help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scott, D. K.
Right arrow Articles by Granner, D. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scott, D. K.
Right arrow Articles by Granner, D. K.
Molecular Endocrinology 12 (4): 482-491
Copyright © 1998 by The Endocrine Society

Further Characterization of the Glucocorticoid Response Unit in the Phosphoenolpyruvate Carboxykinase Gene. The Role of the Glucocorticoid Receptor-Binding Sites

Donald K. Scott1, Per-Erik Strömstedt1,2, Jen-Chywan Wang and Daryl K. Granner

Department of Molecular Physiology and Biophysics Vanderbilt University School of Medicine Nashville, Tennessee 37232-0615


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Phosphoenolpyruvate carboxykinase (PEPCK) catalyzes the rate-limiting step of gluconeogenesis. The activity of this enzyme is controlled by several hormones, including glucocorticoids, glucagon, retinoic acid, and insulin, that principally affect the rate of transcription of the PEPCK gene. Glucocorticoids induce PEPCK gene transcription through a complex glucocorticoid response unit that consists of, from 5' to 3', accessory factor elements AF1 and AF2; two noncanonical glucocorticoid receptor-binding sites, GR1 and GR2; a third accessory factor element, AF3; and a cAMP-response element, CRE. A complete glucocorticoid response is dependent on the presence of both GR-binding sites, all three accessory elements, and the CRE. In this study we assess the relative roles of GR1 and GR2 in the context of the glucocorticoid response unit and use a combination of binding and function assays to compare GR1 and GR2 to glucocorticoid response elements (GREs) that conform closely to the consensus sequence. The relative binding affinity of GR follows the order: consensus GRE >> GR1 > GR2. Mutations that disrupt the binding of GR to GR1 result in a major reduction of the glucocorticoid response, whereas similar mutations of GR2 have a much smaller effect. Unlike the simple consensus GRE, neither GR1 nor GR2 mediate a glucocorticoid response through a heterologous promoter. The accessory elements appear to have different functional roles. AF2 is still needed for a maximal glucocorticoid response when GR1 is converted to a high-affinity GR-binding element, but AF1 and AF3 are not required.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The glucocorticoid receptor (GR), with bound ligand, regulates the transcription of target genes by interacting with specific DNA sequences that can be located either upstream or downstream from the transcription initiation site (1). These DNA sequences, which can activate or repress transcription, are commonly referred to as glucocorticoid response elements (GREs) (reviewed in Refs. 2 and 3). The consensus GRE consists of two partially palindromic hexanucleotide half-sites separated by 3 bp (GGTACAnnnTGTTCT; see Fig. 1Go and Ref.4). Several observations are consistent with the idea that the GRE binds a receptor dimer and that one monomer binds to each half-site (reviewed in Ref.5). As originally characterized, the simple GR-GRE complex mediates glucocorticoid effects through heterologous promoters in a position- and orientation-independent manner. In recent years it has become apparent that, in most instances, the GR-binding sites are functionally associated with numerous other transcription factor-binding sites to form composite or complex elements (6). These functional arrays of DNA elements and associated transcription factors are referred to as glucocorticoid response units (GRUs) (3).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. Schematic Diagram of the PEPCK Gene GRU

The positions of AF1, AF2, GR1, GR2, AF3, and the CRE are shown relative to the transcription initiation site of the PEPCK gene. All six of these elements are required for a complete glucocorticoid response. The sequences of GR1 and GR 2 are aligned in the boxed area, and the hexanucleotide half-sites are indicated by bold letters. The consensus GRE sequence is derived from the base pair conservation in functional response elements (4). The position of each base is numbered relative to the three central spacing nucleotides. For comparison, the sequences of GREs that closely conform to the consensus GRE, and are used in this study, are shown below the consensus GRE sequence. palGRE is a fully palindromic GRE, and tatGRE represents the tyrosine aminotransferase GRE II.

 
Cytosolic phosphoenolpyruvate carboxykinase (GTP; EC 4.1.1.32; PEPCK) catalyzes the conversion of oxaloacetate to phosphoenolpyruvate, a rate-controlling step in the conversion of lactate to glucose in liver (7, 8). Glucocorticoids, glucagon (cAMP), and retinoic acid increase the transcription of the hepatic PEPCK gene while insulin inhibits both induced and basal transcription (9). Induction of the PEPCK gene by glucocorticoids is achieved through a complex GRU. The GRU ensemble includes two GR-binding sites, GR1 and GR2, located by deoxyribonuclease I (DNase I) footprinting between nucleotides -386/-353 relative to the transcription initiation site, and binding sites for transcription factors that act as accessory factors for the glucocorticoid response (Fig. 1Go and Ref.10). Three accessory factor-binding sites (AFs) have been identified and characterized in the PEPCK gene GRU. AF1 is located between -455/-431 (10, 11, 12), AF2 is located between -420/-403 (10, 12), and the more recently identified AF3 is located between -327/-321 (13). The proteins that mediate the accessory activities through AF1, AF2, and AF3 have been identified. Hepatic nuclear factor 4 (HNF-4) and chicken ovalbumin upstream transcription factor (COUP-TF) each confer accessory activity through the AF1 element (11). Members of the hepatic nuclear factor 3 (HNF-3) family bind to AF2 and act as accessory factors to the glucocorticoid response through this element (14). Finally, COUP-TF acts as the accessory factor through AF3 (13).

All three AF elements are required for a complete glucocorticoid response. A mutation of either AF1, AF2, or AF3 reduces the glucocorticoid response by at least 50% (10, 11, 12, 13, 14). Moreover, deletion or mutation of any two accessory elements essentially abolishes the glucocorticoid response; hence, GR1 and GR2 have little, if any, intrinsic activity in the context of the PEPCK gene promoter (10, 13). At least one additional downstream element is required for full activity through the GRU. Deletion of the cAMP response element (CRE) at position -93/-86 also reduces glucocorticoid responsiveness by approximately 50% (15). A direct interaction between GR and the cAMP response element binding protein (CREB) has been demonstrated in vitro; thus, it seems that a functional interaction between the GRU and CRE, which is accomplished over a distance of more than 300 bp, is required for a complete glucocorticoid response (15).

AF1, AF2, AF3, and the CRE are all pleiotropic elements. In addition to their role in the glucocorticoid response, AF1 and AF3 also bind the retinoic acid receptor · 9-cis-retinoic receptor heterodimeric complex and, in the presence of retinoic acid, serve as retinoic acid response elements (16, 17). AF2 mediates an inhibitory response of insulin and phorbol esters in addition to its essential role in the glucocorticoid response (18, 19). The exact factor(s) that mediates the inhibitory effect of insulin on the PEPCK gene through the AF2 element is not known. The CRE is also a multifunctional element, since it is required for basal transcription as well as for the cAMP response and the glucocorticoid response (15, 20).

Having defined the accessory factors, we next performed an analysis of the role of the GR-binding sites in the interplay of these various transcription factors on the PEPCK promoter. When originally defined, GR1 and GR2 were thought to be of equal importance (10). However, the deletion of GR2 also included the recently defined AF3 element (13). Thus, the loss of function originally attributed to GR2 could be explained by the absence of AF3. A reassessment of the role of GR2, using site-directed mutations rather than a large deletion, seemed warranted. In this study block mutations reveal that GR1 is more important than GR2 for a complete glucocorticoid response. The GR1 element binds GR better than does GR2, but both bind the receptor at least 15 times less avidly than a consensus GRE. Unlike a consensus GRE, GR1 and GR2 are unable to convey a glucocorticoid response through a heterologous promoter. The conversion of GR1 to a high-affinity, fully palindromic GRE, in the context of the wild-type PEPCK promoter, relieves the requirement for AF1 and AF3. Inasmuch as AF2 is still necessary for the full response to glucocorticoids, there appears to be a functional difference between the various accessory elements.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
GR1 and GR2 Have Hierarchic Functional Roles
We previously examined the relative roles of GR1 and GR2 in the response of the PEPCK gene to glucocorticoids (10). In those studies, deletion mutations of GR1 and GR2 indicated that these two glucocorticoid receptor-binding sites were of equal importance. However, the deletion mutation of GR2 included the sequence from -327 to -321 relative to the transcription start site, which we have recently shown comprises an accessory factor element (AF3) that is required for a complete glucocorticoid response (13). In light of this recent finding we reexamined the relative roles of GR1 and GR2, in the context of the GRU. Site-directed mutations that prevent GR binding (data not shown) were separately introduced into each element (mGR1 and mGR2) in the context of pPL32 [a plasmid bearing the wild-type PEPCK promoter from -467 to +69 linked to the chloramphenicol acetyltransferase (CAT) reporter gene] to assess the contributions of GR1 and GR2 to the function of the PEPCK GRU. The wild-type promoter (pPL32) mediated a 13-fold induction by glucocorticoids in H4IIE cells (Fig. 2Go). Mutation of GR1 reduced the glucocorticoid induction to about a 2-fold response over control, which is similar to that obtained from a construct in which both GR1 and GR2 have been deleted (10, 13). Mutation of GR2, with GR1 intact, attenuated the glucocorticoid response somewhat, but a 7.5-fold induction by glucocorticoids was still obtained (Fig. 2Go). Thus, GR1 is apparently more important for the response of the PEPCK gene to glucocorticoids than is GR2.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. The Function of GR1 and GR2 in the Context of the PEPCK Gene Promoter

GR1 and GR2 mutations that prevent GR binding were tested for the ability to support glucocorticoid induction of CAT reporter activity in the context of the wild-type PEPCK promoter-CAT construct (pPL32). H4IIE cells were cotransfected with 10 µg of the various PEPCK promoter-CAT chimeric constructs and 5 µg of the GR expression vector (pSVGR1). CAT activity was measured 18 h after treatment with or without 0.5 µM dexamethasone. The solid bars represent the fold induction (with dexamethasone/without dexamethasone, mean ± SEM) of at least five independent transfections. All of the reporter constructs had identical basal activities in these experiments (data not shown). The mGR1 construct contains the sequence -391TGGCACCAAAAATACGAAGCC-371, and the mGR2 construct contains the sequence -370AGCAGCGTATGAATACTAAGA-350; the bold letters indicate variations from the wild-type sequence.

 
GR1 and GR2 Bind GR with Low Affinity in Vitro
For the sake of clarity, we define a consensus GRE as one that closely conforms to the consensus sequence described by Beato (Ref. 4 and see Fig. 1Go) and elicits a glucocorticoid response in the context of a heterologous promoter. Thus, as depicted in Fig. 1Go, the naturally occurring tyrosine aminotransferase GRE (tatGRE, 11 of 12 position match) as well as the synthetic fully palindromic GRE (palGRE, 10 of 12 positions) are consensus GREs, while the PEPCK GR1 (7 of 12 position match) and GR2 (6 of 12 position match) elements are not. In addition, the tatGRE and the palGRE mediate glucocorticoid responses in heterologous promoter systems, while GR1 and GR2 do not (see below).

In the case of the PEPCK GRU it is possible that the requirement for accessory factors is related to a decreased binding affinity of GR1 and/or GR2 for GR, as compared with a consensus GRE. Also, the relative functional importance of GR1 and GR2 in the GRU could be related to the ability of these elements to bind GR. Therefore, the relative binding affinity of GR for oligonucleotides that contain a number of glucocorticoid-binding sites was determined using increasing concentrations of competitor oligonucleotides in an electrophoretic gel mobility shift assay (Fig. 3Go). Figure 3AGo illustrates the results from a study used to establish the system employed in these experiments. An oligonucleotide that contains the GR1 sequence mutated to a palindromic GRE (palGRE) was used as the probe. A protein·DNA complex was diminished in the presence of antiserum directed against GR, but this did not occur when a nonspecific antiserum was employed. In addition, a 100-fold molar excess of the unlabeled palGRE oligonucleotide completely prevented the formation of the GR·DNA complex, whereas a 100-fold molar excess of an oligonucleotide that contains an upstream stimulatory factor (USF)-binding site did not affect the formation of the complex. Together, these data demonstrate that the protein·DNA complex contains GR. As shown in Fig. 3Go, B and C, the palGRE and the tatGRE oligonucleotides prevented the formation of the GR·DNA complex at essentially the same relative low concentration. By contrast, the GR1 and GR2 oligonucleotides were much less effective at preventing the formation of the GR·DNA complex than were either of the consensus GREs. As a control, an oligonucleotide that contains a binding site for the transcription factor USF did not affect the formation of the GR·DNA complex, even at a 200-fold molar excess (Fig. 3CGo). Based on the data illustrated in Fig. 3CGo, we estimate that the consensus GREs bind GR with at least a 15-fold greater affinity than GR1, and GR1 binds GR with a somewhat higher affinity than does GR2. Thus, the relative order of affinity of GR for the GREs tested was: palGRE and tatGRE >> GR1 > GR2. In other studies, the DNA-binding domain of GR bound to the mouse mammary tumor virus (MMTV) GRE (-189 to -166) with about a 10-fold greater affinity than GR1 using a DNase I footprinting strategy (E. Imai and D. K. Granner, unpublished observations).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 3. Relative Affinity of the Glucocorticoid Receptor for GR1, GR2, and Consensus GREs

Mobility gel shift assays were performed in which an end-labeled double-stranded palGRE oligonucleotide was used as the probe in a binding reaction that included 10 ng human recombinant GR. The free DNA and the GR·DNA complex were separated on 4% nondenaturing polyacrylamide gels and subjected to autoradiography or were quantitated using a Bio-Rad PhosphoImager. A, Antiserum directed against GR, a nonspecific antiserum (NS), a specific unlabeled competitor oligonucleotide, palGRE, or a nonspecific competitior, USF, were added to the binding reaction. For simplicity, only the portion of the gel with bound complexes is shown. B, Representative gels wherein various amounts of unlabeled GR1 or palGRE oligonucleotides were added to the binding reaction. C, The relative affinity of GR for oligonucleotides that contain tatGRE and palGRE are compared with the PEPCK GR-binding sites, GR1 and GR2, and to a nonspecific DNA competitor, USF. D, The relative affinity of GR for an oligonucleotide that contains a single palindromic GRE, palGRE, is compared with one that contains two palindromic GREs in tandem, palx2. E, The relative affinity of GR for an oligonucleotide that contains GR1 is compared with one that contains both GR1 and GR2 (GR1·2). The data shown in panels C, D, and E represent the means (±SEM, n >= 3) of the relative amount of the GR·DNA complex remaining as a function of increasing concentrations of competitor DNA as quantitated on a Bio-Rad PhosphoImager. The data for palGRE and GR1 illustrated in panels D and E, respectively, are the same as those shown in panel C. Note that different amounts of competitor DNAs were used in the various experiments.

 
Schmid et al. (21) demonstrated that an oligonucleotide containing two closely spaced consensus GREs that are aligned on the same side of the DNA helix bind GR cooperatively and have at least a 10-fold greater affinity for GR than an oligonucleotide containing a single consensus GRE. GR1 and GR2 are spaced 21 bp apart (see Fig. 1Go), approximately two turns of the double helix, and so may bind GR cooperatively and thus compensate for the low affinity of these two GR-binding sites. Oligonucleotides that contain either GR1 or both GR1 and GR2 with the same spacing and flanking sequences as those present within the native PEPCK promoter were used as competitors in a mobility gel shift assay, using the palGRE oligonucleotide as the probe, to determine whether GR binds to GR1 and GR2 cooperatively. For comparison, oligonucleotides that contained either one palindromic GRE or two palindromic GREs spaced 21 bp apart (palx2) were used as competitors in the same assay. The palx2 oligonucleotide competed for the formation of the GR·DNA complex at a concentration that was at least 10 fold lower than did an oligonucleotide that contained a single palindromic GRE (compare palGRE with palx2 in Fig. 3DGo). This result is in close agreement with that of Schmid et al. (21). In contrast, an oligonucleotide that contains both GR1 and GR2 had the same affinity for GR as did an oligonucleotide that contained only GR1 (compare GR1 with GR1·2 in Fig. 3EGo). Thus, GR1 and GR2 apparently do not bind GR with detectable cooperativity.

GR1 and GR2 Do Not Function as Simple GREs
As mentioned above, a single copy of the tatGRE confers a response to glucocorticoids when placed immediately upstream of the TATA box in the context of a heterologous promoter, but a single GRE placed far upstream (>300 bp) of the TATA box is not sufficient for hormone induction. However, two copies of a consensus GRE, or the combination of a consensus GRE with another transcription factor-binding site, can confer hormonal activation from such a distant position (22). GR1 and GR2 are located between positions -394/-349 within the PEPCK promoter, and this may account for the necessity of having the additional transcription factors that constitute the GRU. Constructs that contain a single copy of either GR1 or GR2 placed immediately upstream of a minimal thymidine kinase (tk) promoter, and ligated to the CAT reporter gene, were tested for their ability to respond to glucocorticoids. H4IIE cells transfected with either GR1tk or GR2tk failed to respond to glucocorticoids (Fig. 4Go). Conversely, cells transfected with a construct that consists of a single copy of the tatGRE ligated to the minimal tk promoter (tatGREtk) showed a 16-fold increase of CAT expression in response to glucocorticoids, in agreement with previous results (Fig. 4Go and Ref.22). Cells transfected with a tkCAT construct that contains the PEPCK promoter sequence from -395 to -346 and therefore contains both GR1 and GR2 (GR1·2tk), were also unresponsive to glucocorticoids when tested in transient transfection experiments (Fig. 4Go). Taken together, these data demonstrate that neither GR1 nor GR2 functions as a simple GRE in a heterologous context. Moreover, unlike the situation with the tatGRE cited above (21, 22), GR1 and GR2 in combination do not confer synergistic activation of transcription in response to glucocorticoids, at least in this heterologous context.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 4. GR1 and GR2 Do Not Confer a Glucocorticoid Response in the Context of a Heterologous Promoter

Constructs were made wherein GR1, GR2, GR1 and GR2 (GR1·2), and the tatGRE were ligated upstream of the minimal tk promoter-CAT reporter gene (tkCAT). Ten micrograms of the various tkCAT constructs were cotransfected with 5 µg of the GR expression vector pSVGR1 into H4IIE cells. CAT activity was measured in cell lysates 18 h after treatment with or without 0.5 µM dexamethasone. The data are expressed as the average fold induction (with dexamethasone/without dexamethasone) of CAT activity ± SEM of four or more separate experiments.

 
Mutation of GR1 to a Fully Palindromic, Consensus GRE Reduces the Requirement for Accessory Factor-Binding Sites
The necessity for accessory factor elements in the PEPCK GRU may be a consequence of the presence of relatively weak GR-binding sites. If so, replacement of GR1 or GR2 with a consensus GR-binding site might relieve this requirement. To test this hypothesis, mutations were introduced in either GR1 (palGR1) or GR2 (palGR2) to generate the palindromic sequence, AGAACAnnnTGTTCT. Transfection of palGR1 into H4IIE cells resulted in a 4-fold increase of the glucocorticoid-dependent CAT activity over that achieved when cells were transfected with the wild-type pPL32 construct (Fig. 5AGo). A similar increase was seen when palGR2 was transfected into H4IIE cells (data not shown). Mutations were made within each of the accessory factor sites to test the role of the accessory factor elements in the context of palGR1. These mutant constructs were compared with the same disruptions in the context of the wild-type pPL32 construct (Fig. 5Go, B and C). The data in Fig. 5BGo confirm earlier observations in that the disruption of a single AF site results in a 50–75% reduction of the glucocorticoid response (10, 12, 13, 14). In the context of palGR1, the disruption of the AF1 or AF3 element had no effect on the glucocorticoid response (compare mAF1-palGR1 and mAF3-palGR1 to palGR1 in Fig. 5CGo). If anything, a slight increase in the glucocorticoid response was observed from the mAF3-palGR1 construct. Conversely, disruption of the AF2 site in the palGR1 context (mAF2-palGR1) resulted in a 50% reduction of the response to glucocorticoids, a decrease that was proportionately similar to that observed when a construct that contains a wild-type GR-binding site in conjunction with a disrupted AF2 (mAF2) site was tested (compare mAF2 and mAF2-palGR1 in Fig. 5Go, B and C). It is worth noting that, even though the glucocorticoid response was attenuated in cells transfected with mAF2-palGR1 compared with palGR1, the glucocorticoid response mediated by mAF2-palGR1 remained 2- to 3-fold greater than that mediated by the wild-type pPL32 construct [pPL32 gave a 10-fold response and mAF2-palGR1 gave a 23-fold response (37% of the 62-fold palGR1 response); Fig. 5Go, A and C]. Thus, in the context of the PEPCK promoter, the dependency on AF1 and AF3 is determined by the sequence at GR1, whereas AF2 augments the response of both canonical and noncanonical GREs.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. The Requirement for Accessory Factor Activity Is Diminished when GR1 Is Replaced with a Palindromic GRE

A construct was made wherein the sequence of GR1, in the context of the wild- type PEPCK promoter-CAT construct (pPL32), was changed to a palindromic GRE (palGR1). H4IIE cells were cotransfected with 10 µg of either pPL32 or palGRE and 5 µg of the pSVGR expression vector. CAT activity was measured 18 h after treatment with or without 0.5 µM dexamethasone. The results illustrated in panel A represent the fold-induction (mean ± SEM) of at least four independent transfection experiments. B, Mutations were introduced into AF1, AF2, and AF3, in the context of the wild-type PEPCK promoter-CAT construct, pPL32, so that the binding of the cognate accessory factors was abolished. The ability of these constructs (mAF1, mAF2, and mAF3, respectively) to mediate a glucocorticoid response was compared with that of pPL32. H4IIE cells were cotransfected with 10 µg of either pPL32 or the mutant constructs and 5 µg of the pSVGR expression vector. CAT activity was measured 18 h after treatment with or without 0.5 µM dexamethasone, and the results are expressed as a percentage of the dexamethasone response mediated by pPL32 (mean ± SEM, n >= 4). C, Constructs were made wherein the same accessory factor mutations that were described in panel B were introduced into the context of palGR1 (mAF1-palGR1, mAF2-palGR1, and mAF3-palGR1). The ability of these constructs to mediate a glucocorticoid response was compared with that of palGR1. H4IIE cells were cotransfected with 10 µg of the reporter constructs and 5 µg of the pSVGR expression vector. CAT activity was measured 18 h after treatment with or without 0.5 µM dexamethasone, and the results are expressed as a percentage of the dexamethasone response mediated by palGR1 (mean ± SEM, n >= 4). There was no significant difference in the basal activity conferred by the reporter constructs used (data not shown). The mAF1 constructs contain the sequence -451ACGAGATTGGCCG-439, the mAF2 constructs contain the sequence -416TGGTGTGGGGT-406, and the mAF3 constructs contain the sequence -337AGCCCTGTCCTTAACAC-321; the bold letters refer to the nucleotides that deviate from the wild-type sequence.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Although hormone response elements were originally defined as simple DNA sequences that bind receptor and mediate a hormone effect through a heterologous promoter, it has now become apparent that genes may have multiple copies of hormone response elements and that these may require either DNA-bound accessory factors or protein-protein interactions for maximal functional activity (6). The PEPCK gene is a case in point. The PEPCK GRU is composed of two weak GR-binding sites and four additional accessory factor elements (see Fig. 1Go). All six of these cis-acting elements, as well as the trans-acting factors that bind them, are required for a complete glucocorticoid response. Furthermore, specific trans-acting factors must bind these elements in the correct spatial orientation and alignment to maintain the proper function of the GRU, which implies that multiple protein-protein interactions are made within the context of a large nucleoprotein complex, the integrity of which is critical for proper regulation by glucocorticoids (Ref. 14 and T. Sugiyama and D. K. Granner, unpublished observations). The level of complexity exhibited by the PEPCK GRU is probably the rule rather than the exception. Indeed, when studied in detail, several GRUs, HRUs, and enhancer complexes have displayed similar requirements (3, 29, 30).

Despite the fact that a consensus sequence for GREs has been defined, a number of GR-binding sites, including GR1 and GR2, do not conform closely to this sequence (4). When first described, GR1 and GR2 were noted to be very different from the consensus GRE (Fig. 1Go and Ref.10). GR1 matches the consensus at seven of 12 positions and GR2 matches at six of 12. However, a number of studies have suggested that these differences may not affect the glucocorticoid response. For example, Nordeen and colleagues, using a library of mutants, mapped the functionally important bases of the MMTV GRE and found that 5 bp are critically important for GRE function, -3, -2, +2, +3, and +5 (Ref. 23 and see Fig. 1Go). GR1 contains all 5 of these base pairs and GR2 contains 4 of the 5. In other studies the nucleotide positions of consensus GREs that are required for GR binding have been identified. Chemical interference and missing base analyses show that GR makes contacts with a consensus GRE at positions -5, -3, -2, -1, +1, +2, +3 and +5 (24, 25). GR1, which has a much lower affinity for GR than a consensus GRE, but a higher affinity than GR2 (Fig. 3Go), contains 7 of these 8, while GR2 contains 6 of 8. Thus, according to these analyses, one might expect that GR1 and GR2 would bind GR with relatively high affinity and/or mediate at least a modest response to glucocorticoids in a heterologous promoter context. However, GR1 and GR2 have low affinity for GR and cannot mediate a glucocorticoid response without the aid of accessory factor activity (Figs. 3Go and 4Go).

It is not unusual to find multiple GREs within a promoter, particularly if these elements are located at some distance from the transcription start site. As is the case with GR1 and GR2, the multiple GREs in other genes are not always of equal functional importance (22, 26, 27, 28). The TAT gene has two functional GREs (tatGRE II and tatGRE III) located approximately 2.5 kb upstream from the transcription initiation site (28). These interact synergistically to provide a full response to glucocorticoids. The upstream tatGRE II is most important when both are present and has independent activity (tatGRE II is the tatGRE described in Fig. 1Go). tatGRE III acts synergistically with tatGRE II, but it has no independent activity and is therefore similar to the PEPCK GR1 and GR2 elements (28). The angiotensinogen promoter has two GREs that are critical components of a GRU. Mutation of the upstream GRE severely reduces glucocorticoid induction while mutation of the other only partially blunts the response, an observation that is again reminiscent of GR1 and GR2 (Ref. 26, and see Fig. 2Go). Thus, a similarity is apparent in the structural and functional organization of these genes, and all three contain a hierarchy of GR-binding sites.

Additionally, most, if not all, known glucocorticoid-responsive genes contain accessory factor elements, the occupancy of which is required for a complete glucocorticoid response (3, 6). The purpose may be to allow a finely tuned response to glucocorticoids rather than the all-or-none response seen by simple GREs in artificial promoters. Furthermore, accessory factors can be involved in other hormonal or metabolic responses (12, 13, 29). Thus, the transactivation of a gene in response to any given environmental stimulus is mediated by a response unit comprised of a number of elements that may be members of other response units. We have proposed that the functional and structural overlap between multiple hormone-response units provides an integrated response to different environmental signals and challenges. This global integrating unit is referred to as a metabolic control domain (13, 30). Thus, in the case of the PEPCK promoter, accessory factor activity could provide a graded response to glucocorticoids within the context of a specific metabolic environment. However, in a different metabolic environment, which results in the generation of other signals such as cAMP, insulin, or retinoic acid, the same glucocorticoid signal could result in a different degree of response: one that is appropriate for that metabolic circumstance.

The selective effects seen when either AF1, AF2, or AF3 are mutated within the context of palGR1 (Fig. 5Go) suggest that the accessory factors support the glucocorticoid induction of the PEPCK promoter by distinct mechanisms. Mutation of either AF1 or AF3, which are required for a complete glucocorticoid response in the wild-type PEPCK promoter, did not affect the induction by glucocorticoids in the context of palGR1 (Fig. 5CGo). These results suggest that AF1 and AF3 are important for the recruitment and/or stabilization of GR binding to the GR-binding sites and could thereby enhance the binding affinity of the GR to the PEPCK promoter complex. In this scenario, there would be no necessity for AF1 or AF3 when GR1 is replaced with a palindromic GRE, since GR binds to a consensus GRE with much higher affinity than GR1. On the other hand, mutation of AF2 in this context resulted in a 50% reduction of the glucocorticoid response (Fig. 5CGo). This result may indicate that the accessory factor activity mediated by AF2 occurs as a result of a direct or indirect protein-protein interaction between HNF-3 [the protein that mediates AF2 activity (14) ] and GR. It is interesting to note that the glucocorticoid response mediated by the high-affinity tatGRE II is also potentiated by HNF-3 in the context of the TAT gene GRU (31, 32). Thus, HNF-3 acts as an accessory factor for both high- and low-affinity GR-binding sites.

Yamamoto and colleagues (33, 34) have provided evidence that DNA acts as an allosteric modulator of GR. In this view, a number of different functional surfaces of GR can be exposed, and the surface displayed may be determined, in part, by the precise DNA sequence it binds, as well as the proteins that bind at or near the GRE. With this model in mind, the functions of AF1 and AF3 could be to allow GR to bind with greater affinity than it would in the absence of these elements. Additionally, the sequence of GR1 might confer a conformation of the GR molecule that prevents it from interacting with a specific factor(s) that is necessary for transactivation. AF2 could compensate for this by interacting directly with GR to either enhance its transactivation potential, or it could participate in transactivation itself, as part of an AF2/GR complex. This could explain why AF2 is required for glucocorticoid-mediated transactivation in both the wild-type PEPCK promoter, and in the palGR1 context.

How might AF1/AF3 stabilize the binding of GR to GR1 and GR2, and how might AF2 affect the function of GR? Steroid hormone receptor family members, including GR, transactivate through adaptor proteins called coactivators. A number of coactivators have been described that interact with GR and augment (at least in simple systems) glucocorticoid responsiveness (35, 36). These include steroid receptor coactivator 1 (SRC-1) and a member of the SRC-1 family, glucocorticoid receptor interacting protein 1 (GRIP1), as well as the closely related integrating factors, CREB binding protein (CBP) and p300 (37, 38, 39). In one possible scenario, a complex of accessory factors and associated coactivators, particularly AF1 and AF3 (also members of the steroid hormone receptor superfamily), could interact with GR and its coactivator to increase the occupancy of GR as a member of a nuclear hormone receptor-coactivator complex. CBP and p300 are called integrating coactivators because they bind an array of different transcription factors, coactivators, and components of the basal transcription machinery and can do so simultaneously at different sites (37, 40). Thus, while AF1 and AF3 may be required for increased GR occupancy, perhaps AF2 is required, along with the nuclear hormone receptor-coactivator complex described above, to bind to a scaffolding protein such as p300 or CBP to confer glucocorticoid-dependent transactivation. Experiments are in progress to test these ideas.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmids
The construction of the reporter plasmid pPL32 has been described previously (20, 41). Site-directed mutations of the pPL32 plasmid were constructed by PCR mutagenesis as described (42). The oligonucleotides used to generate site-directed mutations of pPL32 were:

mGR1, 5'-GCAGCCACTGGCACCAAAAATACGAAGCCA-GCAGCATATGAAGTC-3';

mGR2, 5'-TGTGCAGCCAGCAGCGTATGAATACTAAGA-GGCGTCCCGGCCAGC-3';

palGR1, 5'-ACCAGCAGCCACTGGAGAACAAAATGTTC-TGCCAGCAGCATATGA-3'; and

palGR2, 5'-AAATGTGCAGCCAGCAGAACATGATGTTC-TAGAGGCGTCCCGGCC-3'.

Mutations that disrupt the various accessory factor-binding sites (mAF1, mAF2, and mAF3) were previously designated SDMB, SDM2 (12), and AF3{gamma}m (13), respectively. The tk-CAT fusion constructs were made by digesting the parent plasmid ptkCAT (43) with BamHI and inserting a double-stranded oligonucleotide that represents either the tyrosine aminotransferase GRE (tatGRE) (28), GR1, GR2, or GR1·2 sequences. The sense strands of the oligonucleotides that represent the various GR-binding sites had the following sequences:

GR1, 5'-GATCCCACTGGCACACAAAATGTGCAGCCAG-CAG-3';

GR2, 5'-GATCCAGCCAGCAGCATATGAAGTCCAAGAG-GCG-3';

GR1·2,5'-GATCCCACTGGCACACAAAATGTGCAGCCAGCAGCATATGAAGTCCAAGAGGCG3';

tatGRE, 5'-GATCCAGAGGATCTGTACAGGATGTTCTA-GATCGG-3'.

The plasmids bearing the double-stranded versions of these oligonucleotides were named GR1tk, GR2tk, GR1·2tk, and tatGREtk, respectively. The sequence of all constructs was verified by DNA sequence analysis. All oligonucleotides were produced on a Perceptive Biosystems (Framingham, MA) Expedite 8909 DNA synthesizer. An expression vector that contains the full-length rat GR (pSVGR1) was provided by Dr. Keith R. Yamamoto (University of California San Francisco, San Francisco, CA).

Transient Transfection
The maintenance and transfection of H4IIE cells and the CAT assay method have been previously described (41, 44). All studies described herein involved cotransfection with the mammalian expression vector pSVGR1 unless otherwise indicated.

Gel Mobility Shift Assay
Ten nanograms of recombinant human GR from a baculovirus expression system (Affinity Bioreagents, Inc., Neshanic Station, NJ; purity, 3–5%) were added to a reaction mix (20 µl) that contained an end-labeled, double-stranded palGR1 oligonucleotide with a specific activity of 4 x 104 cpm/16 fmol, 10 mM Tris/HCl (pH 7.5), 50 mM NaCl, 10 mM EDTA, 2 µg of poly(dI-dC)·(dI-dC), 5% (vol/vol) glycerol, 1 mM dithiothreitol, 5 mM MgCl2, and various amounts of competitor oligonucleotides. After allowing the reaction to take place for 15 min at room temperature, the samples were loaded on a nondenaturing 4% polyacrylamide gel (38.0:0.78, acrylamide:bis-acrylamide). For the experiments that employed antibodies, the anti-GR antibody (Santa Cruz Biotechnology, Santa Cruz, CA) or a nonspecific antibody (anti-USF, Santa Cruz Biotechnology) was added to the binding reaction, and the mixture was incubated on ice for 1 h before electrophoresis. The electrophoresis buffer was composed of 36.4 mM boric acid, 32.5 mM Tris base, and 0.25 mM EDTA. The gels were run at room temperature at a constant 150 V and dried, and the relative amount of GR·DNA complex was quantitated using a Bio-Rad (Richmond, CA) GS-250 Molecular Imager in conjunction with the Bio-Rad Molecular Analyst software. The sequences of the sense strands of the GR1, GR2, GR1·2, and tatGRE oligonucleotides were as described above. The sequence of the palGRE oligonucleotide is the same as the palGR1 oligonucleotide described above. In addition, the sequences of the sense strand of the double-stranded palx2 and USF oligonucleotides were as follows:

palx2, 5'-AGTCCCACTGGAGAACAAAATGTTCTGCCAGCAGAACAAAATGTTCTAGAGGCG-3';

USF 5'-GATCTCCGGTCACGTGACCGGA-3' (45).


    ACKNOWLEDGMENTS
 
We thank Rob Hall and Keith Yamamoto for a critical analysis of the manuscript and Cathy Caldwell for her excellent technical assistance.


    FOOTNOTES
 
Address requests for reprints to: Daryl K. Granner, Department of Molecular Physiology and Biophysics, Vanderbilt University School of Medicine, Nashville, Tennessee 37232-0615.

This work was supported by NIH Grant DK-35107 and Grant DK-20593 (to the Vanderbilt Diabetes Research and Training Center).

1 These authors contributed equally to this paper Back

2 Current Address: Pharmacia & Upjohn, Box 724, 220 07 Lund, Sweden. Back

Received for publication June 30, 1997. Revision received December 29, 1997. Accepted for publication January 11, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Beato M, Herrlich P, Schütz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83:851–857[CrossRef][Medline]
  2. Truss M, Beato M 1993 Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr Rev 14:459–479[Abstract/Free Full Text]
  3. Lucas PC, Granner DK 1992 Hormone response domains in gene transcription. Annu Rev Biochem 61:1131–1173[CrossRef][Medline]
  4. Beato M 1989 Gene regulation by steroid hormones. Cell 56:335–344[CrossRef][Medline]
  5. Freedman LP 1992 Anatomy of the steroid receptor zinc finger region. Endocr Rev 13:129–145[Abstract/Free Full Text]
  6. Granner DK, Strömstedt P-E 1996 Glucocorticoid hormone action. In: Austen KF, Burakoff SJ, Rosen FS, Strom JB (eds) Theraputic Immunology. Blackwell Scientific Publishing, Inc., Cambridge, MA, pp 36–73
  7. Granner D, Pilkis S 1990 The genes of hepatic glucose metabolism. J Biol Chem 265:10173–10176[Free Full Text]
  8. Hanson RW, Patel YM 1994 Phosphoenolpyruvate carboxykinase (GTP): the gene and the enzyme. Adv Enzymol 69:203–281
  9. Sasaki K, Cripe TP, Koch SR, Andreone T, Peterson DD, Beale EG, Granner DK 1984 Multihormonal regulation of phosphoenolpyruvate carboxykinase gene transcription: dominant role of insulin. J Biol Chem 259:15242–15251[Abstract/Free Full Text]
  10. Imai E, Strömstedt P-E, Quinn PG, Carlstedt-Duke J, Gustafsson J-Å, Granner DK 1990 Characterization of a complex glucocorticoid response unit in the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 10:4712–4719[Abstract/Free Full Text]
  11. Hall RK, Sladek FM, Granner DK 1995 The orphan receptors COUP-TF and HNF-4 serve as accessory factors required for induction of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Proc Natl Acad Sci USA 92:412–416[Abstract/Free Full Text]
  12. Mitchell J, Noisin E, Hall R, O’Brien R, Imai E, Granner D 1994 Integration of multiple signals through a complex hormone response unit in the phosphoenolpyruvate carboxykinase gene promoter. Mol Endocrinol 8:585–594[Abstract/Free Full Text]
  13. Scott DK, Mitchell JA, Granner DK 1996 The orphan receptor COUP-TF binds to a third glucocorticoid accessory factor element within the posphoenolpyruvate carboxykinase gene promoter. J Biol Chem 271:31909–31914[Abstract/Free Full Text]
  14. Wang J-C, Strömstedt P-E, O’Brien RM, Granner DK 1996 Hepatic nuclear factor 3 is an accessory factor required for the stimulation of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Mol Endocrinol 10:794–800[Abstract/Free Full Text]
  15. Imai E, Miner JN, Mitchell JA, Yamamoto KR, Granner DK 1993 Glucocorticoid receptor-cAMP response element-binding protein interaction and the response of the phosphoenolpyruvate carboxykinase gene to glucocorticoids. J Biol Chem 268:5353–5356[Abstract/Free Full Text]
  16. Scott DK, Mitchell JA, Granner DK 1996 Identification and characterization of a second retinoic acid response element in the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 271:31909–31914
  17. Hall RK, Scott DK, Noisin EL, Granner DK 1992 Activation of the PEPCK retinoic acid response element is dependent on a retinoic acid receptor/coregulator complex. Mol Cell Biol 12:5527–5535[Abstract/Free Full Text]
  18. O’Brien RM, Lucas PC, Forest CD, Magnuson MA, Granner DK 1990 Identification of a sequence in the PEPCK gene that mediates a negative effect of insulin on transcription. Science 249:533–537[Abstract/Free Full Text]
  19. O’Brien RM, Bonovich MT, Forest CD, Granner DK 1991 Signal transduction convergence: phorbol esters and insulin inhibit phosphoenolpyruvate carboxykinase gene transcription through the same 10-base-pair sequence. Proc Natl Acad Sci USA 88:6580–6584[Abstract/Free Full Text]
  20. Quinn PG, Wong TW, Magnuson MM, Shabb JB, Granner DK 1988 Identification of basal and cyclic AMP regulatory elements in the promoter of the phosphoeneolpyruvate carboxykinase gene. Mol Cell Biol 8:3467–3475[Abstract/Free Full Text]
  21. Schmid W, Strähle U, Schütz G, Schmitt J, Stunnenberg H 1989 Glucocorticoid receptor binds cooperatively to adjacent recognition sites. EMBO J 8:2257–2263[Medline]
  22. Strähle U, Schmid W, Schütz G 1988 Synergistic action of the glucocorticoid receptor with transcription factors. EMBO J 7:3389–3395[Medline]
  23. Nordeen SK, Suh BJ, Kuhnel B, Hutchison III CA 1990 Structural determinants of a receptor recognition element. Mol Endocrinol 4:1866–1873[Abstract/Free Full Text]
  24. Cairns C, Gustafsson J-Å, Carlstedt-Duke J 1991 Identification of protein contact sites within the glucocorticoid/progestin response element. Mol Endocrinol 5:598–604[Abstract/Free Full Text]
  25. Truss M, Chalepakis G, Beato M 1990 Contacts between steroid hormone receptors and thymines in DNA: an interference method. Proc Natl Acad Sci USA 87:7180–7184[Abstract/Free Full Text]
  26. Brasier AR, Ron D, Tate JE, Habener JF 1990 Synergistic enhansons located within an acute phase responsive enhancer modulate glucocorticoid induction of angiotensinogen gene transcription. Mol Endocrinol 4:1921–1933[Abstract/Free Full Text]
  27. Grange T, Roux G, Pictet R 1989 Two remote glucocorticoid response units interact cooperatively to promote glucocorticoid induction of rat tyrosine aminotransferase gene expression. Nucleic Acids Res 21:8695–8709
  28. Jantzen H-M, Strähle U, Gloss B, Stewart F, Schmid W, Boshart M, Miksicek R, Schütz G 1987 Cooperativity of glucocorticoid response elements located far upstream of the tyrosine aminotransferase gene. Cell 49:29–38[CrossRef][Medline]
  29. Lucas PC, O’Brien RM, Mitchell JA, Davis CM, Imai E, Forman BM, Samuels HH, Granner DK 1991 A retinoic acid response element is part of a pleiotropic domain in the phosphoenolpyruvate carboxykinase gene. Proc Natl Acad Sci USA 88:2184–2188[Abstract/Free Full Text]
  30. Hall RK, Scott DK, O’Brien RM, Granner DK 1993 From metabolic pathways to metabolic control domains: multiple factors bind the PEPCK AF1/retinoic acid response element. In: Mornex R, Jaffiol C, Leclerc J (eds) Progress in Endocrinology. Proceedings of the Ninth International Congress on Endocrinology, Nice, France, 1992. Parthenon Publishing, London, pp 777–782
  31. Nitsch D, Schütz G 1993 The distal enhancer implicated in the developmental regulation of the tyrosine aminotransferase gene is bound by liver-specific and ubiquitous factors. Mol Cell Biol 13:4494–4504[Abstract/Free Full Text]
  32. Nitsch D, Boshart M, Schütz G 1993 Activation of the tyrosine aminotransferase gene is dependent on synergy between liver-specific and hormone-responsive elements. Proc Natl Acad Sci USA 90:5479–5483[Abstract/Free Full Text]
  33. Lefstin JA, Thomas JR, Yamamoto KR 1994 Influence of a steroid receptor DNA-binding domain on transcriptional regulatory functions. Genes Dev 8:2842–2856[Abstract/Free Full Text]
  34. Starr DB, Matsui W, Thomas JR, Yamamoto KR 1996 Intracellular receptors use a common mechanism to interpret signaling information at response elements. Genes Dev 10:1271–1283[Abstract/Free Full Text]
  35. Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:1167–1177[Abstract/Free Full Text]
  36. Beato M, Sanchez-Pacheco A 1996 Interaction of steroid hormone receptors with the transcription initiation complex. Endocr Rev 17:587–609[Abstract/Free Full Text]
  37. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin S, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414[CrossRef][Medline]
  38. Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc Natl Acad Sci USA 93:4948–4952[Abstract/Free Full Text]
  39. Oñate SA, Tsai SY, Tsai M-J, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  40. Janknecht R, Hunter T 1996 Transcriptional control: versatile molecular glue. Curr Biol 8:951–954
  41. Peterson DD, Magnuson MA, Granner DK 1988 Location and characterization of two widely separated glucocorticoid response elements in the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 8:96–104[Abstract/Free Full Text]
  42. Barik S 1993 Site-directed mutagenesis by double polymerase chain reaction. In: White BA (ed) PCR Protocols: Current Methods and Applications. Humana Press, Totowa, NJ, pp 277–286
  43. McKnight SL, Kingsbury R 1982 Transcriptional control signals of a eukaryotic protein-coding gene. Science 217:316–324[Abstract/Free Full Text]
  44. Nordeen SK, Green PPI II, Fowlkes DM 1987 A rapid, sensitive, and inexpensive assay for chloramphenicol acetyltransferase. DNA 6:173–178[Medline]
  45. Sirito M, Walker S, Qun L, Kozlowski MT, Klein WH, Sawadogo M 1992 Members of the USF family of helix-loop-helix proteins bind DNA as homo- as well as heterodimers. Gene Expres 2:231–240



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
E. B. Kabotyanski, M. Huetter, W. Xian, M. Rijnkels, and J. M. Rosen
Integration of Prolactin and Glucocorticoid Signaling at the {beta}-Casein Promoter and Enhancer by Ordered Recruitment of Specific Transcription Factors and Chromatin Modifiers
Mol. Endocrinol., October 1, 2006; 20(10): 2355 - 2368.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Cassuto, K. Kochan, K. Chakravarty, H. Cohen, B. Blum, Y. Olswang, P. Hakimi, C. Xu, D. Massillon, R. W. Hanson, et al.
Glucocorticoids Regulate Transcription of the Gene for Phosphoenolpyruvate Carboxykinase in the Liver via an Extended Glucocorticoid Regulatory Unit
J. Biol. Chem., October 7, 2005; 280(40): 33873 - 33884.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Baumann, A. Dostert, N. Novac, A. Bauer, W. Schmid, S. C. Fas, A. Krueger, T. Heinzel, S. Kirchhoff, G. Schutz, et al.
Glucocorticoids inhibit activation-induced cell death (AICD) via direct DNA-dependent repression of the CD95 ligand gene by a glucocorticoid receptor dimer
Blood, July 15, 2005; 106(2): 617 - 625.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M.-L. Asselin-Labat, A. Biola-Vidamment, S. Kerbrat, M. Lombes, J. Bertoglio, and M. Pallardy
FoxO3 Mediates Antagonistic Effects of Glucocorticoids and Interleukin-2 on Glucocorticoid-Induced Leucine Zipper Expression
Mol. Endocrinol., July 1, 2005; 19(7): 1752 - 1764.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. Shao, L. Qiao, R. C. Janssen, M. Pagliassotti, and J. E. Friedman
Chronic Hyperglycemia Enhances PEPCK Gene Expression and Hepatocellular Glucose Production Via Elevated Liver Activating Protein/Liver Inhibitory Protein Ratio
Diabetes, April 1, 2005; 54(4): 976 - 984.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-C. Wang, M. K. Derynck, D. F. Nonaka, D. B. Khodabakhsh, C. Haqq, and K. R. Yamamoto
From The Cover: Chromatin immunoprecipitation (ChIP) scanning identifies primary glucocorticoid receptor target genes
PNAS, November 2, 2004; 101(44): 15603 - 15608.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. L. Wang, B. Herzog, M. Waltner-Law, R. K. Hall, M. Shiota, and D. K. Granner
The Synergistic Effect of Dexamethasone and All-trans-retinoic Acid on Hepatic Phosphoenolpyruvate Carboxykinase Gene Expression Involves the Coactivator p300
J. Biol. Chem., August 13, 2004; 279(33): 34191 - 34200.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. J. McInnes, C. J. Kenyon, K. E. Chapman, D. E. W. Livingstone, L. J. Macdonald, B. R. Walker, and R. Andrew
5{alpha}-Reduced Glucocorticoids, Novel Endogenous Activators of the Glucocorticoid Receptor
J. Biol. Chem., May 28, 2004; 279(22): 22908 - 22912.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. Herzog, R. K. Hall, X. L. Wang, M. Waltner-Law, and D. K. Granner
Peroxisome Proliferator-Activated Receptor {gamma} Coactivator-1{alpha}, as a Transcription Amplifier, Is Not Essential for Basal and Hormone-Induced Phosphoenolpyruvate Carboxykinase Gene Expression
Mol. Endocrinol., April 1, 2004; 18(4): 807 - 819.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
K. De Bosscher, W. Vanden Berghe, and G. Haegeman
The Interplay between the Glucocorticoid Receptor and Nuclear Factor-{kappa}B or Activator Protein-1: Molecular Mechanisms for Gene Repression
Endocr. Rev., August 1, 2003; 24(4): 488 - 522.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. J. Coghlan, P. B. Jacobson, B. Lane, M. Nakane, C. W. Lin, S. W. Elmore, P. R. Kym, J. R. Luly, G. W. Carter, R. Turner, et al.
A Novel Antiinflammatory Maintains Glucocorticoid Efficacy with Reduced Side Effects
Mol. Endocrinol., May 1, 2003; 17(5): 860 - 869.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kucera, M. Waltner-Law, D. K. Scott, R. Prasad, and D. K. Granner
A Point Mutation of the AF2 Transactivation Domain of the Glucocorticoid Receptor Disrupts Its Interaction with Steroid Receptor Coactivator 1
J. Biol. Chem., July 12, 2002; 277(29): 26098 - 26102.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. Ma, C. Mallidis, J. Artaza, W. Taylor, N. Gonzalez-Cadavid, and S. Bhasin
Characterization of 5'-regulatory region of human myostatin gene: regulation by dexamethasone in vitro
Am J Physiol Endocrinol Metab, December 1, 2001; 281(6): E1128 - E1136.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Shen, L. M. Scearce, J. E. Brestelli, N. J. Sund, and K. H. Kaestner
Foxa3 (Hepatocyte Nuclear Factor 3gamma ) Is Required for the Regulation of Hepatic GLUT2 Expression and the Maintenance of Glucose Homeostasis during a Prolonged Fast
J. Biol. Chem., November 9, 2001; 276(46): 42812 - 42817.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Stafford, J. C. Wilkinson, J. M. Beechem, and D. K. Granner
Accessory Factors Facilitate the Binding of Glucocorticoid Receptor to the Phosphoenolpyruvate Carboxykinase Gene Promoter
J. Biol. Chem., October 19, 2001; 276(43): 39885 - 39891.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-C. Wang, J. M. Stafford, D. K. Scott, C. Sutherland, and D. K. Granner
The Molecular Physiology of Hepatic Nuclear Factor 3 in the Regulation of Gluconeogenesis
J. Biol. Chem., May 5, 2000; 275(19): 14717 - 14721.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J.-C. Wang, P.-E. Strömstedt, T. Sugiyama, and D. K. Granner
The Phosphoenolpyruvate Carboxykinase Gene Glucocorticoid Response Unit: Identification of the Functional Domains of Accessory Factors HNF3{beta} (Hepatic Nuclear Factor-3{beta}) and HNF4 and the Necessity of Proper Alignment of Their Cognate Binding Sites
Mol. Endocrinol., April 1, 1999; 13(4): 604 - 618.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
P. Leahy, D. R. Crawford, G. Grossman, R. M. Gronostajski, and R. W. Hanson
CREB Binding Protein Coordinates the Function of Multiple Transcription Factors Including Nuclear Factor I to Regulate Phosphoenolpyruvate Carboxykinase (GTP) Gene Transcription
J. Biol. Chem., March 26, 1999; 274(13): 8813 - 8822.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. A. Park, S. Song, C. Vinson, and W. J. Roesler
Role of CCAAT Enhancer-binding Protein beta  in the Thyroid Hormone and cAMP Induction of Phosphoenolpyruvate Carboxykinase Gene Transcription
J. Biol. Chem., January 1, 1999; 274(1): 211 - 217.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Croniger, P. Leahy, L. Reshef, and R. W. Hanson
C/EBP and the Control of Phosphoenolpyruvate Carboxykinase Gene Transcription in the Liver
J. Biol. Chem., November 27, 1998; 273(48): 31629 - 31632.
[Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Sugiyama, D. K. Scott, J.-C. Wang, and D. K. Granner
Structural Requirements of the Glucocorticoid and Retinoic Acid Response Units in the Phosphoenolpyruvate Carboxykinase Gene Promoter
Mol. Endocrinol., October 1, 1998; 12(10): 1487 - 1498.
[Abstract] [Full Text]


Home page
Cold Spring Harb Symp Quant BiolHome page
K.R. YAMAMOTO, B.D. DARIMONT, R.L. WAGNER, and J.A. INIGUEZ-LLUHI
Building Transcriptional Regulatory Complexes: Signals and Surfaces
Cold Spring Harb Symp Quant Biol, January 1, 1998; 63(0): 587 - 598.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Stafford, M. Waltner-Law, and D. K. Granner
Role of Accessory Factors and Steroid Receptor Coactivator 1 in the Regulation of Phosphoenolpyruvate Carboxykinase Gene Transcription by Glucocorticoids
J. Biol. Chem., February 2, 2001; 276(6): 3811 - 3819.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Yeagley, S. Guo, T. Unterman, and P. G. Quinn
Gene- and Activation-specific Mechanisms for Insulin Inhibition of Basal and Glucocorticoid-induced Insulin-like Growth Factor Binding Protein-1 and Phosphoenolpyruvate Carboxykinase Transcription. ROLES OF FORKHEAD AND INSULIN RESPONSE SEQUENCES
J. Biol. Chem., August 31, 2001; 276(36): 33705 - 33710.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. S. Lechner, C. M. Croniger, P. Hakimi, C. Millward, C. Fekter, J. S. Yun, and R. W. Hanson
The Use of Transgenic Mice to Analyze the Role of Accessory Factor Two in the Regulation of Phosphoenolpyruvate Carboxykinase (GTP) Gene Transcription during Diabetes
J. Biol. Chem., June 15, 2001; 276(25): 22675 - 22679.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scott, D. K.
Right arrow Articles by Granner, D. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scott, D. K.
Right arrow Articles by Granner, D. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals