help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freiss, G.
Right arrow Articles by Vignon, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freiss, G.
Right arrow Articles by Vignon, F.
Molecular Endocrinology 12 (4): 568-579
Copyright © 1998 by The Endocrine Society

Extinction of Insulin-Like Growth Factor-I Mitogenic Signaling by Antiestrogen-Stimulated Fas-Associated Protein Tyrosine Phosphatase-1 in Human Breast Cancer Cells

Gilles Freiss, Carole Puech and Françoise Vignon

INSERM Unit 148 on Hormones and Cancer 34090 Montpellier, France


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Steroidal (ICI 182, 780) and nonsteroidal hydroxytamoxifen (OH-Tam) antiestrogens inhibit growth factor-mitogenic activity in MCF 7 estrogen receptor-positive human breast cancer cells. Cell inhibition is correlated with an increase in membrane protein tyrosine phosphatase (PTP) activity, and the addition of orthovanadate prevents OH-Tam inhibition. After RT-PCR cloning of PTPs expressed in MCF 7 cells with primers to their catalytic domains, we have shown, by differential screening, that the expression of two enzymes, leukocyte common antigen-related PTP (LAR) and Fas-associated PTP-1 (FAP-1), was modulated by antiestrogens. By comparative RT-PCR, in situ hybridization, and Northern blot, LAR and FAP-1 mRNAs accumulation was found to be dose- and time-dependently increased by antiestrogens. To further demonstrate that PTPs were key mediators of antiestrogen-inhibitory action on the growth factor pathway, a panel of stable FAP-1 transfectants expressing low to high levels of antisense mRNAs was established. In these clones, the level of antisense RNA expression was correlated with a reduction in basal levels and a complete inhibition of antiestrogen-stimulated values of PTP activity. When FAP-1 expression was abolished, OH-Tam was no longer able to block insulin-like growth factor I mitogenic activity even though it remained strongly antiestrogenic. However, ICI 182,780 was still inhibitory, indicating that its effect was not exclusively mediated by PTP. Our data first demonstrate that a specifically regulated phosphatase (FAP-1) is implicated in the triggering of negative proliferation signals in breast cancer cells.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
It has long been recognized that estradiol (E2) (1), epidermal growth factor (EGF) (2), and insulin-like growth factors (IGFs) (3, 4) are potent mitogens of human breast cancer cells. It was originally thought that the biological action of these ligands on the cell was triggered through two distinct signaling pathways, namely nuclear receptors and transmembrane tyrosine kinase-associated receptors. The demonstration that estrogens (as well as other nuclear receptor ligands) could regulate the expression of ligands or receptors of the polypeptide growth factor family also suggested that growth factors might act as autocrine (or paracrine) mediators of estrogen-induced mitogenesis although there is still no direct experimental evidence demonstrating the existence of such a loop in these tumor cells (5, 6). There are several recently published examples of new intricate interactions between these two pathways, strongly favoring the concept of a cross-talk model. It has been demonstrated that growth factors and other molecules that can activate the Ras/mitogen-activated protein (MAP) kinase pathway could modulate estrogen receptor (ER) transcriptional activation by phosphorylation (7, 8) and that EGF could mimic the uterotrophic effect of estrogen in rodents (9). We previously demonstrated that nuclear receptor ligands interfered with the growth factor signaling system by showing that steroidal (ICI 164, 384 or 182, 780) as well as nonsteroidal antiestrogens [hydroxytamoxifen (OH-Tam)] were able to inhibit IGF-I- or EGF-induced breast cancer cell proliferation (10, 11). Several lines of evidence suggest that the ER is a key element in these cross-talk phenomena. In the absence of ER [wild-type ER-negative or ER-knockout (ERKO) cells] (11, 12), antiestrogens no longer affect growth factor mitogenic responses. Conversely, ER overexpression amplifies estrogen-like responses of EGF in vitro (7, 8).

Nonsteroidal antiestrogens are potent growth inhibitors of hormone-responsive breast tumors and, based on their high tolerance, are therefore widely used in adjuvant therapy of these neoplasms (13). Moreover, because of their beneficial estrogenic properties on bone (14) and cardiovascular diseases (15), they have been proposed as a tumor prevention agent in high-risk patients despite the adverse tumorigenic effect on the endometrium. New steroidal antagonist molecules with tissue-selective agonist activity, expected to be less harmful to endometrium, are being designed by pharmaceutical companies and under preclinical or clinical trials (16). Both classes of molecules were shown to control tumor proliferation by acting as estrogen antagonists as well as growth factor inhibitors. While their classic antiestrogenic properties have been well documented, their interference in the growth factor-signaling pathway deserves further clarification. First, we and others have shown that although both of these negative actions initially require an interaction with the ER, they trigger several distinct downstream inhibition mechanisms. Antigrowth factor activity occurs, in vivo and in vitro, in the absence of active estrogens (9, 11) and is accompanied by a drastic reduction in the regulation of some growth factor-regulated responses (17, 18, 19). We had previously shown that this occurred concomitantly with an increase in membrane protein tyrosine phosphatase (PTP) activity (20) (G. Freiss, unpublished results).

PTPs are a diverse family of proteins whose presently cloned members have been classified either as transmembrane receptor-like or intracellular enzymes according to their structural features (21). All members possess at least one catalytic domain of ~250 amino acid residues that presents the distinctive signature motif (I/V)HCXAGXXR(S/T)G containing the catalytic Cys and Arg residues. The diversity within the PTP family arises from the nature of the noncatalytic sequences, which are thought to confer unique functions and properties to these enzymes by targeting them to specific cellular locations and substrates. Whereas the presence of specific domains on intracellular enzymes indicated that they might be targeted to the nucleus, phosphotyrosine-containing proteins, or cytoskeletal proteins (22), extracellular domains of receptor-type molecules appear to be able to serve a ligand-binding function in heterophilic or homophilic interactions (23). It has been shown that PTPs could interfere in the numerous cellular events in which protein phosphorylation is important, including regulation of gene expression (24), cell proliferation (25, 26), cell transformation (27), or cell differentiation (28, 29, 30) processes. Although a precise physiological role has been attributed to a few members (31, 32), in most instances the identity of the enzymes and the way by which they play a role in cellular signaling events remain obscure. It was demonstrated that the PTPs can also act in cooperation with protein tyrosine kinases (PTKs) to promote tyrosine phosphorylation-dependent signaling events (33) and thus should not be considered exclusively as the negative counterparts of PTKs.

In human breast cancer cells treated with steroidal and nonsteroidal antiestrogens, there was a direct correlation between the negative regulation of growth and the increase in PTP activity in terms of time- and dose-responses as well as ligand specificity (20). Moreover, addition of a specific PTP inhibitor in intact cells prevented OH-Tam growth inhibition, thus strongly suggesting that PTPs are key intermediates of its antiproliferative effect on the growth factor-signaling pathway. Although our preliminary data indicated that increased PTP activity was most probably due to regulation of some specific enzymes, we did not identify which enzymes are implicated, whether they are transcriptionally regulated by antiestrogens, and how they affect growth factor action.

In the present study, we investigated some aspects of these key issues by cloning the PTPs that are expressed in MCF7 cells and demonstrating that the expression of a transmembrane-type enzyme (LAR) and a membrane-associated enzyme (FAP-1) is regulated by steroidal and nonsteroidal antiestrogens. We developed stable FAP-1 antisense RNA-expressing transfectants to confirm that this enzyme is a key actor of OH-Tam antiproliferative action.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Search for Antiestrogen-Regulated Protein Tyrosine Phosphatases
We had previously shown that inhibition of growth factor action in breast cancer cells is correlated with an increase in membrane PTP activity (20). This increase could either reflect a general effect on preexisting enzymes or represent a true augmentation in the expression of some PTPs. Control experiments, with mixed solubilized membranes from control and OH-Tam-treated cells, demonstrated that the PTP activity of the mix was equal to mean activities of the separate fractions, which was in agreement with an induction of PTPs rather than a modulation in enzyme activity. Moreover, analysis by HPLC gel filtration of OH-Tam-treated cell membranes again pointed to the fact that the 70% overall increase in enzyme activity after antiestrogen treatment could be mostly explained by the exposure of a few protein peaks in a broad >100-kDa region (20).

To experimentally support the hypothesis of antiestrogen regulation of PTPs, we thus attempted to clone and sequence PTPs expressed in human breast cancer cells after OH-Tam treatment. By RT-PCR, using two degenerated oligonucleotides corresponding to the consensus region (sequence HCSAGVG)(antisense 3'-primer) (34) and a conserved domain (sequence KCDQYWP)(sense 5'-primer), which are both present in all PTP catalytic domains, we amplified a portion of {approx}280 bp of this domain from PTPs expressed in MCF7-treated cells. The amplified products were then cloned in a pGEMT plasmid and used to transform bacteria for primary differential screening with labeled cDNAs from control or OH-Tam-treated cells. Three clones, termed C3, B4, and B11, were scored as differentially regulated by antiestrogens in primary screening. However, secondary screenings of PTP expression demonstrated that only C3 and B11 clones were differentially regulated while B4 remained unchanged and served as a negative control in further studies (Fig. 2BGo). Sense and antisense sequencing of cDNA fragments of the selected clones showed that they all contained a third region (sequence: WPDXGVP), which is highly conserved in PTP catalytic domains. Among the nonregulated clones, we obtained redundant clones of transmembrane-type enzymes, i.e. PTP{alpha} and PTP{varsigma}, and clone B4 whose sequence has just been described as the transmembrane pancreatic carcinoma phosphatase (PCP-2) (35). Among the differentially expressed clones, clone C3 was identified as the transmembrane leukocyte antigen-related phosphatase (LAR) (36). Clone B11 was found to be identical to the cytoplasmic enzyme that is known under several denominations (FAP-1, PTP-BAS or hBAS, PTPL1 and PTP1E) as it was simultaneously cloned by four separate groups in different cells (37, 38, 39, 40). In agreement with our previous data indicating that cell growth inhibition was associated with an increase in membrane PTP activity, it finally turned out that among the two clones selected one corresponded to a transmembrane-type enzyme, whereas the second one was homologous to a membrane-associated molecule. Interestingly, the molecular weights of the selected enzymes were all within the range of those of protein peaks that were up-shifted after antiestrogen treatment in HPLC gel filtration analysis (20). After detecting potentially regulated clones, we directly evaluated their regulation by different techniques.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 2. Study of LAR, FAP-1, and PCP-2 mRNA Regulation by RT/PCR

MCF-7 cells grown in steroid-stripped medium were treated with ICI 182,780 (50 nM) (A) or OH-Tam (50 nM) (B) or with ethanol (control) (A and B) for 1–3 days, and total RNA was extracted. Total RNA (1.5 µg) was submitted to reverse transcription and 5 µl aliquots of 1:30 diluted reverse transcription mixture were amplified by PCR, as described in Materials and Methods, using each set of primers corresponding to LAR, FAP-1, PCP-2, or constant GAPDH mRNA. A, A representative experiment with LAR, FAP-1, and GAPDH primers. Upper panel, Autoradiogram of amplified products separated on a 6% polyacrylamide gel after increasing number of cycles as follows. a and e: 18 cycles for GAPDH, 22 cycles for LAR, 24 cycles for FAP-1; b and f: 20 cycles for GAPDH, 24 cycles for LAR, 26 cycles for FAP-1; c and g: 22 cycles for GAPDH, 26 cycles for LAR, 28 cycles for FAP-1; d and h: 24 cycles for GAPDH, 28 cycles for LAR, and 30 cycles for FAP-1. Lower panel, Quantification of the relative amounts of each product (LAR, {diamondsuit}; FAP-1, {blacksquare}; GAPDH, •) with Fujix-Bas 1000. Solid lines correspond to results obtained with RNA from 3-day ICI-treated cells (ICI), whereas dotted lines correspond to results obtained with RNA from control cells (Cont.). B, Time-course of LAR, FAP-1, and PCP-2 mRNA regulation by OH-Tam. Results for LAR (hatched bars), FAP-1 (open bars), and PCP-2 (black bars) represent means of three independent experiments. The results are expressed as a percentage of the basal mRNA level measured in control cells (0). Error bars represent 1 SD.

 
Antiestrogens Increase PTP mRNA Accumulation
We started our study with LAR, for which all probes were readily available, to investigate antiestrogen regulation of this enzyme by the following three approaches: in situ hybridization (Fig. 1Go, A and B), Northern blots (Fig. 1CGo), and comparative RT-PCR (Fig. 2Go). In Fig. 1AGo, a representative hybridization experiment revealed a drastic increase in LAR mRNA expression after antiestrogen treatment. As indicated in Fig. 1BGo, a 5-fold increase in hybridization was reproducibly obtained after 3 day-treatment with 50 nM OH-Tam, whereas estradiol (E2) was inefficient (similar timing and concentration) and background (sense) was minimal. Similarly, a 2.5-fold increase in ~8-kb LAR RNA accumulation was shown by Northern blot using 36B4 nonregulated RNA expression as a constant probe (Fig. 1CGo). Finally, comparative RT-PCR analysis of the variations in the expression of LAR mRNA [using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a constant probe] demonstrated a 3-fold stimulation over control after 2–3 days of treatment with ICI 182,780 (Fig. 2AGo, a representative experiment) or OH-Tam (Fig. 2BGo, hatched bars).



View larger version (60K):
[in this window]
[in a new window]
 
Figure 1. Evidence of LAR mRNA Regulation by in Situ Hybridization and Northern Blot

A–B, In situ hybridization: Steroid-withdrawn MCF7 cells, treated for 1–4 days with E2 (50–100 nM) or OH-Tam (50 nM) or maintained in control medium, were pelleted and frozen in liquid nitrogen. Sections (5-µm) of frozen pellets were mounted on microscope slides and fixed in 4% paraformaldehyde. In situ RNA hybridization was performed at 42 C in a 50% formamide mix for 15 h with [35S]{alpha}UTP-labeled sense and antisense LAR probes. After treatment by A and T RNAses and extensive washes, sections were dehydrated and exposed to Ilford K5 autoradiography emulsion for 3 weeks. Hybridization signal was evaluated by counting silver grains (IMSTAR Image Analyzer; Starwise Grains Software, IMSTAR, Paris, France) in nine areas. A, Representative areas of control and antiestrogen-treated cell sections. B, The curves represent the mean of three independent experiments. Error bars represent 1 SD. C, Northern blot. MCF7 cells grown in steroid-stripped medium, as described in Materials and Methods, were incubated with 50 nM OH-Tam or ethanol (control cells) for 1–3 days, and total RNA was extracted. Forty micrograms of RNA were analyzed on a 1% agarose denaturing gel. After transfer onto a nylon membrane, LAR and constant 36B4 mRNA were hybridized with 32P-labeled cDNA probes. Upper panel shows a representative autoradiogram of total RNA after hybridization. Lower panel shows the relative amounts of LAR mRNA quantified with a Fujix-Bas 1000. The results are expressed as a percentage of the basal mRNA level measured in control cells.

 
The overall levels of FAP-1 and PCP-2 expression were shown to be much lower than that of LAR by RT-PCR and almost undetectable by Northern blot and in situ hybridization (data not shown). Since control experiments run on the same preparations of RNAs, by RT-PCR or Northern blot, demonstrated that the two techniques gave identical results for LAR (data not shown), we thus favored the RT-PCR technique for an extensive study on PTP regulation by steroidal and nonsteroidal antiestrogens. To validate our RT-PCR quantification technique, we have performed several control experiments which showed: 1) that the signal detected on a gel is proportional to the concentration of RNA added; 2) the degree of stimulation is identical within the same experiment or in replicate experiments with the same sets of RNA; 3) the stimulation observed is significantly reproduced between experiments with different sets of RNA. While PCP-2 mRNA expression was not regulated by OH-Tam (Fig. 2BGo, black bars) or ICI 182, 780 (not shown), LAR and FAP-1 mRNA expression were time- (Fig. 2Go) and dose-dependently (Fig. 3Go) increased by both types of antiestrogens. The onset and degree of mRNA stimulation were similar for both enzymes and both ligands and consistent with our previous data on regulation of total enzyme activity (20). mRNA stimulation was detectable after 24 h and optimal at 2–3 days, which indicates that if transcriptional regulation occurs it is probably not a direct primary response mediated by an estrogen-responsive element.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 3. Dose-Dependent Stimulation of LAR and FAP-1 mRNA Accumulation

MCF7 cells, maintained in steroid-stripped medium, were then incubated with increasing concentrations of ICI182,780 (A) or OH-Tam (B) or with ethanol (control cells) for 3 days, and total RNA was extracted. RT-PCR was performed as in Fig. 2Go using each set of primers corresponding to LAR (hatched bars), FAP-1 (open bars), or constant GAPDH mRNA. The results for ICI 182,780 and OH-Tam, respectively, represent means of two and three independent experiments. The results are expressed as a percentage of the basal mRNA level measured in control cells (0). Error bars represent 1 SD (three experiments) or the range of obtained values (two experiments).

 
In addition, Fig. 4AGo demonstrates that only ligands of ER that inhibited growth factor mitogenic action (11) increased LAR and FAP-1 mRNA, whereas both synthetic progestin R5020 and antiprogestin RU486 were inefficient. Accordingly, these two progesterone receptor (PR) ligands were previously shown to display an antiestrogenic activity, but they did not block EGF or IGF-I mitogenic activity. Estradiol in itself was inactive (Fig. 4Go) but it totally abolished OH-Tam and ICI 182,780-stimulated-increase on both LAR and FAP-1 PTPs (Fig. 4BGo). The relation between the efficiency of the compounds (ICI 182,780, OH-Tam, cis-Tam) and their ER affinities, associated with the strong competitive effect of E2, confirmed that regulation of PTPs by antiestrogens required binding to ER.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 4. Specificity and Reversibility of PTP mRNA Accumulation

A, Ligand specificity of PTP mRNA accumulation. MCF7 cells, maintained in steroid-stripped medium, were incubated with increasing concentrations (1 nM to 1 µM) of estradiol (E2), 50 nM ICI 182,780 (ICI), 50 nM R5020, 50 nM RU486, 1 µM cisTam, or ethanol (control cells) for 3 days. B, Reversibility by estradiol of the antiestrogen stimulation of PTP mRNA accumulation. MCF7 cells were grown in steroid-stripped medium and then stimulated for 3 days with 50 nM OH-Tam, 50 nM ICI 182,780, 1 µM E2, OH-Tam (50 nM), and E2 (1 µM), ICI 182,780 (50 nM), and E2 (1 µM) or ethanol for control cells. Total RNA (1.5 µg) was submitted to reverse transcription, and 5 µl aliquots were amplified after dilution as in Fig. 2Go (LAR, hatched bars), FAP-1, open bars). The results represent means of the indicated numbers of independent experiments. The results are expressed as a percentage of the basal mRNA level measured in control cells. Error bars represent 1 SD (three or more experiments) or the range of obtained values (two experiments).

 
Our data altogether indicate that the increase in PTP activity was due to antiestrogen regulation of some specific PTPs, including LAR and FAP-1. Although our approach did not exclude that other enzymes might be similarly regulated, this is obviously not a general phenomenon, since neither PCP-2 nor PTP{alpha} and PTP{varsigma} are modulated.

Treatment of ER+ MCF7 cells with micromolar concentrations of orthovanadate, a specific inhibitor, prevented OH-Tam-induced growth factor inhibition, implying that PTPs play a crucial role in this event (20). To evaluate whether LAR and/or FAP-1 are the important enzymes in triggering negative proliferation signals, we decided to develop antisense RNA-expressing transfectants.

Growth Regulation of Anti-PTP Transfectants by Antiestrogens
We had initially planned to establish antisense transfectants of the two regulated PTPs. However, our attempts remained unsuccessful for LAR (three different transfections), suggesting that extinction of this enzyme might markedly limit the outgrowth of breast cancer cells, although neutralization of LAR expression was achieved and shown to augment insulin receptor signaling in rat hepatoma cells (41). In contrast, when using the same vector in identical experimental conditions, a panel of FAP-1 antisense transfectants was obtained in the first attempt. To evaluate the consequences of this transfection on cell growth activity, positive clones were subdivided into three categories according to the level of antisense RNA expression depicted in Fig. 5Go: high expresser (100%; clone 3), medium expresser (60% of maximal level; clone 10) and a set of low expressers (rating from 5–20% maximum; clones 2, 4, 5, and 7). For all further experiments, these clones were compared with a pool of mock-transfectants and to wild-type MCF7 cells.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. FAP-1 Antisense RNA Expression

MCF7 cells and derived clones were grown in FCS-supplemented medium, and total RNA was extracted. Forty micrograms of RNA were analyzed on a 1% agarose denaturing gel. After transfer onto a nylon membrane, FAP-1 antisense (FAP-1 AS) and constant 36B4 mRNA were hybridized with 32P-labeled cDNA probes. Lower panel shows representative autoradiograms of total RNA after hybridization. Upper panel shows the relative amounts of FAP-1 antisense RNA quantified with a Fujix-Bas 1000. The results represent means of two experiments for clone 10, of one experiment with each of the low expressing clones (2, 4, 5, 7), and of one experiment with five independent clones for the mock-transfected MCF7 cells. The results are expressed as a percentage of the maximal mRNA level measured in clone 3. Error bars represent 1 SD or the range of obtained values (less than three determinations).

 
To estimate the extinction of FAP-1 expression at the protein level, we attempted to immunoprecipitate this enzyme in wild-type and transfectant MCF7 cells with available antibodies (commercial and noncommercial sources). The low level of expression of FAP-1 in these cells did not allow us to reproducibly quantitate the amount of enzyme. We have therefore indirectly evaluated the level of FAP-1 expression by measuring how PTP enzymatic activity is affected in these clones. We have verified that total cytoplasmic PTP activity, as well as expression of PTP-1B (Western blot) or LAR (immunoprecipitation), is not modified in FAP-1 antisense transfectants (results not shown). By contrast, in Table 1Go, we showed that the levels of antisense RNA expression were correlated with a reduction in basal membrane-associated PTP activity and a complete inhibition of the antiestrogen-stimulated activity in clones 3 and 10 (high and medium expressers). As expected in this test, the partial reduction (30%) in basal value indicated that other PTPs contributed to total enzymatic activity. However, the complete extinction of the antagonist-stimulated fraction demonstrated that FAP-1 antisense transfection specifically and functionally abolished the enzyme expression. Cell growth stimulation by IGF-I and E2 was independent of the level of expressed FAP-1 antisense RNA (hatched bars/crossed bars) and not significantly different from what was observed in mock-transfectants (open bars) and wild-type cells (black bars) (Fig. 6AGo). However, although OH-Tam prevented E2 stimulation in all clones, it was inefficient in blocking the IGF-I effect in FAP-1 antisense transfectants (Fig. 6Go). Moreover, as shown in Fig. 6BGo and Table 1Go, the ability of FAP-1 antisense clones to resist OH-Tam-inhibitory action was directly related to the degrees of antisense expression and depletion of PTP activity. Competition experiments with increasing concentrations of OH-Tam in antisense clones and wild-type cells indicated that the ER affinity for the drug was equivalent in all clones and could not explain their differential response (Fig. 7Go). Moreover, enzyme immunoassay of ER and PR demonstrated that the concentration of both receptors (ER {cong} 52 fmol/mg protein, PR {cong} 441 fmol/mg protein) were equivalent in wt-MCF7 cells and FAP-1 antisense clones.


View this table:
[in this window]
[in a new window]
 
Table 1. Regulation of PTP Activity in Stable FAP-1 Antisense Transfectants

 


View larger version (28K):
[in this window]
[in a new window]
 
Figure 6. Antiestrogenic and Antigrowth Factor Effect of OH-Tam on Wild-Type MCF7 and FAP-1 Antisense Clones

Cells grown in steroid-stripped medium were treated by the indicated combinations of 1 nM estradiol, 50 nM OH-Tam, 5 nM IGF-I, or ethanol (control dishes) for 7 days in 1% FCS/DCC medium. Cell growth was evaluated by total DNA measurements as described in Materials and Methods. A, A representative growth experiment. The results are expressed as a percentage of the basal DNA level measured in control wells (dotted line). They represent the means of three replicate wells. Error bars represent 1 SD. B, The results are expressed as a percentage of the DNA level obtained with IGF-I (hatched bars) or estradiol (black bars) alone. The results represent means of two, three, and four experiments for wild type MCF7, clone 3, and clone 10, respectively; and the mean of values obtained with four and seven independent clones for low expressing clones 2, 4, 5, and 7 and mock transfected clones, respectively. Error bars represent 1 SD.

 


View larger version (43K):
[in this window]
[in a new window]
 
Figure 7. Antiestrogenic Effect of OH-Tam on Wild-Type MCF7 and FAP-1 Antisense Clones

Steroid-stripped cells were treated by combinations of 1 nM estradiol and 1–50 nM OH-Tam for 7 days in 1% FCS/DCC medium. Cell growth was evaluated as in Fig. 6Go. The results represent means of triplicate wells for clone 3, clone 10, and wild-type MCF7 cells or means of values obtained in three independent clones in the last series. The results are expressed as a percentage of the DNA level obtained with estradiol alone. Error bars represent 1 SD.

 
These data clearly confirmed that OH-Tam antigrowth factor activity is triggered by PTP and that FAP-1 is required to mediate these negative signals. Moreover, the results shown in Fig. 6AGo provide new evidence that the antiestrogenic and antigrowth factor activities are two distinct phenomena. Interestingly, when steroidal antiestrogen, ICI 182,780, was used instead of the nonsteroidal molecule OH-Tam, no resistance appeared in FAP-1 antisense transfectants (Fig. 8Go) although basal PTP activity was reduced and not increased by treatment with this pure antagonist (Table 1Go). These latter results are in agreement with other observations suggesting that these two ligands do not similarly activate ER in responsive cells.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 8. Antigrowth Factor Effect of ICI 182,780 on Wild-Type MCF7 Cells and FAP-1 Antisense Clones

Steroid-withdrawn cells were treated by the indicated combinations of 50 nM ICI 182,780, 5 nM IGF-I, or ethanol (control dishes) for 7 days in 1% FCS/DCC medium. Cell growth was evaluated as described in Fig. 6Go. The results represent means of two experiments for clone 3 and means of values obtained with four and six independent clones for low-expressing clones 2, 4, 5, and 7 and mock-transfected clones, respectively. The final results are expressed as a percentage of the basal DNA level measured in control wells (dotted line). Error bars represent 1 SD or the range of obtained values (less than three experiments).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have previously reported that inhibition of EGF or IGF-I mitogenic activities in MCF7 cells by OH-Tam and ICI 164,384 was associated with an increase in membrane protein tyrosine phosphatase (PTP) activity. The fact that the negative action of OH-Tam on growth factors could be wiped out by orthovanadate suggested that the modulation of PTP activity was a mandatory step. In the present paper, we have now identified two enzymes, i.e. LAR and FAP-1, whose expression is increased by steroid antagonists that inhibit growth factor response. Moreover, our proposal for a key regulatory role of PTPs was confirmed by the evidence of a selective abolition of OH-Tam inhibitory action on the growth factor pathway in MCF-7 stable transfectants in which FAP-1 was neutralized by antisense RNA expression.

In human breast cancer cells, we demonstrated that steroidal (ICI 182,780) or nonsteroidal (OH-Tam) antiestrogens generated a 3-fold increase in mRNA accumulation of two distinct enzymes: a transmembrane receptor-type PTP (LAR) and a cytoskeleton-associated PTP (FAP-1). In accordance with our findings, detection of LAR and FAP-1 (also named hBAS) in breast tissue or breast tumors has already been documented, but we are the first to report on regulation of these PTPs by nuclear receptor ligands and to demonstrate that their enhanced expression plays a key role in growth inhibition of breast cancer. In a general survey of LAR tissue distribution, using immunostaining, Streuli et al. (42) mentioned that myo-epithelial cells of breast ducts and acini presented a positive staining. More recently, the same group identified a strong fluorescent staining of LAR on the plasma membrane and on the edges of MCF7 cells (43). Keane et al. (30) demonstrated by RT-PCR that LAR and FAP-1 were among the 31 PTPs expressed in another human breast cancer cell line (ZR75–1). Recent reports indicated that hormone-, growth factors-, 12-O-tetradecanoyl-phorbol-13-acetate-, or dimethylsulfoxide-regulated PTPs are associated with differentiation of bone cells, testicular tissue (44), a rat pheochromocytoma cell line (28), and leukemia cells (45). In most instances, PTP regulation was observed within minutes or at most a few hours; it was sometimes a transient effect and principally triggered by ligands of transmembrane receptors or membrane-associated coupling transduction systems. Although we believe that nuclear receptors are implicated in PTP regulation in breast cancer cells (our present data), the time lag required to display a significant increase in mRNA accumulation (2 days) is not in favor of a primary direct transcriptional effect on an estrogen-responsive element-driven gene. It could also be a nontranscriptional event, a delayed transcriptional secondary response of nuclear receptor ligands, or an indirect transcriptional regulation of a broad spectrum of genes utilizing a unique class of promoters, since both PTPs have the same regulation scheme. Unfortunately, the promoters of these two genes are not yet accessible. However, in the same line, it was recently shown that OH-Tam and ICI 182,780, which could stimulate the activity of a detoxifying enzyme (quinone reductase) after 3–4 days of treatment, do so by ER-dependently activating a gene that is under control of an electrophile/antioxidant response element (EpRE-ARE) (46).

The second interesting aspect of our study was the striking difference in the effect of steroidal and nonsteroidal antiestrogens that we observed in FAP-1 antisense transfectants. On one hand, the mixed agonist/antagonist OH-Tam no longer affected growth factor action in these cells, which demonstrates that FAP-1 regulation is mandatory for its inhibitory action on IGF-I, thus confirming that PTPs play a major role in the control of breast cancer growth. On the other hand, steroidal pure antagonists (ICI 182, 780) still inhibit growth factor-induced proliferation, suggesting that they exert their negative action through additional distinct mechanisms. Accordingly, two series of published data suggested that ICI 182,780 could inhibit growth factor action through an ER-dependent mechanism on which OH-Tam was inoperative. First, two groups have shown that the ability of growth factors and other molecules to modulate ER transcriptional activity by phosphorylation via the Ras/MAP kinase pathway was prevented by ICI 182,780, whereas OH-Tam synergized with these factors (7, 8). Second, Curtis et al. (12) have shown that in ERKO uterus, lacking functional ER, EGF had no mitogenic activity. When combined, these data suggest that ER transactivation by the Ras/MAP kinase pathway is a necessary step for the effect of EGF (and possibly other growth factors) on growth in hormone-responsive tissues. Our present data in FAP-1 antisense transfectants demonstrate that there are at least two ER-dependent pathways triggered by OH-Tam and steroidal antagonists that are implied in the control of growth factor inhibition. While PTP regulation (FAP-1) is crucial to the negative effect of OH-Tam, ICI 182,780 can bypass this step in breast cancer cells and continue to exert its main blockade presumably on ER transactivation. Moreover, it is conceivable that either PTP expression or regulation might have been lost in some OH-Tam-resistant cells that remain sensitive to ICI 182,780. If this defect were confirmed in resistant tumor cells or tissues, then restoration of PTP expression could be envisaged to circumvent acquired Tam resistance.

The next questions to address now concern the mechanisms by which FAP-1 regulation interferes with IGF-I mitogenic action. FAP-1 was shown to associate with Fas, a cell surface receptor that is capable of triggering apoptosis when bound to anti-Fas cytotoxic monoclonal antibodies or to its specific Fas ligand, which belongs to the tumor necrosis factor family (47). However, Fas, which is widely expressed in nontransformed mammary epithelial cells, is detectable in only one of seven tested breast cancer cell lines (T47D) (48). MCF7 cells do not express Fas and are the only breast cancer cells that remain resistant to Fas-induced apoptosis after IFN{gamma} treatment (48). The mechanism of FAP-1-induced growth inhibition of MCF7 breast cancer cells is therefore unlikely to involve its particular capability of interaction with Fas.

To identify which step in the IGF-I mitogenic signaling pathway is blocked by FAP-1 in breast cancer, we are currently comparing the regulation of IGF-I receptor autophosphorylation and of its initial tyrosine-phosphorylated substrates, e.g. insulin receptor substrate-1 (IRS-1) and phosphatidylinositol 3-kinase (PI 3-kinase), in wild-type MCF 7 cells and their resistant counterparts in which PTP regulation is abolished. Our present data suggest that the IRS-1, PI 3-kinase pathway is a target for FAP-1 phosphatase (G. Freiss, C. Puech, and F. Vignon, in preparation) in accordance with recent data which indicated that this pathway is inhibited by Tam in IGF-I receptor or IRS-1 overexpressing cells (49).

We have presently highlighted a new mode of action of steroid antagonists on the growth factor pathway. Moreover, we have identified an ER-regulated PTP that is responsible in intact cells for the extinction of the IGF-I mitogenic signaling. Further studies aimed at disclosing FAP-1 promoter and understanding how this enzyme is regulated in hormone-independent tissues will be helpful to evaluate the therapeutic future of PTPs in the control of tumor proliferation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture
MCF7 human breast cancer cells were obtained from the Michigan Cancer Foundation (Detroit, MI). MCF7 and derived clones were maintained in Ham’s F-12/DMEM (1:1) supplemented with 10% FCS (GIBCO BRL, Cergy Pontoise, France). Before all hormonal treatments the cells were stripped of endogenous steroids by successive passages in medium without phenol red containing 10% (2 days) and then 3% (5 days) charcoal-stripped FCS [FCS/dextran-coated charcoal (DCC)]. They were finally treated in the presence of 1% FCS/DCC. Control cells were grown in the same conditions (1% FCS/DCC) and complemented with vehicle alone (ethanol).

Isolation of Clones of Antiestrogen-Regulated PTPs in MCF 7 Cells
A set of degenerated oligonucleotide primers to conserved regions within the catalytic PTP domain was designed. These primers were used in RT-PCR to amplify PTP sequences from breast cancer cells. The 5'-primer corresponding to the conserved amino acids KCDQYWP [5' A A (G/A) T G T (G/C) (C/A/T) (A/T/G/C) (G/C) (A/C) (A/G/T) T A (C/T) T G G C C 3';1052-fold degeneracy] was paired with the 3'-primer corresponding to the active site, HCSAGVG [5' C C (A/T/G/C) A (T/C) (A/T/G/C) C C (A/T/G/C) G C (A/G) C T G C A G T G 3'; 256-fold degeneracy]. The PCR reaction template was the cDNA synthesized using RNA isolated from MCF 7 cells treated for 5 days with 50 nM OH-Tam and the 3'-primer. The cDNA synthesis reaction was performed with the M-MLV reverse transcriptase (GIBCO BRL) according to manufacturer’s recommended instructions. The PCR reaction included 0.5 volume of the original cDNA synthesis reaction, 200 nM of each primer, and 200 µM of each deoxynucleoside triphosphate, along with the recommended reagent concentration in the Taq DNA polymerase kit from Appligene (Illkirch, France). The PCR conditions were: 95 C, 30 sec; 48 C, 30 sec; 70 C, 1 min; for 30 cycles. Products of the expected size (~280 bp) were isolated by gel electrophoresis and cloned into the pGEMT vector (Promega, Charbonnières, France). Ninety independent clones were screened by differential hybridization with cDNA from control vs. antiestrogen-treated MCF 7 cells (50 nM OH-Tam, 3 days). Labeled cDNA probes were synthesized with the Moloney murine leukemia virus-RT (GIBCO BRL) with the 3'-primer in the presence of 5 µCi [{alpha}32P]dCTP (Amersham Life Science, 3000 Ci/mmol). Hybridization in 50% formamide and the wash conditions were performed as described (19). All clones hybridizing with at least one probe were sequenced by the dideoxynucleotide method (kit Sequenase version 2.0, Amersham Life Science, Les Ulis, France).

In Situ Hybridization
In situ hybridization, sections of frozen cells, and quantification were performed as previously described (50). All sense and antisense probes that corresponded to the PCR fragment cloned in pGEMT vector were synthesized by in vitro RNA transcription with the SP6/T7 kit system (Amersham Life Science).

Comparative RT-PCR
First-Strand cDNA Synthesis
Reactions were carried out using 1.5 µg total RNA and 0.6 µg oligo(dT)15 (Boehringer-Mannheim, Meylan, France) with the Moloney murine leukemia virus-RT (GIBCO BRL). To avoid Taq polymerase inhibition, the RT product was diluted 30-fold with sterile water. For each RNA, cDNA synthesis was duplicated in the same conditions but without RT to control genomic DNA contamination.

Oligonucleotide Primers
Primers used to amplify examined mRNAs were as follows:

constant GAPDH mRNA: TCCATGACAACTTTGGTAT-CGTGG, GTCGCTGTTGAAGTCAGAGGAGAC;

LAR PTP mRNA: TCGGGAGATGGGCAGGGAGAAATG, CGGAGGAGAGGGGAGCGGTAGTTA;

FAP-1 PTP mRNA: AGGCAAAACAACAATGGTCAGCAA, GGTCTGGCCAGGCAGTGAAATTCA;

PCP-2 PTP mRNA: GGAGGACTCAGACACCTACGGGGA, ATCAGGTGGGGTGGAGGCCTTCAC.

The sizes of the amplified products were 377 bp for GAPDH, 523 bp for LAR, 155 bp for FAP-1, and 223 bp for PCP-2.

PCR
PCR was carried out in a final volume of 25 µl containing 0.5 U Taq polymerase (Appligene, Illkirch, France), 200 µM deoxynucleoside triphosphates, 0.2 µM of the 5'- and 3'-primers from one set of primer, 1x final Taq buffer (Appligene), 5 µl of 1:30 diluted reverse transcription mixture and [{alpha}32P]dCTP (0.5 µCi) as tracer. The samples were denatured initially at 94 C for 2 min, and amplification was performed on a DNA thermal cycler (Trio Thermoblock, Biometra; Kontron Instruments, Paris, France) for 18–30 cycles including the following steps: denaturation at 94 C for 45 sec, annealing at 58 C for 45 sec, and extension at 72 C for 75 sec. The number of cycles was 18–20-22–24 for GAPDH, 22–24-26–28 for LAR, 24–26-28–30 for FAP-1, and 30–32-34–36 for PCP-2. After the indicated number of cycles, 4 µl of each PCR sample were analyzed on a 6% polyacrylamide minigel by electrophoresis. Radioactivity incorporated in each band was quantified by counting with Fujix-Bas 1000 and plotted on a semilogarithmic scale to verify exponential amplification. To correct variations in the reverse transcription reaction efficiency, the signal obtained for each PTP mRNA was divided by the signal obtained on the same cDNA with the internal GAPDH control (constant mRNA). The final results are expressed as a percentage of the basal mRNA levels measured in control cells.

Plasmids and Transfections
The partial FAP-1 cDNA fragment 29–677 was obtained by RT/PCR and cloned in the pGEMT vector. The FAP-I antisense (FAP-1 AS) vector was generated by antisense insertion of the pGEMT-FAP-1 fragment SalI/SacII (blunt ended with T4 polymerase) in SalI/SmaI cut pCI (Promega). pCI is a cytomegalovirus major immediate-early gene enhancer/promoter-driven expression vector. Stable transfectants of MCF7 cells were derived by cotransfection of pSV2neo and FAP-1AS using the calcium phosphate precipitation method (19), whereas mock transfectants were cotransfected with pSV2neo and empty pCI vectors. After selection with geneticin (200 µg/ml) for 21 days, colonies were picked and established as stable cell lines.

Northern Blot
Total RNA was extracted with TRIzol reagent (GIBCO BRL), and 40 µg of RNA were analyzed by Northern blot as described (19). 36B4 full cDNA, LAR full cDNA (34), FAP-1 antisense fragment 29–677 (subcloned in pGEMT), and FAP-1 fragments 5018–6687 and 6257–7198 (subcloned in pGEMT by RT/PCR) were 32P-labeled by multiprime DNA synthesis using an Amersham kit. Hybridization in 50% formamide and the wash conditions were performed as described (19). Filters were exposed to photo-stimulable plates, scanned, and quantified with a Fujix-Bas 1000 scanner (RAYTEST, Courbevoie, France). The results are expressed as a percentage of the basal mRNA levels measured in control cells.

Cell Growth
Cells stripped of endogenous steroids were plated in triplicate in 24-well dishes at a density of 20,000 cells per well in medium containing 3% FCS/DCC. Two days later, the cells were treated with various combinations of hormones, antihormones, and IGF-I for 7 days. Growth was evaluated by total DNA measurement on three replicate wells by the diaminobenzoic acid fluorimetric assay (LS-5 spectrometer, 405 nm excitation, 495 nm emission; Perkin-Elmer Corp.) after in situ fixation with methanol (51). Results are expressed in micrograms of DNA by reference to a calf thymus DNA standard curve.

PTP Assay
Cells stripped of endogenous steroids were treated for 4 days with the indicated hormone, and solubilized membranes were prepared as previously described (20). PTP activity was measured as the release of [32P] orthophosphate from 32P-phosphorylated poly (Glu,Ala,Tyr) 6:3:1 as in Ref. 20. The reaction was usually allowed to proceed for 30 sec to 3 min, and two time-points along the linear portion of the curve were used for final quantification.


    ACKNOWLEDGMENTS
 
We thank A. Wakeling (Zeneca, Macclesfield, UK) and E. Salin-Drouin (Besins-Iscovesco, Paris, France) for ICI 182,780, ICI 164,384, and OH-Tam. We are grateful to M. Streuli and H. Saito for providing LAR cDNA probe and P. Chambon for 36B4 cDNA probe. We thank members of the laboratory for helpful comments and discussions on the manuscript.


    FOOTNOTES
 
Address requests for reprints to: Françoise Vignon, Hormones and Cancer, INSERM Unit 148–60, Rue de Navacelles, Montpellier, France 34090.

This work was supported by INSERM, the Association pour la Recherche sur le Cancer (Grant 1411), and the Ligue Nationale contre le Cancer (Grant 678).

Received for publication August 28, 1997. Revision received November 28, 1997. Accepted for publication January 3, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Lippman ME, Bolan G, Huff K 1976 The effect of estrogens and antiestrogens on hormone-responsive human breast cancer in long term tissue culture. Cancer Res 36:4595–4601[Abstract/Free Full Text]
  2. Osborne CK, Hamilton B, Titus G, Livingston RB 1980 Epidermal growth factor stimulation of human breast cancer cells in culture. Cancer Res 40:2361–2366[Abstract/Free Full Text]
  3. Furlanetto RW, DiCarlo JN 1984 Somatomedin-C receptors and growth effects in human breast cancer cells maintained in long-term tissue culture. Cancer Res 44:2122–2128[Abstract/Free Full Text]
  4. Karey KP, Sirbasku DA 1988 Differential responsiveness of human breast cancer cell line MCF7 and T47D to growth factors and 17ß- estradiol. Cancer Res 48:4083–4092[Abstract/Free Full Text]
  5. Dickson RB, Lippman ME 1995 Growth factors in breast cancer. Endocr Rev 16:559–589[Abstract/Free Full Text]
  6. Freiss G, Prébois C, Vignon F 1993 Control of breast cancer cell growth by steroids and growth factors: interactions and mechanisms. Breast Cancer Res Treat 27:57–68[CrossRef][Medline]
  7. Bunone G, Briand PA, Miksicek RJ, Picard D 1996 Activation of the unliganded estrogen receptor by EGF involves the MAP kinase pathway and direct phosphorylation. EMBO J 15:2174–2183[Medline]
  8. Kato S, Endoh H, Masuhiro Y, Kitamoto T, Uchiyama S, Saski H, Masushige S, Gotoh Y, Nishida E, Kawashima H, Metzger D, Chambon P 1995 Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science 270:1491–1494[Abstract/Free Full Text]
  9. Ignar-Trowbridge DM, Nelson KG, Bidwell MC, Curtis SW, Washburn TF, McLachlan JA, Korach KS 1992 Coupling of dual signaling pathways: EGF action involves the estrogen receptor. Proc Natl Acad Sci USA 89:4658–4662[Abstract/Free Full Text]
  10. Vignon F, Bouton MM, Rochefort H 1987 Antiestrogens inhibit the mitogenic effect of growth factors on breast cancer cells in the total absence of estrogens. Biochem Biophys Res Commun 146:1502–1508[CrossRef][Medline]
  11. Freiss G, Prébois C, Rochefort H, Vignon F 1990 Anti-steroidal and anti-growth factor activities of anti-estrogens. J Steroid Biochem Mol Biol 37:777–781[CrossRef][Medline]
  12. Curtis SW, Washburn TF, Sewall C, DiAugustine R, Lindzey J, Couse JF, Korach KS 1996 Physiological coupling of growth factor and steroid receptor signaling pathways: estrogen receptor knockout mice lack estrogen-like response to epidermal growth factor. Proc Natl Acad Sci USA 93:12626–12630[Abstract/Free Full Text]
  13. Jordan VC, Fritz NF, Tormey DC 1987 Endocrine effects of adjuvant chemotherapy and long-term tamoxifen administration on node-positive patients with breast cancer. Cancer Res 47:624–630[Abstract/Free Full Text]
  14. Love RR, Mazess RB, Barden HS, Epstein S, Newcomb PA, Jordan VC, Carbone PP, DeMets DL 1992 Effects of tamoxifen on bone mineral density in postmenopausal women with breast cancer. N Engl J Med 326:852–856[Abstract]
  15. Love RR, Wiebe DA, Feyzi JM, Newcomb PA, Chappell RJ 1994 Effects of tamoxifen on cardiovascular risk factors in post-menopausal women after 5 years of treatment. J Natl Cancer Inst 86:1534–1539[Abstract/Free Full Text]
  16. Black LJ, Sato M, Rowley ER, Magee DE, Bekele A, Williams DC, Cullinan GJ, Bendele R, Kaufman FR, Bensch WR, Frolik CA, Termine JD, Bryant HU 1994 Raloxifen (LY 139481) prevents bone loss and reduces serum cholesterol without causing uterine hypertrophy in ovariectomized rats. J Clin Invest 93:63–93
  17. Sumida C, Pasqualini JR 1989 Antiestrogens antagonize the stimulatory effect of epidermal growth factor on the induction of progesterone receptor in fetal uterine cells in culture. Endocrinology 124:591–597[Abstract/Free Full Text]
  18. Katzenellenbogen BS, Norman MJ 1990 Multihormonal regulation of the progesterone receptor in MCF7 human breast cancer cells: interrelationships among insulin, insulin-like growth factor-I, serum and estrogen. Endocrinology 126:891–898[Abstract/Free Full Text]
  19. Philips A, Chalbos D, Rochefort H 1993 Estradiol increases and anti-estrogens antagonize the growth factor-induced activator protein-1 activity in MCF7 cells breast cancer cells without affecting c-fos and c-jun synthesis. J Biol Chem 268:14103–14108[Abstract/Free Full Text]
  20. Freiss G, Vignon F 1994 Antiestrogens increase protein tyrosine phosphatase activity in human breast cancer cells. Mol Endocrinol 8:1389–1396[Abstract/Free Full Text]
  21. Krueger NX, Streuli M, Saito H 1990 Structural diversity and evolution of human receptor-like protein tyrosine phosphatases. EMBO J 9:3241–3252[Medline]
  22. Mauro LJ, Dixon JE 1994 ‘Zip codes’ direct intracellular protein tyrosine phosphatases to the correct cellular ‘address’. Trends Biochem Sci 19:151–155[CrossRef][Medline]
  23. Zondag GC, Koningstein GM, Jiang YP, Sap J, Moolenar WH, Gebbink MF 1995 Homophilic interactions mediated by receptor tyrosine phosphatases µ and kappa A critical role for the novel extracellular MAM domain. J Biol Chem 270:14247–14250[Abstract/Free Full Text]
  24. Champion-Arnaud P, Gesnel MC, Foulkes N, Ronsin C, Sassone-Corsi P, Breathnach R 1991 Activation of transcription via AP-1 or CREB regulatory sites is blocked by protein tyrosine phosphatases. Oncogene 6:1203–1209[Medline]
  25. Mooney RA, Freund GG, Way BA, Bordwell KL 1992 Expression of a transmembrane phosphotyrosine phosphatase inhibits cellular response to platelet-derived growth factor and insulin-like growth factor-1. J Biol Chem 267:23443–23446[Abstract/Free Full Text]
  26. Yang Y, Gil M, Byun SM, Choi I, Pyun KH, Ha H 1996 Transforming growth factor-ß1 inhibits human keratinocyte proliferation by upregulation of a receptor-type tyrosine phosphatase R-PTP-kappa gene expression. Biochem Biophys Res Commun 228:807–812[CrossRef][Medline]
  27. Lammers R, Bossenmaier B, Cool DE, Tonks NK, Schlessinger J, Fischer EH, Ullrich A 1993 Differential activities of protein tyrosine phosphatases in intact cells. J Biol Chem 268:22456–22462[Abstract/Free Full Text]
  28. Aparicio LF, Ocrant I, Boylan JM, Gruppuso PA 1992 Protein tyrosine phosphatase activation during nerve growth factor-induced neuronal differentiation of PC12 cells. Cell Growth Differ 3:363–367[Abstract]
  29. den Hertog J, Pals CEGM, Peppelenbosch MP, Tertoolen LGJ, de Laat SW, Kruijer W 1993 Receptor protein tyrosine phosphatase {alpha} activates pp60c-src and is involved in neuronal differentiation. EMBO J 12:3789–3798[Medline]
  30. Keane MM, Lowrey GA, Ettenberg SA, Dayton MA, Lipkowitz S 1996 The protein tyrosine phosphatase DEP-1 is induced during differentiation and inhibits growth of breast cancer cells. Cancer Res 56:4236–4243[Abstract/Free Full Text]
  31. Millar JB, Mc Gowan CH, Lenaers G, Jones R, Russell P 1991 p80cdc25 mitotic inducer is the tyrosine phosphatase that activates p34cdc2 kinase in fission yeast. EMBO J 10:4301–4309[Medline]
  32. Mustelin T, Coggeshall KM, Altman A 1989 Rapid activation of the T-cell tyrosine protein kinase pp561ck by the CD45 phosphotyrosine phosphatase. Proc Natl Acad Sci USA 86:6302–6306[Abstract/Free Full Text]
  33. Zheng XM, Wang Y, Pallen CJ 1992 Cell transformation and activation ofpp60c-src by overexpression of a protein tyrosine phosphatase. Nature 359:336–339[CrossRef][Medline]
  34. Streuli M, Krueger NX, Tsai AY, Saito H 1989 A family of receptor-linked protein phosphatases in humans and Drosophila. Proc Natl Acad Sci USA 86:8698–8702[Abstract/Free Full Text]
  35. Wang H, Lian Z, Lerch MM, Chen Z, Xie W, Ullrich A 1996 Characterization of PCP-2, a novel receptor protein tyrosine phosphatase of the MAM family domain. Oncogene 12:2555–2562[Medline]
  36. Streuli M, Krueger NX, Hall LR, Schlossman SF, Saito H 1988 A new member of the immunoglobulin superfamily that has a cytoplasmic region homologous to the leukocyte common antigen. J Exp Med 168:1523–1530[Abstract/Free Full Text]
  37. Banville D, Ahmad S, Stocco R, Shen SH 1994 A novel protein-tyrosine phosphatase with homology to both the cytoskeletal proteins of the band 4.1 family and junction-associated guanylate kinases. J Biol Chem 269:22320–22327[Abstract/Free Full Text]
  38. Saras J, Claesson-Welsh L, Heldin CH, Gonez LJ 1994 Cloning and characterization of PTPL1, a protein tyrosine phosphatase with similarities to cytoskeletal-associated proteins. J Biol Chem 269:24082–24089[Abstract/Free Full Text]
  39. Sato T, Irie S, Kitada S, Reed JC 1995 FAP-1: a protein tyrosine phosphatase that associates with Fas. Science 268:411–415[Abstract/Free Full Text]
  40. Maekawa K, Imagawa N, Nagamatsu M, Harada S 1994 Molecular cloning of a novel protein-tyrosine phosphatase containing a membrane-binding domain and GLGF repeats. FEBS Lett 337:200–206[CrossRef][Medline]
  41. Kulas DT, Zhang WR, Goldstein BJ, Furnaletto RW, Mooney RA 1995 Insulin receptor signaling is augmented by antisense inhibition of the protein tyrosine phosphatase LAR. J Biol Chem 270:2435–2438[Abstract/Free Full Text]
  42. Streuli M, Krueger NX, Arinielo PD, M Tang M, Munro JM, Blattler WA, Adler DA, Disteche CM, Saito H 1992 Expression of the receptor-linked protein tyrosine phosphatase LAR: proteolytic cleavage and shedding of the CAM-like extracellular region. EMBO J 11:897–907[Medline]
  43. Serra-Pagès C, Kedersha NL, Fazikas L, Medley Q, Debant A, Streuli M 1995 The LAR transmembrane protein tyrosine phosphatase and a coiled-coil LAR-interacting protein co-localize at focal adhesions. EMBO J 14:2827–2838[Medline]
  44. Mauro LJ, Olmsted EA, Skrobacz BM, Mourey RJ, Davis AR, Dixon JE 1994 Identification of a hormonally regulated protein tyrosine phosphatase associated with bone and testicular differentiation. J Biol Chem 269:30659–30667[Abstract/Free Full Text]
  45. Zhao Z, Shen SH, Fischer EH 1994 Phorbol ester-induced expression, phosphorylation, and translocation of protein tyrosine phosphatase 1C in HL-60 cells. Proc Natl Acad Sci USA 91:5007–5011[Abstract/Free Full Text]
  46. Montano MM, Katzenellenbogen BS 1997 The quinone reductase gene: a unique estrogen-receptor regulated gene that is activated by antiestrogens. Proc Natl Acad Sci USA 94:2581–7[Abstract/Free Full Text]
  47. Nagata S, Golstein P 1995 The Fas death factor. Science 267:1449–1456[Abstract/Free Full Text]
  48. Keane MM, Ettenberg SA, Lowrey GA, Russell EK, Lipkowitz S 1996 Fas expression and function in normal and malignant breast cell lines. Cancer Res 56:4791–4798[Abstract/Free Full Text]
  49. Guvakova MA, Surmacz E 1997 Tamoxifen interferes with the insulin-like growth factor I receptor (IGF-IR) signaling pathway in breast cancer cells. Cancer Res 57:2606–2610[Abstract/Free Full Text]
  50. Escot C, LeRoy X, Chalbos D, Joyeux C, Simonsen E, Daures JP, Soussaline F, Rochefort H 1991 Computer-aided quantification of RNA levels detected by in situ hybridization of tissue sections. Anal Cell Pathol 3:215–224[Medline]
  51. Kissane JM, Robins E 1958 The fluorometric measurement of deoxyribonucleic acid in animal tissues with special reference to the central nervous system. J Biol Chem 233:184–8[Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
M. Dromard, G. Bompard, M. Glondu-Lassis, C. Puech, D. Chalbos, and G. Freiss
The Putative Tumor Suppressor Gene PTPN13/PTPL1 Induces Apoptosis through Insulin Receptor Substrate-1 Dephosphorylation
Cancer Res., July 15, 2007; 67(14): 6806 - 6813.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A.-M. Gaben, C. Saucier, M. Bedin, G. Redeuilh, and J. Mester
Mitogenic Activity of Estrogens in Human Breast Cancer Cells Does Not Rely on Direct Induction of Mitogen-Activated Protein Kinase/Extracellularly Regulated Kinase or Phosphatidylinositol 3-Kinase
Mol. Endocrinol., November 1, 2004; 18(11): 2700 - 2713.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
Z. Wang, D. Shen, D. W. Parsons, A. Bardelli, J. Sager, S. Szabo, J. Ptak, N. Silliman, B. A. Peters, M. S. van der Heijden, et al.
Mutational Analysis of the Tyrosine Phosphatome in Colorectal Cancers
Science, May 21, 2004; 304(5674): 1164 - 1166.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
G. Bompard, M. Martin, C. Roy, F. Vignon, and G. Freiss
Membrane targeting of protein tyrosine phosphatase PTPL1 through its FERM domain via binding to phosphatidylinositol 4,5-biphosphate
J. Cell Sci., June 15, 2003; 116(12): 2519 - 2530.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Bompard, C. Puech, C. Prebois, F. Vignon, and G. Freiss
Protein-tyrosine Phosphatase PTPL1/FAP-1 Triggers Apoptosis in Human Breast Cancer Cells
J. Biol. Chem., November 27, 2002; 277(49): 47861 - 47869.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Oesterreich, P. Zhang, R. L. Guler, X. Sun, E. M. Curran, W. V. Welshons, C. K. Osborne, and A. V. Lee
Re-expression of Estrogen Receptor {alpha} in Estrogen Receptor {alpha}-negative MCF-7 Cells Restores both Estrogen and Insulin-like Growth Factor-mediated Signaling and Growth
Cancer Res., August 1, 2001; 61(15): 5771 - 5777.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
R. E. Favoni and A. De Cupis
The Role of Polypeptide Growth Factors in Human Carcinomas: New Targets for a Novel Pharmacological Approach
Pharmacol. Rev., June 1, 2000; 52(2): 179 - 206.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. V. Lee, J. G. Jackson, J. L. Gooch, S. G. Hilsenbeck, E. Coronado-Heinsohn, C. K. Osborne, and D. Yee
Enhancement of Insulin-Like Growth Factor Signaling in Human Breast Cancer: Estrogen Regulation of Insulin Receptor Substrate-1 Expression in Vitro and in Vivo
Mol. Endocrinol., May 1, 1999; 13(5): 787 - 796.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freiss, G.
Right arrow Articles by Vignon, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freiss, G.
Right arrow Articles by Vignon, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals