Molecular Endocrinology 12 (4): 482-491
Copyright © 1998 by The Endocrine Society
Further Characterization of the Glucocorticoid Response Unit in the Phosphoenolpyruvate Carboxykinase Gene. The Role of the Glucocorticoid Receptor-Binding Sites
Donald K. Scott1,
Per-Erik Strömstedt1,2,
Jen-Chywan Wang and
Daryl K. Granner
Department of Molecular Physiology and Biophysics Vanderbilt
University School of Medicine Nashville, Tennessee 37232-0615
 |
ABSTRACT
|
|---|
Phosphoenolpyruvate carboxykinase (PEPCK)
catalyzes the rate-limiting step of gluconeogenesis. The activity of
this enzyme is controlled by several hormones, including
glucocorticoids, glucagon, retinoic acid, and insulin, that principally
affect the rate of transcription of the PEPCK gene. Glucocorticoids
induce PEPCK gene transcription through a complex glucocorticoid
response unit that consists of, from 5' to 3', accessory factor
elements AF1 and AF2; two noncanonical glucocorticoid receptor-binding
sites, GR1 and GR2; a third accessory factor element, AF3; and a
cAMP-response element, CRE. A complete glucocorticoid response is
dependent on the presence of both GR-binding sites, all three accessory
elements, and the CRE. In this study we assess the relative roles of
GR1 and GR2 in the context of the glucocorticoid response unit and use
a combination of binding and function assays to compare GR1 and GR2 to
glucocorticoid response elements (GREs) that conform closely to the
consensus sequence. The relative binding affinity of GR follows the
order: consensus GRE >> GR1 > GR2. Mutations that disrupt the
binding of GR to GR1 result in a major reduction of the glucocorticoid
response, whereas similar mutations of GR2 have a much smaller effect.
Unlike the simple consensus GRE, neither GR1 nor GR2 mediate a
glucocorticoid response through a heterologous promoter. The accessory
elements appear to have different functional roles. AF2 is still needed
for a maximal glucocorticoid response when GR1 is converted to a
high-affinity GR-binding element, but AF1 and AF3 are not required.
 |
INTRODUCTION
|
|---|
The glucocorticoid receptor (GR), with bound ligand, regulates the
transcription of target genes by interacting with specific DNA
sequences that can be located either upstream or downstream from the
transcription initiation site (1). These DNA sequences, which can
activate or repress transcription, are commonly referred to as
glucocorticoid response elements (GREs) (reviewed in Refs. 2 and 3).
The consensus GRE consists of two partially palindromic hexanucleotide
half-sites separated by 3 bp (GGTACAnnnTGTTCT; see Fig. 1
and Ref.4). Several observations are
consistent with the idea that the GRE binds a receptor dimer and that
one monomer binds to each half-site (reviewed in Ref.5). As originally
characterized, the simple GR-GRE complex mediates glucocorticoid
effects through heterologous promoters in a position- and
orientation-independent manner. In recent years it has become apparent
that, in most instances, the GR-binding sites are functionally
associated with numerous other transcription factor-binding sites to
form composite or complex elements (6). These functional arrays of DNA
elements and associated transcription factors are referred to as
glucocorticoid response units (GRUs) (3).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 1. Schematic Diagram of the PEPCK Gene GRU
The positions of AF1, AF2, GR1, GR2, AF3, and the CRE are shown
relative to the transcription initiation site of the PEPCK gene. All
six of these elements are required for a complete glucocorticoid
response. The sequences of GR1 and GR 2 are aligned in the boxed
area, and the hexanucleotide half-sites are indicated by
bold letters. The consensus GRE sequence is derived from
the base pair conservation in functional response elements (4). The
position of each base is numbered relative to the three central spacing
nucleotides. For comparison, the sequences of GREs that closely conform
to the consensus GRE, and are used in this study, are shown
below the consensus GRE sequence. palGRE is a fully
palindromic GRE, and tatGRE represents the tyrosine aminotransferase
GRE II.
|
|
Cytosolic phosphoenolpyruvate carboxykinase (GTP; EC 4.1.1.32; PEPCK)
catalyzes the conversion of oxaloacetate to phosphoenolpyruvate, a
rate-controlling step in the conversion of lactate to glucose in liver
(7, 8). Glucocorticoids, glucagon (cAMP), and retinoic acid increase
the transcription of the hepatic PEPCK gene while insulin inhibits both
induced and basal transcription (9). Induction of the PEPCK gene by
glucocorticoids is achieved through a complex GRU. The GRU ensemble
includes two GR-binding sites, GR1 and GR2, located by
deoxyribonuclease I (DNase I) footprinting between nucleotides
-386/-353 relative to the transcription initiation site, and binding
sites for transcription factors that act as accessory factors for the
glucocorticoid response (Fig. 1
and Ref.10). Three accessory
factor-binding sites (AFs) have been identified and characterized in
the PEPCK gene GRU. AF1 is located between -455/-431 (10, 11, 12), AF2 is
located between -420/-403 (10, 12), and the more recently identified
AF3 is located between -327/-321 (13). The proteins that mediate the
accessory activities through AF1, AF2, and AF3 have been identified.
Hepatic nuclear factor 4 (HNF-4) and chicken ovalbumin upstream
transcription factor (COUP-TF) each confer accessory activity through
the AF1 element (11). Members of the hepatic nuclear factor 3 (HNF-3)
family bind to AF2 and act as accessory factors to the glucocorticoid
response through this element (14). Finally, COUP-TF acts as the
accessory factor through AF3 (13).
All three AF elements are required for a complete glucocorticoid
response. A mutation of either AF1, AF2, or AF3 reduces the
glucocorticoid response by at least 50% (10, 11, 12, 13, 14). Moreover, deletion
or mutation of any two accessory elements essentially abolishes the
glucocorticoid response; hence, GR1 and GR2 have little, if any,
intrinsic activity in the context of the PEPCK gene promoter (10, 13).
At least one additional downstream element is required for full
activity through the GRU. Deletion of the cAMP response element (CRE)
at position -93/-86 also reduces glucocorticoid responsiveness by
approximately 50% (15). A direct interaction between GR and the cAMP
response element binding protein (CREB) has been demonstrated in
vitro; thus, it seems that a functional interaction between the
GRU and CRE, which is accomplished over a distance of more than 300 bp,
is required for a complete glucocorticoid response (15).
AF1, AF2, AF3, and the CRE are all pleiotropic elements. In addition to
their role in the glucocorticoid response, AF1 and AF3 also bind the
retinoic acid receptor · 9-cis-retinoic receptor
heterodimeric complex and, in the presence of retinoic acid, serve as
retinoic acid response elements (16, 17). AF2 mediates an inhibitory
response of insulin and phorbol esters in addition to its essential
role in the glucocorticoid response (18, 19). The exact factor(s) that
mediates the inhibitory effect of insulin on the PEPCK gene through the
AF2 element is not known. The CRE is also a multifunctional element,
since it is required for basal transcription as well as for the cAMP
response and the glucocorticoid response (15, 20).
Having defined the accessory factors, we next performed an analysis of
the role of the GR-binding sites in the interplay of these various
transcription factors on the PEPCK promoter. When originally defined,
GR1 and GR2 were thought to be of equal importance (10). However, the
deletion of GR2 also included the recently defined AF3 element (13).
Thus, the loss of function originally attributed to GR2 could be
explained by the absence of AF3. A reassessment of the role of GR2,
using site-directed mutations rather than a large deletion, seemed
warranted. In this study block mutations reveal that GR1 is more
important than GR2 for a complete glucocorticoid response. The GR1
element binds GR better than does GR2, but both bind the receptor at
least 15 times less avidly than a consensus GRE. Unlike a consensus
GRE, GR1 and GR2 are unable to convey a glucocorticoid response through
a heterologous promoter. The conversion of GR1 to a high-affinity,
fully palindromic GRE, in the context of the wild-type PEPCK promoter,
relieves the requirement for AF1 and AF3. Inasmuch as AF2 is still
necessary for the full response to glucocorticoids, there appears to be
a functional difference between the various accessory elements.
 |
RESULTS
|
|---|
GR1 and GR2 Have Hierarchic Functional Roles
We previously examined the relative roles of GR1 and GR2 in the
response of the PEPCK gene to glucocorticoids (10). In those studies,
deletion mutations of GR1 and GR2 indicated that these two
glucocorticoid receptor-binding sites were of equal importance.
However, the deletion mutation of GR2 included the sequence from -327
to -321 relative to the transcription start site, which we have
recently shown comprises an accessory factor element (AF3) that is
required for a complete glucocorticoid response (13). In light of this
recent finding we reexamined the relative roles of GR1 and GR2, in the
context of the GRU. Site-directed mutations that prevent GR binding
(data not shown) were separately introduced into each element (mGR1 and
mGR2) in the context of pPL32 [a plasmid bearing the wild-type PEPCK
promoter from -467 to +69 linked to the chloramphenicol
acetyltransferase (CAT) reporter gene] to assess the contributions of
GR1 and GR2 to the function of the PEPCK GRU. The wild-type promoter
(pPL32) mediated a 13-fold induction by glucocorticoids in H4IIE cells
(Fig. 2
). Mutation of GR1 reduced the
glucocorticoid induction to about a 2-fold response over control, which
is similar to that obtained from a construct in which both GR1 and GR2
have been deleted (10, 13). Mutation of GR2, with GR1 intact,
attenuated the glucocorticoid response somewhat, but a 7.5-fold
induction by glucocorticoids was still obtained (Fig. 2
). Thus, GR1 is
apparently more important for the response of the PEPCK gene to
glucocorticoids than is GR2.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 2. The Function of GR1 and GR2 in the Context of the
PEPCK Gene Promoter
GR1 and GR2 mutations that prevent GR binding were tested for the
ability to support glucocorticoid induction of CAT reporter activity in
the context of the wild-type PEPCK promoter-CAT construct (pPL32).
H4IIE cells were cotransfected with 10 µg of the various PEPCK
promoter-CAT chimeric constructs and 5 µg of the GR expression vector
(pSVGR1). CAT activity was measured 18 h after treatment with or
without 0.5 µM dexamethasone. The solid
bars represent the fold induction (with dexamethasone/without
dexamethasone, mean ± SEM) of at least five
independent transfections. All of the reporter constructs had identical
basal activities in these experiments (data not shown). The mGR1
construct contains the sequence
-391TGGCACCAAAAATACGAAGCC-371,
and the mGR2 construct contains the sequence
-370AGCAGCGTATGAATACTAAGA-350;
the bold letters indicate variations from the wild-type
sequence.
|
|
GR1 and GR2 Bind GR with Low Affinity in Vitro
For the sake of clarity, we define a consensus GRE as one that
closely conforms to the consensus sequence described by Beato (Ref. 4
and see Fig. 1
) and elicits a glucocorticoid response in the context of
a heterologous promoter. Thus, as depicted in Fig. 1
, the naturally
occurring tyrosine aminotransferase GRE (tatGRE, 11 of 12 position
match) as well as the synthetic fully palindromic GRE (palGRE, 10 of 12
positions) are consensus GREs, while the PEPCK GR1 (7 of 12 position
match) and GR2 (6 of 12 position match) elements are not. In addition,
the tatGRE and the palGRE mediate glucocorticoid responses in
heterologous promoter systems, while GR1 and GR2 do not (see
below).
In the case of the PEPCK GRU it is possible that the requirement
for accessory factors is related to a decreased binding affinity of GR1
and/or GR2 for GR, as compared with a consensus GRE. Also, the relative
functional importance of GR1 and GR2 in the GRU could be related to the
ability of these elements to bind GR. Therefore, the relative binding
affinity of GR for oligonucleotides that contain a number of
glucocorticoid-binding sites was determined using increasing
concentrations of competitor oligonucleotides in an electrophoretic gel
mobility shift assay (Fig. 3
). Figure 3A
illustrates the results from a study used to establish the system
employed in these experiments. An oligonucleotide that contains the GR1
sequence mutated to a palindromic GRE (palGRE) was used as the probe. A
protein·DNA complex was diminished in the presence of antiserum
directed against GR, but this did not occur when a nonspecific
antiserum was employed. In addition, a 100-fold molar excess of the
unlabeled palGRE oligonucleotide completely prevented the formation of
the GR·DNA complex, whereas a 100-fold molar excess of an
oligonucleotide that contains an upstream stimulatory factor
(USF)-binding site did not affect the formation of the complex.
Together, these data demonstrate that the protein·DNA complex
contains GR. As shown in Fig. 3
, B and C, the palGRE and the tatGRE
oligonucleotides prevented the formation of the GR·DNA complex at
essentially the same relative low concentration. By contrast, the GR1
and GR2 oligonucleotides were much less effective at preventing the
formation of the GR·DNA complex than were either of the consensus
GREs. As a control, an oligonucleotide that contains a binding site for
the transcription factor USF did not affect the formation of the
GR·DNA complex, even at a 200-fold molar excess (Fig. 3C
). Based on
the data illustrated in Fig. 3C
, we estimate that the consensus GREs
bind GR with at least a 15-fold greater affinity than GR1, and GR1
binds GR with a somewhat higher affinity than does GR2. Thus, the
relative order of affinity of GR for the GREs tested was: palGRE and
tatGRE >> GR1 > GR2. In other studies, the DNA-binding domain
of GR bound to the mouse mammary tumor virus (MMTV) GRE (-189 to
-166) with about a 10-fold greater affinity than GR1 using a DNase I
footprinting strategy (E. Imai and D. K. Granner, unpublished
observations).

View larger version (33K):
[in this window]
[in a new window]
|
Figure 3. Relative Affinity of the Glucocorticoid Receptor
for GR1, GR2, and Consensus GREs
Mobility gel shift assays were performed in which an end-labeled
double-stranded palGRE oligonucleotide was used as the probe in a
binding reaction that included 10 ng human recombinant GR. The free DNA
and the GR·DNA complex were separated on 4% nondenaturing
polyacrylamide gels and subjected to autoradiography or were
quantitated using a Bio-Rad PhosphoImager. A, Antiserum directed
against GR, a nonspecific antiserum (NS), a specific unlabeled
competitor oligonucleotide, palGRE, or a nonspecific competitior, USF,
were added to the binding reaction. For simplicity, only the portion of
the gel with bound complexes is shown. B, Representative gels wherein
various amounts of unlabeled GR1 or palGRE oligonucleotides were added
to the binding reaction. C, The relative affinity of GR for
oligonucleotides that contain tatGRE and palGRE are compared with the
PEPCK GR-binding sites, GR1 and GR2, and to a nonspecific DNA
competitor, USF. D, The relative affinity of GR for an oligonucleotide
that contains a single palindromic GRE, palGRE, is compared with one
that contains two palindromic GREs in tandem, palx2. E, The relative
affinity of GR for an oligonucleotide that contains GR1 is compared
with one that contains both GR1 and GR2 (GR1·2). The data shown in
panels C, D, and E represent the means (±SEM, n 3)
of the relative amount of the GR·DNA complex remaining as a function
of increasing concentrations of competitor DNA as quantitated on a
Bio-Rad PhosphoImager. The data for palGRE and GR1 illustrated in
panels D and E, respectively, are the same as those shown in panel C.
Note that different amounts of competitor DNAs were used in the various
experiments.
|
|
Schmid et al. (21) demonstrated that an oligonucleotide
containing two closely spaced consensus GREs that are aligned on the
same side of the DNA helix bind GR cooperatively and have at least a
10-fold greater affinity for GR than an oligonucleotide containing a
single consensus GRE. GR1 and GR2 are spaced 21 bp apart (see Fig. 1
),
approximately two turns of the double helix, and so may bind GR
cooperatively and thus compensate for the low affinity of these two
GR-binding sites. Oligonucleotides that contain either GR1 or both GR1
and GR2 with the same spacing and flanking sequences as those present
within the native PEPCK promoter were used as competitors in a mobility
gel shift assay, using the palGRE oligonucleotide as the probe, to
determine whether GR binds to GR1 and GR2 cooperatively. For
comparison, oligonucleotides that contained either one palindromic GRE
or two palindromic GREs spaced 21 bp apart (palx2) were used as
competitors in the same assay. The palx2 oligonucleotide competed for
the formation of the GR·DNA complex at a concentration that was at
least 10 fold lower than did an oligonucleotide that contained a single
palindromic GRE (compare palGRE with palx2 in Fig. 3D
). This result is
in close agreement with that of Schmid et al. (21). In
contrast, an oligonucleotide that contains both GR1 and GR2 had the
same affinity for GR as did an oligonucleotide that contained only GR1
(compare GR1 with GR1·2 in Fig. 3E
). Thus, GR1 and GR2 apparently do
not bind GR with detectable cooperativity.
GR1 and GR2 Do Not Function as Simple GREs
As mentioned above, a single copy of the tatGRE confers a response
to glucocorticoids when placed immediately upstream of the TATA box in
the context of a heterologous promoter, but a single GRE placed far
upstream (>300 bp) of the TATA box is not sufficient for hormone
induction. However, two copies of a consensus GRE, or the combination
of a consensus GRE with another transcription factor-binding site, can
confer hormonal activation from such a distant position (22). GR1 and
GR2 are located between positions -394/-349 within the PEPCK
promoter, and this may account for the necessity of having the
additional transcription factors that constitute the GRU. Constructs
that contain a single copy of either GR1 or GR2 placed immediately
upstream of a minimal thymidine kinase (tk) promoter, and ligated to
the CAT reporter gene, were tested for their ability to respond to
glucocorticoids. H4IIE cells transfected with either GR1tk or GR2tk
failed to respond to glucocorticoids (Fig. 4
). Conversely, cells transfected with a
construct that consists of a single copy of the tatGRE ligated to the
minimal tk promoter (tatGREtk) showed a 16-fold increase of CAT
expression in response to glucocorticoids, in agreement with previous
results (Fig. 4
and Ref.22). Cells transfected with a tkCAT construct
that contains the PEPCK promoter sequence from -395 to -346 and
therefore contains both GR1 and GR2 (GR1·2tk), were also unresponsive
to glucocorticoids when tested in transient transfection experiments
(Fig. 4
). Taken together, these data demonstrate that neither GR1 nor
GR2 functions as a simple GRE in a heterologous context. Moreover,
unlike the situation with the tatGRE cited above (21, 22), GR1 and GR2
in combination do not confer synergistic activation of transcription in
response to glucocorticoids, at least in this heterologous context.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 4. GR1 and GR2 Do Not Confer a Glucocorticoid Response
in the Context of a Heterologous Promoter
Constructs were made wherein GR1, GR2, GR1 and GR2 (GR1·2), and the
tatGRE were ligated upstream of the minimal tk promoter-CAT reporter
gene (tkCAT). Ten micrograms of the various tkCAT constructs were
cotransfected with 5 µg of the GR expression vector pSVGR1 into H4IIE
cells. CAT activity was measured in cell lysates 18 h after
treatment with or without 0.5 µM dexamethasone. The data
are expressed as the average fold induction (with dexamethasone/without
dexamethasone) of CAT activity ± SEM of four or more
separate experiments.
|
|
Mutation of GR1 to a Fully Palindromic, Consensus GRE Reduces the
Requirement for Accessory Factor-Binding Sites
The necessity for accessory factor elements in the PEPCK GRU may
be a consequence of the presence of relatively weak GR-binding sites.
If so, replacement of GR1 or GR2 with a consensus GR-binding site might
relieve this requirement. To test this hypothesis, mutations were
introduced in either GR1 (palGR1) or GR2 (palGR2) to generate the
palindromic sequence, AGAACAnnnTGTTCT. Transfection of palGR1 into
H4IIE cells resulted in a 4-fold increase of the
glucocorticoid-dependent CAT activity over that achieved when cells
were transfected with the wild-type pPL32 construct (Fig. 5A
). A similar increase was seen when
palGR2 was transfected into H4IIE cells (data not shown). Mutations
were made within each of the accessory factor sites to test the role of
the accessory factor elements in the context of palGR1. These mutant
constructs were compared with the same disruptions in the context of
the wild-type pPL32 construct (Fig. 5
, B and C). The data in Fig. 5B
confirm earlier observations in that the disruption of a single AF site
results in a 5075% reduction of the glucocorticoid response (10, 12, 13, 14). In the context of palGR1, the disruption of the AF1 or AF3
element had no effect on the glucocorticoid response (compare
mAF1-palGR1 and mAF3-palGR1 to palGR1 in Fig. 5C
). If anything, a
slight increase in the glucocorticoid response was observed from the
mAF3-palGR1 construct. Conversely, disruption of the AF2 site in the
palGR1 context (mAF2-palGR1) resulted in a 50% reduction of the
response to glucocorticoids, a decrease that was proportionately
similar to that observed when a construct that contains a wild-type
GR-binding site in conjunction with a disrupted AF2 (mAF2) site was
tested (compare mAF2 and mAF2-palGR1 in Fig. 5
, B and C). It is worth
noting that, even though the glucocorticoid response was attenuated in
cells transfected with mAF2-palGR1 compared with palGR1, the
glucocorticoid response mediated by mAF2-palGR1 remained 2- to 3-fold
greater than that mediated by the wild-type pPL32 construct [pPL32
gave a 10-fold response and mAF2-palGR1 gave a 23-fold response (37%
of the 62-fold palGR1 response); Fig. 5
, A and C]. Thus, in the
context of the PEPCK promoter, the dependency on AF1 and AF3 is
determined by the sequence at GR1, whereas AF2 augments the response of
both canonical and noncanonical GREs.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 5. The Requirement for Accessory Factor Activity Is
Diminished when GR1 Is Replaced with a Palindromic GRE
A construct was made wherein the sequence of GR1, in the context of the
wild- type PEPCK promoter-CAT construct (pPL32), was changed to a
palindromic GRE (palGR1). H4IIE cells were cotransfected with 10 µg
of either pPL32 or palGRE and 5 µg of the pSVGR expression vector.
CAT activity was measured 18 h after treatment with or without 0.5
µM dexamethasone. The results illustrated in panel A
represent the fold-induction (mean ± SEM) of at least
four independent transfection experiments. B, Mutations were introduced
into AF1, AF2, and AF3, in the context of the wild-type PEPCK
promoter-CAT construct, pPL32, so that the binding of the cognate
accessory factors was abolished. The ability of these constructs (mAF1,
mAF2, and mAF3, respectively) to mediate a glucocorticoid response was
compared with that of pPL32. H4IIE cells were cotransfected with 10
µg of either pPL32 or the mutant constructs and 5 µg of the pSVGR
expression vector. CAT activity was measured 18 h after treatment
with or without 0.5 µM dexamethasone, and the results are
expressed as a percentage of the dexamethasone response mediated by
pPL32 (mean ± SEM, n 4). C, Constructs were
made wherein the same accessory factor mutations that were described in
panel B were introduced into the context of palGR1 (mAF1-palGR1,
mAF2-palGR1, and mAF3-palGR1). The ability of these constructs to
mediate a glucocorticoid response was compared with that of palGR1.
H4IIE cells were cotransfected with 10 µg of the reporter constructs
and 5 µg of the pSVGR expression vector. CAT activity was measured
18 h after treatment with or without 0.5 µM
dexamethasone, and the results are expressed as a percentage of the
dexamethasone response mediated by palGR1 (mean ±
SEM, n 4). There was no significant difference in
the basal activity conferred by the reporter constructs used (data
not shown). The mAF1 constructs contain the sequence
-451ACGAGATTGGCCG-439, the mAF2
constructs contain the sequence
-416TGGTGTGGGGT-406,
and the mAF3 constructs contain the sequence
-337AGCCCTGTCCTTAACAC-321;
the bold letters refer to the nucleotides that deviate from
the wild-type sequence.
|
|
 |
DISCUSSION
|
|---|
Although hormone response elements were originally defined as
simple DNA sequences that bind receptor and mediate a hormone effect
through a heterologous promoter, it has now become apparent that genes
may have multiple copies of hormone response elements and that these
may require either DNA-bound accessory factors or protein-protein
interactions for maximal functional activity (6). The PEPCK gene is a
case in point. The PEPCK GRU is composed of two weak GR-binding sites
and four additional accessory factor elements (see Fig. 1
). All six of
these cis-acting elements, as well as the
trans-acting factors that bind them, are required for a
complete glucocorticoid response. Furthermore, specific
trans-acting factors must bind these elements in the correct
spatial orientation and alignment to maintain the proper function of
the GRU, which implies that multiple protein-protein interactions are
made within the context of a large nucleoprotein complex, the integrity
of which is critical for proper regulation by glucocorticoids (Ref. 14
and T. Sugiyama and D. K. Granner, unpublished observations). The
level of complexity exhibited by the PEPCK GRU is probably the rule
rather than the exception. Indeed, when studied in detail, several
GRUs, HRUs, and enhancer complexes have displayed similar requirements
(3, 29, 30).
Despite the fact that a consensus sequence for GREs has been defined, a
number of GR-binding sites, including GR1 and GR2, do not conform
closely to this sequence (4). When first described, GR1 and GR2 were
noted to be very different from the consensus GRE (Fig. 1
and Ref.10).
GR1 matches the consensus at seven of 12 positions and GR2 matches at
six of 12. However, a number of studies have suggested that these
differences may not affect the glucocorticoid response. For example,
Nordeen and colleagues, using a library of mutants, mapped the
functionally important bases of the MMTV GRE and found that 5 bp are
critically important for GRE function, -3, -2, +2, +3, and +5 (Ref.
23 and see Fig. 1
). GR1 contains all 5 of these base pairs and GR2
contains 4 of the 5. In other studies the nucleotide positions of
consensus GREs that are required for GR binding have been identified.
Chemical interference and missing base analyses show that GR makes
contacts with a consensus GRE at positions -5, -3, -2, -1, +1, +2,
+3 and +5 (24, 25). GR1, which has a much lower affinity for GR than a
consensus GRE, but a higher affinity than GR2 (Fig. 3
), contains 7 of
these 8, while GR2 contains 6 of 8. Thus, according to these analyses,
one might expect that GR1 and GR2 would bind GR with relatively high
affinity and/or mediate at least a modest response to glucocorticoids
in a heterologous promoter context. However, GR1 and GR2 have low
affinity for GR and cannot mediate a glucocorticoid response without
the aid of accessory factor activity (Figs. 3
and 4
).
It is not unusual to find multiple GREs within a promoter, particularly
if these elements are located at some distance from the transcription
start site. As is the case with GR1 and GR2, the multiple GREs in other
genes are not always of equal functional importance (22, 26, 27, 28). The
TAT gene has two functional GREs (tatGRE II and tatGRE III) located
approximately 2.5 kb upstream from the transcription initiation site
(28). These interact synergistically to provide a full response to
glucocorticoids. The upstream tatGRE II is most important when both are
present and has independent activity (tatGRE II is the tatGRE described
in Fig. 1
). tatGRE III acts synergistically with tatGRE II, but it has
no independent activity and is therefore similar to the PEPCK GR1 and
GR2 elements (28). The angiotensinogen promoter has two GREs that are
critical components of a GRU. Mutation of the upstream GRE severely
reduces glucocorticoid induction while mutation of the other only
partially blunts the response, an observation that is again reminiscent
of GR1 and GR2 (Ref. 26, and see Fig. 2
). Thus, a similarity is
apparent in the structural and functional organization of these genes,
and all three contain a hierarchy of GR-binding sites.
Additionally, most, if not all, known
glucocorticoid-responsive genes contain accessory factor elements, the
occupancy of which is required for a complete glucocorticoid response
(3, 6). The purpose may be to allow a finely tuned response to
glucocorticoids rather than the all-or-none response seen by simple
GREs in artificial promoters. Furthermore, accessory factors can be
involved in other hormonal or metabolic responses (12, 13, 29). Thus,
the transactivation of a gene in response to any given environmental
stimulus is mediated by a response unit comprised of a number of
elements that may be members of other response units. We have proposed
that the functional and structural overlap between multiple
hormone-response units provides an integrated response to different
environmental signals and challenges. This global integrating unit is
referred to as a metabolic control domain (13, 30). Thus, in the case
of the PEPCK promoter, accessory factor activity could provide a graded
response to glucocorticoids within the context of a specific metabolic
environment. However, in a different metabolic environment, which
results in the generation of other signals such as cAMP, insulin, or
retinoic acid, the same glucocorticoid signal could result in a
different degree of response: one that is appropriate for that
metabolic circumstance.
The selective effects seen when either AF1, AF2, or AF3 are mutated
within the context of palGR1 (Fig. 5
) suggest that the accessory
factors support the glucocorticoid induction of the PEPCK promoter by
distinct mechanisms. Mutation of either AF1 or AF3, which are required
for a complete glucocorticoid response in the wild-type PEPCK promoter,
did not affect the induction by glucocorticoids in the context of
palGR1 (Fig. 5C
). These results suggest that AF1 and AF3 are important
for the recruitment and/or stabilization of GR binding to the
GR-binding sites and could thereby enhance the binding affinity of the
GR to the PEPCK promoter complex. In this scenario, there would be no
necessity for AF1 or AF3 when GR1 is replaced with a palindromic GRE,
since GR binds to a consensus GRE with much higher affinity than GR1.
On the other hand, mutation of AF2 in this context resulted in a 50%
reduction of the glucocorticoid response (Fig. 5C
). This result may
indicate that the accessory factor activity mediated by AF2 occurs as a
result of a direct or indirect protein-protein interaction between
HNF-3 [the protein that mediates AF2 activity (14) ] and GR. It is
interesting to note that the glucocorticoid response mediated by the
high-affinity tatGRE II is also potentiated by HNF-3 in the context of
the TAT gene GRU (31, 32). Thus, HNF-3 acts as an accessory factor for
both high- and low-affinity GR-binding sites.
Yamamoto and colleagues (33, 34) have provided evidence that DNA acts
as an allosteric modulator of GR. In this view, a number of different
functional surfaces of GR can be exposed, and the surface displayed may
be determined, in part, by the precise DNA sequence it binds, as well
as the proteins that bind at or near the GRE. With this model in mind,
the functions of AF1 and AF3 could be to allow GR to bind with greater
affinity than it would in the absence of these elements. Additionally,
the sequence of GR1 might confer a conformation of the GR molecule that
prevents it from interacting with a specific factor(s) that is
necessary for transactivation. AF2 could compensate for this by
interacting directly with GR to either enhance its transactivation
potential, or it could participate in transactivation itself, as part
of an AF2/GR complex. This could explain why AF2 is required for
glucocorticoid-mediated transactivation in both the wild-type PEPCK
promoter, and in the palGR1 context.
How might AF1/AF3 stabilize the binding of GR to GR1 and GR2, and how
might AF2 affect the function of GR? Steroid hormone receptor family
members, including GR, transactivate through adaptor proteins called
coactivators. A number of coactivators have been described that
interact with GR and augment (at least in simple systems)
glucocorticoid responsiveness (35, 36). These include steroid receptor
coactivator 1 (SRC-1) and a member of the SRC-1 family, glucocorticoid
receptor interacting protein 1 (GRIP1), as well as the closely related
integrating factors, CREB binding protein (CBP) and p300 (37, 38, 39). In
one possible scenario, a complex of accessory factors and associated
coactivators, particularly AF1 and AF3 (also members of the steroid
hormone receptor superfamily), could interact with GR and its
coactivator to increase the occupancy of GR as a member of a nuclear
hormone receptor-coactivator complex. CBP and p300 are called
integrating coactivators because they bind an array of different
transcription factors, coactivators, and components of the basal
transcription machinery and can do so simultaneously at different sites
(37, 40). Thus, while AF1 and AF3 may be required for increased GR
occupancy, perhaps AF2 is required, along with the nuclear hormone
receptor-coactivator complex described above, to bind to a scaffolding
protein such as p300 or CBP to confer glucocorticoid-dependent
transactivation. Experiments are in progress to test these ideas.
 |
MATERIALS AND METHODS
|
|---|
Plasmids
The construction of the reporter plasmid pPL32 has been
described previously (20, 41). Site-directed mutations of the pPL32
plasmid were constructed by PCR mutagenesis as described (42). The
oligonucleotides used to generate site-directed mutations of pPL32
were:
mGR1, 5'-GCAGCCACTGGCACCAAAAATACGAAGCCA-GCAGCATATGAAGTC-3';
mGR2, 5'-TGTGCAGCCAGCAGCGTATGAATACTAAGA-GGCGTCCCGGCCAGC-3';
palGR1, 5'-ACCAGCAGCCACTGGAGAACAAAATGTTC-TGCCAGCAGCATATGA-3'; and
palGR2, 5'-AAATGTGCAGCCAGCAGAACATGATGTTC-TAGAGGCGTCCCGGCC-3'.
Mutations that disrupt the various accessory factor-binding sites
(mAF1, mAF2, and mAF3) were previously designated SDMB, SDM2 (12), and
AF3
m (13), respectively. The tk-CAT fusion constructs were made by
digesting the parent plasmid ptkCAT (43) with BamHI and
inserting a double-stranded oligonucleotide that represents either the
tyrosine aminotransferase GRE (tatGRE) (28), GR1, GR2, or GR1·2
sequences. The sense strands of the oligonucleotides that represent the
various GR-binding sites had the following sequences:
GR1, 5'-GATCCCACTGGCACACAAAATGTGCAGCCAG-CAG-3';
GR2, 5'-GATCCAGCCAGCAGCATATGAAGTCCAAGAG-GCG-3';
GR1·2,5'-GATCCCACTGGCACACAAAATGTGCAGCCAGCAGCATATGAAGTCCAAGAGGCG3';
tatGRE, 5'-GATCCAGAGGATCTGTACAGGATGTTCTA-GATCGG-3'.
The plasmids bearing the double-stranded versions of these
oligonucleotides were named GR1tk, GR2tk, GR1·2tk, and tatGREtk,
respectively. The sequence of all constructs was verified by DNA
sequence analysis. All oligonucleotides were produced on a Perceptive
Biosystems (Framingham, MA) Expedite 8909 DNA synthesizer. An
expression vector that contains the full-length rat GR (pSVGR1) was
provided by Dr. Keith R. Yamamoto (University of California San
Francisco, San Francisco, CA).
Transient Transfection
The maintenance and transfection of H4IIE cells and the CAT
assay method have been previously described (41, 44). All studies
described herein involved cotransfection with the mammalian expression
vector pSVGR1 unless otherwise indicated.
Gel Mobility Shift Assay
Ten nanograms of recombinant human GR from a baculovirus
expression system (Affinity Bioreagents, Inc., Neshanic Station, NJ;
purity, 35%) were added to a reaction mix (20 µl) that contained
an end-labeled, double-stranded palGR1 oligonucleotide with a specific
activity of 4 x 104 cpm/16 fmol, 10 mM
Tris/HCl (pH 7.5), 50 mM NaCl, 10 mM EDTA, 2
µg of poly(dI-dC)·(dI-dC), 5% (vol/vol) glycerol, 1 mM
dithiothreitol, 5 mM MgCl2, and various amounts
of competitor oligonucleotides. After allowing the reaction to take
place for 15 min at room temperature, the samples were loaded on a
nondenaturing 4% polyacrylamide gel (38.0:0.78,
acrylamide:bis-acrylamide). For the experiments that employed
antibodies, the anti-GR antibody (Santa Cruz Biotechnology, Santa Cruz,
CA) or a nonspecific antibody (anti-USF, Santa Cruz Biotechnology) was
added to the binding reaction, and the mixture was incubated on ice for
1 h before electrophoresis. The electrophoresis buffer was
composed of 36.4 mM boric acid, 32.5 mM Tris
base, and 0.25 mM EDTA. The gels were run at room
temperature at a constant 150 V and dried, and the relative amount of
GR·DNA complex was quantitated using a Bio-Rad (Richmond, CA) GS-250
Molecular Imager in conjunction with the Bio-Rad Molecular Analyst
software. The sequences of the sense strands of the GR1, GR2, GR1·2,
and tatGRE oligonucleotides were as described above. The sequence of
the palGRE oligonucleotide is the same as the palGR1 oligonucleotide
described above. In addition, the sequences of the sense strand of the
double-stranded palx2 and USF oligonucleotides were as follows:
palx2,
5'-AGTCCCACTGGAGAACAAAATGTTCTGCCAGCAGAACAAAATGTTCTAGAGGCG-3';
USF 5'-GATCTCCGGTCACGTGACCGGA-3' (45).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Rob Hall and Keith Yamamoto for a critical analysis of
the manuscript and Cathy Caldwell for her excellent technical
assistance.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Daryl K. Granner, Department of Molecular Physiology and Biophysics, Vanderbilt University School of Medicine, Nashville, Tennessee 37232-0615.
This work was supported by NIH Grant DK-35107 and Grant DK-20593 (to
the Vanderbilt Diabetes Research and Training Center).
1 These authors contributed equally to this paper 
2 Current Address: Pharmacia & Upjohn, Box 724, 220 07 Lund,
Sweden. 
Received for publication June 30, 1997.
Revision received December 29, 1997.
Accepted for publication January 11, 1998.
 |
REFERENCES
|
|---|
-
Beato M, Herrlich P, Schütz G 1995 Steroid hormone
receptors: many actors in search of a plot. Cell 83:851857[CrossRef][Medline]
-
Truss M, Beato M 1993 Steroid hormone receptors: interaction
with deoxyribonucleic acid and transcription factors. Endocr Rev 14:459479[Abstract/Free Full Text]
-
Lucas PC, Granner DK 1992 Hormone response domains in gene
transcription. Annu Rev Biochem 61:11311173[CrossRef][Medline]
-
Beato M 1989 Gene regulation by steroid hormones. Cell 56:335344[CrossRef][Medline]
-
Freedman LP 1992 Anatomy of the steroid receptor zinc finger
region. Endocr Rev 13:129145[Abstract/Free Full Text]
-
Granner DK, Strömstedt P-E 1996 Glucocorticoid hormone
action. In: Austen KF, Burakoff SJ, Rosen FS, Strom JB (eds) Theraputic
Immunology. Blackwell Scientific Publishing, Inc., Cambridge, MA, pp
3673
-
Granner D, Pilkis S 1990 The genes of hepatic glucose
metabolism. J Biol Chem 265:1017310176[Free Full Text]
-
Hanson RW, Patel YM 1994 Phosphoenolpyruvate carboxykinase
(GTP): the gene and the enzyme. Adv Enzymol 69:203281
-
Sasaki K, Cripe TP, Koch SR, Andreone T, Peterson DD, Beale
EG, Granner DK 1984 Multihormonal regulation of phosphoenolpyruvate
carboxykinase gene transcription: dominant role of insulin. J Biol
Chem 259:1524215251[Abstract/Free Full Text]
-
Imai E, Strömstedt P-E, Quinn PG, Carlstedt-Duke J,
Gustafsson J-Å, Granner DK 1990 Characterization of a complex
glucocorticoid response unit in the phosphoenolpyruvate carboxykinase
gene. Mol Cell Biol 10:47124719[Abstract/Free Full Text]
-
Hall RK, Sladek FM, Granner DK 1995 The orphan receptors
COUP-TF and HNF-4 serve as accessory factors required for induction of
phosphoenolpyruvate carboxykinase gene transcription by
glucocorticoids. Proc Natl Acad Sci USA 92:412416[Abstract/Free Full Text]
-
Mitchell J, Noisin E, Hall R, OBrien R, Imai E, Granner D 1994 Integration of multiple signals through a complex hormone response
unit in the phosphoenolpyruvate carboxykinase gene promoter. Mol
Endocrinol 8:585594[Abstract/Free Full Text]
-
Scott DK, Mitchell JA, Granner DK 1996 The orphan receptor
COUP-TF binds to a third glucocorticoid accessory factor element within
the posphoenolpyruvate carboxykinase gene promoter. J Biol
Chem 271:3190931914[Abstract/Free Full Text]
-
Wang J-C, Strömstedt P-E, OBrien RM, Granner DK 1996 Hepatic nuclear factor 3 is an accessory factor required for the
stimulation of phosphoenolpyruvate carboxykinase gene transcription by
glucocorticoids. Mol Endocrinol 10:794800[Abstract/Free Full Text]
-
Imai E, Miner JN, Mitchell JA, Yamamoto KR, Granner DK 1993 Glucocorticoid receptor-cAMP response element-binding protein
interaction and the response of the phosphoenolpyruvate carboxykinase
gene to glucocorticoids. J Biol Chem 268:53535356[Abstract/Free Full Text]
-
Scott DK, Mitchell JA, Granner DK 1996 Identification and
characterization of a second retinoic acid response element in the
phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 271:3190931914
-
Hall RK, Scott DK, Noisin EL, Granner DK 1992 Activation of
the PEPCK retinoic acid response element is dependent on a retinoic
acid receptor/coregulator complex. Mol Cell Biol 12:55275535[Abstract/Free Full Text]
-
OBrien RM, Lucas PC, Forest CD, Magnuson MA, Granner DK 1990 Identification of a sequence in the PEPCK gene that mediates a negative
effect of insulin on transcription. Science 249:533537[Abstract/Free Full Text]
-
OBrien RM, Bonovich MT, Forest CD, Granner DK 1991 Signal
transduction convergence: phorbol esters and insulin inhibit
phosphoenolpyruvate carboxykinase gene transcription through the same
10-base-pair sequence. Proc Natl Acad Sci USA 88:65806584[Abstract/Free Full Text]
-
Quinn PG, Wong TW, Magnuson MM, Shabb JB, Granner DK 1988 Identification of basal and cyclic AMP regulatory elements in the
promoter of the phosphoeneolpyruvate carboxykinase gene. Mol Cell Biol 8:34673475[Abstract/Free Full Text]
-
Schmid W, Strähle U, Schütz G, Schmitt J,
Stunnenberg H 1989 Glucocorticoid receptor binds cooperatively to
adjacent recognition sites. EMBO J 8:22572263[Medline]
-
Strähle U, Schmid W, Schütz G 1988 Synergistic
action of the glucocorticoid receptor with transcription factors. EMBO
J 7:33893395[Medline]
-
Nordeen SK, Suh BJ, Kuhnel B, Hutchison III CA 1990 Structural
determinants of a receptor recognition element. Mol Endocrinol 4:18661873[Abstract/Free Full Text]
-
Cairns C, Gustafsson J-Å, Carlstedt-Duke J 1991 Identification of protein contact sites within the
glucocorticoid/progestin response element. Mol Endocrinol 5:598604[Abstract/Free Full Text]
-
Truss M, Chalepakis G, Beato M 1990 Contacts between steroid
hormone receptors and thymines in DNA: an interference method. Proc
Natl Acad Sci USA 87:71807184[Abstract/Free Full Text]
-
Brasier AR, Ron D, Tate JE, Habener JF 1990 Synergistic
enhansons located within an acute phase responsive enhancer modulate
glucocorticoid induction of angiotensinogen gene transcription. Mol
Endocrinol 4:19211933[Abstract/Free Full Text]
-
Grange T, Roux G, Pictet R 1989 Two remote glucocorticoid
response units interact cooperatively to promote glucocorticoid
induction of rat tyrosine aminotransferase gene expression. Nucleic
Acids Res 21:86958709
-
Jantzen H-M, Strähle U, Gloss B, Stewart F, Schmid W,
Boshart M, Miksicek R, Schütz G 1987 Cooperativity of
glucocorticoid response elements located far upstream of the tyrosine
aminotransferase gene. Cell 49:2938[CrossRef][Medline]
-
Lucas PC, OBrien RM, Mitchell JA, Davis CM, Imai E, Forman
BM, Samuels HH, Granner DK 1991 A retinoic acid response element is
part of a pleiotropic domain in the phosphoenolpyruvate
carboxykinase gene. Proc Natl Acad Sci USA 88:21842188[Abstract/Free Full Text]
-
Hall RK, Scott DK, OBrien RM, Granner DK 1993 From metabolic
pathways to metabolic control domains: multiple factors bind the PEPCK
AF1/retinoic acid response element. In: Mornex R, Jaffiol C, Leclerc J
(eds) Progress in Endocrinology. Proceedings of the Ninth International
Congress on Endocrinology, Nice, France, 1992. Parthenon Publishing,
London, pp 777782
-
Nitsch D, Schütz G 1993 The distal enhancer implicated
in the developmental regulation of the tyrosine aminotransferase gene
is bound by liver-specific and ubiquitous factors. Mol Cell Biol 13:44944504[Abstract/Free Full Text]
-
Nitsch D, Boshart M, Schütz G 1993 Activation of the
tyrosine aminotransferase gene is dependent on synergy between
liver-specific and hormone-responsive elements. Proc Natl Acad Sci USA 90:54795483[Abstract/Free Full Text]
-
Lefstin JA, Thomas JR, Yamamoto KR 1994 Influence of a steroid
receptor DNA-binding domain on transcriptional regulatory functions.
Genes Dev 8:28422856[Abstract/Free Full Text]
-
Starr DB, Matsui W, Thomas JR, Yamamoto KR 1996 Intracellular
receptors use a common mechanism to interpret signaling information at
response elements. Genes Dev 10:12711283[Abstract/Free Full Text]
-
Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung
L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:11671177[Abstract/Free Full Text]
-
Beato M, Sanchez-Pacheco A 1996 Interaction of steroid hormone
receptors with the transcription initiation complex. Endocr Rev 17:587609[Abstract/Free Full Text]
-
Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin
S, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator
complex mediates transcriptional activation and AP-1 inhibition by
nuclear receptors. Cell 85:403414[CrossRef][Medline]
-
Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional
coactivator in yeast for the hormone binding domains of steroid
receptors. Proc Natl Acad Sci USA 93:49484952[Abstract/Free Full Text]
-
Oñate SA, Tsai SY, Tsai M-J, OMalley BW 1995 Sequence and characterization of a coactivator for the steroid
hormone receptor superfamily. Science 270:13541357[Abstract/Free Full Text]
-
Janknecht R, Hunter T 1996 Transcriptional control: versatile
molecular glue. Curr Biol 8:951954
-
Peterson DD, Magnuson MA, Granner DK 1988 Location and
characterization of two widely separated glucocorticoid response
elements in the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 8:96104[Abstract/Free Full Text]
-
Barik S 1993 Site-directed mutagenesis by double polymerase
chain reaction. In: White BA (ed) PCR Protocols: Current Methods and
Applications. Humana Press, Totowa, NJ, pp 277286
-
McKnight SL, Kingsbury R 1982 Transcriptional control signals
of a eukaryotic protein-coding gene. Science 217:316324[Abstract/Free Full Text]
-
Nordeen SK, Green PPI II, Fowlkes DM 1987 A rapid, sensitive,
and inexpensive assay for chloramphenicol acetyltransferase. DNA 6:173178[Medline]
-
Sirito M, Walker S, Qun L, Kozlowski MT, Klein WH, Sawadogo M 1992 Members of the USF family of helix-loop-helix proteins bind DNA as
homo- as well as heterodimers. Gene Expres 2:231240
This article has been cited by other articles:

|
 |

|
 |
 
E. B. Kabotyanski, M. Huetter, W. Xian, M. Rijnkels, and J. M. Rosen
Integration of Prolactin and Glucocorticoid Signaling at the {beta}-Casein Promoter and Enhancer by Ordered Recruitment of Specific Transcription Factors and Chromatin Modifiers
Mol. Endocrinol.,
October 1, 2006;
20(10):
2355 - 2368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Cassuto, K. Kochan, K. Chakravarty, H. Cohen, B. Blum, Y. Olswang, P. Hakimi, C. Xu, D. Massillon, R. W. Hanson, et al.
Glucocorticoids Regulate Transcription of the Gene for Phosphoenolpyruvate Carboxykinase in the Liver via an Extended Glucocorticoid Regulatory Unit
J. Biol. Chem.,
October 7, 2005;
280(40):
33873 - 33884.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Baumann, A. Dostert, N. Novac, A. Bauer, W. Schmid, S. C. Fas, A. Krueger, T. Heinzel, S. Kirchhoff, G. Schutz, et al.
Glucocorticoids inhibit activation-induced cell death (AICD) via direct DNA-dependent repression of the CD95 ligand gene by a glucocorticoid receptor dimer
Blood,
July 15, 2005;
106(2):
617 - 625.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-L. Asselin-Labat, A. Biola-Vidamment, S. Kerbrat, M. Lombes, J. Bertoglio, and M. Pallardy
FoxO3 Mediates Antagonistic Effects of Glucocorticoids and Interleukin-2 on Glucocorticoid-Induced Leucine Zipper Expression
Mol. Endocrinol.,
July 1, 2005;
19(7):
1752 - 1764.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Shao, L. Qiao, R. C. Janssen, M. Pagliassotti, and J. E. Friedman
Chronic Hyperglycemia Enhances PEPCK Gene Expression and Hepatocellular Glucose Production Via Elevated Liver Activating Protein/Liver Inhibitory Protein Ratio
Diabetes,
April 1, 2005;
54(4):
976 - 984.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-C. Wang, M. K. Derynck, D. F. Nonaka, D. B. Khodabakhsh, C. Haqq, and K. R. Yamamoto
From The Cover: Chromatin immunoprecipitation (ChIP) scanning identifies primary glucocorticoid receptor target genes
PNAS,
November 2, 2004;
101(44):
15603 - 15608.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. L. Wang, B. Herzog, M. Waltner-Law, R. K. Hall, M. Shiota, and D. K. Granner
The Synergistic Effect of Dexamethasone and All-trans-retinoic Acid on Hepatic Phosphoenolpyruvate Carboxykinase Gene Expression Involves the Coactivator p300
J. Biol. Chem.,
August 13, 2004;
279(33):
34191 - 34200.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. McInnes, C. J. Kenyon, K. E. Chapman, D. E. W. Livingstone, L. J. Macdonald, B. R. Walker, and R. Andrew
5{alpha}-Reduced Glucocorticoids, Novel Endogenous Activators of the Glucocorticoid Receptor
J. Biol. Chem.,
May 28, 2004;
279(22):
22908 - 22912.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Herzog, R. K. Hall, X. L. Wang, M. Waltner-Law, and D. K. Granner
Peroxisome Proliferator-Activated Receptor {gamma} Coactivator-1{alpha}, as a Transcription Amplifier, Is Not Essential for Basal and Hormone-Induced Phosphoenolpyruvate Carboxykinase Gene Expression
Mol. Endocrinol.,
April 1, 2004;
18(4):
807 - 819.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. De Bosscher, W. Vanden Berghe, and G. Haegeman
The Interplay between the Glucocorticoid Receptor and Nuclear Factor-{kappa}B or Activator Protein-1: Molecular Mechanisms for Gene Repression
Endocr. Rev.,
August 1, 2003;
24(4):
488 - 522.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Coghlan, P. B. Jacobson, B. Lane, M. Nakane, C. W. Lin, S. W. Elmore, P. R. Kym, J. R. Luly, G. W. Carter, R. Turner, et al.
A Novel Antiinflammatory Maintains Glucocorticoid Efficacy with Reduced Side Effects
Mol. Endocrinol.,
May 1, 2003;
17(5):
860 - 869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kucera, M. Waltner-Law, D. K. Scott, R. Prasad, and D. K. Granner
A Point Mutation of the AF2 Transactivation Domain of the Glucocorticoid Receptor Disrupts Its Interaction with Steroid Receptor Coactivator 1
J. Biol. Chem.,
July 12, 2002;
277(29):
26098 - 26102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Ma, C. Mallidis, J. Artaza, W. Taylor, N. Gonzalez-Cadavid, and S. Bhasin
Characterization of 5'-regulatory region of human myostatin gene: regulation by dexamethasone in vitro
Am J Physiol Endocrinol Metab,
December 1, 2001;
281(6):
E1128 - E1136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Shen, L. M. Scearce, J. E. Brestelli, N. J. Sund, and K. H. Kaestner
Foxa3 (Hepatocyte Nuclear Factor 3gamma ) Is Required for the Regulation of Hepatic GLUT2 Expression and the Maintenance of Glucose Homeostasis during a Prolonged Fast
J. Biol. Chem.,
November 9, 2001;
276(46):
42812 - 42817.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Stafford, J. C. Wilkinson, J. M. Beechem, and D. K. Granner
Accessory Factors Facilitate the Binding of Glucocorticoid Receptor to the Phosphoenolpyruvate Carboxykinase Gene Promoter
J. Biol. Chem.,
October 19, 2001;
276(43):
39885 - 39891.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-C. Wang, J. M. Stafford, D. K. Scott, C. Sutherland, and D. K. Granner
The Molecular Physiology of Hepatic Nuclear Factor 3 in the Regulation of Gluconeogenesis
J. Biol. Chem.,
May 5, 2000;
275(19):
14717 - 14721.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-C. Wang, P.-E. Strömstedt, T. Sugiyama, and D. K. Granner
The Phosphoenolpyruvate Carboxykinase Gene Glucocorticoid Response Unit: Identification of the Functional Domains of Accessory Factors HNF3{beta} (Hepatic Nuclear Factor-3{beta}) and HNF4 and the Necessity of Proper Alignment of Their Cognate Binding Sites
Mol. Endocrinol.,
April 1, 1999;
13(4):
604 - 618.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. Leahy, D. R. Crawford, G. Grossman, R. M. Gronostajski, and R. W. Hanson
CREB Binding Protein Coordinates the Function of Multiple Transcription Factors Including Nuclear Factor I to Regulate Phosphoenolpyruvate Carboxykinase (GTP) Gene Transcription
J. Biol. Chem.,
March 26, 1999;
274(13):
8813 - 8822.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Park, S. Song, C. Vinson, and W. J. Roesler
Role of CCAAT Enhancer-binding Protein beta in the Thyroid Hormone and cAMP Induction of Phosphoenolpyruvate Carboxykinase Gene Transcription
J. Biol. Chem.,
January 1, 1999;
274(1):
211 - 217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Croniger, P. Leahy, L. Reshef, and R. W. Hanson
C/EBP and the Control of Phosphoenolpyruvate Carboxykinase Gene Transcription in the Liver
J. Biol. Chem.,
November 27, 1998;
273(48):
31629 - 31632.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Sugiyama, D. K. Scott, J.-C. Wang, and D. K. Granner
Structural Requirements of the Glucocorticoid and Retinoic Acid Response Units in the Phosphoenolpyruvate Carboxykinase Gene Promoter
Mol. Endocrinol.,
October 1, 1998;
12(10):
1487 - 1498.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K.R. YAMAMOTO, B.D. DARIMONT, R.L. WAGNER, and J.A. INIGUEZ-LLUHI
Building Transcriptional Regulatory Complexes: Signals and Surfaces
Cold Spring Harb Symp Quant Biol,
January 1, 1998;
63(0):
587 - 598.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Stafford, M. Waltner-Law, and D. K. Granner
Role of Accessory Factors and Steroid Receptor Coactivator 1 in the Regulation of Phosphoenolpyruvate Carboxykinase Gene Transcription by Glucocorticoids
J. Biol. Chem.,
February 2, 2001;
276(6):
3811 - 3819.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Yeagley, S. Guo, T. Unterman, and P. G. Quinn
Gene- and Activation-specific Mechanisms for Insulin Inhibition of Basal and Glucocorticoid-induced Insulin-like Growth Factor Binding Protein-1 and Phosphoenolpyruvate Carboxykinase Transcription. ROLES OF FORKHEAD AND INSULIN RESPONSE SEQUENCES
J. Biol. Chem.,
August 31, 2001;
276(36):
33705 - 33710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. S. Lechner, C. M. Croniger, P. Hakimi, C. Millward, C. Fekter, J. S. Yun, and R. W. Hanson
The Use of Transgenic Mice to Analyze the Role of Accessory Factor Two in the Regulation of Phosphoenolpyruvate Carboxykinase (GTP) Gene Transcription during Diabetes
J. Biol. Chem.,
June 15, 2001;
276(25):
22675 - 22679.
[Abstract]
[Full Text]
[PDF]
|
 |
|