help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peleg, S.
Right arrow Articles by Posner, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peleg, S.
Right arrow Articles by Posner, G. H.
Molecular Endocrinology 12 (4): 525-535
Copyright © 1998 by The Endocrine Society

Differential Use of Transcription Activation Function 2 Domain of the Vitamin D Receptor by 1,25-Dihydroxyvitamin D3 and Its A Ring-Modified Analogs

Sara Peleg, Cuong Nguyen, Benjamin T. Woodard, Jae-Kyoo Lee and Gary H. Posner

Department of Medical Specialties (S.P., C.N.), The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030; and Department of Chemistry (B.T.W., J.-K.L., G.H.P.), Johns Hopkins University, Baltimore, Maryland 21218


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Analogs of 1,25-dihydroxyvitamin D3 (1,25D3) can be used to elucidate details of vitamin D receptor (VDR) activation. The A ring-modified analog, (TN-2) has 15-fold less affinity for VDR, but its transcriptional activity is diminished 1000-fold. Likewise, the ability of TN-2 to induce a protease- resistant conformation in VDR is 1/1000 that of 1,25D3. The stability of the VDR-TN-2 complexes is also significantly lower than VDR-1,25D3 complexes. Mapping the VDR-binding site of TN-2 showed that it had a significantly greater requirement for transcription activation function 2 (AF-2) residues than 1,25D3 did. These results suggest that the increased requirement for AF-2 residues that was induced by the A ring modifications is associated with diminished receptor activation. To determine whether restoring the potency of TN-2 by additional structural modifications would change the requirements for AF-2 residues, we synthesized hybrid analogs with 1ß-hydroxymethyl-3-epi groups and with dimethyl groups at positions 26 and 27 of the side chain, without or with a double bond between CD ring positions 16 and 17. We found that the side chain modification enhanced transcriptional activity 150-fold, increased the ability of the receptor to form a protease-resistant conformation 100-fold, and stabilized the VDR-analog complexes. The addition of the 16-ene group further reduced the analog’s dissociation rate and increased its potency in the protease assays. These functional changes in the hybrid analogs were associated with a significant reduction in interaction with AF-2 residues. We conclude that there is an inverse relationship between analogs’ potencies and their interaction with AF-2 residues of VDR.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The A ring of 1{alpha},25-dihydroxyvitamin D3 (1,25D3) appears to be critical for its calcium-regulating activity, and modifications in this structure tend to diminish the toxic hypercalcemia of vitamin D metabolites and analogs (1, 2, 3, 4). However, because these same modifications also reduce affinity for the nuclear vitamin D receptor (VDR), they diminish transcriptional responses that are essential for the compounds’ therapeutic effects (2). Our approach to this problem is to combine structural modifications that induce powerful VDR-mediated transcription with A ring modifications that reduce calcemic activity (5, 6, 7). Our goal is 2-fold: 1) to use these analogs as molecular probes to elucidate details of VDR activation and mechanisms of segregated biological responses; 2) to identify structural combinations of vitamin D analogs that maintain low calcemic activities but are highly effective in treatment of 1,25D3-responsive clinical conditions including psoriasis, autoimmune disease, and cancer (8, 9, 10).

Studies from our laboratories have focused on analogs with A ring modifications containing 1ß- hydroxymethyl-3-epi groups (Refs. 5–7, 11, and 12 and Fig. 1Go). We found that this type of A ring [as in analog TN-2(1ß-hydroxymethyl-3-epi-25-hydroxyvitamin D3)] reduces the affinity for VDR 12- to 15-fold, but diminishes growth-inhibitory and VDR-mediated transcriptional activities 1000-fold (7). We hypothesized that the disproportionate loss of transcriptional activity of this analog might be due to a very rapid clearance rate, an inability to form a stable complex with VDR, or an inability to form a transcriptionally active complex. To improve the potency of TN-2, we first had to determine the reasons for its poor potency and then introduce specific modifications that repair these defects.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. Structural Formulas and Short Names for 1,25D3 and Its Analogs

 
Studies of nuclear receptors, including the VDR, have defined a conserved domain at the C-terminal region that regulates transcription (13, 14, 15, 16). This region is defined as transcription activation function-2 domain (AF-2), and in the VDR it regulates ligand-dependent conformational changes, ligand affinity for VDR, and the stability of ligand-receptor complexes (16). For these reasons our investigations of the mechanism of action of the A-ring analog focused on its interaction with this domain.

