help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakaguchi, K.
Right arrow Articles by Kasuga, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakaguchi, K.
Right arrow Articles by Kasuga, M.
Molecular Endocrinology 12 (4): 536-543
Copyright © 1998 by The Endocrine Society

Shc Phosphotyrosine-Binding Domain Dominantly Interacts with Epidermal Growth Factor Receptors and Mediates Ras Activation in Intact Cells

Kazuhiko Sakaguchi, Yoshinori Okabayashi1, Yoshiaki Kido, Sachiko Kimura, Yoko Matsumura, Koichi Inushima and Masato Kasuga

The Second Department of Internal Medicine Kobe University School of Medicine Chuo-ku, Kobe 650, Japan


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The adaptor protein Shc contains a phosphotyrosine binding (PTB) domain and a Src homology 2 (SH2) domain, both of which are known to interact with phosphorylated tyrosines. We have shown previously that tyrosine 1148 of the activated epidermal growth factor (EGF) receptor is a major binding site for Shc while tyrosine 1173 is a secondary binding site in intact cells. In the present study, we investigated the interaction between the PTB and SH2 domains of Shc and the activated human EGF receptor. Mutant 52-kDa Shc with an arginine-to-lysine substitution at residue 175 in the PTB domain (Shc R175K) or 397 in the SH2 domain (Shc R397K) was coexpressed in Chinese hamster ovary cells overexpressing the wild-type or mutant EGF receptors that retained only one of the autophosphorylation sites at tyrosine 1148 (QM1148) or 1173 (QM1173). Shc R397K was coprecipitated with the QM1148 and QM1173 receptors, was tyrosine-phosphorylated, and associated with Grb2 and Sos. In contrast, coprecipitation of Shc R175K with the mutant receptors was barely detectable. In cells expressing the QM1173 receptor, Shc R175K was tyrosine-phosphorylated and associated with Grb2, while association of Sos was barely detectable. In cells expressing the QM1148 receptor, tyrosine phosphorylation of Shc R175K was markedly reduced. When both Shc R175K and 46-kDa Shc R397K were coexpressed with the mutant receptors, p46 Shc R397K was dominantly tyrosine-phosphorylated. In cells expressing the wild-type receptor, Shc R397K, but not Shc R175K, translocated to the membrane in an EGF-dependent manner. In addition, Ras activity stimulated by the immunoprecipitates of Shc R397K was significantly higher than that by the immunoprecipitates of Shc R175K. The present results indicate that tyrosine 1148 of the activated EGF receptor mainly interacts with the Shc PTB domain in intact cells. Tyrosine 1173 interacts with both the PTB and SH2 domains, although the interaction with the PTB domain is dominant. In addition, Shc bound to the activated EGF receptor via the PTB domain dominantly interacts with Grb2-Sos complex and plays a major role in the Ras-signaling pathway.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Growth factor receptors with intrinsic tyrosine kinase activity undergo autophosphorylation on multiple tyrosine residues upon ligand binding (1, 2). One of the most important consequences of autophosphorylation is the creation of binding sites on the receptors for proteins containing domains that specifically interact with the phosphorylated tyrosine (1, 2, 3). Shc is an adaptor protein composed of three overlapping proteins of 46-, 52-, and 66-kDa, which differ only in the extent of their N-terminal sequences (4). Shc proteins share a C-terminal Src homology 2 (SH2) domain, a central glycine/proline-rich region that is 50% homologous to human {alpha}1 collagen, and an adjacent phosphotyrosine binding (PTB) domain (also referred to as phosphotyrosine interaction domain) (4, 5, 6). After stimulation of a variety of cell surface receptors by growth factors and cytokines, Shc binds phosphorylated tyrosines within the activated receptors or receptor substrates, is tyrosine-phosphorylated, and subsequently interacts with Grb2 that forms a complex with Sos, a Ras guanine nucleotide exchange protein. Based on these findings, Shc has been implicated in Ras activation (4, 5, 6, 7, 8, 9, 10, 11). Both the SH2 (4) and PTB domains of Shc (5, 6) are capable of interacting with phosphotyrosine-containing peptides and proteins. For the specific interaction of phosphorylated tyrosines with the SH2 domain of Shc, the C-terminal sequence to the phosphotyrosine pY(I/E/Y/L)X(I/L/M) (where p is phosphorylation and X is any amino acid) is considered to be important (12), whereas the N-terminal sequence, NXXpY, is shown to be a minimal PTB domain-binding motif (13, 14, 15).

We have shown previously that tyrosine 1148 of the activated human epidermal growth factor (EGF) receptor is a major binding site for Shc and that tyrosine 1173 is a secondary binding site in intact cells (16). In vitro studies indicate that the PTB domain interacts with tyrosine 1148 of activated EGF receptors and the SH2 domain with tyrosine 1173 (17, 18). However, it is still not known whether Shc associates with the phosphotyrosines within EGF receptors in vivo by a distinct form of interaction between phosphorylated tyrosines and the PTB or SH2 domain of Shc, since interactions in vitro may not accurately reflect those in vivo. In this regard, a recent study failed to show a stable association of the Shc SH2 domain with the activated EGF receptor in intact cells and suggested a low-affinity interaction between these two molecules (19).

In the present study, we investigated the interaction between the PTB or SH2 domain of Shc and each of tyrosines 1148 and 1173 of the activated EGF receptor. To this end, mutant Shc constructs were cotransfected into Chinese hamster ovary (CHO) cells overexpressing the wild-type mutant, lacking five autophosphorylation sites (F5), and mutant EGF receptors that retained only one of the autophosphorylation sites at tyrosine 1148 (QM1148) or 1173 (QM1173).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Interaction of Mutant Shc Having an Arginine-to-Lysine Substitution at Residue 397 (Shc R397K) with Wild-Type and Mutant EGF Receptors
In the first step we investigated the interaction between the Shc PTB domain and phosphorylated tyrosines at 1148 and 1173, dominant Shc binding sites within EGF receptors. For this purpose, we coexpressed herpes simplex virus (HSV) epitope-tagged Shc R397K in CHO cells overexpressing the wild-type, QM1148, QM1173, or F5 EGF receptors (Fig. 1Go). Parental CHO cells used are devoid of endogenous EGF receptors as previously reported (16). The nuclear magnetic resonance structure of the Shc SH2 domain has shown that an arginine residue at 397 within Shc is located at the bottom of the phosphotyrosine-binding pocket (20). This residue is strictly conserved in the known SH2 domain, and its substitution in the Abl SH2 domain with lysine results in a complete loss of binding activity (21). The expression levels of Shc R397K were estimated to be several fold higher than those of endogenous Shc (data not shown). Lysates from these cells were immunoprecipitated with anti-EGF receptor antibodies and then immunoblotted with anti-HSV antibodies. Anti-HSV immunoblot showed that Shc R397K was detected just above the band of Ig heavy chain. HSV-tagged Shc R397K was coprecipitated with wild-type, QM1148, and QM1173 EGF receptors (Fig. 2Go). The amount of Shc R397K coprecipitated was increased by EGF stimulation, although Shc R397K was detected in unstimulated cells. The amount of Shc R397K coprecipitated with the QM1148 and QM1173 EGF receptors was nearly similar to that with the wild-type EGF receptor. On the other hand, coprecipitation of Shc R397K with the F5 EGF receptor was barely detectable (Fig. 2Go).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 1. Schematic Representation of EGF Receptor and Shc Constructs

A, EGF receptor constructs. WT, The wild-type human EGF receptor shown with five autophosphorylation tyrosines (Y); QM1148 and QM1173, the quadruple point mutant with tyrosine to phenylalanine (F) substitution except tyrosine at 1148 or 1173; F5, the mutant lacking five autophosphorylation sites. B, Shc constructs. Shc, Wild-type 52-kDa Shc showing a PTB, a glycine/proline-rich region (Gly/Pro), and a SH2 domain (SH2); Shc R175K and R397K, HSV epitope-tagged p52 Shc with an arginine-to-lysine substitution at residue 175 or 397, respectively; p46 Shc R397K, T7 epitope-tagged p46 Shc with an arginine-to-lysine substitution at residue 397; Shc{Delta}PTB, T7 epitope-tagged Shc with deleted PTB domain.

 


View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. Interaction of Shc R397K with EGF Receptors

CHO cells coexpressing Shc R397K and wild-type, QM1148, QM1173, or F5 EGF receptors were left unstimulated or stimulated with 10 nM EGF for 2 min at 37 C. Lysates from these cells were immunoprecipitated with anti-EGF receptor (EGFR) antibodies and immunoblotted with anti-HSV epitope tag antibodies. Whole-cell lysates were simultaneously immunoblotted with anti-HSV antibody. IgG, Ig heavy chain. Representative of three separate experiments.

 
We then examined tyrosine phosphorylation of Shc R397K and association of Grb2-Sos complex with Shc R397K. Immunoblotting of anti-HSV immunoprecipitates with anti-phosphotyrosine antibodies showed that the bands of tyrosine-phosphorylated Shc R397K were detected just above the Ig heavy chain in cells expressing wild-type, QM1148, and QM1173, as well as F5 EGF receptors (Fig. 3Go). Tyrosine phosphorylation of Shc R397K was EGF-dependent in these cells. Anti-Grb2 immunoblot showed that Grb2 was coprecipitated with Shc R397K in an EGF-dependent manner in these cells (Fig. 3Go). The degree of tyrosine phosphorylation of Shc R397K and the amount of Grb2 coprecipitated with Shc R397K were similar in these cells. Anti-Sos immunoblot showed that coprecipitation of Sos with Shc R397K was also detectable in cells expressing wild-type, QM1148, and QM1173 EGF receptors, whereas coprecipitation of Sos with Shc R397K was barely detectable in cells expressing F5 receptors (Fig. 3Go). Furthermore, antiphosphotyrosine immunoblots showed the coprecipitation of a tyrosine-phosphorylated EGF receptors with Shc R397K in cells expressing wild-type, QM1148, and QM1173, but not F5 EGF receptors (data not shown). These results suggest that Shc R397K interacts with tyrosines 1148 and 1173 of the activated EGF receptor, is tyrosine-phosphorylated in an EGF-dependent manner, and associates with Grb2-Sos complex. However, Shc R397K, which does not stably bind to EGF receptors, mainly associates with Grb2, which does not form a complex with Sos.



View larger version (60K):
[in this window]
[in a new window]
 
Figure 3. Phosphorylation of Shc R397K and Interaction of Shc R397K with Grb2-Sos Complex

CHO cells coexpressing Shc R397K and wild-type, QM1148, QM1173, or F5 EGF receptors were left unstimulated or stimulated with 10 nM EGF for 2 min at 37 C. Cell lysates were immunoprecipitated with anti-HSV antibodies and immunoblotted with antibodies to phosphotyrosine (PY20), Grb2, Sos, and HSV. IgG, Ig heavy chain. Representative of three separate experiments.

 
Interaction of Mutant Shc Having an Arginine-to-Lysine Substitution at Residue 175 (Shc R175K) with Wild-Type and Mutant EGF Receptors
We then performed a binding study to examine whether the Shc SH2 domain binds to tyrosines 1148 and 1173 of the activated EGF receptor. To this end, we coexpressed HSV epitope-tagged Shc R175K in CHO cells overexpressing the wild-type, QM1148, or QM1173 EGF receptor. The nuclear magnetic resonance structure of the Shc PTB domain has shown that an arginine residue at 175 within Shc interacts with the phosphotyrosine (22). Mutation of arginine to glutamine or lysine has completely eliminated binding of phosphorylated protein, which binds specifically to the Shc PTB domain (22). The expression levels of Shc R175K were estimated to be several fold higher than those of endogenous Shc (data not shown). Lysates prepared from these cells were immunoprecipitated with anti-EGF receptor antibodies and immunoblotted with anti-HSV antibodies. The bands of Shc R175K were barely detectable just above the Ig heavy chain in cells expressing the wild-type, QM1148, and QM1173 EGF receptors (Fig. 4Go). However, the very faint band of Shc R175K was detectable in the QM1173 EGF receptor immunoprecipitates when the scale of the assay was increased. To examine the interaction of mutant Shc lacking an intact PTB domain with EGF receptors more precisely, we used anti-Shc antibodies to detect mutant Shc in anti-EGF receptor immunoprecipitates. Anti-Shc antibodies are several times more efficient than anti-HSV antibodies. Since it is impossible, using anti-Shc antibodies, to distinguish point-mutated Shc from endogenous Shc, we transiently expressed the T7 epitope-tagged deletion mutant of Shc lacking the PTB domain (Shc{Delta}PTB) in CHO cells overexpressing wild-type, QM1148, or QM1173 EGF receptors. Lysates prepared from these cells were immunoprecipitated with anti-EGF receptor antibodies and immunoblotted with anti-Shc antibodies. The band of Shc{Delta}PTB was detectable in cells expressing QM1173, but not wild-type or QM1148, EGF receptors in an EGF-dependent manner (Fig. 4Go). When anti-T7 antibodies were used for immunoblotting, Shc{Delta}PTB was undetectable in QM1173 EGF receptor immunoprecipitates (data not shown).



View larger version (55K):
[in this window]
[in a new window]
 
Figure 4. Interaction of Shc R175K and Shc{Delta}PTB with EGF Receptors

CHO cells coexpressing Shc R175K (top panel) or Shc{Delta}PTB (bottom panel) and wild-type, QM1148, or QM1173 EGF receptors were left unstimulated or stimulated with 10 nM EGF for 2 min at 37 C. Lysates from these cells were immunoprecipitated with anti-EGF receptor (EGFR) antibodies and immunoblotted with antibodies against HSV (top panel) or Shc (bottom panel). Whole-cell lysates were simultaneously immunoblotted with antibodies against HSV (top panel) or Shc (bottom panel). IgG, Ig heavy chain. Representative of three separate experiments.

 
We then examined tyrosine phosphorylation of Shc R175K and association of Grb2-Sos complex with Shc R175K. Immunoblot analysis of anti-HSV immunoprecipitates with anti-phosphotyrosine antibodies showed that similar amounts of tyrosine-phosphorylated HSV-tagged Shc R175K were observed just above the Ig heavy chain in cells expressing wild-type and QM1173 EGF receptors in an EGF-dependent manner (Fig. 5Go). However, tyrosine phosphorylation of Shc R175K in response to EGF was markedly reduced in cells expressing QM1148 receptors (Fig. 5Go). Anti-Grb2 immunoblot showed that the bands of Grb2 were detected below the Ig light chain. The amount of Grb2 coprecipitated with Shc R175K was similar in cells expressing wild-type and QM1173 receptors but was markedly reduced in cells expressing QM1148 receptors (Fig. 5Go). However, anti-Sos immunoblot showed that the bands of Sos coprecipitated with Shc R175K were barely detectable, irrespective of the EGF receptor constructs expressed (Fig. 5Go). These results suggest that Shc R175K dominantly interacts with tyrosine 1173 of the activated EGF receptor, is tyrosine-phosphorylated in an EGF-dependent manner, and associates with Grb2 that does not form a complex with Sos.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 5. Phosphorylation of Shc R175K and Interaction of Shc R175K with Grb2-Sos Complex

CHO cells coexpressing Shc R175K and wild-type, QM1148, or QM1173 EGF receptors were left unstimulated or stimulated with 10 nM EGF for 2 min at 37 C. Cell lysates were immunoprecipitated with anti-HSV antibodies and immunoblotted with antibodies to phosphotyrosine (PY20), Grb2, Sos, and HSV. IgG, Ig heavy or light chain. Representative of three separate experiments.

 
Coexpression of Both 52-kDa Shc R175K and 46-kDa Shc R397K with Mutant EGF Receptors
We performed a third set of experiments in which both HSV-tagged 52-kDa Shc R175K and T7-tagged 46-kDa Shc R397K were coexpressed with QM1148 or QM1173 EGF receptors. Expression levels of both mutants were estimated to be almost similar (data not shown). After stimulation with EGF, cell lysates were immunoprecipitated with either anti-HSV or anti-T7 antibodies and then immunoblotted with anti-phosphotyrosine antibodies. Since interaction of Shc R175K with the EGF receptor was barely detectable, we assessed the interaction by tyrosine phosphorylation of mutant Shc. In anti-HSV immunoprecipitates the band of tyrosine-phosphorylated Shc R175K, migrated just above the Ig heavy chain, was faint in both cells expressing QM1148 or QM1173 EGF receptors (Fig. 6Go). On the other hand, in anti-T7 immunoprecipitates, p46 Shc R397K was dominantly tyrosine-phosphorylated in both cells (Fig. 6Go). In these cells, antibodies to HSV and T7 brought down a similar amount of mutant Shc proteins. These results emphasize that both tyrosines 1148 and 1173 of the activated EGF receptor dominantly interact with the Shc PTB domain in intact cells.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. Coexpression of p46 Shc R397K and p52 Shc R175K with Mutant EGF Receptors

CHO cells coexpressing p46 Shc R397K and p52 Shc R175K with QM1148 or QM1173 EGF receptors were left unstimulated or stimulated with 10 nM EGF for 2 min at 37 C. Lysates from these cells were immunoprecipitated with anti-HSV or anti-T7 antibodies and immunoblotted with antibodies to phosphotyrosine antibodies (PY20) and Shc. IgG, Ig heavy chain. Representative of three separate experiments.

 
EGF-Dependent Membrane Translocation of Shc Mutants
To verify the dominant association of Shc R397K with EGF receptors rather than Shc R175K, we expressed a similar amount of mutant Shc proteins in cells expressing wild-type or F5 EGF receptors. Cell lysates were fractionated, and the cytosol and membrane fractions were immunoprecipitated with anti-HSV antibodies. By anti-HSV immunoblot, mutant Shc proteins were detected just above the Ig heavy chain. Shc R397K, but not Shc R175K, was detected in a membrane fraction in an EGF-dependent manner (Fig. 7Go). In addition, Shc R397K was undetectable in a membrane fraction in cells expressing the F5 EGF receptor, which lacked all five autophosphorylation sites (Fig. 7Go). Given that Shc R397K interacts with Grb2-Sos complex and Shc R175K associates with Grb2, which does not form a complex with Sos in cells expressing wild-type EGF receptors, these results suggest that membrane translocation of Shc is necessary for the association of Grb2-Sos complex with tyrosine-phosphorylated Shc.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 7. Subcellular Localization of Shc R175K and Shc R397K in Cells Expressing Wild-Type and F5 EGF Receptors

CHO cells coexpressing Shc R175K or Shc R397K with wild-type or F5 EGF receptors were left unstimulated or stimulated with 10 nM EGF for 2 min at 37 C. Lysates fractionated into soluble (S) and particulate fractions (P) were immunoprecipitated with anti-HSV antibodies and immunoblotted with anti-HSV antibodies. IgG, Ig heavy chain. Representative of two separate experiments.

 
In Vitro Ras Assay
To verify the preferable association of Grb2-Sos complex with Shc R397K rather than Shc R175K, we determined Ras activity in anti-HSV immunoprecipitates. CHO cells coexpressing Shc R175K or Shc R397K with the wild-type EGF receptor were left unstimulated or stimulated with EGF. HSV-tagged mutant Shc proteins were immunoprecipitated, and an ability of the immune complexes to stimulate [{alpha}-32P]GTP binding to recombinant H-Ras expressed as a fusion protein with glutathione S-transferase (GST) was assessed. With the complexes including Shc R175K and Shc R397K, the rate of binding of [{alpha}-32P]GTP to GST-H-Ras was significantly stimulated (Fig. 8Go). Ras activity stimulated by the complex containing Shc R397K was significantly higher than that by the complex including Shc R175K. Given that Shc R397K more stably associates with the activated EGF receptor than does Shc R175K and translocates to plasma membrane in an EGF-dependent manner, these results suggest that Shc translocated to plasma membrane plays an important role in Ras activation signaling.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 8. In Vitro Ras Activity Stimulated with Immunoprecipitates of Shc R175K or Shc R397K

CHO cells coexpressing Shc R175K or Shc R397K with wild-type EGF receptors were left unstimulated or stimulated with 10 nM EGF for 2 min at 37 C. Lysates were immunoprecipitated with anti-HSV antibodies, and an ability of immune complex to phosphorylate GST-H-Ras was determined. Results were expressed as the percentage of radioactivity stimulated with protein G-Sepharose beads alone. Results shown are mean ± SEM of five separate experiments. *, Significant difference vs. respective control; **, significant difference vs. Shc R175K.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
To clarify the interaction between the PTB or SH2 domain of Shc and activated EGF receptors in intact cells, we carried out three sets of experiments. Either Shc R175K, Shc R397K, or both were coexpressed in CHO cells overexpressing the wild-type mutant lacking five autophosphorylation sites and mutant EGF receptors that retain only one of the autophosphorylation sites at tyrosine 1148 or 1173, the dominant Shc binding sites. Mutation of arginine at 175 in the PTB domain or 397 in the SH2 domain to lysine is shown to result in a complete loss of binding activity of the PTB or SH2 domains, respectively (21, 22). The expression levels of these Shc mutants were several fold higher than those of endogenous Shc. The present results indicate that the PTB domain of Shc interacts with both tyrosines 1148 and 1173 of activated EGF receptors with higher affinity than does the Shc SH2 domain, and that binding of the Shc PTB domain to the EGF receptor plays an important role in regulating the association of Grb2-Sos complex with Shc and Ras activation signaling.

With respect to the interaction of the Shc PTB domain with tyrosines 1148 and 1173 of the activated EGF receptor, the amount of Shc R397K associated with the QM1148 and QM1173 EGF receptor is nearly similar to that with the wild-type EGF receptor. We have previously shown the amount of endogenous Shc bound to mutant EGF receptors retaining only one of the autophosphorylation sites at tyrosines 1148 or 1173 was ~80% or ~40% of the wild-type level, respectively (16). The present result with the QM1148 EGF receptor is in agreement with our previous results, while that with the QM1173 receptor seems conflicting. This conflict may result from the increased levels of mutant Shc proteins expressed. Excess amount of mutant Shc proteins may inhibit the binding of other molecules, such as phospholipase C-{gamma}1, to tyrosine 1173 of the activated EGF receptor. The Shc PTB domain is known to recognize amino acids N-terminal to the phosphotyrosine consisting of core NXXpY motif (13, 14, 15). In vitro binding studies using synthetic phosphopeptides and GST fusion proteins (12, 13, 23, 24) and a study using the yeast two-hybrid system (25) have shown that proline at position -2 to the phosphotyrosine increases the binding affinity of the Shc PTB domain. Several studies of in vitro binding assay using phosphopeptides (14, 15, 26, 27, 28) have shown that, in addition to the NXXpY sequence, a leucine or hydrophobic amino acid at position -5 to the phosphotyrosine, which contacts a hydrophobic pocket formed by the PTB domain (22), is critical for the tight binding of the Shc PTB domain. In addition, a ß-turn within the phosphopeptide has been suggested integral for the interaction of the Shc PTB domain with the phosphopeptide (26, 27, 28). These results suggest that the amino acid sequence {Phi}XNPXpY (where {Phi} is hydrophobic) is critical for tight binding. Since the amino acid sequences surrounding tyrosines 1148 and 1173 of EGF receptors are LDNPDpY and AENAEpY, respectively, it seems likely that the Shc PTB domain interacts with tyrosine 1148 more tightly than with tyrosine 1173. In addition, the Shc PTB domain binds to a phosphopeptide corresponding to tyrosine 1148 of the EGF receptor with high affinity and to that corresponding to tyrosine 1173 with low affinity (23).

Using the nuclear magnetic resonance and surface plasmon resonance techniques, Zhou et al. (23) have shown that the tyrosine-phosphorylated peptide corresponding to tyrosine 1173 of the EGF receptor binds preferentially to the Shc SH2 domain rather than to the Shc PTB domain. In addition, Batzer et al. (18) have shown that phosphopeptide corresponding to tyrosine 1173 of the EGF receptor inhibits the binding of GST-Shc SH2 domain to EGF receptors more efficiently than it does that of GST-Shc PTB domain. These results suggest that the Shc SH2 domain interacts with tyrosine 1173 with a higher affinity than does the Shc PTB domain. In contrast to these in vitro results, the present in vivo results clearly indicate that the PTB domain binds to tyrosine 1173 of the activated EGF receptor with higher affinity than does the SH2 domain. In support of this finding, we have also observed that GST-Shc PTB domain dominantly interacts with phosphorylated QM1173 EGF receptors by in vitro binding assay using an excess of equimolar GST-Shc PTB and GST-Shc SH2 domains (our unpublished observations).

A recent study of the transient expression of mutant Shc in HeLa cells has shown that association of mutant Shc lacking an intact PTB domain with EGF receptors is diminished (19), indicating that the Shc SH2 domain does not form a stable complex with the wild-type EGF receptors. Consistent with this finding, the present results show that the association of mutant Shc lacking an intact PTB domain with the wild-type EGF receptor is hardly detectable. However, our results also reveal that the Shc SH2 domain is able to interact with tyrosine 1173 of EGF receptors in intact cells, since the mutant Shc lacking an intact PTB domain is tyrosine phosphorylated in cells expressing the QM1173 EGF receptor. It seems unlikely that other ErbB families are implicated in this process, since EGF-induced tyrosine phosphorylation of the mutant Shc is dependent on the mutant EGF receptor construct expressed. Actually, EGF-dependent tyrosine phosphorylation of the mutant Shc is abolished in cells expressing the F5 EGF receptor (our unpublished observation). The reason why the interaction between Shc R175K and the QM1173 EGF receptor was hardly detectable is probably due to the low-affinity interaction of Shc R175K with the receptor.

In the present study we have shown that Shc having an intact PTB domain dominantly interacts with Grb2-Sos complex, while the interaction of Grb2-Sos complex with Shc lacking an intact PTB domain is markedly reduced. In addition, interaction of Grb2-Sos complex with Shc retaining an intact PTB domain is also markedly reduced when this mutant Shc is coexpressed in cells expressing the mutant EGF receptor lacking five autophosphorylation sites. This suggests that plasma membrane targeting is necessary for Grb2-Sos complex binding to tyrosine-phosphorylated Shc. Alternatively, the stable interaction of Shc with EGF receptors may cause conformational changes of Shc molecules, which results in a high-affinity binding of Grb2-Sos complex to receptor-associated and tyrosine-phosphorylated Shc. Further studies are needed to address this issue.

In accordance with the results of immunoblot experiments, the ability of Shc R397K immunoprecipitates to activate Ras is greater than that of Shc R175K immunoprecipitates. Shc R175K immunoprecipitates retain the ability to stimulate Ras activity in vitro, since Shc R175K interacts with the EGF receptor, is tyrosine-phosphorylated, and associates with small amounts of Grb2-Sos complex. Thus, the present results suggest that tight association of Shc with EGF receptors might mediate stable interaction of Grb2-Sos complex with Shc and Ras activation signaling. Alternatively, Grb2 complexed with molecules other than Sos might bind to Shc, which associates the EGF receptor via the SH2 domain, with higher affinity than does Grb2-Sos complex. Recent reports have shown that various molecules associate with Grb2, including a putative nucleotide exchange protein Vav (29), a protooncogene product Cbl (30), the 85-kDa subunit of phosphatidylinositol 3-kinase (31), dynamin (32), and dystroglycan (33), as well as Sos. This suggests that Shc, as well as Grb2, may play some role in addition to that of regulating the Ras activation pathway. We have examined which molecules form a complex with Grb2 that associates with Shc R175K. However, we could not detect Cbl, the 85-kDa subunit of phosphatidylinositol 3-kinase, and dynamin in the anti-Shc R175K immunoprecipitates (our unpublished observation).

In conclusion, the Shc PTB domain interacts with the EGF receptor with higher affinity than does the Shc SH2 domain, and Grb2-Sos complex dominantly interacts with tyrosine-phosphorylated Shc that associates the EGF receptor via the PTB domain, resulting in the activation of Ras-signaling pathway.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Tissue Culture
CHO cells overexpressing the wild-type, QM1148, QM1173, or F5 EGF receptors (16) were maintained in Ham’s F-12 medium supplemented with 10% FBS.

Construction and Transfection of Expression Plasmids Carrying Mutant Shc cDNA
A full-length human p52 Shc cDNA was isolated as described previously (34). cDNA of mutant p52 Shc, Shc R175K, or Shc R397K, tagged with a HSV epitope (YTDIEMNRLGK), was prepared by site-directed mutagenesis and sequential PCR. Oligonucleotides 5'>GGCAGGCTTTCTGATTC<3' and 5'>GTGCTCTCCTTTACCAAGAAG<3' were used for Shc R175K and Shc R397K mutagenesis, respectively. Oligonucleotides used for PCR were the sense primer 5'>CATGCGGCCGCGGACATGAACAAGCTG<3', the first round antisense primer 5'>CCTCTGGAGCGAGTTCAGGCTGCAGTTTCCGCTCCA-CAGG<3', and the second round antisense primer 5'>ATTGCGGCCGCTTAATCTTCCGGATCCTCTGGAGCGAG-TTCAGG<3'.

cDNA of 46-kDa Shc R397K tagged with a T7 epitope (MASMTGGQQMG) was prepared by sequential PCR, using the first-round sense primer 5'>ATGGCTAGCATGACTGGTGGACAGCAAATGGGACCCGGGGTTTCC<3', the second-round sense primer 5'>GCGGAATTCACCATGGCTAGCATGACTGG<3', and antisense primer 5'>AAGAGAATT-CTAGGGCAGATCACAGTTTCCGC<3'.

cDNAs of these mutants were subcloned into pcDNAI (Invitrogen, San Diego, CA). The expression plasmids were introduced into CHO cells with pHph (Boehringer Mannheim, Tokyo, Japan), which encodes hygromycin resistance, using lipofectAMINE (Life Technologies, Gaithersburg, MD), and appropriate transfectants were isolated using hygromycin (0.5 mg/ml).

Immunoprecipitation and Immunoblot Analysis
CHO cells expressing mutant Shc were serum-starved for 12 h and then left unstimulated or stimulated with mouse EGF (Takara Shuzo, Kyoto, Japan). The cells were immediately frozen in liquid nitrogen and lysed in a buffer containing 20 mM Tris-HCl (pH 8.0), 137 mM NaCl, 10% glycerol, 1.0% Nonidet P-40, 2 mM EDTA, 1.0 mM Na3VO4, 1.0 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, and 10 µM leupeptin. For the fractionation experiments, CHO cells were homogenized in a buffer containing 50 mM HEPES (pH 7.4), 150 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 100 mM NaF, 10 mM sodium pyrophosphate, 1 mM Na3VO4, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, and 10 µM leupeptin (homogenization buffer). After centrifugation at 15,000 rpm for 5 min at 4 C, the supernatants were saved as the cytosol fraction and the pellets were solubilized in the homogenization buffer containing 1% Triton X-100 and 10% glycerol. Clarified lysates were used as the membrane fraction. Lysates were incubated with antibodies to EGF receptor (Ab-1; Oncogene Science, Uniondale, NY), HSV epitope-tag (Novagen, Madison, WI), or T7 epitope-tag (Novagen) coupled with protein G-Sepharose (Pharmacia Biotech, Uppsala, Sweden) for 90 min at 4 C. Immunoprecipitates were washed three times with a solution containing 20 mM HEPES (pH 7.5), 150 mM NaCl, 10% glycerol, 0.1% Triton X-100, and 1.0 mM Na3VO4, and then boiled for 3 min in SDS sample buffer. The samples were subjected to SDS-PAGE and transferred onto nitrocellulose. Blots were blocked in 5% skim milk in Tris-buffered saline and then probed with antibodies to phosphotyrosine (PY20; ICN Biomedical, Costa Mesa, CA), Grb2 (Transduction Laboratories, Lexington, KY), mSos1 (Transduction), Shc (16), HSV, and T7. Bound antibodies were detected with horseradish peroxidase-conjugated antibodies to mouse or rabbit IgG (Promega, Madison, WI) using the ECL detection system (Amersham, Buckinghamshire, U.K.).

In Vitro Ras Assay
Cells were serum-starved for 12 h and then left unstimulated or stimulated with 10 nM EGF for 2 min. Immunoprecipitation was done as described above using anti-HSV antibody. The immunoprecipitates were washed and resuspended in 10 µl of a buffer containing 20 mM Tris-HCl (pH 7.4), 1 mM MgCl2, 1 mM dithiothreitol, 10 mM NaCl, and 50 µg/ml BSA in the presence of purified H-ras (5 µg/ml). H-ras protein was expressed as a GST-fusion protein in bacteria and purified by glutathione-agarose column (Pharmacia). The reaction was started at 32 C by the addition of 1 µCi [{alpha}-32P]GTP (~3000 Ci/mmol, Amersham). After 30 min, the reaction mixtures were centrifuged and the supernatants were filtered through nitrocellulose. Radioactivity associated with the filters was quantified. In parallel, assay with protein G-Sepharose beads alone was run as a control. Results are expressed as the percentage of radioactivity obtained with beads alone.


    ACKNOWLEDGMENTS
 
We thank Dr. M. Shibuya for donating human EGF receptor cDNA.


    FOOTNOTES
 
Address requests for reprints to: Dr. Yoshinori Okabayashi, The Second Department of Internal Medicine, Kobe University School of Medicine, Chuo-ku, Kobe 650, Japan.

1 This work was supported by a grant to Y. O. and a grant-in-aid for Cancer Research to M. K. from the Ministry of Education, Science, and Culture of Japan. Back

Received for publication October 23, 1997. Revision received January 2, 1998. Accepted for publication January 9, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Ullrich A, Schlessinger J 1990 Signal transduction by receptors with tyrosine kinase activity. Cell 61:203–212[CrossRef][Medline]
  2. Carpenter G, Cohen S 1990 Epidermal growth factor. J Biol Chem 265:7709–7712[Free Full Text]
  3. Pawson T 1995 Protein modules and signalling networks. Nature 37:573–580
  4. Pelicci G, Lanfrancone L, Grignami F, McGlade J, Cavallo F, Forni G, Nicoletti I, Grignami F, Pawson T, Pelicci PG 1992 A novel transforming protein (SHC) with an SH2 domain is implicated in mitogenic signal transduction. Cell 70:93–104[CrossRef][Medline]
  5. Kavanaugh WM, Williams LT 1994 An alternative to SH2 domains for binding tyrosine-phosphorylated proteins. Science 266:1862–1865[Abstract/Free Full Text]
  6. Blaikie P, Immanuel D, Wu J, Li N, Yajnik V, Margolis B 1994 A region in Shc distinct from the SH2 domain can bind tyrosine-phosphorylated growth factor receptors. J Biol Chem 269:32031–32034[Abstract/Free Full Text]
  7. Rozakis-Adcock M, McGlade J, Mbmalu G, Pelicci G, Daly R, Li W, Batzer A, Thomas S, Brugge J, Pelicci PG, Schlessinger J, Pawson T 1992 Association of the Shc and Grb2/Sem5 SH2-containing proteins is implicated in activation of the Ras pathway by tyrosine kinases. Nature 360:689–692[CrossRef][Medline]
  8. Cutler RL, Liu L, Damen JE, Krystal G 1993 Multiple cytokines induce the tyrosine phosphorylation of Shc and its association with Grb2 in hemopoietic cells. J Biol Chem 268:21463–21465[Abstract/Free Full Text]
  9. Pronk GJ, deVries-Smits MM, Buday L, Downward J, Maassen JA, Madema R, Bos JL 1994 Involvement of Shc in insulin- and epidermal growth factor-induced activation of p21ras. Mol Cell Biol 14:1575–1581[Abstract/Free Full Text]
  10. Ravichandran KS, Lee KK, Songyang Z, Cantley LC, Burn P, Burakoff SJ 1993 Interaction of Shc with the zeta chain of the T cell receptor upon T cell activation. Science 262:902–905[Abstract/Free Full Text]
  11. Egan SE, Giddings BW, Brooks MW, Buday L, Sizeland AM, Weinberg RA 1993 Association of Sos Ras exchange protein with Grb2 is implicated in tyrosine kinase signal transduction and transformation. Nature 363:45–51[CrossRef][Medline]
  12. Songyang Z, Margolis B, Chaudhuri M, Shoelson SE, Cantley LC 1995 The phosphotyrosine interaction domain of SHC recognizes tyrosine-phosphorylated NPXY motif. J Biol Chem 270:14863–14866[Abstract/Free Full Text]
  13. Kavanaugh WM, Turck CW, Williams LT 1995 PTB domain binding to signaling proteins through a se-quence motif containing phosphotyrosine. Science 268:1177–1179[Abstract/Free Full Text]
  14. Laminet AA, Apell G, Conroy L, Kavanaugh WM 1996 Affinity, specificity, and kinetics of the interaction of the SHC phosphotyrosine binding domain with asparagine-X-X-phosphotyrosine motifs of growth factor receptors. J Biol Chem 271:264–269[Abstract/Free Full Text]
  15. van der Geer P, Wiley S, Gish GD, Lai VK-M, Stephens R, White MF, Kaplan D, Pawson T 1996 Identification of residues that control specific binding of the Shc phosphotyrosine-binding domain to phosphotyrosine sites. Proc Natl Acad Sci USA 93:963–968[Abstract/Free Full Text]
  16. Okabayashi Y, Kido Y, Okutani T, Sugimoto Y, Sakaguchi K, Kasuga M 1994 Tyrosines 1148 and 1173 of activated human epidermal growth factor receptors are binding sites of Shc in intact cells. J Biol Chem 269:18674–18678[Abstract/Free Full Text]
  17. Batzer AG, Rotin D, Urena JM, Skolnik EY, Schlessinger J 1994 Hierarchy of binding sites for Grb2 and Shc on the epidermal growth factor receptor. Mol Cell Biol 14:5192–5201[Abstract/Free Full Text]
  18. Batzer AG, Blaikie P, Nelson K, Schlessinger J, Margolis B 1995 The phosphotyrosine interaction domain of Shc binds an LXNPXY motif on the epidermal growth factor receptor. Mol Cell Biol 15:4403–4409[Abstract]
  19. Yajnik V, Blaikie P, Bork P, Margolis B 1996 Identification of residues within the SHC phosphotyrosine binding/phosphotyrosine interaction domain crucial for phosphopeptide interaction. J Biol Chem 271:1813–1816[Abstract/Free Full Text]
  20. Zhou M-M, Meadows RP, Logan TM, Yoon HS, Wade WS, Ravichandran KS, Burakoff SJ, Fesik SW 1995 Solution structure of the Shc SH2 domain complexed with a tyrosine-phosphorylated peptide from the T-cell receptor. Proc Natl Acad Sci USA 92:7784–7788[Abstract/Free Full Text]
  21. Mayer BJ, Jackson PK, Van Etten RA, Baltimore D 1992 Point mutations in the abl SH2 domain coordinately impair phosphotyrosine binding in vitro and transforming activity in vivo. Mol Cell Biol 12:609–618[Abstract/Free Full Text]
  22. Zhou M-M, Ravichandran KS, Olejniczak ET, Petros AM, Meadows RP, Sattler M, Harlan JE, Wade WS, Burakoff SJ, Fesik SW 1995 Structure and ligand recognition of the phosphotyrosine binding domain of Shc. Nature 378:584–592[CrossRef][Medline]
  23. Zhou M-M, Harlan JE, Wade WS, Crosby S, Ravichandran KS, Burakoff SJ, Fesik SW 1995 Binding affinities of tyrosine-phosphorylated peptides to the COOH-terminal SH2 and NH2-terminal phosphotyrosine binding domains of Shc. J Biol Chem 270:31119–31123[Abstract/Free Full Text]
  24. Prigent SA, Pillay TS, Ravichandran KS, Gullick WJ 1995 Binding of Shc to the NPXY motif is mediated by its N-terminal domain. J Biol Chem 270:22097–22100[Abstract/Free Full Text]
  25. Gustafson TA, He W, Craparo A, Schaub CD, O’Neill TJ 1995 Phosphotyrosine-dependent interaction of SHC and insulin receptor substrate 1 with the NPEY motif of the insulin receptor via a novel non-SH2 domain. Mol Cell Biol 15:2500–2508[Abstract]
  26. Dikic I, Batzer AG, Blaikie P, Obermeier A, Ullrich A, Schlessinger J, Margolis B 1995 Shc binding to nerve growth factor receptor is mediated by the phosphotyrosine interaction domain. J Biol Chem 270:15125–15129[Abstract/Free Full Text]
  27. Trub T, Choi WE, Wolf G, Ottinger E, Chen Y, Weiss M, Shoelson S 1995 Specificity of the PTB domain of Shc for ß turn-forming pentapeptide motifs amino-terminal to phosphotyrosine. J Biol Chem 270:18205–18208[Abstract/Free Full Text]
  28. Wolf G, Trub T, Ottinger E, Groninga L, Lynch A, White MF, Miyazaki M, Lee J, Shoelson SE 1995 PTB domains of IRS-1 and Shc have distinct but overlapping binding specificities. J Biol Chem 270:27407–27410[Abstract/Free Full Text]
  29. Ye ZS, Baltimore D 1994 Binding of Vav to Grb2 through dimerization of Src homology 3 domains. Proc Natl Acad Sci USA 91:12629–12633[Abstract/Free Full Text]
  30. Meisner H, Conway BR, Hartley D, Czech MP 1995 Interactions of Cbl with Grb2 and phosphatidylinositol 3'-kinase in activated Jurkat cells. Mol Cell Biol 15:3571–3578[Abstract]
  31. Wang J, Auger KR, Jarvis L, Shi Y, Roberts TM 1995 Direct association of Grb2 with the p85 subunit of phosphatidylinositol 3-kinase. J Biol Chem 270:12774–12780[Abstract/Free Full Text]
  32. Ando A, Yonezawa K, Gout I, Nakata T, Ueda H, Hara K, Kitamura Y, Noda Y, Takenawa T, Hirokawa N, Waterfield MD, Kasuga M 1994 A complex of Grb2-dynamin binds to tyrosine-phosphorylated insulin receptor substrate-1 after insulin treatment. EMBO J 13:3033–3038[Medline]
  33. Yang B, Jung D, Motto D, Meyer J, Koretzky G, Campbell KP 1995 SH3 domain-mediated interaction of dystroglycan and Grb2. J Biol Chem 270:11711–11714[Abstract/Free Full Text]
  34. Okabayashi Y, Sugimoto Y, Totty NF, Hsuan J, Kido Y, Sakaguchi K, Gout I, Waterfield MD, Kasuga M 1996 Interaction of Shc with adaptor protein adaptins. J Biol Chem 271:5265–5269[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
W. Cai, J. C. He, L. Zhu, C. Lu, and H. Vlassara
Advanced glycation end product (AGE) receptor 1 suppresses cell oxidant stress and activation signaling via EGF receptor
PNAS, September 12, 2006; 103(37): 13801 - 13806.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
M. Mitsushima, K. Ueda, and N. Kioka
Vinexin beta regulates the phosphorylation of epidermal growth factor receptor on the cell surface.
Genes Cells, September 1, 2006; 11(9): 971 - 982.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Wilhelmsen, S. H.M. Litjens, and A. Sonnenberg
Multiple Functions of the Integrin {alpha}6{beta}4 in Epidermal Homeostasis and Tumorigenesis
Mol. Cell. Biol., April 15, 2006; 26(8): 2877 - 2886.
[Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
I. V. Yosypiv, M. Schroeder, and S. S. El-Dahr
Angiotensin II Type 1 Receptor-EGF Receptor Cross-Talk Regulates Ureteric Bud Branching Morphogenesis
J. Am. Soc. Nephrol., April 1, 2006; 17(4): 1005 - 1014.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
A. Kasai, T. Shima, and M. Okada
Role of Src family tyrosine kinases in the down-regulation of epidermal growth factor signaling in PC12 cells
Genes Cells, December 1, 2005; 10(12): 1175 - 1187.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
Y. Zhang, A. Wolf-Yadlin, P. L. Ross, D. J. Pappin, J. Rush, D. A. Lauffenburger, and F. M. White
Time-resolved Mass Spectrometry of Tyrosine Phosphorylation Sites in the Epidermal Growth Factor Receptor Signaling Network Reveals Dynamic Modules
Mol. Cell. Proteomics, September 1, 2005; 4(9): 1240 - 1250.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Radtke, S. Haan, A. Jorissen, H. M. Hermanns, S. Diefenbach, T. Smyczek, H. Schmitz-VandeLeur, P. C. Heinrich, I. Behrmann, and C. Haan
The Jak1 SH2 Domain Does Not Fulfill a Classical SH2 Function in Jak/STAT Signaling but Plays a Structural Role for Receptor Interaction and Up-regulation of Receptor Surface Expression
J. Biol. Chem., July 8, 2005; 280(27): 25760 - 25768.
[Abstract] [Full Text] [PDF]


Home page
Biophys. JHome page
T. Uyemura, H. Takagi, T. Yanagida, and Y. Sako
Single-Molecule Analysis of Epidermal Growth Factor Signaling that Leads to Ultrasensitive Calcium Response
Biophys. J., May 1, 2005; 88(5): 3720 - 3730.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Dong, S. Ramachandiran, K. Tikoo, Z. Jia, S. S. Lau, and T. J. Monks
EGFR-independent activation of p38 MAPK and EGFR-dependent activation of ERK1/2 are required for ROS-induced renal cell death
Am J Physiol Renal Physiol, November 1, 2004; 287(5): F1049 - F1058.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. P. M. Hughes, D. G. Thomas, T. J. Giordano, L. H. Baker, and K. T. McDonagh
Cell Surface Expression of Epidermal Growth Factor Receptor and Her-2 with Nuclear Expression of Her-4 in Primary Osteosarcoma
Cancer Res., March 15, 2004; 64(6): 2047 - 2053.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. P. Mahajan and H. S. Earp
An SH2 Domain-dependent, Phosphotyrosine-independent Interaction between Vav1 and the Mer Receptor Tyrosine Kinase: A MECHANISM FOR LOCALIZING GUANINE NUCLEOTIDE-EXCHANGE FACTOR ACTION
J. Biol. Chem., October 24, 2003; 278(43): 42596 - 42603.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Ugi, P. M. Sharma, W. Ricketts, T. Imamura, and J. M. Olefsky
Phosphatidylinositol 3-Kinase Is Required for Insulin-stimulated Tyrosine Phosphorylation of Shc in 3T3-L1 Adipocytes
J. Biol. Chem., May 17, 2002; 277(21): 18592 - 18597.
[Abstract] [Full Text] [PDF]


Home page
J. Gerontol. A Biol. Sci. Med. Sci.Home page
D. Hutter, Y. Yo, W. Chen, P. Liu, N. J. Holbrook, G. S. Roth, and Y. Liu
Age-Related Decline in Ras/ERK Mitogen-Activated Protein Kinase Cascade Is Linked to a Reduced Association Between Shc and EGF Receptor
J. Gerontol. A Biol. Sci. Med. Sci., March 1, 2000; 55(3): 125B - 134.
[Abstract] [Full Text]


Home page
J. Histochem. Cytochem.Home page
M. P. Oksvold, E. Skarpen, B. Lindeman, N. Roos, and H. S. Huitfeldt
Immunocytochemical Localization of Shc and Activated EGF Receptor in Early Endosomes After EGF Stimulation of HeLa Cells
J. Histochem. Cytochem., January 1, 2000; 48(1): 21 - 34.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. Hashimoto, M. Kurosaki, N. Gotoh, M. Shibuya, and T. Kurosaki
Shc Regulates Epidermal Growth Factor-induced Activation of the JNK Signaling Pathway
J. Biol. Chem., July 16, 1999; 274(29): 20139 - 20143.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. J. Palmer, C. T. Tuzon, and K. E. Paulson
Age-dependent Decline in Mitogenic Stimulation of Hepatocytes. REDUCED ASSOCIATION BETWEEN Shc AND THE EPIDERMAL GROWTH FACTOR RECEPTOR IS COUPLED TO DECREASED ACTIVATION OF Raf AND EXTRACELLULAR SIGNAL-REGULATED KINASES
J. Biol. Chem., April 16, 1999; 274(16): 11424 - 11430.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. M. Hermanns, S. Radtke, F. Schaper, P. C. Heinrich, and I. Behrmann
Non-redundant Signal Transduction of Interleukin-6-type Cytokines. THE ADAPTER PROTEIN Shc IS SPECIFICALLY RECRUITED TO THE ONCOSTATIN M RECEPTOR
J. Biol. Chem., December 22, 2000; 275(52): 40742 - 40748.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. N. Poy, R. J. Ruch, M. A. Fernstrom, Y. Okabayashi, and S. M. Najjar
Shc and CEACAM1 Interact to Regulate the Mitogenic Action of Insulin
J. Biol. Chem., January 4, 2002; 277(2): 1076 - 1084.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow