help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eraly, S. A.
Right arrow Articles by Mellon, P. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eraly, S. A.
Right arrow Articles by Mellon, P. L.
Molecular Endocrinology 12 (4): 469-481
Copyright © 1998 by The Endocrine Society

Oct-1 Binds Promoter Elements Required for Transcription of the GnRH Gene

Satish A. Eraly1, Shelley B. Nelson1, Karen M. Huang2 and Pamela L. Mellon

Departments of Reproductive Medicine and Neurosciences The Center for Molecular Genetic University of California, San Diego La Jolla, California 92037-0674


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The GnRH gene is exclusively expressed in a discrete population of neurons in the hypothalamus. The promoter-proximal 173 bp of the rat GnRH gene are highly conserved through evolution and are bound by multiple nuclear proteins found in the neuronal cell line, GT1–7, a model for the GnRH-expressing hypothalamic neuron. To explore the protein-DNA interactions that occur within this promoter and the role of these interactions in targeting GnRH gene expression, we have mutagenized individual binding sites in this region. Deoxyribonuclease I protection experiments reveal that footprint 2, a 51-bp sequence that confers a 20-fold induction of the GnRH gene, is comprised of at least three independent protein-binding sites. Transfections of the GnRH promoter-reporter plasmid containing a series of block mutations of footprint 2 into GT1–7 neurons indicate that each of the three putative component sites contributes to transcriptional activity. Mutations in footprint 4 also decrease GnRH gene expression. Footprint 4 and the promoter-proximal site in footprint 2 contain octamer-like motifs, an element that is also present in the neuron-specific enhancer of the rat GnRH gene located approximately 1.6 kb upstream of the promoter. Previous studies in our laboratory have demonstrated that two enhancer octamer sites are bound by the POU-homeodomain transcription factor Oct-1 in GT1–7 cells. We now show that Oct-1 binds the octamer motifs within footprints 2 and 4. Thus, Oct-1 plays a critical role in the regulation of GnRH transcription, binding functional elements in both the distal enhancer and the promoter-proximal conserved region.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The transcription of eukaryotic genes is characteristically controlled by interactions between multiple regulatory proteins that cooperate to restrict gene expression to the appropriate tissues and physiological conditions (1, 2, 3). Thus, a limited number of factors used in various combinations permits widely distributed proteins to participate in the regulation of tissue-specific gene expression.

As a model of neuron-specific gene expression, we have investigated the mechanisms underlying the transcription of the hypothalamic factor GnRH in the GnRH-expressing hypothalamic cell-line, GT1–7. This cell line was created by targeted tumorigenesis in transgenic mice (4). Introduction of a hybrid gene composed of the rat GnRH 5'-flanking region coupled to the coding region for the SV40 T antigen oncogene into transgenic mice produced hypothalamic tumors from which the GT1–7 cell line was derived. This cell line is a clonal, differentiated, hypothalamic neuronal cell line that secretes GnRH. GnRH is the decapeptide hormone released from a small number of specialized neurons scattered throughout the hypothalamus that mediates central nervous system (CNS) control of reproduction. The GT1 cells are well suited as a model system for the study of the neuron-specific expression of the GnRH gene, since they have retained many characteristics of GnRH neurons in vivo, including distinct neuronal morphology (5), expression of differentiated neuronal markers (6), secretion of GnRH in response to appropriate signals (7, 8, 9, 10), and even pulsatile release of GnRH in cell culture (11, 12).

Transfection studies established that the precise activation of the rat GnRH gene in GT1–7 cells is dependent on two stretches of regulatory sequence: a 300-bp distal enhancer, located approximately 1.6 kb upstream of the transcription start site in the rat gene (13), and a proximal promoter sequence, located between -173 and -1 of the rat gene (14). The combination of these two sequences is sufficient to produce highly tissue-specific expression in transfections (13) and is sufficient to target expression to the small population of GnRH neurons in the anterior hypothalamus in vivo in transgenic mice (Mark A. Lawson and P. L. Mellon, unpublished observations). Both sequences are bound by multiple nuclear proteins that appear to cooperate in activating transcription of the GnRH gene. Several of these proteins have been detected in other cell lines (13); S. A. Eraly and P. L. Mellon, unpublished observations) indicating that expression of the GnRH gene may be controlled by multiple factors in combination rather than an individual cell type-specific factor.

Further investigations have demonstrated that the activity of the enhancer is critically dependent on the binding of the POU-homeodomain protein Oct-1 (15). The converse, however, does not hold: the binding of Oct-1 alone is not sufficient for the functioning of the enhancer. Oct-1 is known to be present in a variety of tissues and cell types (16) and is believed to participate in tissue-specific gene expression by virtue of interaction either with other transcription factors (17, 18) or with tissue-specific coactivators (19, 20). Thus, the function of Oct-1 in tissue-specific expression of GnRH might involve interactions with the other proteins binding the enhancer and promoter and/or with specific coactivators.

A large proportion of the proximal sequence (-175 to -13 of the rat gene) involved in the hypothalamic regulation of GnRH has been evolutionarily conserved, with approximately 80% of the nucleotides identical between rat, mouse, and human, while flanking sequences manifest scant homology. In human and other primates, an alternative promoter 579 bp upstream of the one identified in human hypothalamic mRNA is used in nonhypothalamic tissues that express GnRH mRNA, such as placenta, mammary gland, and gonads (21, 22). Transfections of the human 5'-flanking region into mouse GT1–7 hypothalamic cells did not provide evidence of activity from the upstream start site; only the proximal start site homologous to that in the rat and mouse genes was active (23). Furthermore, there is no evidence for the use of an upstream region of the mouse or rat genes as a promoter in any tissue, and it is not homologous to the upstream region of the human gene. Thus, the proximal region of the rat GnRH gene likely serves as the only promoter in rodent hypothalamic cells.

The promoter-proximal region of the GnRH gene plays a role not only in transcription of the GnRH gene in hypothalamic cells but is also a target for hormonal regulation. Down-regulation of kinase C activity by prolonged treatment with phorbol esters represses transcription of the rat GnRH gene (24). This effect is localized to the promoter region between -127 and -13 of the rat gene (14, 25, 26). Glucocorticoids also repress GnRH gene expression in GT1–7 cells (which contain glucocorticoid receptor) (27). This effect is mediated by two regions between -216 and -150 of the mouse gene that bind glucocorticoid receptor in vitro (28). Progesterone can also repress GnRH gene expression, but only with the cotransfection of a progesterone receptor expression vector, since progesterone receptors are not present in GT1–7 cells (29). This regulatory activity targets the region between -171 and -73 of the rat GnRH gene and progesterone receptor can bind to this region in vitro.

Our previous studies have shown that the evolutionarily conserved promoter-proximal region of the rat gene (-175 to -13) contains seven closely spaced binding sites, designated footprints 1–7 in accordance with their proximity to the transcription start site (14). Truncation of the promoter region to less than 173 bp decreases activity progressively (14, 27, 30). Furthermore, excision of an internal block of sequence containing footprints 5, 4, and 3 led to a 2-fold decrease in transcriptional activity, and internal deletion of footprint 2 led to a dramatic 20-fold decrease in activity, indicating the role of these sequences in maintaining optimal transcription of the GnRH gene (14). Thus, these promoter-proximal sequences appear to have been conserved due to their importance in GnRH expression.

In the present study we have undertaken a systematic mutagenesis of footprints 5, 4, 3, and 2, to identify the elements within them that are critical for activity. Analysis of protein binding to the mutated promoter reveals the presence of three overlapping, but independent, protein-binding sites within footprint 2. Mutations that abolish binding to any of the three sites within footprint 2 decrease transcription. Similarly, mutation of footprint 4, but not 5 or 3, leads to a decrease in GnRH transcription. Finally, we demonstrate that Oct-1 binds both footprint 4 and the 3'- region of footprint 2, but not mutated sequences, indicating that Oct-1 functions through both the distal enhancer and the proximal promoter in the regulation of the GnRH gene.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Block Replacement Mutagenesis of the GnRH Promoter
To investigate the functional and protein-binding activity of the conserved sequences in the promoter, we created mutations within footprints 5, 4, 3, and 2 (Fig. 1Go). The mutations were created by replacing 8-bp elements of native sequence with the recognition sequence for the restriction enzyme NotI, GCGGCCGC. These mutations were introduced into the expression plasmid directing transcription of the chloramphenicol acetyltransferase (CAT) reporter gene from the -173 GnRH promoter under the control of the GnRH enhancer (14), with the goal of utilizing the mutants in transfection experiments to identify the specific elements required for GnRH transcription.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. Positions of the Mutations Introduced into the Rat GnRH Promoter

The DNA sequence for the conserved promoter-proximal region is presented; the positions of the footprints are indicated by brackets, and the positions of the block replacement mutations are indicated by the black bars above the sequence. The dots indicate the position of every tenth nucleotide in the sequence (i.e. -30, -40, etc.). The individual mutations have been named m2a through m2g according to their relative positions in footprint 2. For each mutation, the indicated native sequence was replaced with the element GCGGCCGC, which corresponds to the recognition site for the restriction enzyme NotI.

 
Footprint 5 lies between -127 and -112, and footprint 4 occupies the sequence between -110 and -89. Footprint 3 is relatively short, extending from -79 to -85, and only can be detected on the sense strand. Additionally, in contrast to footprints 5 and 4, binding to footprint 3 cannot be detected in mobility shift assays (data not shown). Footprint 4 contains the sequence ATTAAAAT located toward the 5'-end of the footprint, between -106 to -99 on the bottom strand. This element represents a six of eight match to the octamer consensus, ATGCAAAT, the sequence recognized by members of the Oct family of transcription factors (31). Furthermore, the two most highly conserved bases, the A residues at positions 1 and 7, are retained in the GnRH sequence. Additionally, with the exception of the terminal T, this element in the GnRH gene has been entirely conserved across the rat, mouse, and human species (14). We created two mutations in the footprint 4 sequence. The first, m4a, is almost precisely centered on the octamer motif and retains only two of eight matched positions (the terminal T, and the G in position 3). The second, m4b, covers the 3'-end of footprint 4 and matches the octamer sequence at four of eight positions, with the conserved A at position 1 changed to G. The mutations in the smaller footprints 5 and 3 (m5 and m3) were centered within the corresponding protein-binding sites. All the nucleotides within these mutants are different from the wild-type sequence, with the exception of m4b, which has five of eight nucleotides altered from the wild-type sequence.

Footprint 2 occupies a 51-nucleotide stretch, from -76 to -26 (Fig. 1Go), suggesting that it might encompass more than one protein-binding site. The upstream half of footprint 2 contains an E box located at -64 that conforms to the extended consensus recognition motif GCAGGTGT, which has been described for the proneural subfamily of helix-loop-helix proteins (including the Drosophila proteins Achaete and Scute, and the mammalian proteins MASH-1 and -2) (32). Footprint 2 also contains a CCAAT box located at -56, just 2 bases from the 3'-terminus of the E box. However, it should be noted that neither the E box nor the CCAAT box has been evolutionarily conserved across the rat, mouse, and human species (14). The downstream half of footprint 2 contains a potential octamer-binding site in the antisense direction, between -47 and -40. Although this site, ATGAGGAA, is only a four of eight match, it contains the highly conserved A’s at positions 1 and 7 and is partially conserved between the rat, mouse, and human GnRH genes. Footprint 2 is positioned very close to the putative TATA box of the GnRH gene, which is only 7 bases downstream of its 3'-terminus.

Seven block replacement mutations were designed within footprint 2, replacing virtually every nucleotide within the footprint (Fig. 1Go). The placement of the mutations was guided by two considerations: first, to target the potential transcription factor-binding sites described above and second, to create evenly spaced mutations with substantial overlap, ensuring disruption of all protein-binding sites in footprint 2. The mutations were designated m2a through m2g according to their relative position in the 5'- to 3'-direction (Fig. 1Go). The 5'-most mutation, m2a, replaces the first 3 bases of the E box. Mutations m2b and m2c are located directly over the E box and CCAAT box, respectively. M2e disrupts three of the four octamer consensus bases of the potential octamer site, including the conserved A at position 1, but sparing the A at position 7, while m2f mutates positions 1 and 2 of this site. M2g, the 3'-most mutation, overlaps m2f and ends five nucleotides from the 3'-end of footprint 2.

Footprint 2 Contains at Least Three Independent Protein-Binding Sites
Deoxyribonuclease I (DNase I) protection (footprinting) assays of the footprint 2 mutants were performed using nuclear extracts from the GnRH-expressing hypothalamic cell-line, GT1–7 (Fig. 2AGo). If footprint 2 contains multiple, independent binding sites, then individual mutations should specifically disrupt individual elements. Thus, footprinting of the mutants would delineate the boundaries of the remaining protein-binding sites, and the collective analysis of the protection patterns of the mutants would indicate the borders of individual component sites within footprint 2. As expected, the placement of the mutations locally altered the nucleotides preferentially cleaved by DNase I, so that the protection pattern for each mutant had to be determined by comparison with the cleavage pattern obtained for that mutant in the absence of nuclear extract. The precise protection patterns of the mutants were confirmed by additional footprinting experiments conducted under varying conditions of DNase I cleavage and using different quantities of nuclear extract (data not shown).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 2. DNase I Protection Patterns on Footprint 2 Mutants

A, DNase I analysis of the protection pattern over wild-type footprint 2 or over the various footprint 2 mutants was performed using 1 fmol of probe labeled at the 3'-end of the antisense strand, incubated either with 50 µg GT1–7 nuclear extract (labeled E, middle lanes) or incubated in control reactions without nuclear extract (labeled C, flanking lanes). The black bars represent the positions of the block replacement mutations; the DNase I hypersensitivity profile of each probe is locally altered at these positions. The brackets indicate the extent of protection from DNase I cleavage on each of the probes, and the numbers within the brackets indicate the boundaries of the protected regions as determined by comparison with Maxam-Gilbert reactions (not shown). B, The positions of the three proposed protein-binding sites within footprint 2 are indicated by the open boxes overlying the sequence. The positions of the individual mutations are indicated by the lines above the sequence. The dots indicate the position of every tenth nucleotide in the sequence (i.e. -30, -40, etc.).

 
On the bottom strand of the wild-type sequence, footprint 2 extends from -76 to -28 as a continuous stretch of protected nucleotides interrupted by four hypersensitive sites, three occurring as a cluster between nucleotides -43 and -45, and the fourth at position -33. The protection patterns of the mutants fall into three categories (Fig. 2AGo). Mutations m2a and m2b disrupt protection in the upstream third of footprint 2, between nucleotide positions -76 and -62, leaving the downstream portion of the footprint between -61 and -28 protected, but inducing the formation of a novel hypersensitive site at -56. The m2c and m2d mutants manifest loss of protection at two positions close to the geometric center of footprint 2: nucleotides -51 and -52, with protection being retained in the upstream sequence from -76 to -53 and the downstream sequence from -50 to -28. The m2e, m2f, and m2g mutations all affect protection within the downstream region -45 to -28, while upstream protection between -76 and -46 remains intact. However, mutation m2e decreases binding less than mutations m2f and m2g.

Thus, three binding sites are defined. The boundaries of the upstream binding site are -76 and -53, those of the middle site are -61 and -46, and those of the downstream site are -50 and -28. The downstream site therefore encloses the four hypersensitive sites (at -43 to -45 and at -33) that form on the wild-type sequence. The upstream site contains the E box discussed earlier, while the middle site contains the CCAAT box, and the downstream site contains the octamer-like motif. While our results indicate that footprint 2 contains at least three independent protein-binding sites, further experiments utilizing gel shift assays indicate the presence of more than three proteins occupying these sites (see Fig. 4Go and below), suggesting either that some of the proteins interacting with footprint 2 might be dependent on one another binding (such that prevention of binding at one site results in loss of binding to a distinct site), or that multiple proteins bind to individual sites.



View larger version (76K):
[in this window]
[in a new window]
 
Figure 4. Oct-1 Binds to Footprint 2

Mobility shift analysis of binding to the footprint 2 probe (-63/-33) and to the mutated probes are shown. One femtomole of probe was incubated with 2 µg of GT1–7 crude nuclear extract and run on a polyacrylamide gel. Lanes show reactions (from left to right) without competitor (none) or with 100-fold excess of unlabeled competitor comprising either the homologous sequence (self) or the Oct-1 consensus sequence (Oct-1), in the presence of either Oct-1-specific antibody ({alpha}Oct-1) or a nonspecific immunoglobulin (IgG). Mutant oligonucleotide probes were incubated without competitor/antibody (none) or in the presence of either Oct-1-specific antibody ({alpha}Oct-1) or nonspecific immunoglobulin (IgG) as indicated.

 
It remains possible that footprint 2 contains only two protein-binding sites. Since nucleotides -51 and -52 are mutated in the m2c and m2d mutations, cleavage at these positions in those mutants could correspond to the creation of novel hypersensitive positions between two protein-binding sites, rather than to lack of protection due to the absence of protein binding at a third site. However, the two protein-binding sites invoked by this hypothesis would be required to be quite large; the upstream site would confer protection between -76 and -46 and the downstream site between -61 and -28. Additionally, within each site, the critical residues for protein recognition would have to be eccentrically displaced, occurring toward the 5'-end of the upstream site and the 3'-end of the downstream site. Finally, the m2c and m2d mutations cause a decrease in transcriptional activity (see below) indicating the functional significance of the corresponding wild-type sequence in transcription, and therefore, the presence of a cognate DNA-binding protein.

Each of the Three Binding Sites Within Footprint 2 Contributes to GnRH Transcription
We had previously demonstrated that the presence of footprint 2 is critical for transcription of the GnRH gene, as excision of this 51-bp sequence resulted in a 20-fold decrease in activity (14). Here we have investigated the transcriptional activity of the block mutants to identify the sequence elements important for the activity of footprint 2. As described earlier, the mutations were introduced into the reporter-expression vector that contained the GnRH enhancer directing transcription of the CAT reporter gene from the -173 GnRH promoter. The resulting mutant plasmids were transfected along with the wild-type expression plasmid into GT1–7 cultures for determination of transcriptional activity (Fig. 3AGo). Mutations m2a and m2b, which both disrupt the upstream binding site in footprint 2, cause very similar decreases in basal transcription, decreasing activity approximately 55% relative to that of the wild-type gene. Mutations m2c and m2d, which disrupt the middle site, decrease activity to different degrees: mutation m2c causes the greatest decrease in activity of all the mutations, 75%, while m2d represses activity only 40%. While both mutations disrupt in vitro binding to a similar degree, it is possible that m2c has a greater effect in vivo. Alternatively, it is possible that either mutation might have functional consequences in addition to inactivation of the binding site for the proposed middle protein. For example, m2c, while disrupting the middle site, could also be situated in such a manner as to interfere with interactions between the proteins bound to the intact upstream and downstream binding sites. In either case, as discussed earlier, the finding that these mutations decrease activity supports the existence of the proposed middle protein-binding site. Mutations m2f and m2g, which disrupt the downstream site, decrease activity 55% and 40%, respectively. Mutation m2e is the least deleterious of the mutations, only decreasing activity 25%, possibly because, as indicated by the footprints, m2e retains more protein binding than m2f and m2g.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Transcriptional Activity of Footprint 2 Mutants

The transcriptional activity of the various mutants in comparison to that of the wild-type sequence was determined by transfection into GT1–7 cultures. The single-block mutant plasmids (A) and the double-block mutant plasmids (B), all of which contain the GnRH enhancer directing transcription of a CAT reporter gene from the -173 GnRH promoter, are schematically illustrated to the left of each panel. The enhancer and the -173 promoter are portrayed by boxes, and the three major protein-binding sites within footprint 2 are represented by ovals. Thus, in panel A, as mutants m2a and m2b disrupt the upstream binding site, the corresponding oval is missing. Similarly, the illustration for mutants m2c and m2d lacks the middle oval, and that for mutants m2e, f, and g, lacks the downstream oval. In panel B, the undisrupted element is represented as a single oval where the two mutations have eliminated the other two binding sites. CAT reporter activities were normalized to the activity, set to 1, of the plasmid containing wild-type sequence. Values are the mean of at least three independent experiments ± SEM. Values for all mutations are significantly different than the wild-type gene (WT) by one-way ANOVA P <= 0.0001.

 
To better understand the interaction between the individual elements within footprint 2, three double-block mutant promoters were designed. Each of these disrupts two of the sites within footprint 2, while leaving one intact: the upstream, middle, and downstream sites are left intact by mutants m2ce, m2ag, and m2ad, respectively (Fig. 3BGo). Thus the activity of these double mutants indicates the inherent activity (within the context of the GnRH enhancer and promoter) of the site remaining intact in these GnRH promoters. Each of the double mutants retains approximately 20% of the activity of the wild-type gene [while elimination of the entire footprint 2 results in 95% loss of activity (14)]. Thus the activity of the individual elements within footprint 2 adds up to only 60% of the activity of the entire footprint 2. These results indicate a greater than additive interaction between the elements of footprint 2 in the activation of transcription from the GnRH gene.

Oct-1 Binds to Footprint 2
Previous studies in our laboratory have demonstrated that the POU-homeodomain factor, Oct-1, is present in GT1–7 cells, that this protein binds two sequences in the GnRH upstream enhancer, and that binding to one of these sites is critically required for transcription of the GnRH gene (15). As noted earlier, the downstream site in footprint 2 contains an octamer-like motif (-47 to -40). To determine whether Oct-1 binds this promoter element, mobility shift cross-competition and antibody shift experiments were performed (Fig. 4Go).

An oligonucleotide probe representing the sequence from -63 to -33 (-63/-33) was synthesized, centered over the potential octamer motif that falls within the downstream site. The -63/-33 oligonucleotide includes the entire middle site as well as a significant portion of the downstream site. This extended sequence was chosen for the gel shift experiments because a shorter sequence containing only the octamer motif did not form specific complexes in preliminary experiments (data not shown), and the longer PCR-generated probe encompassing the entire length of footprint 2 (-82 to -22) used previously (14) led to difficulties in quantification of the competitor oligonucleotides. The -63 to -33 probe formed several complexes with GT1–7 nuclear extract, of which five (termed 1 to 5) are specific, as indicated by their ability to be effectively self-competed. Since this probe excludes the upstream site in footprint 2, the five complexes here (1 to 5) do not directly correspond to those designated C1 to C4 in the previous paper (14).

Cross-competition with an Oct-1 consensus oligonucleotide results in the loss of complex 5, indicating the presence of an octamer-binding protein within this complex (Fig. 4Go, lane 3). Inclusion of an antibody against Oct-1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) results in the specific diminution of complex 5, whereas incubation with nonspecific IgG has no effect. The other four complexes are not specifically affected by the Oct-1 antibody. These data suggest that Oct-1 is present in complex 5 and binds to the divergent octamer motif within the downstream site of footprint 2. Additionally, an oligonucleotide containing point mutations in the highly conserved positions 1 and 7 of the potential octamer site (m2oct) forms a greatly reduced complex 5, validating this sequence as a true octamer-binding site. There is another possible octamer site at -54 to -47 in the antisense direction; however, it is unlikely that this other site is bound by an octamer family protein, since the only footprint 2 complex that is competed by the octamer consensus sequence and disrupted by the Oct-1 antibody is reduced by the mutation in m2oct, which leaves this other site intact. The m2oct mutant forms a weaker complex 1, a band that is not cross-competed with the octamer consensus oligonucleotide. This complex thus likely represents a non-octamer protein that binds in the same region as the octamer site (see below).

To determine which of the footprint 2 sites (middle or downstream) the remaining complexes (1 through 4) bind, we used mutant probes that lacked binding to either the middle site (m2c block mutation, described earlier) or to the downstream site (m2e block mutation). As expected, complex 5 (Oct-1) and complex 1 are greatly reduced by the m2e mutation, corroborating the binding of the corresponding proteins in the downstream site of footprint 2. Complex 4 is eliminated by the m2c mutation, indicating that it binds to the middle protein binding site. Complex 3 is eliminated by either block mutation (but not by the octamer point mutation). It is possible that the formation of this complex either involves protein-protein interactions necessitating the presence of intact contiguous binding sites or requires bases that overlap both the middle and downstream sites. Conversely, complex 2 is retained in both block mutations, suggesting that the corresponding protein either is equally capable of binding both middle and downstream sites or is held in place by protein-protein interactions even when its DNA recognition sequence has been disrupted.

Footprint 4 Contributes to GnRH Transcription
As noted above, excision of an internal block of sequence containing footprints 5, 4, and 3 led to a 2-fold decrease in transcriptional activity, indicating the role of these sequences in maintaining optimal transcription of the GnRH gene (14). To assess the role of each footprinted element individually, we tested the transcriptional activity of the mutated promoter regions shown in Fig. 1Go. First, to confirm that the mutations introduced into footprints 5 and 4 had indeed eliminated protein binding at those sites, mobility shift analyses were performed (Fig. 5Go). As described earlier, footprint 3 does not form detectable protein-DNA complexes in mobility shift assays (14). Oligonucleotide probes corresponding to footprints 5 and 4, and to the mutant sequences m5, m4a, and m4b, were incubated with GT1–7 nuclear extract in the presence or absence of homologous or heterologous competitors, and the resulting complexes were resolved by gel electrophoresis. As in our previous studies (14), footprint 4 forms multiple specific complexes with GT1–7 nuclear proteins, none of which are effectively competed by either mutant m4a or m4b. Correspondingly, when used as probes, neither m4a nor m4b forms specific complexes. Footprint 5 forms a single major complex with GT1–7 nuclear extract, which is not competed by the mutant oligonucleotide, m5. The probe corresponding to m5 does, however, form a faint novel complex that is specific (i.e. was abolished with self-competition). As expected, this complex is not competed by the wild-type sequence, indicating that the introduction of the mutation, while destroying the native protein-binding site, has resulted in the formation of a weak new binding site.



View larger version (72K):
[in this window]
[in a new window]
 
Figure 5. Binding of GT1–7 Nuclear Proteins to Footprints 5 and 4, Mutant, and Wild-Type Sequences

Mobility shift analysis of binding to probes corresponding to footprints 5 and 4 (FP5 and FP4) and to the mutant probes m5, m4a, and m4b are shown; 20,000 cpm of probe, with or without 100-fold excess of the indicated unlabeled homologous or heterologous competitor, was bound to 2 µg of GT1–7 crude nuclear extract.

 
Having confirmed the effectiveness of these mutations in disrupting protein binding, we performed transfection assays in GT1–7 cells to assess the function of footprints 5, 4, and 3 (Fig. 6Go). Mutations of footprints 5 and 3 do not substantially change promoter activity. However, it is possible that the inability of the footprint 5 mutation to reduce activity is due to the creation of a novel protein-binding site (albeit a weaker one, as indicated by the relatively small amount of shifted probe in the new complex) in substitution of the native site that has been disrupted by the mutation. By contrast, mutation of footprint 4 in mutants m4a and m4b decreases activity by 60% and 30%, respectively. While mutations m4a and m4b overlap, the former is centered over the octamer sequence within footprint 4, while the latter is directed toward the 3'-end of the footprint (Fig. 1Go). M4a retains only two of eight matches to the octamer consensus motif (compared with the six of eight match obtained with the wild-type sequence), but m4b matches the octamer motif at four of eight positions. While it is possible that this difference accounts for the greater activity that is observed with the m4b mutant, it should be noted that in mobility shift experiments both mutants were equally ineffective at protein binding. We demonstrated previously that deletion of a sequence block encompassing footprints 5, 4, and 3 results in a 2-fold decrease in promoter transcriptional activity (14). The results presented here suggest that this decrease is largely attributable to the loss of binding to footprint 4.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 6. Transcriptional Activity of the Footprint 5, 4, and 3 Mutants

The transcriptional activity of the various mutants compared with that of the wild-type sequence was determined by transfection into GT1–7 cultures. CAT reporter activities were normalized to the activity, set to 1, of the vector containing wild-type sequence. Values are the mean of at least three independent experiments ± SEM. Values for m4a and m4b mutations are significantly different than the wild-type gene (WT) by one-way ANOVA P <= 0.0001.

 
Oct-1 Binds to Footprint 4
Of the several complexes formed on footprint 4 with GT1–7 nuclear proteins, the major complex (upper complex) is preferentially competed by an oligonucleotide incorporating the Oct-1 consensus motif, while the remaining complexes are weakly competed (Fig. 7Go). In reciprocal experiments, footprint 4 competes for binding to the octamer consensus motif (data not shown). We subsequently performed antibody supershift experiments utilizing an Oct-1-specific antibody (Santa Cruz Biotechnology, Inc.). Incubation of GT1–7 nuclear extract with the Oct-1 antibody, but not with nonspecific antibody, results in the formation of specific supershifts of footprint 4 (last lane). These experiments indicate that Oct-1 binds footprint 4 to form the upper complex observed in the mobility shift experiments. We believe the doublet seen in the Oct-1 supershift is due to two forms of the antibody rather than to two different forms of Oct-1 protein since only a single band is observed when Oct-1 is immunoprecipitated from GT1–7 nuclear extract (data not shown).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 7. Oct-1 Binds to Footprint 4

Antibody supershift and cross-competition analysis of binding to footprint 4 is shown; 20,000 cpm of probe was incubated with 2 µg of GT1–7 crude nuclear extract and run on a polyacrylamide gel. Lanes show reactions (from left to right) without competitor (none) or with 100-fold excess of unlabeled competitor comprising either the homologous sequence (self) or the Oct-1 consensus sequence (Oct-1), in the absence of antibody (none) or in the presence of either nonspecific immunoglobulin (IgG) or an Oct-1-specific antibody ({alpha}Oct-1).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this study we have explored the protein-DNA interactions that occur within the evolutionarily conserved promoter-proximal region of the GnRH gene. We have found that footprint 2, a sequence that confers a 20-fold activation of the GnRH gene, is comprised of at least three independent protein-binding sites. Each of these sites contributes to transcription of the GnRH gene. The POU-homeodomain transcription factor Oct-1 binds a divergent (four of eight) octamer site within the downstream site in footprint 2. We have also determined that footprint 4, located approximately 15 bp upstream of footprint 2, confers a 2-fold activation of the GnRH gene. Finally, we have demonstrated that footprint 4, which contains a six of eight match to the octamer consensus motif, is also bound by Oct-1. Thus, two elements important for transcription from the GnRH promoter are bound by Oct-1, the same POU-homeodomain protein that is required for the activity of the GnRH neuron-specific enhancer (15).

Functional analysis reveals that while deletion of the entire footprint 2 sequence leads to a 20-fold decrease in activity (14), mutation of individual protein-binding sites decreases activity only 2- to 4-fold. Simultaneous mutation of any two sites (leaving one intact), results in an approximately 5-fold decrease in activity. Thus as each of the three sites in footprint 2 contributes less than a third of the activity of the footprint, they interact to have a synergistic effect on transcription. The existence of protein-protein interactions within footprint 2 mediating this synergy is suggested by the proximity of the three footprint 2 binding sites as well as the finding in mobility shift assays that complex 3 requires the presence of both the middle and downstream sites, while complex 2 can form in the presence of either site alone. Elimination of the middle binding site by mutation m2c results in the largest decrease in activity of all the mutants, approximately 75%, indicating the importance of the corresponding protein(s) in transcription of the GnRH gene. It is possible that proteins binding this middle site serve as a bridge facilitating interactions between the upstream and downstream sites, thus permitting the synergistic activation of the entire footprint 2 complex.

The upstream protein-binding site within footprint 2 (between positions -76 and -53) contains the sequence GCAGGTGT (eccentrically located between -65 and -58), a motif that conforms to the extended consensus described for the proneural subfamily of Drosophila basic-helix-loop-helix proteins (32). Two mammalian homologs of Drosophila proneural proteins have been described: MASH-1 and -2 (33). Gene knockout studies of MASH-1 have indicated that it functions in the development of the autonomic, enteric, and olfactory branches of the nervous system (34). GnRH neurons originate in the olfactory placode before migrating to the hypothalamus early in embryonic development (35). Thus it seems plausible that MASH-1 might be present in GnRH neurons and might function in the transcription of the GnRH gene. However, we determined that this protein does not bind the GnRH promoter. In mobility shift assays, the upstream footprint 2 sequence was found not to compete for binding to the proneural protein-specific oligonucleotide, but rather to form complexes of distinct mobility that did not react with the MASH-1-specific antibody (data not shown). The Mad family of mammalian basic-helix-loop-helix proteins is found in neural tissues during development. They form heterodimers with Max and repress transcription from CACGTG-binding sites (36). However, the E box in the GnRH footprint 2 sequence is CAGGTG, and it likely binds an activator since the m2b mutation decreases expression. Thus, the identity of the protein binding the upstream site in footprint 2 is likely a basic-helix-loop-helix protein activator, but it remains to be determined.

The proposed middle binding site is almost precisely centered on a CCAAT box, a sequence that was originally identified as a potential cis-acting promoter element within a number of eukaryotic genes. It has since been recognized that CCAAT boxes are bound by disparate proteins, including CCAAT-box binding factor (CBF) (37), multimeric CBF (38), CCAAT transcription factor (39), and the well characterized CCAAT/enhancer binding protein (C/EBP) family of transcription factors (40). C/EBP-ß is present in the GT1–7 neurons as demonstrated by mobility antibody supershift experiments and Western blotting (Denise D. Belsham, personal communication; and S. B. Nelson and P. L. Mellon, unpublished observations). However, the protein(s) that bind to footprint 2 do not interact with an antibody against C/EBP-ß (data not shown).

Both footprint 4 and the downstream element in footprint 2 contain octamer-like motifs that are bound by Oct-1. Although these motifs are somewhat divergent from the octamer consensus sequence, Oct family proteins are known to interact with AT-rich sequences with relaxed specificity (31). Both complex 5 in footprint 2 and the major complex in footprint 4 are inhibited by the Oct-1 antibody, but the footprint 4 complex is not completely inhibited by the antibody. This result indicates a qualitative difference between the protein-DNA interactions in footprint 4 and complex 5. It is possible that the binding of Oct-1 in complex 5 involves protein-protein interactions, such as those previously demonstrated for this protein in other contexts (see below).

In the mouse GnRH promoter region, two elements have been identified as negative glucocorticoid-responsive elements or nGREs (28). One of these elements overlaps with the region homologous to footprint 4 (the distal nGRE) while the other is homologous to the upstream part of footprint 2 (the proximal nGRE). Oct-1 binding was demonstrated in one of five complexes bound to a distal nGRE probe that overlaps the homology to footprint 4, and glucocorticoid receptor was shown to be associated with the same complex. Although Oct-1 was not found binding to the probe for the proximal nGRE, this probe did not include the downstream region of DNA that contains the footprint 2 octamer site. Thus, Oct-1 may also be involved in hormonal regulation of the GnRH gene through at least the footprint 4 region.

The binding of Oct-1 to footprints 2 and 4 indicates a role for this protein in the function of the GnRH promoter, in addition to its previously demonstrated critical role in the activity of the upstream enhancer (15). Interestingly, while Oct-1 is expressed in most tissues and cell lines, it is not widely expressed within the CNS (41, 42). Thus, within the CNS, Oct-1 might serve as a cell type-specific factor, serving to restrict expression of the GnRH gene to the hypothalamus. Furthermore, while we are unable to detect such interactions in vitro, it is possible that the octamer sequences in the GnRH enhancer and promoter are bound in vivo by the other POU-homeodomain proteins Oct-2, Brain-3, and SCIP/Tst-1, that are known to be present in GT1 neurons (15, 43). In fact, SCIP/Tst-1 represses GnRH promoter expression when overexpressed in GT1 cells by cotransfection, and purified bacterially expressed SCIP/Tst-1 binds in vitro to footprint 4 (43).

Finally, it is intriguing to speculate that the presence of octamer motifs in both the enhancer and the promoter of the GnRH gene serves to facilitate interactions between these two regulatory regions, which are separated by more than 1.5 kb of sequence. In support of this hypothesis is the fact that Oct-1 has been shown to participate in both homotypic and heterotypic interactions. Studies of homodimer formation by Oct-1 in vitro demonstrated that the POU domain will form dimers in solution and that association with an octamer DNA-binding site will stabilize this interaction (44). Oct-1 also interacts with other transcription factors such as the glucocorticoid receptor, which it recruits to the mouse GnRH promoter (45), an F9 embryonal carcinoma cell- specific factor, Fx (46), a helix-loop-helix protein (47), NF-1 (48), and with other POU homeodomain factors such as Pit-1/GHF-1 (17), Oct-3 (49), Oct-2, and Oct-6 (44). Most interestingly, Oct-1 associates with the B cell-specific coactivator OBF-1/Bob-1, as well as herpesvirus VP16 (20, 50). In the B cell, Oct-1 binding was thought to signify general but not tissue-specific activation of gene expression. However, with the discovery of the B cell-specific coactivator, Oct-1 binding became a potential indication of tissue-specific activity. In the case of Oct-1 activation of the GnRH enhancer and promoter in GnRH neurons, it will be important to identify any Oct-1 coactivators and determine their tissue distribution to understand the role of Oct-1 in GnRH gene expression and neuron-specific gene expression. Further investigations utilizing mutational analyses of regulatory elements, along with studies of protein-protein interactions, should help clarify the vital role of Oct-1 in GnRH transcription, as well as shed light on the molecular mechanisms underlying the interactions between the enhancer and promoter of the GnRH gene.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid Constructions and Scanning Replacement Mutagenesis
The construction of the plasmid containing the GnRH enhancer directing transcription of the CAT reporter gene from the -173 GnRH promoter has been previously described (14). Linker scanning mutations corresponding to the NotI recognition sequence GCGGCCGC were inserted into this vector at -123 to -116 (m5), -105 to -98 (m4a), and -100 to -93 (m4b), -85 to -78 (m3), -70 to -63 (m2a), -65 to -58 (m2b), -58 to -51 (m2c), -53 to -46 (m2d), -45 to -38 (m2e), -41 to -34 (m2f), -38 to -31 (m2g) using a PCR-based strategy (51). Additionally double-block mutations were introduced into one of the existing singly mutated plasmids in a similar manner. The m2g mutation was incorporated into the m2a plasmid creating NotI recognition sites at -70 to -63 and -38 to -31 (m2ag). The m2a mutation was incorporated into the m2d plasmid creating NotI recognition sites at -70 to -63 and -53 to -46 (m2ad). The m2e mutation was incorporated into the m2c plasmid, creating NotI recognition sites at -58 to -51 and -45 to -38 (m2ce). This plasmid contains a one nucleotide reversion to wild-type within the NotI site at -52. Briefly, for each mutation to be created, PCR primers incorporating the mutation were designed for both the sense and antisense strands of the promoter. The primers extended 14 nucleotides beyond the 3'-end of the linker mutation, and six nucleotides beyond the 5'-end for a total length of 28 nucleotides. These mutagenic primers were used in separate PCR reactions with upstream and downstream vector primers to amplify sequences from the wild-type CAT expression vector. The antisense mutagenic primer was paired with a primer corresponding to the top strand of the enhancer (which corresponded to the antisense sequence because of the reverse orientation of the enhancer in the CAT vector), and the sense primer with a primer corresponding to the bottom strand of the CAT gene, to generate two PCR products that each contained the introduced mutation at one end. The two products, which had 20 nucleotide complementary overlaps at their mutated ends (eight nucleotides corresponding to the linker, and six nucleotides of 5'-flanking sequence from each primer), were purified away from the primers and then annealed to one another. This annealed DNA, containing a certain proportion of heteroduplex strands, was amplified in a secondary PCR reaction with the upstream and downstream vector primers to generate a product whose sequence, except for the introduced internal mutation, was identical to that of the vector This product was digested with restriction enzymes that recognized sites flanking the mutation and then ligated into the vector prepared by digestion of the CAT expression plasmid with the identical restriction enzymes. All clones were sequenced to identify any extraneous PCR-introduced mutations; clones with extraneous mutations were discarded. Sequencing was carried out by performing dideoxy-chain termination reactions in the presence of [{alpha}32P]dATP, 3000 Ci/mmol, and Sequenase (U.S. Biochemical Corp., Cleveland, OH) under conditions described by the manufacturer.

Cell Culture and Transfections
Cell culture and transfections were carried out as previously described (14). Briefly, GT1–7 neurons were maintained in DMEM supplemented with 10% FCS, penn/strep, and 4.5 mg/ml glucose in an atmosphere with 5% CO2. Transfections were performed using calcium phosphate precipitates (52) containing 15 µg of CAT expression vector DNA and 3 µg of the internal control plasmid Rous sarcoma virus (RSV) ß-galactosidase (53). GT1–7 cells were incubated with precipitates for 14–16 h and then rinsed and given fresh medium, and cells were harvested after an additional 24–26 h. Protein extracts were prepared by freeze-thawing as previously described (54), and protein concentrations were determined using the Bio-Rad protein assay reagent (Bio-Rad, Richmond, CA) according to the manufacturer’s directions. CAT assays (55) and ß-galactosidase assays were performed as previously described (53) or using the Galacto-light Plus assay kit from Tropix (Bedford, MA) (Figs. 3BGo and 6Go).

Nuclear Extract Preparation and DNase I Protection Analysis
Nuclear extracts were prepared according to the method described by Schreiber et al. (56). DNase I protection reactions were performed as previously described (14). Briefly, probes contained the GnRH promoter sequence from -173 to +112 of either the wild-type gene or the various linker scanner mutants. These probes were prepared from the wild-type and mutant plasmids described above and were labeled using Klenow and [{alpha}32P]dATP (3000 Ci/mmole) at the XbaI site in the polylinker between the enhancer and the -173 GnRH promoter. The labeled fragments were subsequently redigested with XhoI, which cleaves at +112 of the GnRH promoter, to generate probes labeled on the bottom strand, which were purified from a 1.5% agarose gel. DNase I protection analysis was performed using 1 fmol of probe and 50 µg of GT1–7 crude nuclear extract in 50 µl reactions, and as described (57).

Mobility Shift and Supershift Assay
Annealed wild-type and mutant oligonucleotides (20 ng) containing sequences of the GnRH promoter and consensus sequences were filled in with {alpha}[32P]dATP (3000 Ci/mmol, Dupont NEN, Boston, MA) and Klenow using standard procedures (51). Probes were gel purified by 6% nondenaturing PAGE, crushed, and soaked overnight and phenol-chloroform extracted. In Fig. 4Go, the competitor oligonucleotide was filled in with Klenow, and an alternative probe purification method was used: after standard labeling procedures, probes were phenol/chloroform extracted and passed over G-50 micro columns (Pharmacia Biotech, Piscataway, NJ). Probes were counted in a scintillation counter and diluted in 50 mM NaCl. Binding reactions were carried out in 10 mM HEPES-KOH, pH 7.8, 50 mM KCl, 1 mM EDTA, 5 mM spermidine, 5 mM dithiothreitol, 0.2 mg/ml BSA, 0.5 mM phenylmethylsulfonylfluoride, 12.5–25 µg/ml polydeoxyinosinic-deoxycytidylic acid, 10% (vol/vol) glycerol, and 20 mg/ml Ficoll; 20,000 cpm or 1 fmol, as indicated, of each probe was incubated with 2 µg GT1–7 crude nuclear extract in 20 µl reactions. Reactions were incubated at room temperature for 5 min, loaded, with current on, into a 5% polyacrylamide gel (30:1 acrylamide/bisacrylamide, 0.25 x TBE [130 mM Tris, 45 mM boric acid, 2.5 mM EDTA], 5% glycerol), and electrophoresed for 2 h at 175 V. Gels were prerun for 30 min in 0.25 x TBE. After electrophoresis, gels were dried and subjected to autoradiography. Competition reactions were performed by preincubating the reactions with the specified amount of excess unlabeled oligonucleotide for 20 min before the addition of probe. Supershift assays were performed by adding 1 µl of Oct-1 antibody (sc-232 X, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or rabbit IgG control to the complete reaction and incubating at room temperature for 1 h before adding labeled oligonucleotide probe and loading onto gel as above.

Oligonucleotide Sequences
The top and bottom strands of the FP5 oligonucleotide correspond to the GnRH sequences -128 to -114 and -124 to -110, respectively; the top and bottom strands of the FP4 oligonucleotide correspond to the sequences -109 to -94 and -104 to -89. The mutant oligonucleotides were identical to the wild-type oligonucleotides except for the substitution of the sequence 5'-GCGGCCGC-3' at the following positions: -123 to -116, -105 to -98, and -100 to -93, for the oligonucleotides m5, m4a, and m4b, respectively. The -63/-33 oligonucleotide corresponds to the sequences -63 to -38, and -59 to -33. The T residues at positions -46 and -40 were changed to G residues to make the m2oct oligonucleotide. The m2c and m2e oligonucleotides are identical to the -63/-33 oligonucleotide except for the substitution of 5''- GCGGCCGC-3'' at -58 to -51 and -45 to -38, respectively. The top strand of the Oct-1 consensus oligonucleotide sequence is as follows; TGTCGAATGCAAATCACTAGAA (Santa Cruz Biotechnology, Inc.).


    ACKNOWLEDGMENTS
 
We thank Teri Banks, Simon Lee, and Brian Powl for excellent technical assistance, Jeff Ludwig for creating the double-block mutation plasmids, Melody Clark and Mark Lawson for scientific discussions, and members of the Mellon laboratory for support.


    FOOTNOTES
 
Address requests for reprints to: Pamela L. Mellon, Ph.D. Department of Reproductive Medicine 0674, 2057 Cellular and Molecular Medicine East, University of California, San Diego, 9500 Gilman Drive, La Jolla, California 92093-0674.

This work was supported by NIH Grant DK-44838 (to P.L.M.). S.B.N. was supported by NIH Training Grants AG-00216 and DK-07541.

1 These authors contributed equally. Back

2 Present address: University of California, Irvine, c/o Office of Educational Affairs, Medical Education 802, Room 252, Box 4089, Irvine California 92697-4089. Back

Received for publication September 9, 1997. Revision received January 6, 1998. Accepted for publication January 9, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Struhl K 1991 Mechanisms for diversity in gene expression patterns. Neuron 7:177–181[CrossRef][Medline]
  2. Mitchell PJ, Tjian R 1989 Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245:371–378[Abstract/Free Full Text]
  3. He X, Rosenfeld MG 1991 Mechanisms of complex transcriptional regulation: implications for brain development. Neuron 7:183–196[CrossRef][Medline]
  4. Mellon PL, Windle JJ, Goldsmith P, Pedula C, Roberts J, Weiner RI 1990 Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis. Neuron 5:1–10[CrossRef][Medline]
  5. Liposits Z, Merchenthaler I, Wetsel WC, Reid JJ, Mellon PL, Weiner RI, Negro-Vilar A 1991 Morphological characterization of immortalized hypothalamic neurons synthesizing luteinizing hormone-releasing hormone. Endocrinology 129:1575–1583[Abstract]
  6. Hales TG, Kim H, Longoni B, Olsen RW, Tobin AJ 1992 Immortalized hypothalamic GT1–7 neurons express functional {gamma}-aminobutyric acid type A receptors. Mol Pharmacol 42:197–202[Abstract]
  7. Gonzalez-Manchon C, Bilezikjian LM, Corrigan AZ, Mellon PL, Vale W 1991 Activin-A modulates GnRH secretion from a GnRH-secreting neuronal cell line. Neuroendocrinology 54:373–377[Medline]
  8. Findell PR, Wong KH, Jackman JK, Daniels DV 1993 Beta 1-adrenergic and dopamine (D1)-receptors coupled to adenylyl cyclase activation in GT1 gonadotropin-releasing hormone neurosecretory cells. Endocrinology 132:682–688[Abstract]
  9. Martinez de la Escalera G, Gallo F, Choi ALH, Weiner RI 1992 Dopaminergic regulation of the GT1 gonadotropin-releasing hormone (GnRH) neuronal cell lines: stimulation of GnRH release via D1-receptors positively coupled to adenylate cyclase. Endocrinology 131:2965–2971[Abstract]
  10. Moretto M, Lopez FJ, Negro-Vilar A 1993 Nitric oxide regulates luteinizing hormone-releasing hormone secretion. Endocrinology 133:2399–2402[Abstract]
  11. Wetsel WC, Valença MM, Merchenthaler I, Liposits Z, L-pez FJ, Weiner RI, Mellon PL, Negro-Vilar A 1992 Intrinsic pulsatile secretory activity of immortalized LHRH secreting neurons. Proc Natl Acad Sci USA 89:4149–4153[Abstract/Free Full Text]
  12. Martinez de la Escalera G, Choi ALH, Weiner RI 1992 Generation and synchronization of gonadotropin-releasing hormone (GnRH) pulses: intrinsic properties of the GT1–1 GnRH neuronal cell line. Proc Natl Acad Sci USA 89:1852–1855[Abstract/Free Full Text]
  13. Whyte DB, Lawson MA, Belsham DD, Eraly SA, Bond CT, Adelman JP, Mellon PL 1995 A neuron-specific enhancer targets expression of the gonadotropin-releasing hormone gene to hypothalamic neurosecretory neurons. Mol Endocrinol 9:467–477[Abstract]
  14. Eraly SA, Mellon PL 1995 Regulation of GnRH transcription by protein kinase C is mediated by evolutionarily conserved, promoter-proximal elements. Mol Endocrinol 9:848–859[Abstract]
  15. Clark ME, Mellon PL 1995 The POU homeodomain transcription factor Oct-1 is essential for activity of the gonadotropin-releasing hormone neuron-specific enhancer. Mol Cell Biol 15:6169–6177[Abstract]
  16. Sturm R, Baumruker T, Franza BR, Herr W 1987 A 100-kD HeLa cell octamer binding protein (OBF100) interacts differently with two separate octamer-related sequences within the SV40 enhancer. Genes Dev 1:1147–1160[Abstract/Free Full Text]
  17. Voss JW, Wilson L, Rosenfeld MG 1991 POU-domain proteins Pit-1 and Oct-1 interact to form a heteromeric complex and can cooperate to induce expression of the prolactin promoter. Genes Dev 5:1309–1320[Abstract/Free Full Text]
  18. Poellinger L, Yoza BK, Roeder RG 1989 Functional cooperativity between protein molecules bound at two distinct sequence elements of the immunoglobulin heavy-chain promoter. Nature 337:573–576[CrossRef][Medline]
  19. Luo Y, Fujii H, Gerster T, Roeder RG 1992 A novel B cell-derived coactivator potentiates the activation of immunoglobulin promoters by octamer-binding transcription factors. Cell 71:231–241[CrossRef][Medline]
  20. Strubin M, Newell JW, Matthias P 1995 OBF-1, a novel B cell-specific coactivator that stimulates immunoglobulin promoter activity through association with octamer-binding proteins. Cell 80:497–506[CrossRef][Medline]
  21. Dong K-W, Yu K-L, Roberts JL 1993 Identification of a major up-stream transcription start site for the human progonadotropin-releasing hormone gene used in reproductive tissues and cell lines. Mol Endocrinol 7:1654–1666[Abstract]
  22. Dong KW, Duval P, Zeng Z, Gordon K, Williams RF, Hodgen GD, Jones G, Kerdelhue B, Roberts JL 1996 Multiple transcription start sites for the GnRH gene in rhesus and cynomolgus monkeys: a non-human primate model for studying GnRH gene regulation. Mol Cell Endocrinol 117:121–130[CrossRef][Medline]
  23. Kepa JK, Spaulding AJ, Jacobsen BM, Fang Z, Xiong X, Radovick S, Wierman ME 1996 Structure of the distal human gonadotropin releasing hormone (hGnRH) gene promoter and functional analysis in Gt1–7 neuronal cells. Nucleic Acids Res 24:3614–3620[Abstract/Free Full Text]
  24. Wetsel WC, Eraly SA, Whyte DB, Mellon PL 1993 Regulation of gonadotropin-releasing hormone by protein kinases A and C in immortalized hypothalamic neurons. Endocrinology 132:2360–2370[Abstract]
  25. Bruder JM, Wierman ME 1994 Evidence for transcriptional inhibition of GnRH gene expression by phorbol ester at a proximal promoter region. Mol Cell Endocrinol 99:177–182[CrossRef][Medline]
  26. Bruder JM, Spaulding AJ, Wierman ME 1996 Phorbol ester inhibition of rat gonadotropin-releasing hormone promoter activity: role of fos and jun in the repression of transcription. Mol Endocrinol 10:35–44[Abstract]
  27. Chandran UR, Attardi B, Friedman R, Dong K-W, Roberts JL, DeFranco DB 1994 Glucocorticoid receptor-mediated repression of gonadotropin-releasing hormone promoter activity in GT1 hypothalamic cell lines. Endocrinology 134:1467–1474[Abstract]
  28. Chandran UR, Attardi B, Friedman R, Zheng Z, Roberts JL, DeFranco DB 1996 Glucocorticoid repression of the mouse gonadotropin-releasing hormone gene is mediated by promoter elements that are recognized by heteromeric complexes containing glucocorticoid receptor. J Biol Chem 271:20412–20420[Abstract/Free Full Text]
  29. Kepa JK, Jacobsen BM, Boen EA, Prendergast P, Edwards DP, Takimoto G, Wierman ME 1996 Direct binding of progesterone receptor to nonconsensus DNA sequences represses rat GnRH. Mol Cell Endocrinol 117:27–39[CrossRef][Medline]
  30. Kepa KJ, Wang C, Neeley CI, Raynolds MV, Gordon DF, Wood WM, Wierman ME 1992 Structure of the rat gonadotropin releasing hormone (rGnGH) gene promoter and functional analysis in hypothalamic cells. Nucleic Acids Res 20:1393–1399[Abstract/Free Full Text]
  31. Bendall AJ, Sturm RA, Danoy PA, Molloy PL 1993 Broad binding-site specificity and affinity properties of octamer 1 and brain octamer-binding proteins. Eur J Biochem 217:799–811[Medline]
  32. Singson A, Leviten MW, Bang AG, Hua XH, Posakony JW 1994 Direct downstream targets of proneural activators in the imaginal disc include genes involved in lateral inhibitory signaling. Genes Dev 8:2058–2071[Abstract/Free Full Text]
  33. Johnson JE, Birren SJ, Anderson DJ 1990 Two rat homologues of Drosophila achaete-scute specifically expressed in neuronal precursors. Nature 346:858–861[CrossRef][Medline]
  34. Guillemot F, Lo L-C, Johnson JE, Auerbach A, Anderson DJ, Joyner AL 1993 Mammalian achaete-scute homolog 1 is required for the early develoment of olfactory and autonomic neurons. Cell 75:463–476[CrossRef][Medline]
  35. Schwanzel-Fukuda M, Pfaff DW 1989 Origin of luteini-zing hormone-releasing hormone neurons. Nature 338:161–164[CrossRef][Medline]
  36. Hurlin PJ, Queva C, Koskinen PJ, Steingrimsson E, Ayer DE, Copeland NG, Jenkins NA, Eisenman RN 1995 Mad3 and Mad4: novel Max-interacting transcriptional repressors that suppress c-myc dependent transformation and are expressed during neural and epidermal differentiation. EMBO J 14:5646–5659[Medline]
  37. Lum LS, Sultzman LA, Kaufman RJ, Linzer DI, Wu BJ 1990 A cloned human CCAAT-box-binding factor stimulates transcription from the human hsp70 promoter. Mol Cell Biol 10:6709–6717[Abstract/Free Full Text]
  38. Maity SN, Sinha S, Ruteshouser EC, de Crombrugghe B 1992 Three different polypeptides are necessary for DNA binding of the mammalian heteromeric CCAAT binding factor. J Biol Chem 267:16574–16580[Abstract/Free Full Text]
  39. Jones KA, Kadonaga JT, Rosenfeld PJ, Kelly TJ, Tijan R 1987 A cellular DNA-binding protein that activates eukaryotic transcription and DNA replication. Cell 42:559–572
  40. Landschulz WH, Johnson PF, Adashi EY, Graves BJ, McKnight SL 1988 Isolation of a recombinant copy of the gene encoding C/EBP. Genes Dev 2:786–800[Abstract/Free Full Text]
  41. Schreiber E, Merchant RE, Wiestler OD, Fontana A 1994 Primary brain tumors differ in their expression of octamer deoxyribonucleic acid-binding transcription factors from long-term cultured glioma cell lines. Neurosurgery 34:129–135[Medline]
  42. He X, Treacy MN, Simmons DM, Ingraham HA, Swanson LW, Rosenfeld MG 1989 Expression of a large family of POU-domain regulatory genes in mammalian brain development. Nature 340:35–42[CrossRef][Medline]
  43. Wierman ME, Xiong X, Kepa JK, Spaulding AJ, Jacobsen BM, Fang Z, Nilaver G, Ojeda SR 1997 Repression of gonadotropin-releasing hormone promoter activity by the POU homeodomain transcription factor SCIP/Oct-6/Tst-1: a regulatory mechanism of phenotype expression? Mol Cell Biol 17:1652–1665[Abstract]
  44. Verrijzer CP, van Oosterhout JA, van der Vliet PC 1992 The Oct-1 POU domain mediates interactions between Oct-1 and other POU proteins. Mol Cell Biol 12:542–551[Abstract/Free Full Text]
  45. Kutoh E, Stromstedt P, Poellinger L 1992 Functional interference between the ubiquitous and constitutive octamer transcription factor 1 (OTF1) and the glucocorticoid receptor by direct protein-protein interaction involving the homeo subdomain of OTF-1. Mol Cell Biol 12:4960–4969[Abstract/Free Full Text]
  46. Dailey L, Yuan H, Basilico C 1994 Interaction between a novel F9-specific factor and octamer-binding proteins is required for cell-type-restricted activity of the fibroblast growth factor 4 enhancer. Mol Cell Biol 14:7758–7769[Abstract/Free Full Text]
  47. Tverberg LA, Russo AF 1993 Regulation of the calcitonin/calcitonin gene-related peptide gene by cell-specific synergy between helix-loop-helix and octamer-binding transcription factors. J Biol Chem 268:15965–15973[Abstract/Free Full Text]
  48. Oberdick J, Smeyne RJ, Mann JR, Zackson S, Morgan JI 1990 A promotor that drives transgene expression in cerebellar Purkinje and retinal bipolar neurons. Science 248:223–226[Abstract/Free Full Text]
  49. Vigano MA, Staudt LM 1996 Transcriptional activation by Oct-3: evidence for a specific role of the POU-specific domain in mediating functional interaction with Oct-1. Nucleic Acids Res 24:2112–2118[Abstract/Free Full Text]
  50. Gstaiger M, Knoepfel L, Georgiev O, Schaffner W, Hovens CM 1995 A B-cell coactivator of octamer-binding transcription factors. Nature 373:360–362[CrossRef][Medline]
  51. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K 1987 Current Protocols in Molecular Biology. John Wiley & Sons, New York
  52. Mellon PL, Parker V, Gluzman Y, Maniatis T 1981 Identification of DNA sequences required for transcription of the human alpha1 globin gene using a new SV40 host-vector system. Cell 27:279–288[CrossRef][Medline]
  53. Delegeane AM, Ferland LH, Mellon PL 1987 Tissue-specific enhancer of the human glycoprotein hormone alpha-subunit gene: dependence on cyclic AMP-inducible elements. Mol Cell Biol 7:3994–4002[Abstract/Free Full Text]
  54. Gorman C 1985 High efficiency gene transfer into mammalian cells. In: Glover DM (ed) DNA Cloning: A Practical Approach. IRL Press, Oxford, vol II:143–190
  55. Seed B, Sheen JY 1988 A simple phase-extraction assay for chloramphenicol acyltransferase activity. Gene 67:271–277[CrossRef][Medline]
  56. Schreiber E, Matthias P, Müller M, Schaffner W 1989 Rapid detection of octamer binding proteins with mini-extracts prepared from a small number of cells. Nucleic Acids Res 17:6419[Free Full Text]
  57. Ohlsson H, Edlund T 1986 Sequence-specific interactions of nuclear factors with the insulin gene enhancer. Cell 45:35–44[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
T. R. Pak, W. C. J. Chung, J. L. Roberts, and R. J. Handa
Ligand-Independent Effects of Estrogen Receptor {beta} on Mouse Gonadotropin-Releasing Hormone Promoter Activity
Endocrinology, April 1, 2006; 147(4): 1924 - 1931.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Q. Tang, M. Mazur, and P. L. Mellon
The Protein Kinase C Pathway Acts through Multiple Transcription Factors to Repress Gonadotropin-Releasing Hormone Gene Expression in Hypothalamic GT1-7 Neuronal Cells
Mol. Endocrinol., November 1, 2005; 19(11): 2769 - 2779.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Rave-Harel, N. L. G. Miller, M. L. Givens, and P. L. Mellon
The Groucho-related Gene Family Regulates the Gonadotropin-releasing Hormone Gene through Interaction with the Homeodomain Proteins MSX1 and OCT1
J. Biol. Chem., September 2, 2005; 280(35): 30975 - 30983.
[Abstract] [Full Text] [PDF]