In the study reported here we demonstrate that the poor activity of the A ring-modified analog is associated with instability of the VDR-analog complexes and inability of the analog to induce a protease-resistant conformation in VDR. The poor performance of the analog was linked to binding requirements that strongly involved AF-2 residues. Modifications that increased the potency of the A ring analog simultaneously stabilized the VDR-analog complexes, increased the ability of VDR to fold into a protease-resistant conformation, and reduced the involvement of AF-2 residues in analog binding.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Comparing VDR-Binding Properties of 1,25D3 and Analog TN-2
Previous analysis of biological and biochemical properties of the A ring-modified analog TN-2 showed that its growth-inhibitory and transcriptional activities were 1/1000 that of 1,25D3 (Ref. 7, and Fig. 2AGo). Surprisingly, binding analysis of this analog by competition assays showed only a 10- to 15-fold lower affinity for the human VDR (Ref. 7 and Fig. 2BGo). To determine whether the poor transcriptional activity was associated with parameters of binding other than affinity for 1,25D3-binding site of VDR, we examined the stability of VDR-TN-2 complexes by exchange assays. For these experiments ligand-binding sites were saturated by incubating VDR-transfected COS-1 cells with 2 x 10-8 M 1,25D3 or with 2 x 10-7 M TN-2 for 1 h, the excess ligand was then removed, and the cells were homogenized. The homogenates were incubated at 30 C with [3H]1,25D3, and the exchange of unlabeled and radioactive ligands was measured at various times. The results (Fig. 2CGo) revealed 20% exchange of receptor-bound unlabeled 1,25D3 with [3H]1,25D3 in vitro within the first 15 min of incubation. However, 80% of the receptor-binding sites did not bind the radioactive ligand even after 1 h of incubation. On the other hand, rapid exchange of TN-2 and [3H]1,25D3 occurred with 95% of occupied VDR-binding sites within the first 15 min of incubation. In conclusion, these experiments showed that VDR-TN-2 complexes were significantly less stable than VDR-1,25D3 complexes. In recent studies we have shown that the ratios of the rapidly dissociating and slowly dissociating receptor-ligand complexes varies with ligand structure (16). We speculate that this represents heterogeneity in VDR-ligand complexes, in which there are receptor conformations that permit rapid dissociation of the ligand as well as receptor conformations that lock the ligand in the binding pocket. The mode of ligand interaction determines whether the predominant conformation is that of a rapidly dissociating or a slowly dissociating ligand-receptor complex.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 2. Interaction of 1,25D3 and the A Ring-Modified Analog TN-2 with VDR

A, Transcriptional activity was tested in VDR-negative CV-1 cells cotransfected with the ocVDRE/GH reporter and the VDR expression vector. 1,25D3 or TN-2 was added to the culture medium, and reporter gene expression was examined 48 h later. Titration of 1,25D3 was included in each transfection experiment, and results were expressed as percent of maximal reporter gene expression in 1,25D3-treated cells. The values shown represent the mean from duplicate transfections. B, Relative affinities of TN-2 and 1,25D3 for hVDR were examined by competition assays performed with homogenates from COS-1 cells transfected with the hVDR expression vector. Shown are representative plots of three or four competition experiments. The linear regression coefficients of these plots were 0.95–0.99. C, Exchange assays were performed with homogenates from VDR-transfected COS-1 cells after incubation of 1 h without or with 2 x 10-8 M 1,25D3 or 2 x 10-7 M TN-2 in a serum-free medium. D, Quantitative protease sensitivity assay: in vitro-translated wild-type VDR labeled with [35S]methionine was incubated with or without the indicated concentrations of 1,25D3 or TN-2 and digested with 20 µg/ml trypsin. The 34- and 28-kDa ligand-dependent proteolytic products are indicated by arrows.

 
To determine whether the A ring modification also had a significant effect on the ability of the ligand to induce conformational changes in VDR, we performed quantitative protease-sensitivity assays (16, 20). In these assays, [35S]VDR was incubated with increasing concentrations of 1,25D3 or the analog and then subjected to trypsin digestion. The conformational changes induced by both ligands were very similar: both stabilized 34-kDa and 28-kDa trypsin-resistant fragments. However, the ED50 for the maximal protection of these fragments was 0.5 nM for 1,25D3 and 150 nM for TN-2. In conclusion, the poor transcriptional activity of TN-2 was directly correlated with its rapid dissociation rate from VDR and with its inability to form a protease-resistant conformation but not with its affinity for VDR.

Interaction of TN-2 with Transcriptional Activation Function-2 (AF-2) Domain of VDR
Our earlier studies suggested that the mode of interaction of side chain-modified analogs with AF-2 residues had a significant effect on the stability of their complexes with VDR and on their transcriptional potency (16). To determine whether the A-ring modification in TN-2 increased or decreased the requirement for AF-2 residues, we used several VDR constructs with point mutations at the C-terminal region, in residues 419, 420, 421, 422, and 425 (Fig. 3AGo). These constructs, with the exception of L419S, were previously used by us to compare the binding requirements of 1,25D3 and its 20-epi analog (16). To determine the effect of these mutations on transcriptional potency and efficacy, we cotransfected each receptor mutant with the osteocalcin vitamin D-responsive element (ocVDRE)- reporter fusion gene into VDR-negative CV-1 cells (Fig. 3BGo) and treated the cells with various concentrations of 1,25D3. We found that each of these mutations, with the exception of E425Q, reduced 1,25D3-dependent transcriptional potency and efficacy, and the most dramatic effect was of a double mutation at residues 421 and 422 (V421M-F422A). We then examined the effect of the AF-2 mutations on binding of 1,25D3 and TN-2 by competition assays. Figure 4Go shows that substitution of residue 419 (L419S) reduced the affinity of 1,25D3 for the receptor 4- to 5-fold, but reduced affinity of TN-2 30-fold. A double mutation V421M-F422A reduced the affinity of 1,25D3 for the receptor 2.5- to 3-fold, but reduced affinity of TN-2 37-fold. Finally, substitution of residue 420 (E420A) had no significant effect on the affinity of 1,25D3 for VDR, but reduced the affinity of TN-2 2.5-fold. These results suggest that the reduced stability of VDR-TN-2 complexes and diminished ability of TN-2 to induce a protease-resistant conformation in VDR were associated with increased dependence of TN-2 on AF-2 residues for binding to VDR.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. Mapping the AF-2 Domain by Amino Acid Substitutions at the C-Terminal Region of VDR

Site-directed mutagenesis of the amino acid residues indicated (A) was performed as described previously (16), and individual mutants were examined for transcriptional activity (B) in VDR-negative CV-1 cells cotransfected with the ocVDRE/GH reporter and the wild-type or mutant VDR expression vectors. The indicated amounts of 1,25D3 were added to the culture medium, and reporter gene expression was examined 48 h later. The values shown are the mean from duplicate transfections.

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Differential Interaction of 1,25D3 and Analog TN-2 with AF-2 Residues of VDR

The binding activity of receptor mutants was assessed by competition assays performed three to four times with each mutant. Each competition assay of mutant VDR was performed simultaneously with a competition assay of wild-type VDR. The linear regression coefficients of the plots shown were 0.96–0.99. The ED50 for competition binding to wild-type VDR, L419S, E420A, and V421M-F422A by 1,25D3 (nM ± SE) were 0.7 ± 0.054, 3.22 ± 0.42, 0.62 ± 0.02, and 1.75 ± 0.03, respectively. The ED50 for competition binding to wild-type VDR, L419S, E420A, and V421M-F422A by TN-2 (nM ± SE) were 8.75 ± 0.09, 267 ± 22, 22.75 ± 2.1, and 327 ± 32, respectively.

 
Restoration of VDR-TN-2 Complex Stability and Transcriptional Activity
The results described above suggest that one approach to restore potency of TN-2 is to make structural modifications that stabilize ligand-receptor complexes or enhance the ligand’s ability to induce protease-resistant conformation. These results also suggest that modifications that improve these aspects of ligand potency may also reduce the involvement of AF-2 residues in the binding process. To test these hypotheses we examined the binding properties of a hybrid analog containing an A ring with 1ß-hydroxymethyl-3-epi groups, a side chain with dimethyl groups at positions 26 and 27, and a double bond between carbons 16 and 17 [JK-1626–2 (1ß-hydroxymethyl-3-epi-16-ene-26,27-dimethyl-25-hydroxyvitamin D3), see formula in Fig. 1Go]). This hybrid analog was chosen because it was recently shown to be as potent as 1,25D3 in the inhibition of murine keratinocyte growth (17). To distinguish the contributions of the 16-ene group and the side-chain modification to the potency of this analog, we examined another hybrid analog, BTW-26–2 (1ß-hydroxymethyl-3-epi-26,27- dimethyl-25-hydroxyvitamin D3) (Fig. 1Go), which contains only the A-ring modifications and the dimethyl groups at positions 26 and 27. The two-hybrid analogs and TN-2 were tested simultaneously for VDR-mediated transcription of the ocVDRE-reporter fusion gene (Fig. 5AGo), affinity for VDR by competition assays (Fig. 5BGo), stability of their complexes with VDR (Fig. 5CGo), and their ability to form protease-resistant conformation (Fig. 5DGo). These experiments showed that the side chain modification alone was sufficient to increase the transcriptional activity of BTW-26–2 150-fold; it also increased this analog’s ability to induce protease- resistant conformation more than 100-fold and stabilized VDR-BTW-26–2 complexes. All these changes occurred with no apparent increase in BTW-26–2’s affinity for VDR, as indicated by the competition assays (Fig. 5BGo). The addition of 16-ene group (JK-1626–2, Fig. 1Go) made a small but significant improvement in transcriptional activity, in the stability of ligand-receptor complexes, and in the ability to form a protease-resistant conformation. The 16-ene group also caused a small but significant increase (2-fold) in the affinity of JK-1626–2 for VDR. In conclusion, the side chain modification significantly changed two aspects in binding properties of the A ring-modified analogs: stability of the VDR-analog complexes and ability of the complexes to form a protease-resistant conformation. These changes were not accompanied by an increase in the ability of the analog to compete for the 1,25D3-binding site in VDR, suggesting that the changes in binding properties were not associated with the hybrid analog’s shift into 1,25D3 contact sites in VDR.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 5. Restoration of Potency of the A Ring-Modified Analog by Side Chain and C-D Ring Modifications

A, Transcriptional activity was tested in VDR-negative CV-1 cells cotransfected with the ocVDRE/GH reporter and the VDR expression vector. The indicated amounts of analogs TN-2, BTW-26–2, or JK-1626–2 were added to the culture medium, and reporter gene expression was examined 48 h later. Titration of 1,25D3 was included in each transfection experiment, and results were expressed as percent of maximal reporter gene expression in 1,25D3-treated cells. Values shown represent the mean from duplicate transfections. B, Relative affinities of the three analogs for VDR were examined by competition assays performed as in Fig. 2Go, with homogenates prepared from COS-1 cells transfected with the VDR expression vector. C, Exchange assays were performed as in Fig. 2Go, using homogenates from VDR-transfected COS-1 cells incubated without or with 2 x 10-7 M analog in a serum-free medium for 1 h. D, The quantitative protease sensitivity assays were performed with in vitro-translated VDR labeled with [35S]methionine as in Fig. 2Go.

 
Effect of the 16-ene Group and the Side Chain Modification on Binding of the Hybrid Analogs to AF-2 Residues
To test whether the stabilization of ligand-receptor complexes, the increase in ability to form a protease-resistant conformation, and the increase in transcriptional potencies were associated with changes in binding of BTW-26–2 and JK-1626–2 to AF-2 residues, we repeated the competition assays described above with wild-type VDR and the three AF-2 mutants. Figure 6BGo shows that the residue 420 substitution (E420A) reduced the affinity of the BTW-26–2 for VDR to the same extent that it decreased the affinity of TN-2 (Fig. 6AGo). On the other hand, the affinity of JK-1626–2 for this mutant was completely restored (Fig. 6CGo). The AF-2 mutation L419S reduced binding of analog BTW-26–2 to the AF-2 mutant but to a lesser extent than it reduced TN-2 binding (10-fold instead of 30-fold). Binding of JK-1626–2 to this mutant was also reduced relative to its binding to wild-type VDR. However, again, this reduction was only 9-fold as compared with the 30-fold reduction in TN-2 binding.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 6. Effect of AF-2 Mutations on Binding of TN-2 and the Hybrid Analogs to VDR

The binding activity of receptor mutants was assessed by competition assays performed with homogenates of VDR-transfected COS-1 cells. Each competition assay of mutant VDR was performed simultaneously with a competition assay of wild-type VDR three to four times. The linear regression coefficients of the plots shown were 0.96–0.99. WT, Wild-type VDR; 420, E420A substitution; 419, L419S substitution; 421–422, V421M-F422A substitution. Shown are representative plots. The differences in the slope of these plots are shown in Fig. 7Go.

 
The double mutations at residues 421 and 422 reduced the affinity of BTW-26–2 for VDR 22-fold and reduced the affinity of JK-1626–2 16-fold, as compared with the 37-fold reduction in the affinity of TN-2. In conclusion, BTW-26–2 bound significantly better than TN-2 to the AF-2 mutant L419S, whereas JK-1626–2 bound better than TN-2 to all three AF-2 mutants tested.

To compare changes in the analog’s requirement for AF-2 residues with the binding requirements of 1,25D3 to the same residues, we summarized the binding data for all four ligands in Fig. 7Go. In this figure we compared the binding of each ligand to the wild-type VDR and to mutant VDR by calculating a relative competition index (RCI = the slope of the competition plot with mutant VDR divided by the slope of the competition plot with wild-type VDR, and multiplied by 100). By this calculation the RCI for wild-type VDR is 100. The bar graphs in Fig. 7Go indicate that the two hybrid analogs bound better than TN-2 to the mutant VDR L419S, but their RCI for this mutant was not as great as that of 1,25D3. On the other hand, the RCI of JK-1626–2 for mutant E420A was the same as that of 1,25D3. Finally, all three A ring-modified analogs still bound poorly to the double mutant V421M-F422A.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 7. Comparing Competition Indices of 1,25D3, TN-2, and the Two Hybrid Analogs

To assess the change induced by the mutation in the ability of each ligand to bind to VDR, the slope of each competition assay performed with mutant VDR was divided by the slope of the competition plot with wild-type VDR and multiplied by 100. Each bar represents an average of competition indices from three to four competition assays. *, P < 0.05 for the difference between the competition indices of the hybrid analog and TN-2.

 
To determine whether the changes in binding requirements of the A ring-modified analogs also affected their ability to induce a protease-resistant conformation through the AF-2 mutants, we performed protease-sensitivity assays (Fig. 8Go). The results of these assays showed that there was no apparent change in the ability of 1,25D3 or the three analogs to induce a conformational change through the E420A mutant. The mutation in residue 419 completely abolished the ability of TN-2 to fold VDR in a protease-resistant conformation even at a concentration of 10-6 M. The addition of the side chain modification as in BTW-26–2 partially restored this ability, and the combination of 16-ene group and dimethyl groups in the side chain (as in JK-1626–2) further improved this ability. Likewise, the double mutation in residues 421 and 422 completely abolished the ability of TN-2 to induce protease-resistant conformation. In this case, the addition of the side chain modification alone (as in analog BTW-26–2) had little effect, but the double modification in JK-1626–2 significantly improved that analog’s ability to induce protease-resistant conformation. In conclusion, both 1,25D3 and the two hybrid analogs bound to the AF-2 mutants more effectively than the singly modified A-ring analog TN-2. The apparent reduced dependency on AF-2 residues may increase the ability of the hybrid analogs to fold the AF-2-mutated VDRs into a protease-resistant conformation.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 8. Conformational Changes Induced in the Wild-Type (WT) and Mutant VDRs by the A Ring-Modified Analogs

In vitro-translated wild-type or mutated VDR labeled with [35S]methionine was incubated with or without 10-6 M ligand before digestion with 20 µg/ml trypsin. The 34-, 32-, and 28-kDa ligand-dependent proteolytic products are indicated by arrows. Lane 1, No ligand; lane 2, 1,25D3; lane 3, TN-2; lane 4, BTW-26–2; lane 5, JK-1626–2. WT, WT VDR treated with 10-7 M 1,25D3 and digested with trypsin was added as size reference for the protease-resistant fragments induced by binding of ligand to the mutants L419S and V421M-F422A.

 
Finally, we examined whether the differential use of AF-2 residues for binding and for the induction of protease-resistant conformation affected transcriptional activation of the AF-2 mutants by the analogs. For that, we cotransfected CV-1 cells with the ocVDRE- reporter and either wild-type (WT)-VDR or with each of the AF-2 mutants and treated the transfected cells with the natural hormone or with the analogs (Fig. 9Go). These experiments showed that transcriptional activity of analog TN-2 was diminished to nondetectable levels by the double mutations at residues 421 and 422 (not shown) and that transcriptional activity of this analog through the L419S and E420A mutants was barely detectable even at a concentration of 10-6 M. On the other hand, the hybrid analogs BTW-26–2 and JK-1626–2 had significant transcriptional activity through mutants L419S and E420A (Fig. 9Go, B and C) and a small but detectable transcriptional activity through the double mutant V421M/F422A (not shown). These results suggest that the improved ability of the hybrid analogs to induce a protease-resistant conformation through mutants L419S and V421M/F422A is directly correlated with their ability to induce transcription through these mutants. However, the ability of BTW-26–2 and JK-1626–2 to transactivate VDR through the L419S mutant is significantly lower than that of 1,25D3, as would be predicted by their greater dependence on this residue for binding to VDR.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 9. Effect of the AF-2 Mutations on Transcriptional Activity of the A Ring-Modified Analogs

To assess the effect of AF-2 mutations on transcriptional activity of each analog, individual mutants were examined in VDR-negative CV-1 cells cotransfected with the ocVDRE/GH reporter and the wild-type (WT) or mutant VDR expression vectors. The indicated amounts of 1,25D3 or the analogs were added to the culture medium, and reporter gene expression was examined 48 h later. Transcriptional activity was expressed as percentage of maximal reporter gene expression by cells transfected with WT VDR and treated with 10-7 M 1,25D3 (a control that was included in each transfection experiment). The values shown are the mean from duplicate transfections.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In the present study we further extended our recent observations on the role of the AF-2 domain in binding of 1,25D3 and its analogs to the VDR (16). In the earlier publication we demonstrated that analogs that have side chains with the natural stereochemistry and orientation (northeast) were dependent, to some extent, on AF-2 residues for their binding to VDR. On the other hand, binding of the highly potent 20-epi analogs to VDR was completely independent of these residues. We, therefore, hypothesized that the use of AF-2 residues for binding had a negative effect on the potency of the ligand. We further examined these results in light of the mousetrap model proposed by Renaud et al. (23), for the apo and holo ligand-binding domains of the retinoid receptors (22, 23). According to that model, the lid of the putative mousetrap (the AF-2 domain) is open before ligand binding, and upon entry of the ligand into the pocket a conformational change occurs that locks the mouse trap by both the AF-2 domain and an {omega}-loop located between helices 2 and 3. We hypothesized that the 20-epi analogs interacted not with the AF-2 residues but with other residues located deeper inside the pocket. This type of binding promoted efficient sealing of the pocket and stabilized the VDR-analog complexes. On the other hand, the natural hormone and analogs with natural side chain orientation did interact with AF-2 residues, thereby preventing an effective sealing of the pocket and giving the VDR-ligand complexes a shorter half-life. The results of the study reported here support that model and the proposed role of AF-2 in stabilization of ligand- receptor complexes. The A-ring modifications that were introduced to TN-2 diminished several AF-2-dependent properties: ability to induce conformational changes, stability of the VDR-ligand complexes, and transcriptional potency. These changes occurred with only a moderate decrease in affinity for VDR but a significant increase in dependency on AF-2 residues for binding to VDR.

We also confirmed the other part of the hypothesis: the addition of side- chain modifications to the A ring analog (as in BTW-26–2 and JK-1626–2) simultaneously reduced the requirements for AF-2 residues in the binding process and increased the AF-2-dependent functions, stabilization of ligand-VDR complexes, ability to form a protease-resistant conformation, and transcriptional potency.

How do the A-ring modifications in TN-2 reduce AF-2-mediated functions and why do the dimethyl groups in the side chain of the hybrid analog restore these functions? Structure-function studies showed that A-ring modifications always diminish the affinity of 1,25D3 analogs for VDR, especially if they are in C-1 (2). On the other hand, side chain modifications have little or no effect on affinity for VDR, but do change transcriptional potency and VDR-mediated growth-regulatory responses substantially (2, 20). It is tempting to speculate that the A ring contributes an essential (and probably not very flexible) anchoring point for 1,25D3 inside the ligand-binding pocket. On the other hand, the side chain may use more flexible contact points near or at the AF-2 domain. Therefore, chemical or stereochemical modifications in side chain may change the mode of interaction of the side chain with individual residues in the AF-2 domain. Introducing 1ß-hydoxymethyl-3-epi groups diminishes the contact of the A ring with its anchoring site in the pocket, so that binding of TN-2 is dependent more on the side chain and its interaction with the AF-2 domain. This increased dependency on AF-2 residues for binding has two possible consequences: it may hold the AF-2 domain at an angle that does not allow the induction of transcriptionally active (protease-resistant) conformation and at the same time it may also promote rapid dissociation of the analog from the binding pocket. The dimethyl groups at positions 26 and 27 in the side chain introduced subtle changes in the mode of interaction of the analog with the AF-2 residues: they significantly reduced the requirement for residue 419, had no effect on the requirement for residue 420, and only moderately reduced the requirement for residues 421 and 422. We hypothesize that these changes are sufficient to shift the AF-2 domain to a position that allows better sealing of the ligand-binding pocket and stabilization of the transcriptionally active conformation. However, it is important to note that the binding properties of the two hybrid analogs with respect to use of AF-2 residues are still significantly different from those of the parent hormone, 1,25D3. Because the AF-2 residues regulate interaction with transcription coactivators and corepressors (24, 25, 26, 27, 28, 29, 30), it is possible that the remaining differences in the use of AF-2 residues by the hybrid analogs and 1,25D3 may lead to subtle differences in the nature of their VDR-mediated transcriptional activities by selective recruitment of specific coactivators or corepressors. Preliminary experiments (17) indicated that the hybrid analogs JK-1626–2 and BTW-26–2 had a substantial antiproliferative activity in keratinocytes, but their calcemic activities were about 1/50 that of 1,25D3 (T. Kensler and P. Dolan, unpublished results). These findings suggest that the initial working hypothesis that the modifications in the A ring reduce calcemic activity is correct even for analogs that have side chains that induce high transcriptional and growth-inhibitory responses. Furthermore, these findings raise the possibility that the hybrid analogs have tissue- or cell- segregated activities. Future investigation of these compounds will focus on examination of their efficacy and potency in cell culture and animal models of diseases that respond to vitamin D treatment.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents
[35S]methionine and 1,25-(OH)2[26,27-3H]D3 were obtained from Amersham Corp. (Arlington Heights, IL). A coupled transcription/translation system was obtained from Promega Corp. (Madison WI). 1,25D3 was a generous gift from Dr. L. Binderup (Leo Pharmaceuticals, Ballerup, Denmark), and the analogs TN-2 (12), BTW-26–2, and JK-1626–2 (17) were synthesized in Dr. Posner’s laboratory. The structural formulas for and short names of these ligands are shown in Fig. 1Go.

Cell Culture and Transfections
Monkey kidney CV-1 cells were plated in 35-mm dishes at a density of 3 x 105/dish and cotransfected with 2 µg of the plasmid ocVDRE, which contains the VDRE from the human osteocalcin gene (GGTGACTCACCGGGTGAACGGGGGCATT) (18) attached to the thymidine kinase promoter/GH fusion gene and with the recombinant human VDR expression vector (2 µg/dish). Monkey kidney COS-1 cells were plated in 150-mm dishes at a density of 6 x 105/dish and transfected with 20 µg/dish recombinant human VDR plasmids.

All transfections were performed by the diethylaminoethyl-dextran method (19). Medium samples for measurements of GH were collected 2 days after transfection. GH production from the reporter gene was measured by a RIA as described by the manufacturer (Nichols Institute, San Juan Capistrano, CA).

Ligand-Binding Assays
To assess the relative affinities of 1,25D3 and the analogs for wild-type and mutated VDR in vitro, whole-cell homogenates from COS-1 cells transfected with VDR expression plasmids were prepared in KTED (10 mM Tris-HCl, pH 7.4; 1.5 mM EDTA; 0.3 M KCl; and 1 mM dithiothreitol) as described previously (20). The homogenates were then aliquoted into tubes containing 0.2 pmol of [3H]1,25D3 and increasing concentrations of nonradioactive ligand. The mixtures were incubated on ice for 3–4 h after which free ligand was separated from bound by hydroxyapatite (24). The bound ligand was released from the hydroxyapatite by ethanol extraction, and the radioactivity was measured by scintillation counting. The results of the competition assays were plotted as the inverse value of percent maximal binding against competitor concentration by the method of Wecksler and Norman (21).

To assess exchange of unlabeled 1,25D3 or its analogs with [3H]1,25D3, monolayers of VDR-transfected COS-1 cells were washed three times with PBS and incubated for 1 h without or with ligand in serum-free medium. Then the medium was discarded, and the cells were washed three times in cold PBS, scraped into 10 ml PBS, centrifuged, resuspended in KTED, and homogenized. Aliquots of the homogenates (0.2 ml) were incubated at 30 C with 0.2 pmol of [3H]1,25D3 for various times and then transferred to ice for an additional 3 h. The free radioactive ligand was separated from the bound by hydroxyapatite as described above. Exchange was assessed by comparing the amount of [3H]1,25D3 bound to unoccupied VDR and the amount of [3H]1,25D3 bound to the in vivo-occupied VDR at each time point.

Ligand-Induced Sensitivity to Proteases
Synthetic wild-type and mutated human VDRs labeled with [35S]methionine (1000 Ci/mmol) were prepared by in vitro coupled transcription/translation in reticulocyte lysates (Promega Corp.) with the human VDR cDNA inserted into the pGEM4 plasmid. The receptor preparations were incubated without or with the indicated concentrations of 1,25D3 or analogs for 10 min at room temperature. Then trypsin, 20 µg/ml (Sigma Chemical Co. St. Louis, MO), was added, and the mixtures were incubated for an additional 10 min. The digestion products were analyzed by 12% SDS-PAGE, and the gels were dried and autoradiographed.


    ACKNOWLEDGMENTS
 
We thank Dr. J. W. Pike for the human VDR expression plasmid, Dr. Y-Y Liu for the preparation of the mutant VDR constructs, and Dr. L. Binderup of Leo Pharmaceuticals for the generous gift of 1,25-dihydroxyvitamin D3. We also thank Dr. Maureen E. Goode for her useful comments in preparation of this manuscript, and Dr. T. Kensler and Mr. P. Dolan for the in vivo calcemic measurements.


    FOOTNOTES
 
Address requests for reprints to: Dr. Sara Peleg, Section of Endocrinology, Box 15, Department of Medical Specialties, 1515 Holcombe Boulevard, Houston, Texas 77030.

This work was supported by NIH Grant DK-50583 (to S.P.) and NIH Grant CA-44530 (to G.H.P.).

Received for publication October 10, 1997. Revision received December 9, 1997. Accepted for publication December 29, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Norman AW, Myrtle JF, Midgett RJ, Nowicki HG, William V, Popjak G 1971 1,25- Dihydroxycholecalciferol: identification of the proposed active form of vitamin D3 in the intestine. Science 173:51–54[Abstract/Free Full Text]
  2. Bouillon R, Okamura WH, Norman AW 1995 Structure-function relationship in the vitamin D endocrine system. Endocr Rev 16:200–257[Abstract/Free Full Text]
  3. Norman AW, Okamura WH, Farach-Carson MC, Allewaret K, Branisteanu D, Nemere I, Raman-Muralidharan K, Boullion R 1993 Structure-function studies of 1,25-dihydroxyvitamin D3 and the vitamin D endocrine system. 1,25-Dihydroxy-pentadeuterio- previtamin D3 (as a 6-s cis analog) stimulates nongenomic but not genomic biological responses. J Biol Chem 268:13811–13819[Abstract/Free Full Text]
  4. Norman AW, Bouillon R, Farach-Carson MC, Bishop JE, Zhou L-X, Nemere I, Zhao J, Muralidharan RK, Okamura WH 1993 Demonstration that 1ß,25-dihydroxyvitamin D3 is an antagonist of the nongenomic but not genomic biological responses and biological profile of the three A-ring diastereomers of 1{alpha},25-dihydroxyvitamin D3. J Biol Chem 268:20022–20030[Abstract/Free Full Text]
  5. Posner GH, White CM, Dolan P, Kensler TW, Yukihiro S, Guggino SE (1994): 1{alpha},25-Dihydroxyvitamin D3 hybrid analogs with structural changes in both the A-ring and the C,D-ring side chain. Bioorg Med Chem Lett 4: 2919–2924
  6. Posner GH, Lee JK, Li Z, Takeuchi K, Guggino SE, Dolan P, Kensler TW (1995): 1{alpha},25-Dihydroxyvitamin D3 hybrid analogs with structural changes in both the A-ring and the C,D-ring side chain. Bioorg Med Chem Lett 5: 2163–2168
  7. Peleg S, Liu Y-Y, Reddy S, Horst RL, White C, Posner GH 1996 A 20-epi side chain restores growth-regulatory and transcriptional activities of an A ring-modified hybrid analog of 1{alpha},25-dihydroxyvitamin D3 without increasing its affinity to the vitamin D receptor. J Cell Biochem 63:149–161[Medline]
  8. Kragballe K 1997 Psoriasis and other skin diseases. In: Feldman D, Glorieux FH, Pike JW (eds) Vitamin D. Academic Press, San Diego, CA, pp 1213–1226
  9. Lemire J 1997 The role of vitamin D3 in immunosuppression: lessons from autoimmunity and transplantation. In: Feldman D, Glorieux FH, Pike JW (eds) Vitamin D. Academic Press, San Diego, CA, pp 1167–1182
  10. Kolston K 1997 Vitamin D and breast cancer: therapeutic potential of new vitamin D analogs. In: Feldman D, Glorieux FH, Pike JW (eds) Vitamin D. Academic Press, San Diego, CA, pp 1125–1140
  11. Posner GH, Nelson TD, Guyton KZ, Kensler TW 1992 New vitamin D3 derivatives with unexpected antiproliferative activity: 1-(hydroxymethyl)-25-hydroxyvitamin D3 homologs. J Med Chem 35:3280–3287[CrossRef][Medline]
  12. Posner GH, Dai H, Afarinkia K, Murthy NN, Guyton KZ, Kensler TW 1993 Asymmetric total synthesis, X-ray crystallography and preliminary biological evaluation of 1-(1'-hydroxyethyl)-25-hydroxyvitamin D3 analogs of natural calcitriol. J Org Chem 58:7209–7215[CrossRef]
  13. Tora L, White J, Brou C, Tasset D, Webster N, Scheer E, Chambon P 1989 The human estrogen receptor has two independent nonacidic transcription activation functions. Cell 59:477–487[CrossRef][Medline]
  14. Danielian PS, White R, Lees JA, Parker MG 1992 Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J 11:1025–1033[Medline]
  15. Nakaajima S, Hsieh JC, MacDonald PN, Galligton MA, Haussler CA, Whitfield GK, Haussler MR 1994 The c-terminal region of the vitamin D receptor is essential to form a complex with a receptor auxiliary factor required for high affinity binding to the vitamin D-responsive element. Mol Endocrinol 8:159–172[Abstract/Free Full Text]
  16. Liu Y-Y, Collins ED, Norman AW, Peleg S 1997 Differential interaction of 1{alpha},25-dihydroxyvitamin D3 analogues and their 20-epi homologues with the vitamin D receptor. J Biol Chem 272:3336–3345[Abstract/Free Full Text]
  17. Posner GH, Lee JK, White C, Hutchings RH, Dai H, Kachinski JL, Dolan P, Kensler TW 1997 Antiproliferative hybrid analogs of the hormone 1{alpha},25-dihydroxyvitamin D3: design, synthesis and preliminary biological evaluation. J Med Chem, in press
  18. Ozono K, Liao J, Kerner SA, Scott RA, Pike JW 1990 The vitamin D-responsive element in the human osteocalcin gene. J Biol Chem 265:21881–21888[Abstract/Free Full Text]
  19. Peleg S, Abruzzese RV, Cote GJ, Gagel RF 1990 Transcription of the human calcitonin gene is mediated by a C cell-specific enhancer containing E-box-like elements. Mol Endocrinol 11:1750–1757
  20. Peleg S, Sastry M, Collins ED, Bishop JE, Norman AW 1995 Distinct conformational changes induced by 20-epi analogues of 1{alpha},25-dihydroxyvitamin D3 are associated with enhanced activation of the vitamin D receptor. J Biol Chem 270:10551–10558[Abstract/Free Full Text]
  21. Wecksler WR, Norman AW 1980 Measurement of kinetic rate constants for the binding of 1{alpha},25-dihydroxyvitamin D3 to its chick intestinal mucosa receptor using a hydroxyapatite batch assay. Methods Enzymol 67:488–497[Medline]
  22. Bourguet W, Ruff D, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the ligand binding domain of the human nuclear receptor RXR{alpha}. Nature 375:377–382[CrossRef][Medline]
  23. Renaud J-P, Natacha R, Ruff M, Vivat V, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the RAR-gamma ligand-binding domain bound to all-trans retinoic acid. Nature 378:681–689[CrossRef][Medline]
  24. Kurokawa R, Soderstrom M, Horlein A, Halachmi S, Brown M, Rosenfeld MG, Glass CK 1995 Polarity-specific activities of retinoid acid receptors determined by a co-repressor. Nature 377:451–454[CrossRef][Medline]
  25. Horlein A, Naar A, Heinzel T, Torchia J, Gloss B, Kurokawa R, Kamai Y, Ryan A, Soderstrom M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor is mediated by a nuclear receptor co-repressor, N-CoR. Nature 377:397–404[CrossRef][Medline]
  26. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]
  27. Onate SA Tsai SY, Tsai M-J, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  28. Halachmi S, Marden E, Martin G, Mackay H, Abbondanza C, Brown M 1994 Estrogen receptor-associated proteins: possible mediators of hormone induced transcription. Science 264:1455–1458[Abstract/Free Full Text]
  29. Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:1167–1177[Abstract/Free Full Text]
  30. Masuyama H, Brownfield CM, Starnaud R, Macdonald PN 1997 Evidence for ligand dependent intramolecular folding of the AF-2 domain in vitamin D receptor-activated transcription and coactivator interaction. Mol Endocrinol 11:1507–1517[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
L. A. Zella, M. B. Meyer, R. D. Nerenz, and J. W. Pike
The Enhanced Hypercalcemic Response to 20-Epi-1,25-Dihydroxyvitamin D3 Results from a Selective and Prolonged Induction of Intestinal Calcium-Regulating Genes
Endocrinology, August 1, 2009; 150(8): 3448 - 3456.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Ismail, C. V. Nguyen, A. Ahene, J. C. Fleet, M. R. Uskokovic, and S. Peleg
Effect of Cellular Environment on the Selective Activation of the Vitamin D Receptor by 1{alpha},25-Dihydroxyvitamin D3 and Its Analog 1{alpha}-Fluoro-16-Ene-20-Epi-23-Ene-26,27-Bishomo-25-Hydroxyvitamin D3 (Ro-26-9228)
Mol. Endocrinol., April 1, 2004; 18(4): 874 - 887.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
P. J. Malloy, R. Xu, L. Peng, P. A. Clark, and D. Feldman
A Novel Mutation in Helix 12 of the Vitamin D Receptor Impairs Coactivator Interaction and Causes Hereditary 1,25-Dihydroxyvitamin D-Resistant Rickets without Alopecia
Mol. Endocrinol., November 1, 2002; 16(11): 2538 - 2546.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Y.-Y. Liu, C. Nguyen, and S. Peleg
Regulation of Ligand-Induced Heterodimerization and Coactivator Interaction by the Activation Function-2 Domain of the Vitamin D Receptor
Mol. Endocrinol., November 1, 2000; 14(11): 1776 - 1787.
[Abstract] [Full Text]


Home page
CarcinogenesisHome page
T. W. Kensler, P. M. Dolan, S. J. Gange, J.-K. Lee, Q. Wang, and G. H. Posner
Conceptually new deltanoids (vitamin D analogs) inhibit multistage skin tumorigenesis
Carcinogenesis, July 1, 2000; 21(7): 1341 - 1345.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. Feldman, X.-Y. Zhao, and A. V. Krishnan
Editorial/Mini-Review: Vitamin D and Prostate Cancer
Endocrinology, January 1, 2000; 141(1): 5 - 9.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Ozono, M. Saito, D. Miura, T. Michigami, S. Nakajima, and S. Ishizuka
Analysis of the Molecular Mechanism for the Antagonistic Action of a Novel 1alpha ,25-Dihydroxyvitamin D3 Analogue toward Vitamin D Receptor Function
J. Biol. Chem., November 5, 1999; 274(45): 32376 - 32381.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H. Hofer, G.-m. Ho, M. Peterlik, M. R. Uskokovic, J. K. Lee, M. C. White, G. H. Posner, and H. S. Cross
Biological Effects of 1alpha -Hydroxy- and 1beta -(Hydroxymethyl)-Vitamin D Compounds Relevant for Potential Colorectal Cancer Therapy
J. Pharmacol. Exp. Ther., November 1, 1999; 291(2): 450 - 455.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. Racz and J. Barsony
Hormone-dependent Translocation of Vitamin D Receptors Is Linked to Transactivation
J. Biol. Chem., July 2, 1999; 274(27): 19352 - 19360.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Quack and C. Carlberg
Selective Recognition of Vitamin D Receptor Conformations Mediates Promoter Selectivity of Vitamin D Analogs
Mol. Pharmacol., June 1, 1999; 55(6): 1077 - 1087.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
S. A. Gardezi, C. Nguyen, P. J. Malloy, G. H. Posner, D. Feldman, and S. Peleg
A Rationale for Treatment of Hereditary Vitamin D-resistant Rickets with Analogs of 1alpha ,25-Dihydroxyvitamin D3
J. Biol. Chem., July 27, 2001; 276(31): 29148 - 29156.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peleg, S.
Right arrow Articles by Posner, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peleg, S.
Right arrow Articles by Posner, G. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals