations introduced into footprints 5
and 4 had indeed eliminated protein binding at those sites, mobility
shift analyses were performed (Fig. 5
).
As described earlier, footprint 3 does not form detectable protein-DNA
complexes in mobility shift assays (14). Oligonucleotide probes
corresponding to footprints 5 and 4, and to the mutant sequences m5,
m4a, and m4b, were incubated with GT17 nuclear extract in the
presence or absence of homologous or heterologous competitors, and the
resulting complexes were resolved by gel electrophoresis. As in our
previous studies (14), footprint 4 forms multiple specific complexes
with GT17 nuclear proteins, none of which are effectively competed by
either mutant m4a or m4b. Correspondingly, when used as probes, neither
m4a nor m4b forms specific complexes. Footprint 5 forms a single major
complex with GT17 nuclear extract, which is not competed by the
mutant oligonucleotide, m5. The probe corresponding to m5 does,
however, form a faint novel complex that is specific (i.e.
was abolished with self-competition). As expected, this complex is not
competed by the wild-type sequence, indicating that the introduction of
the mutation, while destroying the native protein-binding site, has
resulted in the formation of a weak new binding site.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Functional analysis reveals that while deletion of the entire footprint 2 sequence leads to a 20-fold decrease in activity (14), mutation of individual protein-binding sites decreases activity only 2- to 4-fold. Simultaneous mutation of any two sites (leaving one intact), results in an approximately 5-fold decrease in activity. Thus as each of the three sites in footprint 2 contributes less than a third of the activity of the footprint, they interact to have a synergistic effect on transcription. The existence of protein-protein interactions within footprint 2 mediating this synergy is suggested by the proximity of the three footprint 2 binding sites as well as the finding in mobility shift assays that complex 3 requires the presence of both the middle and downstream sites, while complex 2 can form in the presence of either site alone. Elimination of the middle binding site by mutation m2c results in the largest decrease in activity of all the mutants, approximately 75%, indicating the importance of the corresponding protein(s) in transcription of the GnRH gene. It is possible that proteins binding this middle site serve as a bridge facilitating interactions between the upstream and downstream sites, thus permitting the synergistic activation of the entire footprint 2 complex.
The upstream protein-binding site within footprint 2 (between positions -76 and -53) contains the sequence GCAGGTGT (eccentrically located between -65 and -58), a motif that conforms to the extended consensus described for the proneural subfamily of Drosophila basic-helix-loop-helix proteins (32). Two mammalian homologs of Drosophila proneural proteins have been described: MASH-1 and -2 (33). Gene knockout studies of MASH-1 have indicated that it functions in the development of the autonomic, enteric, and olfactory branches of the nervous system (34). GnRH neurons originate in the olfactory placode before migrating to the hypothalamus early in embryonic development (35). Thus it seems plausible that MASH-1 might be present in GnRH neurons and might function in the transcription of the GnRH gene. However, we determined that this protein does not bind the GnRH promoter. In mobility shift assays, the upstream footprint 2 sequence was found not to compete for binding to the proneural protein-specific oligonucleotide, but rather to form complexes of distinct mobility that did not react with the MASH-1-specific antibody (data not shown). The Mad family of mammalian basic-helix-loop-helix proteins is found in neural tissues during development. They form heterodimers with Max and repress transcription from CACGTG-binding sites (36). However, the E box in the GnRH footprint 2 sequence is CAGGTG, and it likely binds an activator since the m2b mutation decreases expression. Thus, the identity of the protein binding the upstream site in footprint 2 is likely a basic-helix-loop-helix protein activator, but it remains to be determined.
The proposed middle binding site is almost precisely centered on a CCAAT box, a sequence that was originally identified as a potential cis-acting promoter element within a number of eukaryotic genes. It has since been recognized that CCAAT boxes are bound by disparate proteins, including CCAAT-box binding factor (CBF) (37), multimeric CBF (38), CCAAT transcription factor (39), and the well characterized CCAAT/enhancer binding protein (C/EBP) family of transcription factors (40). C/EBP-ß is present in the GT17 neurons as demonstrated by mobility antibody supershift experiments and Western blotting (Denise D. Belsham, personal communication; and S. B. Nelson and P. L. Mellon, unpublished observations). However, the protein(s) that bind to footprint 2 do not interact with an antibody against C/EBP-ß (data not shown).
Both footprint 4 and the downstream element in footprint 2 contain octamer-like motifs that are bound by Oct-1. Although these motifs are somewhat divergent from the octamer consensus sequence, Oct family proteins are known to interact with AT-rich sequences with relaxed specificity (31). Both complex 5 in footprint 2 and the major complex in footprint 4 are inhibited by the Oct-1 antibody, but the footprint 4 complex is not completely inhibited by the antibody. This result indicates a qualitative difference between the protein-DNA interactions in footprint 4 and complex 5. It is possible that the binding of Oct-1 in complex 5 involves protein-protein interactions, such as those previously demonstrated for this protein in other contexts (see below).
In the mouse GnRH promoter region, two elements have been identified as negative glucocorticoid-responsive elements or nGREs (28). One of these elements overlaps with the region homologous to footprint 4 (the distal nGRE) while the other is homologous to the upstream part of footprint 2 (the proximal nGRE). Oct-1 binding was demonstrated in one of five complexes bound to a distal nGRE probe that overlaps the homology to footprint 4, and glucocorticoid receptor was shown to be associated with the same complex. Although Oct-1 was not found binding to the probe for the proximal nGRE, this probe did not include the downstream region of DNA that contains the footprint 2 octamer site. Thus, Oct-1 may also be involved in hormonal regulation of the GnRH gene through at least the footprint 4 region.
The binding of Oct-1 to footprints 2 and 4 indicates a role for this protein in the function of the GnRH promoter, in addition to its previously demonstrated critical role in the activity of the upstream enhancer (15). Interestingly, while Oct-1 is expressed in most tissues and cell lines, it is not widely expressed within the CNS (41, 42). Thus, within the CNS, Oct-1 might serve as a cell type-specific factor, serving to restrict expression of the GnRH gene to the hypothalamus. Furthermore, while we are unable to detect such interactions in vitro, it is possible that the octamer sequences in the GnRH enhancer and promoter are bound in vivo by the other POU-homeodomain proteins Oct-2, Brain-3, and SCIP/Tst-1, that are known to be present in GT1 neurons (15, 43). In fact, SCIP/Tst-1 represses GnRH promoter expression when overexpressed in GT1 cells by cotransfection, and purified bacterially expressed SCIP/Tst-1 binds in vitro to footprint 4 (43).
Finally, it is intriguing to speculate that the presence of octamer motifs in both the enhancer and the promoter of the GnRH gene serves to facilitate interactions between these two regulatory regions, which are separated by more than 1.5 kb of sequence. In support of this hypothesis is the fact that Oct-1 has been shown to participate in both homotypic and heterotypic interactions. Studies of homodimer formation by Oct-1 in vitro demonstrated that the POU domain will form dimers in solution and that association with an octamer DNA-binding site will stabilize this interaction (44). Oct-1 also interacts with other transcription factors such as the glucocorticoid receptor, which it recruits to the mouse GnRH promoter (45), an F9 embryonal carcinoma cell- specific factor, Fx (46), a helix-loop-helix protein (47), NF-1 (48), and with other POU homeodomain factors such as Pit-1/GHF-1 (17), Oct-3 (49), Oct-2, and Oct-6 (44). Most interestingly, Oct-1 associates with the B cell-specific coactivator OBF-1/Bob-1, as well as herpesvirus VP16 (20, 50). In the B cell, Oct-1 binding was thought to signify general but not tissue-specific activation of gene expression. However, with the discovery of the B cell-specific coactivator, Oct-1 binding became a potential indication of tissue-specific activity. In the case of Oct-1 activation of the GnRH enhancer and promoter in GnRH neurons, it will be important to identify any Oct-1 coactivators and determine their tissue distribution to understand the role of Oct-1 in GnRH gene expression and neuron-specific gene expression. Further investigations utilizing mutational analyses of regulatory elements, along with studies of protein-protein interactions, should help clarify the vital role of Oct-1 in GnRH transcription, as well as shed light on the molecular mechanisms underlying the interactions between the enhancer and promoter of the GnRH gene.
| MATERIALS AND METHODS |
|---|
|
|
|---|
32P]dATP,
3000 Ci/mmol, and Sequenase (U.S. Biochemical Corp., Cleveland, OH)
under conditions described by the manufacturer.
Cell Culture and Transfections
Cell culture and transfections were carried out as previously
described (14). Briefly, GT17 neurons were maintained in DMEM
supplemented with 10% FCS, penn/strep, and 4.5 mg/ml glucose in an
atmosphere with 5% CO2. Transfections were performed using
calcium phosphate precipitates (52) containing 15 µg of CAT
expression vector DNA and 3 µg of the internal control plasmid Rous
sarcoma virus (RSV) ß-galactosidase (53). GT17 cells were incubated
with precipitates for 1416 h and then rinsed and given fresh medium,
and cells were harvested after an additional 2426 h. Protein extracts
were prepared by freeze-thawing as previously described (54), and
protein concentrations were determined using the Bio-Rad protein assay
reagent (Bio-Rad, Richmond, CA) according to the manufacturers
directions. CAT assays (55) and ß-galactosidase assays were performed
as previously described (53) or using the Galacto-light Plus assay kit
from Tropix (Bedford, MA) (Figs. 3B
and 6
).
Nuclear Extract Preparation and DNase I Protection Analysis
Nuclear extracts were prepared according to the method described
by Schreiber et al. (56). DNase I protection reactions were
performed as previously described (14). Briefly, probes contained the
GnRH promoter sequence from -173 to +112 of either the wild-type gene
or the various linker scanner mutants. These probes were prepared from
the wild-type and mutant plasmids described above and were labeled
using Klenow and [
32P]dATP (3000 Ci/mmole) at the
XbaI site in the polylinker between the enhancer and the
-173 GnRH promoter. The labeled fragments were subsequently redigested
with XhoI, which cleaves at +112 of the GnRH promoter, to
generate probes labeled on the bottom strand, which were purified from
a 1.5% agarose gel. DNase I protection analysis was performed using 1
fmol of probe and 50 µg of GT17 crude nuclear extract in 50 µl
reactions, and as described (57).
Mobility Shift and Supershift Assay
Annealed wild-type and mutant oligonucleotides (20 ng)
containing sequences of the GnRH promoter and consensus sequences were
filled in with
[32P]dATP (3000 Ci/mmol, Dupont NEN,
Boston, MA) and Klenow using standard procedures (51). Probes were gel
purified by 6% nondenaturing PAGE, crushed, and soaked overnight and
phenol-chloroform extracted. In Fig. 4
, the competitor oligonucleotide
was filled in with Klenow, and an alternative probe purification method
was used: after standard labeling procedures, probes were
phenol/chloroform extracted and passed over G-50 micro columns
(Pharmacia Biotech, Piscataway, NJ). Probes were counted in a
scintillation counter and diluted in 50 mM NaCl. Binding
reactions were carried out in 10 mM HEPES-KOH, pH 7.8, 50
mM KCl, 1 mM EDTA, 5 mM spermidine,
5 mM dithiothreitol, 0.2 mg/ml BSA, 0.5 mM
phenylmethylsulfonylfluoride, 12.525 µg/ml
polydeoxyinosinic-deoxycytidylic acid, 10% (vol/vol) glycerol, and 20
mg/ml Ficoll; 20,000 cpm or 1 fmol, as indicated, of each probe was
incubated with 2 µg GT17 crude nuclear extract in 20 µl
reactions. Reactions were incubated at room temperature for 5 min,
loaded, with current on, into a 5% polyacrylamide gel (30:1
acrylamide/bisacrylamide, 0.25 x TBE [130 mM Tris,
45 mM boric acid, 2.5 mM EDTA], 5% glycerol),
and electrophoresed for 2 h at 175 V. Gels were prerun for 30 min
in 0.25 x TBE. After electrophoresis, gels were dried and
subjected to autoradiography. Competition reactions were performed by
preincubating the reactions with the specified amount of excess
unlabeled oligonucleotide for 20 min before the addition of probe.
Supershift assays were performed by adding 1 µl of Oct-1 antibody
(sc-232 X, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or rabbit
IgG control to the complete reaction and incubating at room temperature
for 1 h before adding labeled oligonucleotide probe and loading
onto gel as above.
Oligonucleotide Sequences
The top and bottom strands of the FP5 oligonucleotide correspond
to the GnRH sequences -128 to -114 and -124 to -110, respectively;
the top and bottom strands of the FP4 oligonucleotide correspond to the
sequences -109 to -94 and -104 to -89. The mutant oligonucleotides
were identical to the wild-type oligonucleotides except for the
substitution of the sequence 5'-GCGGCCGC-3' at the following positions:
-123 to -116, -105 to -98, and -100 to -93, for the
oligonucleotides m5, m4a, and m4b, respectively. The -63/-33
oligonucleotide corresponds to the sequences -63 to -38, and -59 to
-33. The T residues at positions -46 and -40 were changed to G
residues to make the m2oct oligonucleotide. The m2c and m2e
oligonucleotides are identical to the -63/-33 oligonucleotide except
for the substitution of 5''- GCGGCCGC-3'' at -58 to -51 and -45 to
-38, respectively. The top strand of the Oct-1 consensus
oligonucleotide sequence is as follows; TGTCGAATGCAAATCACTAGAA (Santa
Cruz Biotechnology, Inc.).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by NIH Grant DK-44838 (to P.L.M.). S.B.N. was supported by NIH Training Grants AG-00216 and DK-07541.
1 These authors contributed equally. ![]()
2 Present address: University of California, Irvine, c/o Office of
Educational Affairs, Medical Education 802, Room 252, Box 4089, Irvine
California 92697-4089. ![]()
Received for publication September 9, 1997. Revision received January 6, 1998. Accepted for publication January 9, 1998.
| REFERENCES |
|---|
|
|
|---|
-aminobutyric acid type A receptors. Mol Pharmacol 42:197202[Abstract]
This article has been cited by other articles:
![]() |
C. Zhou, Y. Tong, K. Wawrowsky, S. Bannykh, I. Donangelo, and S. Melmed Oct-1 induces pituitary tumor transforming gene expression in endocrine tumors Endocr. Relat. Cancer, September 1, 2008; 15(3): 817 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Pak, W. C. J. Chung, J. L. Roberts, and R. J. Handa Ligand-Independent Effects of Estrogen Receptor {beta} on Mouse Gonadotropin-Releasing Hormone Promoter Activity Endocrinology, April 1, 2006; 147(4): 1924 - 1931. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Tang, M. Mazur, and P. L. Mellon The Protein Kinase C Pathway Acts through Multiple Transcription Factors to Repress Gonadotropin-Releasing Hormone Gene Expression in Hypothalamic GT1-7 Neuronal Cells Mol. Endocrinol., November 1, 2005; 19(11): 2769 - 2779. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Rave-Harel, N. L. G. Miller, M. L. Givens, and P. L. Mellon The Groucho-related Gene Family Regulates the Gonadotropin-releasing Hormone Gene through Interaction with the Homeodomain Proteins MSX1 and OCT1 J. Biol. Chem., September 2, 2005; 280(35): 30975 - 30983. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-Y. Kam, K.-H. Jeong, E. R. Norwitz, E. M. Jorgensen, and U. B. Kaiser Oct-1 and Nuclear Factor Y Bind to the SURG-1 Element to Direct Basal and Gonadotropin-Releasing Hormone (GnRH)-Stimulated Mouse GnRH Receptor Gene Transcription Mol. Endocrinol., January 1, 2005; 19(1): 148 - 162. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Givens, R. Kurotani, N. Rave-Harel, N. L. G. Miller, and P. L. Mellon Phylogenetic Footprinting Reveals Evolutionarily Conserved Regions of the Gonadotropin-Releasing Hormone Gene that Enhance Cell-Specific Expression Mol. Endocrinol., December 1, 2004; 18(12): 2950 - 2966. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Rave-Harel, M. L. Givens, S. B. Nelson, H. A. Duong, D. Coss, M. E. Clark, S. B. Hall, M. P. Kamps, and P. L. Mellon TALE Homeodomain Proteins Regulate Gonadotropin-releasing Hormone Gene Expression Independently and via Interactions with Oct-1 J. Biol. Chem., July 16, 2004; 279(29): 30287 - 30297. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Kelley, M. L. Givens, N. Rave-Harel, S. B. Nelson, S. Anderson, and P. L. Mellon Neuron-Restricted Expression of the Rat Gonadotropin-Releasing Hormone Gene Is Conferred by a Cell-Specific Protein Complex that Binds Repeated CAATT Elements Mol. Endocrinol., November 1, 2002; 16(11): 2413 - 2425. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Vazquez-Martinez, G. M. Leclerc, M. E. Wierman, and F. R. Boockfor Episodic Activation of the Rat GnRH Promoter: Role of the Homeoprotein Oct-1 Mol. Endocrinol., September 1, 2002; 16(9): 2093 - 2100. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Moriguchi, T. Sakurai, S. Takahashi, K. Goto, and M. Yamamoto The Human Prepro-orexin Gene Regulatory Region That Activates Gene Expression in the Lateral Region and Represses It in the Medial Regions of the Hypothalamus J. Biol. Chem., May 3, 2002; 277(19): 16985 - 16992. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Fan, S. Jin, T. Tong, H. Zhao, F. Fan, M. J. Antinore, B. Rajasekaran, M. Wu, and Q. Zhan BRCA1 Regulates GADD45 through Its Interactions with the OCT-1 and CAAT Motifs J. Biol. Chem., March 1, 2002; 277(10): 8061 - 8067. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Kim, A. Wolfe, G. R. Smith, S. A. Tobet, and S. Radovick Promoter Sequences Targeting Tissue-specific Gene Expression of Hypothalamic and Ovarian Gonadotropin-releasing Hormone in Vivo J. Biol. Chem., February 8, 2002; 277(7): 5194 - 5202. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-W. Dong, H.-M. Zheng, Z.-Y. Wen, and Z.-G. Chen The POU Homeodomain Protein Oct-1 Binds Cis-Regulatory Element Essential for the Human GnRH Upstream Promoter Activity in JEG-3 Cells J. Clin. Endocrinol. Metab., June 1, 2001; 86(6): 2838 - 2844. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Andersen and M. G. Rosenfeld POU Domain Factors in the Neuroendocrine System: Lessons from Developmental Biology Provide Insights into Human Disease Endocr. Rev., February 1, 2001; 22(1): 2 - 35. [Abstract] [Full Text] |
||||
![]() |
H. Zhao, S. Jin, F. Fan, W. Fan, T. Tong, and Q. Zhan Activation of the Transcription Factor Oct-1 in Response to DNA Damage Cancer Res., November 1, 2000; 60(22): 6276 - 6280. [Abstract] [Full Text] |
||||
![]() |
S. B. Nelson, M. A. Lawson, C. G. Kelley, and P. L. Mellon Neuron-Specific Expression of the Rat Gonadotropin-Releasing Hormone Gene Is Conferred by Interactions of a Defined Promoter Element with the Enhancer in GT1-7 Cells Mol. Endocrinol., September 1, 2000; 14(9): 1509 - 1522. [Abstract] [Full Text] |
||||
![]() |
D.R. Corley, X. Li, Z.M. Lei, and Ch.V. Rao Potential regulation of GnRH gene by a steroidogenic factor-1-like protein Mol. Hum. Reprod., August 1, 2000; 6(8): 671 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dobi, M. Palkovits, C. G. Palkovits, M. A. Ring, and D. v. Agoston Septamer Element-Binding Proteins in Neuronal and Glial Differentiation J. Neurosci., February 1, 2000; 20(3): 1073 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Gonzalez and D. M. Robins Oct-1 Preferentially Interacts with Androgen Receptor in a DNA-dependent Manner That Facilitates Recruitment of SRC-1 J. Biol. Chem., February 23, 2001; 276(9): 6420 - 6428. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |