Molecular Endocrinology 12 (4): 568-579
Copyright © 1998 by The Endocrine Society
Extinction of Insulin-Like Growth Factor-I Mitogenic Signaling by Antiestrogen-Stimulated Fas-Associated Protein Tyrosine Phosphatase-1 in Human Breast Cancer Cells
Gilles Freiss,
Carole Puech and
Françoise Vignon
INSERM Unit 148 on Hormones and Cancer 34090 Montpellier,
France
 |
ABSTRACT
|
|---|
Steroidal (ICI 182, 780) and nonsteroidal
hydroxytamoxifen (OH-Tam) antiestrogens inhibit growth factor-mitogenic
activity in MCF 7 estrogen receptor-positive human breast cancer cells.
Cell inhibition is correlated with an increase in membrane protein
tyrosine phosphatase (PTP) activity, and the addition of orthovanadate
prevents OH-Tam inhibition. After RT-PCR cloning of PTPs expressed in
MCF 7 cells with primers to their catalytic domains, we have shown, by
differential screening, that the expression of two enzymes, leukocyte
common antigen-related PTP (LAR) and Fas-associated PTP-1 (FAP-1), was
modulated by antiestrogens. By comparative RT-PCR, in situ
hybridization, and Northern blot, LAR and FAP-1 mRNAs accumulation was
found to be dose- and time-dependently increased by antiestrogens. To
further demonstrate that PTPs were key mediators of
antiestrogen-inhibitory action on the growth factor pathway, a panel of
stable FAP-1 transfectants expressing low to high levels of antisense
mRNAs was established. In these clones, the level of antisense RNA
expression was correlated with a reduction in basal levels and a
complete inhibition of antiestrogen-stimulated values of PTP activity.
When FAP-1 expression was abolished, OH-Tam was no longer able to block
insulin-like growth factor I mitogenic activity even though it remained
strongly antiestrogenic. However, ICI 182,780 was still inhibitory,
indicating that its effect was not exclusively mediated by PTP. Our
data first demonstrate that a specifically regulated phosphatase
(FAP-1) is implicated in the triggering of negative proliferation
signals in breast cancer cells.
 |
INTRODUCTION
|
|---|
It has long been recognized that estradiol (E2) (1),
epidermal growth factor (EGF) (2), and insulin-like growth factors
(IGFs) (3, 4) are potent mitogens of human breast cancer cells. It was
originally thought that the biological action of these ligands on the
cell was triggered through two distinct signaling pathways, namely
nuclear receptors and transmembrane tyrosine kinase-associated
receptors. The demonstration that estrogens (as well as other nuclear
receptor ligands) could regulate the expression of ligands or receptors
of the polypeptide growth factor family also suggested that growth
factors might act as autocrine (or paracrine) mediators of
estrogen-induced mitogenesis although there is still no direct
experimental evidence demonstrating the existence of such a loop in
these tumor cells (5, 6). There are several recently published examples
of new intricate interactions between these two pathways, strongly
favoring the concept of a cross-talk model. It has been demonstrated
that growth factors and other molecules that can activate the
Ras/mitogen-activated protein (MAP) kinase pathway could modulate
estrogen receptor (ER) transcriptional activation by phosphorylation
(7, 8) and that EGF could mimic the uterotrophic effect of estrogen in
rodents (9). We previously demonstrated that nuclear receptor ligands
interfered with the growth factor signaling system by showing that
steroidal (ICI 164, 384 or 182, 780) as well as nonsteroidal
antiestrogens [hydroxytamoxifen (OH-Tam)] were able to inhibit IGF-I-
or EGF-induced breast cancer cell proliferation (10, 11). Several lines
of evidence suggest that the ER is a key element in these cross-talk
phenomena. In the absence of ER [wild-type ER-negative or ER-knockout
(ERKO) cells] (11, 12), antiestrogens no longer affect growth factor
mitogenic responses. Conversely, ER overexpression amplifies
estrogen-like responses of EGF in vitro (7, 8).
Nonsteroidal antiestrogens are potent growth inhibitors of
hormone-responsive breast tumors and, based on their high tolerance,
are therefore widely used in adjuvant therapy of these neoplasms (13).
Moreover, because of their beneficial estrogenic properties on bone
(14) and cardiovascular diseases (15), they have been proposed as a
tumor prevention agent in high-risk patients despite the adverse
tumorigenic effect on the endometrium. New steroidal antagonist
molecules with tissue-selective agonist activity, expected to be less
harmful to endometrium, are being designed by pharmaceutical companies
and under preclinical or clinical trials (16). Both classes of
molecules were shown to control tumor proliferation by acting as
estrogen antagonists as well as growth factor inhibitors. While their
classic antiestrogenic properties have been well documented, their
interference in the growth factor-signaling pathway deserves further
clarification. First, we and others have shown that although both of
these negative actions initially require an interaction with the ER,
they trigger several distinct downstream inhibition mechanisms.
Antigrowth factor activity occurs, in vivo and in
vitro, in the absence of active estrogens (9, 11) and is
accompanied by a drastic reduction in the regulation of some growth
factor-regulated responses (17, 18, 19). We had previously shown that this
occurred concomitantly with an increase in membrane protein tyrosine
phosphatase (PTP) activity (20) (G. Freiss, unpublished results).
PTPs are a diverse family of proteins whose presently cloned members
have been classified either as transmembrane receptor-like or
intracellular enzymes according to their structural features (21). All
members possess at least one catalytic domain of
250 amino acid
residues that presents the distinctive signature motif
(I/V)HCXAGXXR(S/T)G containing the catalytic Cys and Arg residues. The
diversity within the PTP family arises from the nature of the
noncatalytic sequences, which are thought to confer unique functions
and properties to these enzymes by targeting them to specific cellular
locations and substrates. Whereas the presence of specific domains on
intracellular enzymes indicated that they might be targeted to the
nucleus, phosphotyrosine-containing proteins, or cytoskeletal proteins
(22), extracellular domains of receptor-type molecules appear to be
able to serve a ligand-binding function in heterophilic or homophilic
interactions (23). It has been shown that PTPs could interfere in the
numerous cellular events in which protein phosphorylation is important,
including regulation of gene expression (24), cell proliferation (25, 26), cell transformation (27), or cell differentiation (28, 29, 30)
processes. Although a precise physiological role has been attributed to
a few members (31, 32), in most instances the identity of the enzymes
and the way by which they play a role in cellular signaling events
remain obscure. It was demonstrated that the PTPs can also act in
cooperation with protein tyrosine kinases (PTKs) to promote tyrosine
phosphorylation-dependent signaling events (33) and thus should not be
considered exclusively as the negative counterparts of PTKs.
In human breast cancer cells treated with steroidal and nonsteroidal
antiestrogens, there was a direct correlation between the negative
regulation of growth and the increase in PTP activity in terms of time-
and dose-responses as well as ligand specificity (20). Moreover,
addition of a specific PTP inhibitor in intact cells prevented OH-Tam
growth inhibition, thus strongly suggesting that PTPs are key
intermediates of its antiproliferative effect on the growth
factor-signaling pathway. Although our preliminary data indicated that
increased PTP activity was most probably due to regulation of some
specific enzymes, we did not identify which enzymes are implicated,
whether they are transcriptionally regulated by antiestrogens, and how
they affect growth factor action.
In the present study, we investigated some aspects of these key issues
by cloning the PTPs that are expressed in MCF7 cells and demonstrating
that the expression of a transmembrane-type enzyme (LAR) and a
membrane-associated enzyme (FAP-1) is regulated by steroidal and
nonsteroidal antiestrogens. We developed stable FAP-1 antisense
RNA-expressing transfectants to confirm that this enzyme is a key actor
of OH-Tam antiproliferative action.
 |
RESULTS
|
|---|
Search for Antiestrogen-Regulated Protein Tyrosine Phosphatases
We had previously shown that inhibition of growth factor action in
breast cancer cells is correlated with an increase in membrane PTP
activity (20). This increase could either reflect a general effect on
preexisting enzymes or represent a true augmentation in the expression
of some PTPs. Control experiments, with mixed solubilized membranes
from control and OH-Tam-treated cells, demonstrated that the PTP
activity of the mix was equal to mean activities of the separate
fractions, which was in agreement with an induction of PTPs rather than
a modulation in enzyme activity. Moreover, analysis by HPLC gel
filtration of OH-Tam-treated cell membranes again pointed to the fact
that the 70% overall increase in enzyme activity after antiestrogen
treatment could be mostly explained by the exposure of a few protein
peaks in a broad >100-kDa region (20).
To experimentally support the hypothesis of antiestrogen regulation of
PTPs, we thus attempted to clone and sequence PTPs expressed in human
breast cancer cells after OH-Tam treatment. By RT-PCR, using two
degenerated oligonucleotides corresponding to the consensus region
(sequence HCSAGVG)(antisense 3'-primer) (34) and a conserved domain
(sequence KCDQYWP)(sense 5'-primer), which are both present in all PTP
catalytic domains, we amplified a portion of
280 bp of this domain
from PTPs expressed in MCF7-treated cells. The amplified products were
then cloned in a pGEMT plasmid and used to transform bacteria for
primary differential screening with labeled cDNAs from control or
OH-Tam-treated cells. Three clones, termed C3, B4, and B11, were scored
as differentially regulated by antiestrogens in primary screening.
However, secondary screenings of PTP expression demonstrated that only
C3 and B11 clones were differentially regulated while B4 remained
unchanged and served as a negative control in further studies (Fig. 2B
). Sense and antisense sequencing of cDNA fragments of the selected
clones showed that they all contained a third region (sequence:
WPDXGVP), which is highly conserved in PTP catalytic domains. Among
the nonregulated clones, we obtained redundant clones of
transmembrane-type enzymes, i.e. PTP
and PTP
, and
clone B4 whose sequence has just been described as the transmembrane
pancreatic carcinoma phosphatase (PCP-2) (35). Among the differentially
expressed clones, clone C3 was identified as the transmembrane
leukocyte antigen-related phosphatase (LAR) (36). Clone B11 was found
to be identical to the cytoplasmic enzyme that is known under several
denominations (FAP-1, PTP-BAS or hBAS, PTPL1 and PTP1E) as it was
simultaneously cloned by four separate groups in different cells
(37, 38, 39, 40). In agreement with our previous data indicating that cell
growth inhibition was associated with an increase in membrane PTP
activity, it finally turned out that among the two clones selected one
corresponded to a transmembrane-type enzyme, whereas the second one was
homologous to a membrane-associated molecule. Interestingly, the
molecular weights of the selected enzymes were all within the range of
those of protein peaks that were up-shifted after antiestrogen
treatment in HPLC gel filtration analysis (20). After detecting
potentially regulated clones, we directly evaluated their regulation by
different techniques.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 2. Study of LAR, FAP-1, and PCP-2 mRNA Regulation by
RT/PCR
MCF-7 cells grown in steroid-stripped medium were treated with ICI
182,780 (50 nM) (A) or OH-Tam (50 nM) (B) or
with ethanol (control) (A and B) for 13 days, and total RNA was
extracted. Total RNA (1.5 µg) was submitted to reverse transcription
and 5 µl aliquots of 1:30 diluted reverse transcription mixture were
amplified by PCR, as described in Materials and Methods,
using each set of primers corresponding to LAR, FAP-1, PCP-2, or
constant GAPDH mRNA. A, A representative experiment with LAR, FAP-1,
and GAPDH primers. Upper panel, Autoradiogram of
amplified products separated on a 6% polyacrylamide gel after
increasing number of cycles as follows. a and e: 18 cycles for GAPDH,
22 cycles for LAR, 24 cycles for FAP-1; b and f: 20 cycles for GAPDH,
24 cycles for LAR, 26 cycles for FAP-1; c and g: 22 cycles for GAPDH,
26 cycles for LAR, 28 cycles for FAP-1; d and h: 24 cycles for GAPDH,
28 cycles for LAR, and 30 cycles for FAP-1. Lower panel,
Quantification of the relative amounts of each product (LAR, ;
FAP-1, ; GAPDH, ) with Fujix-Bas 1000. Solid lines
correspond to results obtained with RNA from 3-day ICI-treated cells
(ICI), whereas dotted lines correspond to results
obtained with RNA from control cells (Cont.). B, Time-course of LAR,
FAP-1, and PCP-2 mRNA regulation by OH-Tam. Results for LAR
(hatched bars), FAP-1 (open bars), and
PCP-2 (black bars) represent means of three independent
experiments. The results are expressed as a percentage of the basal
mRNA level measured in control cells (0). Error bars
represent 1 SD.
|
|
Antiestrogens Increase PTP mRNA Accumulation
We started our study with LAR, for which all probes were readily
available, to investigate antiestrogen regulation of this enzyme by the
following three approaches: in situ hybridization (Fig. 1
, A and B), Northern blots (Fig. 1C
),
and comparative RT-PCR (Fig. 2
). In Fig. 1A
, a representative hybridization experiment revealed a drastic
increase in LAR mRNA expression after antiestrogen treatment. As
indicated in Fig. 1B
, a 5-fold increase in hybridization was
reproducibly obtained after 3 day-treatment with 50 nM
OH-Tam, whereas estradiol (E2) was inefficient (similar timing and
concentration) and background (sense) was minimal. Similarly, a
2.5-fold increase in
8-kb LAR RNA accumulation was shown by
Northern blot using 36B4 nonregulated RNA expression as a constant
probe (Fig. 1C
). Finally, comparative RT-PCR analysis of the variations
in the expression of LAR mRNA [using glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) as a constant probe] demonstrated a 3-fold
stimulation over control after 23 days of treatment with ICI 182,780
(Fig. 2A
, a representative experiment) or OH-Tam (Fig. 2B
, hatched bars).

View larger version (60K):
[in this window]
[in a new window]
|
Figure 1. Evidence of LAR mRNA Regulation by in
Situ Hybridization and Northern Blot
AB, In situ hybridization: Steroid-withdrawn MCF7
cells, treated for 14 days with E2 (50100
nM) or OH-Tam (50 nM) or maintained in control
medium, were pelleted and frozen in liquid nitrogen. Sections (5-µm)
of frozen pellets were mounted on microscope slides and fixed in 4%
paraformaldehyde. In situ RNA hybridization was
performed at 42 C in a 50% formamide mix for 15 h with
[35S] UTP-labeled sense and antisense LAR probes. After
treatment by A and T RNAses and extensive washes, sections were
dehydrated and exposed to Ilford K5 autoradiography emulsion for 3
weeks. Hybridization signal was evaluated by counting silver grains
(IMSTAR Image Analyzer; Starwise Grains Software, IMSTAR, Paris,
France) in nine areas. A, Representative areas of control and
antiestrogen-treated cell sections. B, The curves represent the mean of
three independent experiments. Error bars represent 1
SD. C, Northern blot. MCF7 cells grown in steroid-stripped
medium, as described in Materials and Methods, were
incubated with 50 nM OH-Tam or ethanol (control cells) for
13 days, and total RNA was extracted. Forty micrograms of RNA were
analyzed on a 1% agarose denaturing gel. After transfer onto a nylon
membrane, LAR and constant 36B4 mRNA were hybridized with
32P-labeled cDNA probes. Upper panel shows a
representative autoradiogram of total RNA after hybridization.
Lower panel shows the relative amounts of LAR mRNA
quantified with a Fujix-Bas 1000. The results are expressed as a
percentage of the basal mRNA level measured in control cells.
|
|
The overall levels of FAP-1 and PCP-2 expression were shown to be much
lower than that of LAR by RT-PCR and almost undetectable by Northern
blot and in situ hybridization (data not shown). Since
control experiments run on the same preparations of RNAs, by RT-PCR or
Northern blot, demonstrated that the two techniques gave identical
results for LAR (data not shown), we thus favored the RT-PCR technique
for an extensive study on PTP regulation by steroidal and nonsteroidal
antiestrogens. To validate our RT-PCR quantification technique, we have
performed several control experiments which showed: 1) that the signal
detected on a gel is proportional to the concentration of RNA added; 2)
the degree of stimulation is identical within the same experiment or in
replicate experiments with the same sets of RNA; 3) the stimulation
observed is significantly reproduced between experiments with different
sets of RNA. While PCP-2 mRNA expression was not regulated by OH-Tam
(Fig. 2B
, black bars) or ICI 182, 780 (not shown), LAR and
FAP-1 mRNA expression were time- (Fig. 2
) and dose-dependently (Fig. 3
) increased by both types of
antiestrogens. The onset and degree of mRNA stimulation were similar
for both enzymes and both ligands and consistent with our previous data
on regulation of total enzyme activity (20). mRNA stimulation was
detectable after 24 h and optimal at 23 days, which indicates
that if transcriptional regulation occurs it is probably not a direct
primary response mediated by an estrogen-responsive element.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 3. Dose-Dependent Stimulation of LAR and FAP-1 mRNA
Accumulation
MCF7 cells, maintained in steroid-stripped medium, were then incubated
with increasing concentrations of ICI182,780 (A) or OH-Tam (B) or with
ethanol (control cells) for 3 days, and total RNA was extracted. RT-PCR
was performed as in Fig. 2 using each set of primers corresponding to
LAR (hatched bars), FAP-1 (open bars), or
constant GAPDH mRNA. The results for ICI 182,780 and OH-Tam,
respectively, represent means of two and three independent experiments.
The results are expressed as a percentage of the basal mRNA level
measured in control cells (0). Error bars represent 1
SD (three experiments) or the range of obtained values (two
experiments).
|
|
In addition, Fig. 4A
demonstrates that
only ligands of ER that inhibited growth factor mitogenic action (11)
increased LAR and FAP-1 mRNA, whereas both synthetic progestin R5020
and antiprogestin RU486 were inefficient. Accordingly, these two
progesterone receptor (PR) ligands were previously shown to display an
antiestrogenic activity, but they did not block EGF or IGF-I mitogenic
activity. Estradiol in itself was inactive (Fig. 4
) but it totally
abolished OH-Tam and ICI 182,780-stimulated-increase on both LAR and
FAP-1 PTPs (Fig. 4B
). The relation between the efficiency of the
compounds (ICI 182,780, OH-Tam, cis-Tam) and their ER affinities,
associated with the strong competitive effect of E2,
confirmed that regulation of PTPs by antiestrogens required binding to
ER.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 4. Specificity and Reversibility of PTP mRNA
Accumulation
A, Ligand specificity of PTP mRNA accumulation. MCF7 cells, maintained
in steroid-stripped medium, were incubated with increasing
concentrations (1 nM to 1 µM) of estradiol
(E2), 50 nM ICI 182,780 (ICI), 50 nM R5020, 50
nM RU486, 1 µM cisTam, or ethanol (control
cells) for 3 days. B, Reversibility by estradiol of the antiestrogen
stimulation of PTP mRNA accumulation. MCF7 cells were grown in
steroid-stripped medium and then stimulated for 3 days with 50
nM OH-Tam, 50 nM ICI 182,780, 1
µM E2, OH-Tam (50 nM), and E2 (1
µM), ICI 182,780 (50 nM), and E2 (1
µM) or ethanol for control cells. Total RNA (1.5 µg)
was submitted to reverse transcription, and 5 µl aliquots were
amplified after dilution as in Fig. 2 (LAR, hatched
bars), FAP-1, open bars). The results represent
means of the indicated numbers of independent experiments. The results
are expressed as a percentage of the basal mRNA level measured in
control cells. Error bars represent 1 SD
(three or more experiments) or the range of obtained values (two
experiments).
|
|
Our data altogether indicate that the increase in PTP activity was due
to antiestrogen regulation of some specific PTPs, including LAR and
FAP-1. Although our approach did not exclude that other enzymes might
be similarly regulated, this is obviously not a general phenomenon,
since neither PCP-2 nor PTP
and PTP
are modulated.
Treatment of ER+ MCF7 cells with micromolar concentrations of
orthovanadate, a specific inhibitor, prevented OH-Tam-induced growth
factor inhibition, implying that PTPs play a crucial role in this event
(20). To evaluate whether LAR and/or FAP-1 are the important enzymes in
triggering negative proliferation signals, we decided to develop
antisense RNA-expressing transfectants.
Growth Regulation of Anti-PTP Transfectants by Antiestrogens
We had initially planned to establish antisense transfectants of
the two regulated PTPs. However, our attempts remained unsuccessful for
LAR (three different transfections), suggesting that extinction of this
enzyme might markedly limit the outgrowth of breast cancer cells,
although neutralization of LAR expression was achieved and shown to
augment insulin receptor signaling in rat hepatoma cells (41). In
contrast, when using the same vector in identical experimental
conditions, a panel of FAP-1 antisense transfectants was obtained in
the first attempt. To evaluate the consequences of this transfection on
cell growth activity, positive clones were subdivided into three
categories according to the level of antisense RNA expression depicted
in Fig. 5
: high expresser (100%; clone
3), medium expresser (60% of maximal level; clone 10) and a set of low
expressers (rating from 520% maximum; clones 2, 4, 5, and 7). For
all further experiments, these clones were compared with a pool of
mock-transfectants and to wild-type MCF7 cells.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 5. FAP-1 Antisense RNA Expression
MCF7 cells and derived clones were grown in FCS-supplemented medium,
and total RNA was extracted. Forty micrograms of RNA were analyzed on a
1% agarose denaturing gel. After transfer onto a nylon membrane, FAP-1
antisense (FAP-1 AS) and constant 36B4 mRNA were hybridized with
32P-labeled cDNA probes. Lower panel shows
representative autoradiograms of total RNA after hybridization.
Upper panel shows the relative amounts of FAP-1
antisense RNA quantified with a Fujix-Bas 1000. The results represent
means of two experiments for clone 10, of one experiment with each of
the low expressing clones (2, 4, 5, 7), and of one experiment with five
independent clones for the mock-transfected MCF7 cells. The results are
expressed as a percentage of the maximal mRNA level measured in clone
3. Error bars represent 1 SD or the range of
obtained values (less than three determinations).
|
|
To estimate the extinction of FAP-1 expression at the protein level, we
attempted to immunoprecipitate this enzyme in wild-type and
transfectant MCF7 cells with available antibodies (commercial and
noncommercial sources). The low level of expression of FAP-1 in these
cells did not allow us to reproducibly quantitate the amount of enzyme.
We have therefore indirectly evaluated the level of FAP-1 expression by
measuring how PTP enzymatic activity is affected in these clones. We
have verified that total cytoplasmic PTP activity, as well as
expression of PTP-1B (Western blot) or LAR (immunoprecipitation), is
not modified in FAP-1 antisense transfectants (results not shown). By
contrast, in Table 1
, we showed that the levels of
antisense RNA expression were correlated with a reduction in basal
membrane-associated PTP activity and a complete inhibition of the
antiestrogen-stimulated activity in clones 3 and 10 (high and medium
expressers). As expected in this test, the partial reduction (30%) in
basal value indicated that other PTPs contributed to total enzymatic
activity. However, the complete extinction of the antagonist-stimulated
fraction demonstrated that FAP-1 antisense transfection specifically
and functionally abolished the enzyme expression. Cell growth
stimulation by IGF-I and E2 was independent of the level of
expressed FAP-1 antisense RNA (hatched bars/crossed bars)
and not significantly different from what was observed in
mock-transfectants (open bars) and wild-type cells
(black bars) (Fig. 6A
).
However, although OH-Tam prevented E2 stimulation in all
clones, it was inefficient in blocking the IGF-I effect in FAP-1
antisense transfectants (Fig. 6
). Moreover, as shown in Fig. 6B
and
Table 1
, the ability of FAP-1 antisense clones to resist
OH-Tam-inhibitory action was directly related to the degrees of
antisense expression and depletion of PTP activity. Competition
experiments with increasing concentrations of OH-Tam in antisense
clones and wild-type cells indicated that the ER affinity for the drug
was equivalent in all clones and could not explain their differential
response (Fig. 7
). Moreover, enzyme
immunoassay of ER and PR demonstrated that the concentration of both
receptors (ER
52 fmol/mg protein, PR
441 fmol/mg protein) were
equivalent in wt-MCF7 cells and FAP-1 antisense clones.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 6. Antiestrogenic and Antigrowth Factor Effect of
OH-Tam on Wild-Type MCF7 and FAP-1 Antisense Clones
Cells grown in steroid-stripped medium were treated by the indicated
combinations of 1 nM estradiol, 50 nM OH-Tam, 5
nM IGF-I, or ethanol (control dishes) for 7 days in 1%
FCS/DCC medium. Cell growth was evaluated by total DNA measurements as
described in Materials and Methods. A, A representative
growth experiment. The results are expressed as a percentage of the
basal DNA level measured in control wells (dotted line).
They represent the means of three replicate wells. Error bars represent
1 SD. B, The results are expressed as a percentage of the
DNA level obtained with IGF-I (hatched bars) or
estradiol (black bars) alone. The results represent
means of two, three, and four experiments for wild type MCF7, clone 3,
and clone 10, respectively; and the mean of values obtained with four
and seven independent clones for low expressing clones 2, 4, 5, and 7
and mock transfected clones, respectively. Error bars represent 1
SD.
|
|

View larger version (43K):
[in this window]
[in a new window]
|
Figure 7. Antiestrogenic Effect of OH-Tam on Wild-Type MCF7
and FAP-1 Antisense Clones
Steroid-stripped cells were treated by combinations of 1 nM
estradiol and 150 nM OH-Tam for 7 days in 1% FCS/DCC
medium. Cell growth was evaluated as in Fig. 6 . The results represent
means of triplicate wells for clone 3, clone 10, and wild-type MCF7
cells or means of values obtained in three independent clones in the
last series. The results are expressed as a percentage of the DNA level
obtained with estradiol alone. Error bars represent 1
SD.
|
|
These data clearly confirmed that OH-Tam antigrowth factor activity is
triggered by PTP and that FAP-1 is required to mediate these negative
signals. Moreover, the results shown in Fig. 6A
provide new evidence
that the antiestrogenic and antigrowth factor activities are two
distinct phenomena. Interestingly, when steroidal antiestrogen, ICI
182,780, was used instead of the nonsteroidal molecule OH-Tam, no
resistance appeared in FAP-1 antisense transfectants (Fig. 8
) although basal PTP activity was
reduced and not increased by treatment with this pure antagonist (Table 1
). These latter results are in agreement with other observations
suggesting that these two ligands do not similarly activate ER in
responsive cells.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 8. Antigrowth Factor Effect of ICI 182,780 on
Wild-Type MCF7 Cells and FAP-1 Antisense Clones
Steroid-withdrawn cells were treated by the indicated combinations of
50 nM ICI 182,780, 5 nM IGF-I, or ethanol
(control dishes) for 7 days in 1% FCS/DCC medium. Cell growth was
evaluated as described in Fig. 6 . The results represent means of two
experiments for clone 3 and means of values obtained with four and six
independent clones for low-expressing clones 2, 4, 5, and 7 and
mock-transfected clones, respectively. The final results are expressed
as a percentage of the basal DNA level measured in control wells
(dotted line). Error bars represent 1
SD or the range of obtained values (less than three
experiments).
|
|
 |
DISCUSSION
|
|---|
We have previously reported that inhibition of EGF or IGF-I
mitogenic activities in MCF7 cells by OH-Tam and ICI 164,384 was
associated with an increase in membrane protein tyrosine phosphatase
(PTP) activity. The fact that the negative action of OH-Tam on growth
factors could be wiped out by orthovanadate suggested that the
modulation of PTP activity was a mandatory step. In the present paper,
we have now identified two enzymes, i.e. LAR and FAP-1,
whose expression is increased by steroid antagonists that inhibit
growth factor response. Moreover, our proposal for a key regulatory
role of PTPs was confirmed by the evidence of a selective abolition of
OH-Tam inhibitory action on the growth factor pathway in MCF-7 stable
transfectants in which FAP-1 was neutralized by antisense RNA
expression.
In human breast cancer cells, we demonstrated that steroidal (ICI
182,780) or nonsteroidal (OH-Tam) antiestrogens generated a 3-fold
increase in mRNA accumulation of two distinct enzymes: a transmembrane
receptor-type PTP (LAR) and a cytoskeleton-associated PTP (FAP-1). In
accordance with our findings, detection of LAR and FAP-1 (also named
hBAS) in breast tissue or breast tumors has already been documented,
but we are the first to report on regulation of these PTPs by nuclear
receptor ligands and to demonstrate that their enhanced expression
plays a key role in growth inhibition of breast cancer. In a general
survey of LAR tissue distribution, using immunostaining, Streuli
et al. (42) mentioned that myo-epithelial cells of breast
ducts and acini presented a positive staining. More recently, the same
group identified a strong fluorescent staining of LAR on the plasma
membrane and on the edges of MCF7 cells (43). Keane et al.
(30) demonstrated by RT-PCR that LAR and FAP-1 were among the 31 PTPs
expressed in another human breast cancer cell line (ZR751). Recent
reports indicated that hormone-, growth factors-,
12-O-tetradecanoyl-phorbol-13-acetate-, or
dimethylsulfoxide-regulated PTPs are associated with differentiation of
bone cells, testicular tissue (44), a rat pheochromocytoma cell line
(28), and leukemia cells (45). In most instances, PTP regulation was
observed within minutes or at most a few hours; it was sometimes a
transient effect and principally triggered by ligands of transmembrane
receptors or membrane-associated coupling transduction systems.
Although we believe that nuclear receptors are implicated in PTP
regulation in breast cancer cells (our present data), the time lag
required to display a significant increase in mRNA accumulation (2
days) is not in favor of a primary direct transcriptional effect on an
estrogen-responsive element-driven gene. It could also be a
nontranscriptional event, a delayed transcriptional secondary response
of nuclear receptor ligands, or an indirect transcriptional regulation
of a broad spectrum of genes utilizing a unique class of promoters,
since both PTPs have the same regulation scheme. Unfortunately, the
promoters of these two genes are not yet accessible. However, in the
same line, it was recently shown that OH-Tam and ICI 182,780, which
could stimulate the activity of a detoxifying enzyme (quinone
reductase) after 34 days of treatment, do so by ER-dependently
activating a gene that is under control of an electrophile/antioxidant
response element (EpRE-ARE) (46).
The second interesting aspect of our study was the striking difference
in the effect of steroidal and nonsteroidal antiestrogens that we
observed in FAP-1 antisense transfectants. On one hand, the mixed
agonist/antagonist OH-Tam no longer affected growth factor action in
these cells, which demonstrates that FAP-1 regulation is mandatory for
its inhibitory action on IGF-I, thus confirming that PTPs play a major
role in the control of breast cancer growth. On the other hand,
steroidal pure antagonists (ICI 182, 780) still inhibit growth
factor-induced proliferation, suggesting that they exert their negative
action through additional distinct mechanisms. Accordingly, two series
of published data suggested that ICI 182,780 could inhibit growth
factor action through an ER-dependent mechanism on which OH-Tam was
inoperative. First, two groups have shown that the ability of growth
factors and other molecules to modulate ER transcriptional activity by
phosphorylation via the Ras/MAP kinase pathway was prevented
by ICI 182,780, whereas OH-Tam synergized with these factors (7, 8).
Second, Curtis et al. (12) have shown that in ERKO
uterus, lacking functional ER, EGF had no mitogenic activity. When
combined, these data suggest that ER transactivation by the Ras/MAP
kinase pathway is a necessary step for the effect of EGF (and possibly
other growth factors) on growth in hormone-responsive tissues. Our
present data in FAP-1 antisense transfectants demonstrate that there
are at least two ER-dependent pathways triggered by OH-Tam and
steroidal antagonists that are implied in the control of growth factor
inhibition. While PTP regulation (FAP-1) is crucial to the negative
effect of OH-Tam, ICI 182,780 can bypass this step in breast cancer
cells and continue to exert its main blockade presumably on ER
transactivation. Moreover, it is conceivable that either PTP expression
or regulation might have been lost in some OH-Tam-resistant cells that
remain sensitive to ICI 182,780. If this defect were confirmed in
resistant tumor cells or tissues, then restoration of PTP expression
could be envisaged to circumvent acquired Tam resistance.
The next questions to address now concern the mechanisms by which FAP-1
regulation interferes with IGF-I mitogenic action. FAP-1 was shown to
associate with Fas, a cell surface receptor that is capable of
triggering apoptosis when bound to anti-Fas cytotoxic monoclonal
antibodies or to its specific Fas ligand, which belongs to the tumor
necrosis factor family (47). However, Fas, which is widely expressed in
nontransformed mammary epithelial cells, is detectable in only one of
seven tested breast cancer cell lines (T47D) (48). MCF7 cells do not
express Fas and are the only breast cancer cells that remain
resistant to Fas-induced apoptosis after IFN
treatment (48).
The mechanism of FAP-1-induced growth inhibition of MCF7 breast cancer
cells is therefore unlikely to involve its particular capability of
interaction with Fas.
To identify which step in the IGF-I mitogenic signaling pathway is
blocked by FAP-1 in breast cancer, we are currently comparing the
regulation of IGF-I receptor autophosphorylation and of its initial
tyrosine-phosphorylated substrates, e.g. insulin receptor
substrate-1 (IRS-1) and phosphatidylinositol 3-kinase (PI 3-kinase), in
wild-type MCF 7 cells and their resistant counterparts in which PTP
regulation is abolished. Our present data suggest that the IRS-1, PI
3-kinase pathway is a target for FAP-1 phosphatase (G. Freiss, C.
Puech, and F. Vignon, in preparation) in accordance with recent data
which indicated that this pathway is inhibited by Tam in IGF-I receptor
or IRS-1 overexpressing cells (49).
We have presently highlighted a new mode of action of steroid
antagonists on the growth factor pathway. Moreover, we have identified
an ER-regulated PTP that is responsible in intact cells for the
extinction of the IGF-I mitogenic signaling. Further studies aimed at
disclosing FAP-1 promoter and understanding how this enzyme is
regulated in hormone-independent tissues will be helpful to evaluate
the therapeutic future of PTPs in the control of tumor
proliferation.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture
MCF7 human breast cancer cells were obtained from the Michigan
Cancer Foundation (Detroit, MI). MCF7 and derived clones were
maintained in Hams F-12/DMEM (1:1) supplemented with 10% FCS (GIBCO
BRL, Cergy Pontoise, France). Before all hormonal treatments the cells
were stripped of endogenous steroids by successive passages in medium
without phenol red containing 10% (2 days) and then 3% (5 days)
charcoal-stripped FCS [FCS/dextran-coated charcoal (DCC)]. They were
finally treated in the presence of 1% FCS/DCC. Control cells were
grown in the same conditions (1% FCS/DCC) and complemented with
vehicle alone (ethanol).
Isolation of Clones of Antiestrogen-Regulated PTPs in MCF 7
Cells
A set of degenerated oligonucleotide primers to conserved
regions within the catalytic PTP domain was designed. These primers
were used in RT-PCR to amplify PTP sequences from breast cancer cells.
The 5'-primer corresponding to the conserved amino acids KCDQYWP [5' A
A (G/A) T G T (G/C) (C/A/T) (A/T/G/C) (G/C) (A/C) (A/G/T) T A (C/T) T G
G C C 3';1052-fold degeneracy] was paired with the 3'-primer
corresponding to the active site, HCSAGVG [5' C C (A/T/G/C) A (T/C)
(A/T/G/C) C C (A/T/G/C) G C (A/G) C T G C A G T G 3'; 256-fold
degeneracy]. The PCR reaction template was the cDNA synthesized using
RNA isolated from MCF 7 cells treated for 5 days with 50 nM
OH-Tam and the 3'-primer. The cDNA synthesis reaction was performed
with the M-MLV reverse transcriptase (GIBCO BRL) according to
manufacturers recommended instructions. The PCR reaction included 0.5
volume of the original cDNA synthesis reaction, 200 nM of
each primer, and 200 µM of each deoxynucleoside
triphosphate, along with the recommended reagent concentration in the
Taq DNA polymerase kit from Appligene (Illkirch, France).
The PCR conditions were: 95 C, 30 sec; 48 C, 30 sec; 70 C, 1 min; for
30 cycles. Products of the expected size (
280 bp) were isolated by
gel electrophoresis and cloned into the pGEMT vector (Promega,
Charbonnières, France). Ninety independent clones were screened
by differential hybridization with cDNA from control vs.
antiestrogen-treated MCF 7 cells (50 nM OH-Tam, 3 days).
Labeled cDNA probes were synthesized with the Moloney murine leukemia
virus-RT (GIBCO BRL) with the 3'-primer in the presence of 5 µCi
[
32P]dCTP (Amersham Life Science, 3000 Ci/mmol).
Hybridization in 50% formamide and the wash conditions were performed
as described (19). All clones hybridizing with at least one probe were
sequenced by the dideoxynucleotide method (kit Sequenase version 2.0,
Amersham Life Science, Les Ulis, France).
In Situ Hybridization
In situ hybridization, sections of frozen cells, and
quantification were performed as previously described (50). All sense
and antisense probes that corresponded to the PCR fragment cloned in
pGEMT vector were synthesized by in vitro RNA transcription
with the SP6/T7 kit system (Amersham Life Science).
Comparative RT-PCR
First-Strand cDNA Synthesis
Reactions were carried out using 1.5 µg total RNA and 0.6 µg
oligo(dT)15 (Boehringer-Mannheim, Meylan, France) with the
Moloney murine leukemia virus-RT (GIBCO BRL). To avoid Taq
polymerase inhibition, the RT product was diluted 30-fold with sterile
water. For each RNA, cDNA synthesis was duplicated in the same
conditions but without RT to control genomic DNA
contamination.
Oligonucleotide Primers
Primers used to amplify examined mRNAs were as follows:
constant GAPDH mRNA: TCCATGACAACTTTGGTAT-CGTGG,
GTCGCTGTTGAAGTCAGAGGAGAC;
LAR PTP mRNA: TCGGGAGATGGGCAGGGAGAAATG, CGGAGGAGAGGGGAGCGGTAGTTA;
FAP-1 PTP mRNA: AGGCAAAACAACAATGGTCAGCAA, GGTCTGGCCAGGCAGTGAAATTCA;
PCP-2 PTP mRNA: GGAGGACTCAGACACCTACGGGGA, ATCAGGTGGGGTGGAGGCCTTCAC.
The sizes of the amplified products were 377 bp for GAPDH, 523 bp for
LAR, 155 bp for FAP-1, and 223 bp for PCP-2.
PCR
PCR was carried out in a final volume of 25 µl containing 0.5 U
Taq polymerase (Appligene, Illkirch, France), 200
µM deoxynucleoside triphosphates, 0.2 µM of
the 5'- and 3'-primers from one set of primer, 1x final Taq
buffer (Appligene), 5 µl of 1:30 diluted reverse transcription
mixture and [
32P]dCTP (0.5 µCi) as tracer. The
samples were denatured initially at 94 C for 2 min, and amplification
was performed on a DNA thermal cycler (Trio Thermoblock, Biometra;
Kontron Instruments, Paris, France) for 1830 cycles including the
following steps: denaturation at 94 C for 45 sec, annealing at 58 C for
45 sec, and extension at 72 C for 75 sec. The number of cycles was
1820-2224 for GAPDH, 2224-2628 for LAR, 2426-2830 for
FAP-1, and 3032-3436 for PCP-2. After the indicated number of
cycles, 4 µl of each PCR sample were analyzed on a 6% polyacrylamide
minigel by electrophoresis. Radioactivity incorporated in each band was
quantified by counting with Fujix-Bas 1000 and plotted on a
semilogarithmic scale to verify exponential amplification. To correct
variations in the reverse transcription reaction efficiency, the signal
obtained for each PTP mRNA was divided by the signal obtained on the
same cDNA with the internal GAPDH control (constant mRNA). The final
results are expressed as a percentage of the basal mRNA levels measured
in control cells.
Plasmids and Transfections
The partial FAP-1 cDNA fragment 29677 was obtained by RT/PCR
and cloned in the pGEMT vector. The FAP-I antisense (FAP-1 AS) vector
was generated by antisense insertion of the pGEMT-FAP-1 fragment
SalI/SacII (blunt ended with T4 polymerase) in
SalI/SmaI cut pCI (Promega). pCI is a
cytomegalovirus major immediate-early gene enhancer/promoter-driven
expression vector. Stable transfectants of MCF7 cells were derived by
cotransfection of pSV2neo and FAP-1AS using the calcium phosphate
precipitation method (19), whereas mock transfectants were
cotransfected with pSV2neo and empty pCI vectors. After selection with
geneticin (200 µg/ml) for 21 days, colonies were picked and
established as stable cell lines.
Northern Blot
Total RNA was extracted with TRIzol reagent (GIBCO BRL), and 40
µg of RNA were analyzed by Northern blot as described (19). 36B4 full
cDNA, LAR full cDNA (34), FAP-1 antisense fragment 29677 (subcloned
in pGEMT), and FAP-1 fragments 50186687 and 62577198 (subcloned in
pGEMT by RT/PCR) were 32P-labeled by multiprime DNA
synthesis using an Amersham kit. Hybridization in 50% formamide and
the wash conditions were performed as described (19). Filters were
exposed to photo-stimulable plates, scanned, and quantified with a
Fujix-Bas 1000 scanner (RAYTEST, Courbevoie, France). The results
are expressed as a percentage of the basal mRNA levels measured in
control cells.
Cell Growth
Cells stripped of endogenous steroids were plated in triplicate
in 24-well dishes at a density of 20,000 cells per well in medium
containing 3% FCS/DCC. Two days later, the cells were treated with
various combinations of hormones, antihormones, and IGF-I for 7 days.
Growth was evaluated by total DNA measurement on three replicate wells
by the diaminobenzoic acid fluorimetric assay (LS-5 spectrometer, 405
nm excitation, 495 nm emission; Perkin-Elmer Corp.) after in
situ fixation with methanol (51). Results are expressed in
micrograms of DNA by reference to a calf thymus DNA standard curve.
PTP Assay
Cells stripped of endogenous steroids were treated for 4 days
with the indicated hormone, and solubilized membranes were prepared as
previously described (20). PTP activity was measured as the release of
[32P] orthophosphate from 32P-phosphorylated
poly (Glu,Ala,Tyr) 6:3:1 as in Ref. 20. The reaction was usually
allowed to proceed for 30 sec to 3 min, and two time-points along the
linear portion of the curve were used for final quantification.
 |
ACKNOWLEDGMENTS
|
|---|
We thank A. Wakeling (Zeneca, Macclesfield, UK) and E.
Salin-Drouin (Besins-Iscovesco, Paris, France) for ICI 182,780, ICI
164,384, and OH-Tam. We are grateful to M. Streuli and H. Saito for
providing LAR cDNA probe and P. Chambon for 36B4 cDNA probe. We thank
members of the laboratory for helpful comments and discussions on the
manuscript.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Françoise Vignon, Hormones and Cancer, INSERM Unit 14860, Rue de Navacelles, Montpellier, France 34090.
This work was supported by INSERM, the Association pour la Recherche
sur le Cancer (Grant 1411), and the Ligue Nationale contre le Cancer
(Grant 678).
Received for publication August 28, 1997.
Revision received November 28, 1997.
Accepted for publication January 3, 1998.
 |
REFERENCES
|
|---|
-
Lippman ME, Bolan G, Huff K 1976 The effect of estrogens
and antiestrogens on hormone-responsive human breast cancer in long
term tissue culture. Cancer Res 36:45954601[Abstract/Free Full Text]
-
Osborne CK, Hamilton B, Titus G, Livingston RB 1980 Epidermal
growth factor stimulation of human breast cancer cells in culture.
Cancer Res 40:23612366[Abstract/Free Full Text]
-
Furlanetto RW, DiCarlo JN 1984 Somatomedin-C receptors and
growth effects in human breast cancer cells maintained in long-term
tissue culture. Cancer Res 44:21222128[Abstract/Free Full Text]
-
Karey KP, Sirbasku DA 1988 Differential responsiveness of
human breast cancer cell line MCF7 and T47D to growth factors and
17ß- estradiol. Cancer Res 48:40834092[Abstract/Free Full Text]
-
Dickson RB, Lippman ME 1995 Growth factors in breast cancer.
Endocr Rev 16:559589[Abstract/Free Full Text]
-
Freiss G, Prébois C, Vignon F 1993 Control of breast
cancer cell growth by steroids and growth factors: interactions and
mechanisms. Breast Cancer Res Treat 27:5768[CrossRef][Medline]
-
Bunone G, Briand PA, Miksicek RJ, Picard D 1996 Activation of
the unliganded estrogen receptor by EGF involves the MAP kinase pathway
and direct phosphorylation. EMBO J 15:21742183[Medline]
-
Kato S, Endoh H, Masuhiro Y, Kitamoto T, Uchiyama S, Saski H,
Masushige S, Gotoh Y, Nishida E, Kawashima H, Metzger D, Chambon P 1995 Activation of the estrogen receptor through phosphorylation by
mitogen-activated protein kinase. Science 270:14911494[Abstract/Free Full Text]
-
Ignar-Trowbridge DM, Nelson KG, Bidwell MC, Curtis SW,
Washburn TF, McLachlan JA, Korach KS 1992 Coupling of dual signaling
pathways: EGF action involves the estrogen receptor. Proc
Natl Acad Sci USA 89:46584662[Abstract/Free Full Text]
-
Vignon F, Bouton MM, Rochefort H 1987 Antiestrogens inhibit
the mitogenic effect of growth factors on breast cancer cells in the
total absence of estrogens. Biochem Biophys Res Commun 146:15021508[CrossRef][Medline]
-
Freiss G, Prébois C, Rochefort H, Vignon F 1990 Anti-steroidal and anti-growth factor activities of anti-estrogens. J
Steroid Biochem Mol Biol 37:777781[CrossRef][Medline]
-
Curtis SW, Washburn TF, Sewall C, DiAugustine R, Lindzey J,
Couse JF, Korach KS 1996 Physiological coupling of growth factor and
steroid receptor signaling pathways: estrogen receptor knockout mice
lack estrogen-like response to epidermal growth factor. Proc Natl Acad
Sci USA 93:1262612630[Abstract/Free Full Text]
-
Jordan VC, Fritz NF, Tormey DC 1987 Endocrine effects of
adjuvant chemotherapy and long-term tamoxifen administration on
node-positive patients with breast cancer. Cancer Res 47:624630[Abstract/Free Full Text]
-
Love RR, Mazess RB, Barden HS, Epstein S, Newcomb PA, Jordan
VC, Carbone PP, DeMets DL 1992 Effects of tamoxifen on bone mineral
density in postmenopausal women with breast cancer. N Engl J
Med 326:852856[Abstract]
-
Love RR, Wiebe DA, Feyzi JM, Newcomb PA, Chappell RJ 1994 Effects of tamoxifen on cardiovascular risk factors in post-menopausal
women after 5 years of treatment. J Natl Cancer Inst 86:15341539[Abstract/Free Full Text]
-
Black LJ, Sato M, Rowley ER, Magee DE, Bekele A, Williams DC,
Cullinan GJ, Bendele R, Kaufman FR, Bensch WR, Frolik CA, Termine
JD, Bryant HU 1994 Raloxifen (LY 139481) prevents bone loss and reduces
serum cholesterol without causing uterine hypertrophy in ovariectomized
rats. J Clin Invest 93:6393
-
Sumida C, Pasqualini JR 1989 Antiestrogens antagonize the
stimulatory effect of epidermal growth factor on the induction of
progesterone receptor in fetal uterine cells in culture. Endocrinology 124:591597[Abstract/Free Full Text]
-
Katzenellenbogen BS, Norman MJ 1990 Multihormonal regulation
of the progesterone receptor in MCF7 human breast cancer cells:
interrelationships among insulin, insulin-like growth factor-I, serum
and estrogen. Endocrinology 126:891898[Abstract/Free Full Text]
-
Philips A, Chalbos D, Rochefort H 1993 Estradiol increases and
anti-estrogens antagonize the growth factor-induced activator
protein-1 activity in MCF7 cells breast cancer cells without affecting
c-fos and c-jun synthesis. J Biol Chem 268:1410314108[Abstract/Free Full Text]
-
Freiss G, Vignon F 1994 Antiestrogens increase protein
tyrosine phosphatase activity in human breast cancer cells. Mol
Endocrinol 8:13891396[Abstract/Free Full Text]
-
Krueger NX, Streuli M, Saito H 1990 Structural diversity and
evolution of human receptor-like protein tyrosine phosphatases. EMBO J 9:32413252[Medline]
-
Mauro LJ, Dixon JE 1994 Zip codes direct intracellular
protein tyrosine phosphatases to the correct cellular address.
Trends Biochem Sci 19:151155[CrossRef][Medline]
-
Zondag GC, Koningstein GM, Jiang YP, Sap J, Moolenar WH,
Gebbink MF 1995 Homophilic interactions mediated by receptor tyrosine
phosphatases µ and kappa A critical role for the novel extracellular
MAM domain. J Biol Chem 270:1424714250[Abstract/Free Full Text]
-
Champion-Arnaud P, Gesnel MC, Foulkes N, Ronsin C,
Sassone-Corsi P, Breathnach R 1991 Activation of transcription via AP-1
or CREB regulatory sites is blocked by protein tyrosine phosphatases.
Oncogene 6:12031209[Medline]
-
Mooney RA, Freund GG, Way BA, Bordwell KL 1992 Expression of a
transmembrane phosphotyrosine phosphatase inhibits cellular response to
platelet-derived growth factor and insulin-like growth factor-1. J
Biol Chem 267:2344323446[Abstract/Free Full Text]
-
Yang Y, Gil M, Byun SM, Choi I, Pyun KH, Ha H 1996 Transforming growth factor-ß1 inhibits human keratinocyte
proliferation by upregulation of a receptor-type tyrosine phosphatase
R-PTP-kappa gene expression. Biochem Biophys Res Commun 228:807812[CrossRef][Medline]
-
Lammers R, Bossenmaier B, Cool DE, Tonks NK, Schlessinger J,
Fischer EH, Ullrich A 1993 Differential activities of protein tyrosine
phosphatases in intact cells. J Biol Chem 268:2245622462[Abstract/Free Full Text]
-
Aparicio LF, Ocrant I, Boylan JM, Gruppuso PA 1992 Protein
tyrosine phosphatase activation during nerve growth factor-induced
neuronal differentiation of PC12 cells. Cell Growth Differ 3:363367[Abstract]
-
den Hertog J, Pals CEGM, Peppelenbosch MP, Tertoolen LGJ,
de Laat SW, Kruijer W 1993 Receptor protein tyrosine phosphatase
activates pp60c-src and is involved in neuronal
differentiation. EMBO J 12:37893798[Medline]
-
Keane MM, Lowrey GA, Ettenberg SA, Dayton MA, Lipkowitz S 1996 The protein tyrosine phosphatase DEP-1 is induced during
differentiation and inhibits growth of breast cancer cells. Cancer Res 56:42364243[Abstract/Free Full Text]
-
Millar JB, Mc Gowan CH, Lenaers G, Jones R, Russell P 1991 p80cdc25 mitotic inducer is the tyrosine phosphatase that activates
p34cdc2 kinase in fission yeast. EMBO J 10:43014309[Medline]
-
Mustelin T, Coggeshall KM, Altman A 1989 Rapid activation of
the T-cell tyrosine protein kinase pp561ck by the CD45 phosphotyrosine
phosphatase. Proc Natl Acad Sci USA 86:63026306[Abstract/Free Full Text]
-
Zheng XM, Wang Y, Pallen CJ 1992 Cell transformation and
activation ofpp60c-src by overexpression of a protein
tyrosine phosphatase. Nature 359:336339[CrossRef][Medline]
-
Streuli M, Krueger NX, Tsai AY, Saito H 1989 A family of
receptor-linked protein phosphatases in humans and
Drosophila. Proc Natl Acad Sci USA 86:86988702[Abstract/Free Full Text]
-
Wang H, Lian Z, Lerch MM, Chen Z, Xie W, Ullrich A 1996 Characterization of PCP-2, a novel receptor protein tyrosine
phosphatase of the MAM family domain. Oncogene 12:25552562[Medline]
-
Streuli M, Krueger NX, Hall LR, Schlossman SF, Saito H 1988 A
new member of the immunoglobulin superfamily that has a cytoplasmic
region homologous to the leukocyte common antigen. J Exp Med 168:15231530[Abstract/Free Full Text]
-
Banville D, Ahmad S, Stocco R, Shen SH 1994 A novel
protein-tyrosine phosphatase with homology to both the
cytoskeletal proteins of the band 4.1 family and
junction-associated guanylate kinases. J Biol Chem 269:2232022327[Abstract/Free Full Text]
-
Saras J, Claesson-Welsh L, Heldin CH, Gonez LJ 1994 Cloning
and characterization of PTPL1, a protein tyrosine phosphatase with
similarities to cytoskeletal-associated proteins. J Biol Chem 269:2408224089[Abstract/Free Full Text]
-
Sato T, Irie S, Kitada S, Reed JC 1995 FAP-1: a protein
tyrosine phosphatase that associates with Fas. Science 268:411415[Abstract/Free Full Text]
-
Maekawa K, Imagawa N, Nagamatsu M, Harada S 1994 Molecular
cloning of a novel protein-tyrosine phosphatase containing a
membrane-binding domain and GLGF repeats. FEBS Lett 337:200206[CrossRef][Medline]
-
Kulas DT, Zhang WR, Goldstein BJ, Furnaletto RW, Mooney RA 1995 Insulin receptor signaling is augmented by antisense inhibition of
the protein tyrosine phosphatase LAR. J Biol Chem 270:24352438[Abstract/Free Full Text]
-
Streuli M, Krueger NX, Arinielo PD, M Tang M, Munro JM,
Blattler WA, Adler DA, Disteche CM, Saito H 1992 Expression of the
receptor-linked protein tyrosine phosphatase LAR: proteolytic cleavage
and shedding of the CAM-like extracellular region. EMBO J 11:897907[Medline]
-
Serra-Pagès C, Kedersha NL, Fazikas L, Medley Q,
Debant A, Streuli M 1995 The LAR transmembrane protein tyrosine
phosphatase and a coiled-coil LAR-interacting protein co-localize at
focal adhesions. EMBO J 14:28272838[Medline]
-
Mauro LJ, Olmsted EA, Skrobacz BM, Mourey RJ, Davis AR, Dixon
JE 1994 Identification of a hormonally regulated protein tyrosine
phosphatase associated with bone and testicular differentiation. J
Biol Chem 269:3065930667[Abstract/Free Full Text]
-
Zhao Z, Shen SH, Fischer EH 1994 Phorbol ester-induced
expression, phosphorylation, and translocation of protein tyrosine
phosphatase 1C in HL-60 cells. Proc Natl Acad Sci USA 91:50075011[Abstract/Free Full Text]
-
Montano MM, Katzenellenbogen BS 1997 The quinone reductase
gene: a unique estrogen-receptor regulated gene that is activated by
antiestrogens. Proc Natl Acad Sci USA 94:25817[Abstract/Free Full Text]
-
Nagata S, Golstein P 1995 The Fas death factor. Science 267:14491456[Abstract/Free Full Text]
-
Keane MM, Ettenberg SA, Lowrey GA, Russell EK, Lipkowitz S 1996 Fas expression and function in normal and malignant breast cell
lines. Cancer Res 56:47914798[Abstract/Free Full Text]
-
Guvakova MA, Surmacz E 1997 Tamoxifen interferes with the
insulin-like growth factor I receptor (IGF-IR) signaling pathway
in breast cancer cells. Cancer Res 57:26062610[Abstract/Free Full Text]
-
Escot C, LeRoy X, Chalbos D, Joyeux C, Simonsen E, Daures JP,
Soussaline F, Rochefort H 1991 Computer-aided quantification of RNA
levels detected by in situ hybridization of tissue sections.
Anal Cell Pathol 3:215224[Medline]
-
Kissane JM, Robins E 1958 The fluorometric measurement of
deoxyribonucleic acid in animal tissues with special reference to the
central nervous system. J Biol Chem 233:1848[Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. Dromard, G. Bompard, M. Glondu-Lassis, C. Puech, D. Chalbos, and G. Freiss
The Putative Tumor Suppressor Gene PTPN13/PTPL1 Induces Apoptosis through Insulin Receptor Substrate-1 Dephosphorylation
Cancer Res.,
July 15, 2007;
67(14):
6806 - 6813.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.-M. Gaben, C. Saucier, M. Bedin, G. Redeuilh, and J. Mester
Mitogenic Activity of Estrogens in Human Breast Cancer Cells Does Not Rely on Direct Induction of Mitogen-Activated Protein Kinase/Extracellularly Regulated Kinase or Phosphatidylinositol 3-Kinase
Mol. Endocrinol.,
November 1, 2004;
18(11):
2700 - 2713.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Wang, D. Shen, D. W. Parsons, A. Bardelli, J. Sager, S. Szabo, J. Ptak, N. Silliman, B. A. Peters, M. S. van der Heijden, et al.
Mutational Analysis of the Tyrosine Phosphatome in Colorectal Cancers
Science,
May 21, 2004;
304(5674):
1164 - 1166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Bompard, M. Martin, C. Roy, F. Vignon, and G. Freiss
Membrane targeting of protein tyrosine phosphatase PTPL1 through its FERM domain via binding to phosphatidylinositol 4,5-biphosphate
J. Cell Sci.,
June 15, 2003;
116(12):
2519 - 2530.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Bompard, C. Puech, C. Prebois, F. Vignon, and G. Freiss
Protein-tyrosine Phosphatase PTPL1/FAP-1 Triggers Apoptosis in Human Breast Cancer Cells
J. Biol. Chem.,
November 27, 2002;
277(49):
47861 - 47869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Oesterreich, P. Zhang, R. L. Guler, X. Sun, E. M. Curran, W. V. Welshons, C. K. Osborne, and A. V. Lee
Re-expression of Estrogen Receptor {alpha} in Estrogen Receptor {alpha}-negative MCF-7 Cells Restores both Estrogen and Insulin-like Growth Factor-mediated Signaling and Growth
Cancer Res.,
August 1, 2001;
61(15):
5771 - 5777.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. E. Favoni and A. De Cupis
The Role of Polypeptide Growth Factors in Human Carcinomas: New Targets for a Novel Pharmacological Approach
Pharmacol. Rev.,
June 1, 2000;
52(2):
179 - 206.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Lee, J. G. Jackson, J. L. Gooch, S. G. Hilsenbeck, E. Coronado-Heinsohn, C. K. Osborne, and D. Yee
Enhancement of Insulin-Like Growth Factor Signaling in Human Breast Cancer: Estrogen Regulation of Insulin Receptor Substrate-1 Expression in Vitro and in Vivo
Mol. Endocrinol.,
May 1, 1999;
13(5):
787 - 796.
[Abstract]
[Full Text]
|
 |
|