Molecular Endocrinology 12 (4): 525-535
Copyright © 1998 by The Endocrine Society
Differential Use of Transcription Activation Function 2 Domain of the Vitamin D Receptor by 1,25-Dihydroxyvitamin D3 and Its A Ring-Modified Analogs
Sara Peleg,
Cuong Nguyen,
Benjamin T. Woodard,
Jae-Kyoo Lee and
Gary H. Posner
Department of Medical Specialties (S.P., C.N.), The University of
Texas M. D. Anderson Cancer Center, Houston, Texas 77030; and
Department of Chemistry (B.T.W., J.-K.L., G.H.P.), Johns Hopkins
University, Baltimore, Maryland 21218
 |
ABSTRACT
|
|---|
Analogs of 1,25-dihydroxyvitamin
D3 (1,25D3) can be used
to elucidate details of vitamin D receptor (VDR) activation. The A
ring-modified analog, (TN-2) has 15-fold less affinity for VDR,
but its transcriptional activity is diminished 1000-fold. Likewise, the
ability of TN-2 to induce a protease- resistant conformation in VDR
is 1/1000 that of 1,25D3. The stability of the
VDR-TN-2 complexes is also significantly lower than
VDR-1,25D3 complexes. Mapping the VDR-binding
site of TN-2 showed that it had a significantly greater requirement for
transcription activation function 2 (AF-2) residues than
1,25D3 did. These results suggest that the
increased requirement for AF-2 residues that was induced by the A ring
modifications is associated with diminished receptor activation. To
determine whether restoring the potency of TN-2 by additional
structural modifications would change the requirements for AF-2
residues, we synthesized hybrid analogs with 1ß-hydroxymethyl-3-epi
groups and with dimethyl groups at positions 26 and 27 of the side
chain, without or with a double bond between CD ring positions 16 and
17. We found that the side chain modification enhanced transcriptional
activity 150-fold, increased the ability of the receptor to form a
protease-resistant conformation 100-fold, and stabilized the VDR-analog
complexes. The addition of the 16-ene group further reduced the
analogs dissociation rate and increased its potency in the protease
assays. These functional changes in the hybrid analogs were associated
with a significant reduction in interaction with AF-2 residues. We
conclude that there is an inverse relationship between analogs
potencies and their interaction with AF-2 residues of VDR.
 |
INTRODUCTION
|
|---|
The A ring of 1
,25-dihydroxyvitamin D3
(1,25D3) appears to be critical for its calcium-regulating
activity, and modifications in this structure tend to diminish the
toxic hypercalcemia of vitamin D metabolites and analogs (1, 2, 3, 4).
However, because these same modifications also reduce affinity for the
nuclear vitamin D receptor (VDR), they diminish transcriptional
responses that are essential for the compounds therapeutic effects
(2). Our approach to this problem is to combine structural
modifications that induce powerful VDR-mediated transcription with A
ring modifications that reduce calcemic activity (5, 6, 7). Our goal is
2-fold: 1) to use these analogs as molecular probes to elucidate
details of VDR activation and mechanisms of segregated biological
responses; 2) to identify structural combinations of vitamin D analogs
that maintain low calcemic activities but are highly effective in
treatment of 1,25D3-responsive clinical conditions
including psoriasis, autoimmune disease, and cancer (8, 9, 10).
Studies from our laboratories have focused on analogs with A ring
modifications containing 1ß- hydroxymethyl-3-epi groups (Refs. 57,
11, and 12 and Fig. 1
). We found that this type of A ring [as in
analog TN-2(1ß-hydroxymethyl-3-epi-25-hydroxyvitamin
D3)] reduces the affinity for VDR 12- to 15-fold, but
diminishes growth-inhibitory and VDR-mediated transcriptional
activities 1000-fold (7). We hypothesized that the disproportionate
loss of transcriptional activity of this analog might be due to a very
rapid clearance rate, an inability to form a stable complex with VDR,
or an inability to form a transcriptionally active complex. To improve
the potency of TN-2, we first had to determine the reasons for its poor
potency and then introduce specific modifications that repair these
defects.
Studies of nuclear receptors, including the VDR, have defined a
conserved domain at the C-terminal region that regulates transcription
(13, 14, 15, 16). This region is defined as transcription activation function-2
domain (AF-2), and in the VDR it regulates ligand-dependent
conformational changes, ligand affinity for VDR, and the stability of
ligand-receptor complexes (16). For these reasons our investigations of
the mechanism of action of the A-ring analog focused on its interaction
with this domain.
In the study reported here we demonstrate that the poor activity of the
A ring-modified analog is associated with instability of the VDR-analog
complexes and inability of the analog to induce a protease-resistant
conformation in VDR. The poor performance of the analog was linked to
binding requirements that strongly involved AF-2 residues.
Modifications that increased the potency of the A ring analog
simultaneously stabilized the VDR-analog complexes, increased the
ability of VDR to fold into a protease-resistant conformation, and
reduced the involvement of AF-2 residues in analog
binding.
 |
RESULTS
|
|---|
Comparing VDR-Binding Properties of 1,25D3
and Analog TN-2
Previous analysis of biological and biochemical properties of the
A ring-modified analog TN-2 showed that its growth-inhibitory and
transcriptional activities were 1/1000 that of 1,25D3 (Ref.
7, and Fig. 2A
). Surprisingly, binding
analysis of this analog by competition assays showed only a 10- to
15-fold lower affinity for the human VDR (Ref. 7 and Fig. 2B
). To
determine whether the poor transcriptional activity was associated with
parameters of binding other than affinity for
1,25D3-binding site of VDR, we examined the stability of
VDR-TN-2 complexes by exchange assays. For these experiments
ligand-binding sites were saturated by incubating VDR-transfected COS-1
cells with 2 x 10-8 M 1,25D3
or with 2 x 10-7 M TN-2 for 1 h,
the excess ligand was then removed, and the cells were homogenized. The
homogenates were incubated at 30 C with
[3H]1,25D3, and the exchange of unlabeled and
radioactive ligands was measured at various times. The results (Fig. 2C
) revealed 20% exchange of receptor-bound unlabeled
1,25D3 with [3H]1,25D3 in
vitro within the first 15 min of incubation. However, 80% of the
receptor-binding sites did not bind the radioactive ligand even after
1 h of incubation. On the other hand, rapid exchange of TN-2 and
[3H]1,25D3 occurred with 95% of occupied
VDR-binding sites within the first 15 min of incubation. In conclusion,
these experiments showed that VDR-TN-2 complexes were significantly
less stable than VDR-1,25D3 complexes. In recent studies we
have shown that the ratios of the rapidly dissociating and slowly
dissociating receptor-ligand complexes varies with ligand structure
(16). We speculate that this represents heterogeneity in VDR-ligand
complexes, in which there are receptor conformations that permit rapid
dissociation of the ligand as well as receptor conformations that lock
the ligand in the binding pocket. The mode of ligand interaction
determines whether the predominant conformation is that of a
rapidly dissociating or a slowly dissociating ligand-receptor
complex.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 2. Interaction of 1,25D3 and the A
Ring-Modified Analog TN-2 with VDR
A, Transcriptional activity was tested in VDR-negative CV-1 cells
cotransfected with the ocVDRE/GH reporter and the VDR expression
vector. 1,25D3 or TN-2 was added to the culture medium, and
reporter gene expression was examined 48 h later. Titration of
1,25D3 was included in each transfection experiment, and
results were expressed as percent of maximal reporter gene expression
in 1,25D3-treated cells. The values shown represent the
mean from duplicate transfections. B, Relative affinities of TN-2 and
1,25D3 for hVDR were examined by competition assays
performed with homogenates from COS-1 cells transfected with the hVDR
expression vector. Shown are representative plots of three or four
competition experiments. The linear regression coefficients of these
plots were 0.950.99. C, Exchange assays were performed with
homogenates from VDR-transfected COS-1 cells after incubation of 1
h without or with 2 x 10-8 M
1,25D3 or 2 x 10-7 M TN-2 in
a serum-free medium. D, Quantitative protease sensitivity assay:
in vitro-translated wild-type VDR labeled with
[35S]methionine was incubated with or without the
indicated concentrations of 1,25D3 or TN-2 and digested
with 20 µg/ml trypsin. The 34- and 28-kDa ligand-dependent
proteolytic products are indicated by arrows.
|
|
To determine whether the A ring modification also had a significant
effect on the ability of the ligand to induce conformational changes in
VDR, we performed quantitative protease-sensitivity assays (16, 20). In
these assays, [35S]VDR was incubated with increasing
concentrations of 1,25D3 or the analog and then subjected
to trypsin digestion. The conformational changes induced by both
ligands were very similar: both stabilized 34-kDa and 28-kDa
trypsin-resistant fragments. However, the ED50 for the
maximal protection of these fragments was 0.5 nM for
1,25D3 and 150 nM for TN-2. In conclusion, the
poor transcriptional activity of TN-2 was directly correlated with its
rapid dissociation rate from VDR and with its inability to form a
protease-resistant conformation but not with its affinity for VDR.
Interaction of TN-2 with Transcriptional Activation Function-2
(AF-2) Domain of VDR
Our earlier studies suggested that the mode of interaction of side
chain-modified analogs with AF-2 residues had a significant effect on
the stability of their complexes with VDR and on their transcriptional
potency (16). To determine whether the A-ring modification in TN-2
increased or decreased the requirement for AF-2 residues, we used
several VDR constructs with point mutations at the C-terminal region,
in residues 419, 420, 421, 422, and 425 (Fig. 3A
). These constructs, with the exception
of L419S, were previously used by us to compare the binding
requirements of 1,25D3 and its 20-epi analog (16). To
determine the effect of these mutations on transcriptional potency and
efficacy, we cotransfected each receptor mutant with the osteocalcin
vitamin D-responsive element (ocVDRE)- reporter fusion gene into
VDR-negative CV-1 cells (Fig. 3B
) and treated the cells with various
concentrations of 1,25D3. We found that each of these
mutations, with the exception of E425Q, reduced
1,25D3-dependent transcriptional potency and efficacy, and
the most dramatic effect was of a double mutation at residues 421 and
422 (V421M-F422A). We then examined the effect of the AF-2 mutations on
binding of 1,25D3 and TN-2 by competition assays. Figure 4
shows that substitution of residue 419
(L419S) reduced the affinity of 1,25D3 for the receptor 4-
to 5-fold, but reduced affinity of TN-2 30-fold. A double mutation
V421M-F422A reduced the affinity of 1,25D3 for the receptor
2.5- to 3-fold, but reduced affinity of TN-2 37-fold. Finally,
substitution of residue 420 (E420A) had no significant effect on the
affinity of 1,25D3 for VDR, but reduced the affinity of
TN-2 2.5-fold. These results suggest that the reduced stability of
VDR-TN-2 complexes and diminished ability of TN-2 to induce a
protease-resistant conformation in VDR were associated with increased
dependence of TN-2 on AF-2 residues for binding to VDR.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3. Mapping the AF-2 Domain by Amino Acid Substitutions
at the C-Terminal Region of VDR
Site-directed mutagenesis of the amino acid residues indicated (A) was
performed as described previously (16), and individual mutants were
examined for transcriptional activity (B) in VDR-negative CV-1 cells
cotransfected with the ocVDRE/GH reporter and the wild-type or mutant
VDR expression vectors. The indicated amounts of 1,25D3
were added to the culture medium, and reporter gene expression was
examined 48 h later. The values shown are the mean from duplicate
transfections.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Figure 4. Differential Interaction of 1,25D3 and
Analog TN-2 with AF-2 Residues of VDR
The binding activity of receptor mutants was assessed by competition
assays performed three to four times with each mutant. Each competition
assay of mutant VDR was performed simultaneously with a competition
assay of wild-type VDR. The linear regression coefficients of the plots
shown were 0.960.99. The ED50 for competition binding to
wild-type VDR, L419S, E420A, and V421M-F422A by 1,25D3
(nM ± SE) were 0.7 ± 0.054, 3.22 ±
0.42, 0.62 ± 0.02, and 1.75 ± 0.03, respectively. The
ED50 for competition binding to wild-type VDR, L419S,
E420A, and V421M-F422A by TN-2 (nM ± SE) were
8.75 ± 0.09, 267 ± 22, 22.75 ± 2.1, and 327 ±
32, respectively.
|
|
Restoration of VDR-TN-2 Complex Stability and Transcriptional
Activity
The results described above suggest that one approach to restore
potency of TN-2 is to make structural modifications that stabilize
ligand-receptor complexes or enhance the ligands ability to induce
protease-resistant conformation. These results also suggest that
modifications that improve these aspects of ligand potency may also
reduce the involvement of AF-2 residues in the binding process. To test
these hypotheses we examined the binding properties of a hybrid analog
containing an A ring with 1ß-hydroxymethyl-3-epi groups, a side
chain with dimethyl groups at positions 26 and 27, and a double bond
between carbons 16 and 17 [JK-16262
(1ß-hydroxymethyl-3-epi-16-ene-26,27-dimethyl-25-hydroxyvitamin
D3), see formula in Fig. 1
]). This hybrid analog was
chosen because it was recently shown to be as potent as
1,25D3 in the inhibition of murine keratinocyte growth
(17). To distinguish the contributions of the 16-ene group and the
side-chain modification to the potency of this analog, we examined
another hybrid analog, BTW-262 (1ß-hydroxymethyl-3-epi-26,27-
dimethyl-25-hydroxyvitamin D3) (Fig. 1
), which contains
only the A-ring modifications and the dimethyl groups at positions 26
and 27. The two-hybrid analogs and TN-2 were tested simultaneously for
VDR-mediated transcription of the ocVDRE-reporter fusion gene (Fig. 5A
), affinity for VDR by competition
assays (Fig. 5B
), stability of their complexes with VDR (Fig. 5C
), and
their ability to form protease-resistant conformation (Fig. 5D
). These
experiments showed that the side chain modification alone was
sufficient to increase the transcriptional activity of BTW-262
150-fold; it also increased this analogs ability to induce protease-
resistant conformation more than 100-fold and stabilized
VDR-BTW-262 complexes. All these changes occurred with no apparent
increase in BTW-262s affinity for VDR, as indicated by the
competition assays (Fig. 5B
). The addition of 16-ene group (JK-16262,
Fig. 1
) made a small but significant improvement in transcriptional
activity, in the stability of ligand-receptor complexes, and in the
ability to form a protease-resistant conformation. The 16-ene group
also caused a small but significant increase (2-fold) in the affinity
of JK-16262 for VDR. In conclusion, the side chain modification
significantly changed two aspects in binding properties of the A
ring-modified analogs: stability of the VDR-analog complexes and
ability of the complexes to form a protease-resistant conformation.
These changes were not accompanied by an increase in the ability of the
analog to compete for the 1,25D3-binding site in VDR,
suggesting that the changes in binding properties were not associated
with the hybrid analogs shift into 1,25D3 contact sites
in VDR.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 5. Restoration of Potency of the A Ring-Modified
Analog by Side Chain and C-D Ring Modifications
A, Transcriptional activity was tested in VDR-negative CV-1 cells
cotransfected with the ocVDRE/GH reporter and the VDR expression
vector. The indicated amounts of analogs TN-2, BTW-262, or JK-16262
were added to the culture medium, and reporter gene expression was
examined 48 h later. Titration of 1,25D3 was included
in each transfection experiment, and results were expressed as percent
of maximal reporter gene expression in 1,25D3-treated
cells. Values shown represent the mean from duplicate transfections. B,
Relative affinities of the three analogs for VDR were examined by
competition assays performed as in Fig. 2 , with homogenates prepared
from COS-1 cells transfected with the VDR expression vector. C,
Exchange assays were performed as in Fig. 2 , using homogenates from
VDR-transfected COS-1 cells incubated without or with 2 x
10-7 M analog in a serum-free medium for
1 h. D, The quantitative protease sensitivity assays were
performed with in vitro-translated VDR labeled with
[35S]methionine as in Fig. 2 .
|
|
Effect of the 16-ene Group and the Side Chain Modification on
Binding of the Hybrid Analogs to AF-2 Residues
To test whether the stabilization of ligand-receptor complexes,
the increase in ability to form a protease-resistant conformation, and
the increase in transcriptional potencies were associated with changes
in binding of BTW-262 and JK-16262 to AF-2 residues, we repeated
the competition assays described above with wild-type VDR and the three
AF-2 mutants. Figure 6B
shows that the
residue 420 substitution (E420A) reduced the affinity of the BTW-262
for VDR to the same extent that it decreased the affinity of TN-2 (Fig. 6A
). On the other hand, the affinity of JK-16262 for this mutant was
completely restored (Fig. 6C
). The AF-2 mutation L419S reduced binding
of analog BTW-262 to the AF-2 mutant but to a lesser extent than it
reduced TN-2 binding (10-fold instead of 30-fold). Binding of
JK-16262 to this mutant was also reduced relative to its binding to
wild-type VDR. However, again, this reduction was only 9-fold as
compared with the 30-fold reduction in TN-2 binding.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 6. Effect of AF-2 Mutations on Binding of TN-2 and the
Hybrid Analogs to VDR
The binding activity of receptor mutants was assessed by competition
assays performed with homogenates of VDR-transfected COS-1 cells. Each
competition assay of mutant VDR was performed simultaneously with a competition assay of
wild-type VDR three to four times. The linear regression coefficients
of the plots shown were 0.960.99. WT, Wild-type VDR; 420, E420A
substitution; 419, L419S substitution; 421422, V421M-F422A
substitution. Shown are representative plots. The differences in the
slope of these plots are shown in Fig. 7 .
|
|
The double mutations at residues 421 and 422 reduced the affinity of
BTW-262 for VDR 22-fold and reduced the affinity of JK-16262
16-fold, as compared with the 37-fold reduction in the affinity of
TN-2. In conclusion, BTW-262 bound significantly better than TN-2 to
the AF-2 mutant L419S, whereas JK-16262 bound better than TN-2 to all
three AF-2 mutants tested.
To compare changes in the analogs requirement for AF-2 residues with
the binding requirements of 1,25D3 to the same residues, we
summarized the binding data for all four ligands in Fig. 7
. In this figure we compared the binding
of each ligand to the wild-type VDR and to mutant VDR by calculating a
relative competition index (RCI = the slope of the competition
plot with mutant VDR divided by the slope of the competition plot with
wild-type VDR, and multiplied by 100). By this calculation the RCI for
wild-type VDR is 100. The bar graphs in Fig. 7
indicate that
the two hybrid analogs bound better than TN-2 to the mutant VDR L419S,
but their RCI for this mutant was not as great as that of
1,25D3. On the other hand, the RCI of JK-16262 for mutant
E420A was the same as that of 1,25D3. Finally, all three A
ring-modified analogs still bound poorly to the double mutant
V421M-F422A.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 7. Comparing Competition Indices of
1,25D3, TN-2, and the Two Hybrid Analogs
To assess the change induced by the mutation in the ability of
each ligand to bind to VDR, the slope of each competition assay
performed with mutant VDR was divided by the slope of the competition
plot with wild-type VDR and multiplied by 100. Each bar
represents an average of competition indices from three to four
competition assays. *, P < 0.05 for the difference
between the competition indices of the hybrid analog and TN-2.
|
|
To determine whether the changes in binding requirements of the A
ring-modified analogs also affected their ability to induce a
protease-resistant conformation through the AF-2 mutants, we performed
protease-sensitivity assays (Fig. 8
). The
results of these assays showed that there was no apparent change in the
ability of 1,25D3 or the three analogs to induce a
conformational change through the E420A mutant. The mutation in residue
419 completely abolished the ability of TN-2 to fold VDR in a
protease-resistant conformation even at a concentration of
10-6 M. The addition of the side chain
modification as in BTW-262 partially restored this ability, and the
combination of 16-ene group and dimethyl groups in the side chain (as
in JK-16262) further improved this ability. Likewise, the double
mutation in residues 421 and 422 completely abolished the ability of
TN-2 to induce protease-resistant conformation. In this case, the
addition of the side chain modification alone (as in
analog BTW-262) had little effect, but the double
modification in JK-16262 significantly improved that analogs
ability to induce protease-resistant conformation. In conclusion, both
1,25D3 and the two hybrid analogs bound to the AF-2 mutants
more effectively than the singly modified A-ring analog TN-2. The
apparent reduced dependency on AF-2 residues may increase the
ability of the hybrid analogs to fold the AF-2-mutated VDRs into a
protease-resistant conformation.

View larger version (65K):
[in this window]
[in a new window]
|
Figure 8. Conformational Changes Induced in the Wild-Type
(WT) and Mutant VDRs by the A Ring-Modified Analogs
In vitro-translated wild-type or mutated VDR labeled
with [35S]methionine was incubated with or without
10-6 M ligand before digestion with 20 µg/ml
trypsin. The 34-, 32-, and 28-kDa ligand-dependent proteolytic products
are indicated by arrows. Lane 1, No ligand; lane 2,
1,25D3; lane 3, TN-2; lane 4, BTW-262; lane 5,
JK-16262. WT, WT VDR treated with 10-7 M
1,25D3 and digested with trypsin was added as size
reference for the protease-resistant fragments induced by binding of
ligand to the mutants L419S and V421M-F422A.
|
|
Finally, we examined whether the differential use of AF-2 residues for
binding and for the induction of protease-resistant conformation
affected transcriptional activation of the AF-2 mutants by the analogs.
For that, we cotransfected CV-1 cells with the ocVDRE-
reporter and either wild-type (WT)-VDR or with each of the AF-2
mutants and treated the transfected cells with the natural hormone or
with the analogs (Fig. 9
). These
experiments showed that transcriptional activity of analog TN-2 was
diminished to nondetectable levels by the double mutations at residues
421 and 422 (not shown) and that transcriptional activity of this
analog through the L419S and E420A mutants was barely detectable even
at a concentration of 10-6 M. On the other
hand, the hybrid analogs BTW-262 and JK-16262 had significant
transcriptional activity through mutants L419S and E420A (Fig. 9
, B and
C) and a small but detectable transcriptional activity through the
double mutant V421M/F422A (not shown). These results suggest that the
improved ability of the hybrid analogs to induce a protease-resistant
conformation through mutants L419S and V421M/F422A is directly
correlated with their ability to induce transcription through these
mutants. However, the ability of BTW-262 and JK-16262 to
transactivate VDR through the L419S mutant is significantly lower than
that of 1,25D3, as would be predicted by their greater
dependence on this residue for binding to VDR.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 9. Effect of the AF-2 Mutations on Transcriptional
Activity of the A Ring-Modified Analogs
To assess the effect of AF-2 mutations on transcriptional activity of
each analog, individual mutants were examined in VDR-negative CV-1
cells cotransfected with the ocVDRE/GH reporter and the wild-type (WT)
or mutant VDR expression vectors. The indicated amounts of
1,25D3 or the analogs were added to the culture medium, and
reporter gene expression was examined 48 h later. Transcriptional
activity was expressed as percentage of maximal reporter gene
expression by cells transfected with WT VDR and treated with
10-7 M 1,25D3 (a control that was
included in each transfection experiment). The values shown are the
mean from duplicate transfections.
|
|
 |
DISCUSSION
|
|---|
In the present study we further extended our recent observations
on the role of the AF-2 domain in binding of 1,25D3 and its
analogs to the VDR (16). In the earlier publication we demonstrated
that analogs that have side chains with the natural stereochemistry and
orientation (northeast) were dependent, to some extent, on AF-2
residues for their binding to VDR. On the other hand, binding of the
highly potent 20-epi analogs to VDR was completely independent of these
residues. We, therefore, hypothesized that the use of AF-2 residues for
binding had a negative effect on the potency of the ligand. We further
examined these results in light of the mousetrap model proposed by
Renaud et al. (23), for the apo and holo ligand-binding
domains of the retinoid receptors (22, 23). According to that model,
the lid of the putative mousetrap (the AF-2 domain) is open before
ligand binding, and upon entry of the ligand into the pocket a
conformational change occurs that locks the mouse trap by both the AF-2
domain and an
-loop located between helices 2 and 3. We hypothesized
that the 20-epi analogs interacted not with the AF-2 residues but with
other residues located deeper inside the pocket. This type of binding
promoted efficient sealing of the pocket and stabilized the VDR-analog
complexes. On the other hand, the natural hormone and analogs with
natural side chain orientation did interact with AF-2 residues, thereby
preventing an effective sealing of the pocket and giving the VDR-ligand
complexes a shorter half-life. The results of the study reported here
support that model and the proposed role of AF-2 in stabilization
of ligand- receptor complexes. The A-ring modifications that were
introduced to TN-2 diminished several AF-2-dependent properties:
ability to induce conformational changes, stability of the VDR-ligand
complexes, and transcriptional potency. These changes occurred with
only a moderate decrease in affinity for VDR but a significant increase
in dependency on AF-2 residues for binding to VDR.
We also confirmed the other part of the hypothesis: the addition of
side- chain modifications to the A ring analog (as in BTW-262 and
JK-16262) simultaneously reduced the requirements for AF-2 residues
in the binding process and increased the AF-2-dependent functions,
stabilization of ligand-VDR complexes, ability to form a
protease-resistant conformation, and transcriptional potency.
How do the A-ring modifications in TN-2 reduce AF-2-mediated functions
and why do the dimethyl groups in the side chain of the hybrid analog
restore these functions? Structure-function studies showed that A-ring
modifications always diminish the affinity of 1,25D3
analogs for VDR, especially if they are in C-1 (2). On the other hand,
side chain modifications have little or no effect on affinity for VDR,
but do change transcriptional potency and VDR-mediated
growth-regulatory responses substantially (2, 20). It is tempting to
speculate that the A ring contributes an essential (and probably not
very flexible) anchoring point for 1,25D3 inside the
ligand-binding pocket. On the other hand, the side chain may use more
flexible contact points near or at the AF-2 domain. Therefore, chemical
or stereochemical modifications in side chain may change the mode of
interaction of the side chain with individual residues in the AF-2
domain. Introducing 1ß-hydoxymethyl-3-epi groups diminishes the
contact of the A ring with its anchoring site in the pocket, so that
binding of TN-2 is dependent more on the side chain and its interaction
with the AF-2 domain. This increased dependency on AF-2 residues for
binding has two possible consequences: it may hold the AF-2 domain at
an angle that does not allow the induction of transcriptionally active
(protease-resistant) conformation and at the same time it may also
promote rapid dissociation of the analog from the binding pocket. The
dimethyl groups at positions 26 and 27 in the side chain introduced
subtle changes in the mode of interaction of the analog with the AF-2
residues: they significantly reduced the requirement for residue 419,
had no effect on the requirement for residue 420, and only moderately
reduced the requirement for residues 421 and 422. We hypothesize that
these changes are sufficient to shift the AF-2 domain to a position
that allows better sealing of the ligand-binding pocket and
stabilization of the transcriptionally active conformation. However, it
is important to note that the binding properties of the two hybrid
analogs with respect to use of AF-2 residues are still significantly
different from those of the parent hormone, 1,25D3. Because
the AF-2 residues regulate interaction with transcription coactivators
and corepressors (24, 25, 26, 27, 28, 29, 30), it is possible that the remaining
differences in the use of AF-2 residues by the hybrid analogs and
1,25D3 may lead to subtle differences in the nature of
their VDR-mediated transcriptional activities by selective recruitment
of specific coactivators or corepressors. Preliminary experiments (17)
indicated that the hybrid analogs JK-16262 and BTW-262 had a
substantial antiproliferative activity in keratinocytes, but their
calcemic activities were about 1/50 that of 1,25D3 (T.
Kensler and P. Dolan, unpublished results). These findings suggest that
the initial working hypothesis that the modifications in the A ring
reduce calcemic activity is correct even for analogs that have side
chains that induce high transcriptional and growth-inhibitory
responses. Furthermore, these findings raise the possibility that the
hybrid analogs have tissue- or cell- segregated activities. Future
investigation of these compounds will focus on examination of their
efficacy and potency in cell culture and animal models of diseases that
respond to vitamin D treatment.
 |
MATERIALS AND METHODS
|
|---|
Reagents
[35S]methionine and
1,25-(OH)2[26,27-3H]D3 were
obtained from Amersham Corp. (Arlington Heights, IL). A coupled
transcription/translation system was obtained from Promega Corp.
(Madison WI). 1,25D3 was a generous gift from Dr. L.
Binderup (Leo Pharmaceuticals, Ballerup, Denmark), and the analogs TN-2
(12), BTW-262, and JK-16262 (17) were synthesized in Dr. Posners
laboratory. The structural formulas for and short names of these
ligands are shown in Fig. 1
.
Cell Culture and Transfections
Monkey kidney CV-1 cells were plated in 35-mm dishes at a
density of 3 x 105/dish and cotransfected with 2 µg
of the plasmid ocVDRE, which contains the VDRE from the human
osteocalcin gene (GGTGACTCACCGGGTGAACGGGGGCATT)
(18) attached to the thymidine kinase promoter/GH fusion
gene and with the recombinant human VDR expression vector (2
µg/dish). Monkey kidney COS-1 cells were plated in 150-mm dishes at a
density of 6 x 105/dish and transfected with 20
µg/dish recombinant human VDR plasmids.
All transfections were performed by the diethylaminoethyl-dextran
method (19). Medium samples for measurements of GH were collected 2
days after transfection. GH production from the reporter gene was
measured by a RIA as described by the manufacturer (Nichols Institute,
San Juan Capistrano, CA).
Ligand-Binding Assays
To assess the relative affinities of 1,25D3 and the
analogs for wild-type and mutated VDR in vitro, whole-cell
homogenates from COS-1 cells transfected with VDR expression plasmids
were prepared in KTED (10 mM Tris-HCl, pH 7.4; 1.5
mM EDTA; 0.3 M KCl; and 1 mM
dithiothreitol) as described previously (20). The homogenates were then
aliquoted into tubes containing 0.2 pmol of
[3H]1,25D3 and increasing concentrations of
nonradioactive ligand. The mixtures were incubated on ice for 34 h
after which free ligand was separated from bound by hydroxyapatite
(24). The bound ligand was released from the hydroxyapatite by ethanol
extraction, and the radioactivity was measured by scintillation
counting. The results of the competition assays were plotted as the
inverse value of percent maximal binding against competitor
concentration by the method of Wecksler and Norman (21).
To assess exchange of unlabeled 1,25D3 or its analogs with
[3H]1,25D3, monolayers of VDR-transfected
COS-1 cells were washed three times with PBS and incubated for 1 h
without or with ligand in serum-free medium. Then the medium was
discarded, and the cells were washed three times in cold PBS, scraped
into 10 ml PBS, centrifuged, resuspended in KTED, and homogenized.
Aliquots of the homogenates (0.2 ml) were incubated at 30 C with 0.2
pmol of [3H]1,25D3 for various times and then
transferred to ice for an additional 3 h. The free radioactive
ligand was separated from the bound by hydroxyapatite as described
above. Exchange was assessed by comparing the amount of
[3H]1,25D3 bound to unoccupied VDR and the
amount of [3H]1,25D3 bound to the in
vivo-occupied VDR at each time point.
Ligand-Induced Sensitivity to Proteases
Synthetic wild-type and mutated human VDRs labeled with
[35S]methionine (1000 Ci/mmol) were prepared by in
vitro coupled transcription/translation in reticulocyte lysates
(Promega Corp.) with the human VDR cDNA inserted into the pGEM4
plasmid. The receptor preparations were incubated without or with the
indicated concentrations of 1,25D3 or analogs for 10 min at
room temperature. Then trypsin, 20 µg/ml (Sigma Chemical Co. St.
Louis, MO), was added, and the mixtures were incubated for an
additional 10 min. The digestion products were analyzed by 12%
SDS-PAGE, and the gels were dried and autoradiographed.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. J. W. Pike for the human VDR expression
plasmid, Dr. Y-Y Liu for the preparation of the mutant VDR constructs,
and Dr. L. Binderup of Leo Pharmaceuticals for the generous gift of
1,25-dihydroxyvitamin D3. We also thank Dr. Maureen E.
Goode for her useful comments in preparation of this manuscript, and
Dr. T. Kensler and Mr. P. Dolan for the in vivo calcemic
measurements.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Dr. Sara Peleg, Section of Endocrinology, Box 15, Department of Medical Specialties, 1515 Holcombe Boulevard, Houston, Texas 77030.
This work was supported by NIH Grant DK-50583 (to S.P.) and NIH Grant
CA-44530 (to G.H.P.).
Received for publication October 10, 1997.
Revision received December 9, 1997.
Accepted for publication December 29, 1997.
 |
REFERENCES
|
|---|
-
Norman AW, Myrtle JF, Midgett RJ, Nowicki HG, William V,
Popjak G 1971 1,25- Dihydroxycholecalciferol: identification of the
proposed active form of vitamin D3 in the intestine.
Science 173:5154[Abstract/Free Full Text]
-
Bouillon R, Okamura WH, Norman AW 1995 Structure-function
relationship in the vitamin D endocrine system. Endocr Rev 16:200257[Abstract/Free Full Text]
-
Norman AW, Okamura WH, Farach-Carson MC, Allewaret K,
Branisteanu D, Nemere I, Raman-Muralidharan K, Boullion R 1993 Structure-function studies of 1,25-dihydroxyvitamin D3 and
the vitamin D endocrine system. 1,25-Dihydroxy-pentadeuterio-
previtamin D3 (as a 6-s cis analog) stimulates nongenomic
but not genomic biological responses. J Biol Chem 268:1381113819[Abstract/Free Full Text]
-
Norman AW, Bouillon R, Farach-Carson MC, Bishop JE, Zhou L-X,
Nemere I, Zhao J, Muralidharan RK, Okamura WH 1993 Demonstration that
1ß,25-dihydroxyvitamin D3 is an antagonist of the
nongenomic but not genomic biological responses and biological profile
of the three A-ring diastereomers of 1
,25-dihydroxyvitamin
D3. J Biol Chem 268:2002220030[Abstract/Free Full Text]
-
Posner GH, White CM, Dolan P, Kensler TW, Yukihiro S, Guggino
SE (1994): 1
,25-Dihydroxyvitamin D3 hybrid analogs with
structural changes in both the A-ring and the C,D-ring side chain.
Bioorg Med Chem Lett 4: 29192924
-
Posner GH, Lee JK, Li Z, Takeuchi K, Guggino SE, Dolan P,
Kensler TW (1995): 1
,25-Dihydroxyvitamin D3 hybrid
analogs with structural changes in both the A-ring and the C,D-ring
side chain. Bioorg Med Chem Lett 5: 21632168
-
Peleg S, Liu Y-Y, Reddy S, Horst RL, White C, Posner GH 1996 A 20-epi side chain restores growth-regulatory and transcriptional
activities of an A ring-modified hybrid analog of
1
,25-dihydroxyvitamin D3 without increasing its affinity
to the vitamin D receptor. J Cell Biochem 63:149161[Medline]
-
Kragballe K 1997 Psoriasis and other skin diseases. In:
Feldman D, Glorieux FH, Pike JW (eds) Vitamin D. Academic Press, San
Diego, CA, pp 12131226
-
Lemire J 1997 The role of vitamin D3 in
immunosuppression: lessons from autoimmunity and transplantation. In:
Feldman D, Glorieux FH, Pike JW (eds) Vitamin D. Academic Press, San
Diego, CA, pp 11671182
-
Kolston K 1997 Vitamin D and breast cancer: therapeutic
potential of new vitamin D analogs. In: Feldman D, Glorieux FH, Pike JW
(eds) Vitamin D. Academic Press, San Diego, CA, pp 11251140
-
Posner GH, Nelson TD, Guyton KZ, Kensler TW 1992 New vitamin
D3 derivatives with unexpected antiproliferative activity:
1-(hydroxymethyl)-25-hydroxyvitamin D3 homologs. J Med
Chem 35:32803287[CrossRef][Medline]
-
Posner GH, Dai H, Afarinkia K, Murthy NN, Guyton KZ, Kensler
TW 1993 Asymmetric total synthesis, X-ray crystallography and
preliminary biological evaluation of
1-(1'-hydroxyethyl)-25-hydroxyvitamin D3 analogs of natural
calcitriol. J Org Chem 58:72097215[CrossRef]
-
Tora L, White J, Brou C, Tasset D, Webster N, Scheer E,
Chambon P 1989 The human estrogen receptor has two independent
nonacidic transcription activation functions. Cell 59:477487[CrossRef][Medline]
-
Danielian PS, White R, Lees JA, Parker MG 1992 Identification
of a conserved region required for hormone dependent transcriptional
activation by steroid hormone receptors. EMBO J 11:10251033[Medline]
-
Nakaajima S, Hsieh JC, MacDonald PN, Galligton MA, Haussler
CA, Whitfield GK, Haussler MR 1994 The c-terminal region of the vitamin
D receptor is essential to form a complex with a receptor auxiliary
factor required for high affinity binding to the vitamin D-responsive
element. Mol Endocrinol 8:159172[Abstract/Free Full Text]
-
Liu Y-Y, Collins ED, Norman AW, Peleg S 1997 Differential
interaction of 1
,25-dihydroxyvitamin D3 analogues and
their 20-epi homologues with the vitamin D receptor. J Biol Chem 272:33363345[Abstract/Free Full Text]
-
Posner GH, Lee JK, White C, Hutchings RH, Dai H, Kachinski JL,
Dolan P, Kensler TW 1997 Antiproliferative hybrid analogs of the
hormone 1
,25-dihydroxyvitamin D3: design, synthesis and
preliminary biological evaluation. J Med Chem, in press
-
Ozono K, Liao J, Kerner SA, Scott RA, Pike JW 1990 The vitamin
D-responsive element in the human osteocalcin gene. J Biol Chem 265:2188121888[Abstract/Free Full Text]
-
Peleg S, Abruzzese RV, Cote GJ, Gagel RF 1990 Transcription of
the human calcitonin gene is mediated by a C cell-specific enhancer
containing E-box-like elements. Mol Endocrinol 11:17501757
-
Peleg S, Sastry M, Collins ED, Bishop JE, Norman AW 1995 Distinct conformational changes induced by 20-epi analogues of
1
,25-dihydroxyvitamin D3 are associated with enhanced
activation of the vitamin D receptor. J Biol Chem 270:1055110558[Abstract/Free Full Text]
-
Wecksler WR, Norman AW 1980 Measurement of kinetic rate
constants for the binding of 1
,25-dihydroxyvitamin D3 to
its chick intestinal mucosa receptor using a hydroxyapatite batch
assay. Methods Enzymol 67:488497[Medline]
-
Bourguet W, Ruff D, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the ligand binding domain of the human nuclear
receptor RXR
. Nature 375:377382[CrossRef][Medline]
-
Renaud J-P, Natacha R, Ruff M, Vivat V, Chambon P, Gronemeyer
H, Moras D 1995 Crystal structure of the RAR-gamma ligand-binding
domain bound to all-trans retinoic acid. Nature 378:681689[CrossRef][Medline]
-
Kurokawa R, Soderstrom M, Horlein A, Halachmi S, Brown M,
Rosenfeld MG, Glass CK 1995 Polarity-specific activities of retinoid
acid receptors determined by a co-repressor. Nature 377:451454[CrossRef][Medline]
-
Horlein A, Naar A, Heinzel T, Torchia J, Gloss B, Kurokawa R,
Kamai Y, Ryan A, Soderstrom M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor is
mediated by a nuclear receptor co-repressor, N-CoR. Nature 377:397404[CrossRef][Medline]
-
Chen JD, Evans RM 1995 A transcriptional co-repressor that
interacts with nuclear hormone receptors. Nature 377:454457[CrossRef][Medline]
-
Onate SA Tsai SY, Tsai M-J, OMalley BW 1995 Sequence and
characterization of a coactivator for the steroid receptor superfamily.
Science 270:13541357[Abstract/Free Full Text]
-
Halachmi S, Marden E, Martin G, Mackay H, Abbondanza C, Brown
M 1994 Estrogen receptor-associated proteins: possible mediators of
hormone induced transcription. Science 264:14551458[Abstract/Free Full Text]
-
Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung
L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:11671177[Abstract/Free Full Text]
-
Masuyama H, Brownfield CM, Starnaud R, Macdonald PN 1997 Evidence for ligand dependent intramolecular folding of the AF-2 domain
in vitamin D receptor-activated transcription and coactivator
interaction. Mol Endocrinol 11:15071517[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
L. A. Zella, M. B. Meyer, R. D. Nerenz, and J. W. Pike
The Enhanced Hypercalcemic Response to 20-Epi-1,25-Dihydroxyvitamin D3 Results from a Selective and Prolonged Induction of Intestinal Calcium-Regulating Genes
Endocrinology,
August 1, 2009;
150(8):
3448 - 3456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ismail, C. V. Nguyen, A. Ahene, J. C. Fleet, M. R. Uskokovic, and S. Peleg
Effect of Cellular Environment on the Selective Activation of the Vitamin D Receptor by 1{alpha},25-Dihydroxyvitamin D3 and Its Analog 1{alpha}-Fluoro-16-Ene-20-Epi-23-Ene-26,27-Bishomo-25-Hydroxyvitamin D3 (Ro-26-9228)
Mol. Endocrinol.,
April 1, 2004;
18(4):
874 - 887.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Malloy, R. Xu, L. Peng, P. A. Clark, and D. Feldman
A Novel Mutation in Helix 12 of the Vitamin D Receptor Impairs Coactivator Interaction and Causes Hereditary 1,25-Dihydroxyvitamin D-Resistant Rickets without Alopecia
Mol. Endocrinol.,
November 1, 2002;
16(11):
2538 - 2546.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-Y. Liu, C. Nguyen, and S. Peleg
Regulation of Ligand-Induced Heterodimerization and Coactivator Interaction by the Activation Function-2 Domain of the Vitamin D Receptor
Mol. Endocrinol.,
November 1, 2000;
14(11):
1776 - 1787.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. W. Kensler, P. M. Dolan, S. J. Gange, J.-K. Lee, Q. Wang, and G. H. Posner
Conceptually new deltanoids (vitamin D analogs) inhibit multistage skin tumorigenesis
Carcinogenesis,
July 1, 2000;
21(7):
1341 - 1345.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Feldman, X.-Y. Zhao, and A. V. Krishnan
Editorial/Mini-Review: Vitamin D and Prostate Cancer
Endocrinology,
January 1, 2000;
141(1):
5 - 9.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Ozono, M. Saito, D. Miura, T. Michigami, S. Nakajima, and S. Ishizuka
Analysis of the Molecular Mechanism for the Antagonistic Action of a Novel 1alpha ,25-Dihydroxyvitamin D3 Analogue toward Vitamin D Receptor Function
J. Biol. Chem.,
November 5, 1999;
274(45):
32376 - 32381.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Hofer, G.-m. Ho, M. Peterlik, M. R. Uskokovic, J. K. Lee, M. C. White, G. H. Posner, and H. S. Cross
Biological Effects of 1alpha -Hydroxy- and 1beta -(Hydroxymethyl)-Vitamin D Compounds Relevant for Potential Colorectal Cancer Therapy
J. Pharmacol. Exp. Ther.,
November 1, 1999;
291(2):
450 - 455.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. Racz and J. Barsony
Hormone-dependent Translocation of Vitamin D Receptors Is Linked to Transactivation
J. Biol. Chem.,
July 2, 1999;
274(27):
19352 - 19360.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Quack and C. Carlberg
Selective Recognition of Vitamin D Receptor Conformations Mediates Promoter Selectivity of Vitamin D Analogs
Mol. Pharmacol.,
June 1, 1999;
55(6):
1077 - 1087.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. A. Gardezi, C. Nguyen, P. J. Malloy, G. H. Posner, D. Feldman, and S. Peleg
A Rationale for Treatment of Hereditary Vitamin D-resistant Rickets with Analogs of 1alpha ,25-Dihydroxyvitamin D3
J. Biol. Chem.,
July 27, 2001;
276(31):
29148 - 29156.
[Abstract]
[Full Text]
[PDF]
|
 |
|