| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Pharmacology (K.N., M.A.) The University of Iowa
College of Medicine Iowa City, Iowa 52242
Department of
Pharmacology (R.W.H.) The University of Texas Medical School
Houston, Texas 77225
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The LH/CG (LHR) and FSH (FSHR) receptors, collectively known as the gonadotropin receptors, are members of the rhodopsin-like subfamily of GPCRs (8) and bind their respective ligands with high affinities (10-9-10-10 M). Since the bound hormones dissociate very slowly, we reasoned that the LHR and FSHR may utilize unusual mechanisms for deactivation, and we embarked on a series of studies designed to determine the molecular basis of their deactivation.
Like other GPCRs, the rat LHR (rLHR) and rat FSHR (rFSHR) become rapidly phosphorylated in response to agonist stimulation and, at least in the case of the LHR, phosphorylation facilitates agonist-induced uncoupling and internalization (reviewed in Refs. 9 and 10). Our studies on the rLHR have progressed to the point where the phosphorylation sites have been identified as four serine residues located in the C-terminal tail (11, 12, 13, 14). On the other hand, the studies on the identification of the rFSHR phosphorylation sites and their functional significance have lagged behind because of the abundance of potential phosphorylation sites. In contrast to the rLHR, which is phosphorylated only on serine residues (12), the rFSHR is phosphorylated on serine and threonine residues, and there are 25 such residues in the intracellular regions of the rFSHR that may serve as phosphorylation sites (15).
In a previous publication we prepared a C-terminally truncated mutant of the rFSHR that removed all but one of the S/T residues present in the C-terminal tail and showed that the agonist-induced phosphorylation of this mutant is completely preserved (16). While these studies eliminated 12 of the 25 S/T residues as potential phosphorylation sites, they provided little information about the location of the residues that become phosphorylated. The experiments presented herein were thus designed to determine the location of the phosphorylation sites in the rFSHR and to characterize the functional impact of rFSHR phosphorylation.
| RESULTS |
|---|
|
|
|---|
|
|
The results presented in Fig. 2
show that the most prominent peptide
generated by exhaustive N-chlorosuccinimide cleavage of the
phosphorylated rFSHR migrates slightly above the 6.5-kDa size marker
with an apparent size similar to the predicted molecular mass of
peptide 1 (7.4 kDa, see above), which contains the first intracellular
loop. There is an additional faint band slightly above this prominent
peptide and another prominent phosphopeptide that is resolved in the
gel and migrates slightly above the 26.6-kDa size marker. This
phosphopeptide is larger than peptide 4 (22 kDa, see above), which is
the largest putative phosphopeptide and is predicted to contain the
third intracellular loop and C-terminal tail. The largest
phosphopeptide shown in Fig. 2
may represent peptide 4, which migrates
anomalously because of the phosphate groups or an incomplete
degradation product. The latter is not an unlikely possibility as
incomplete cleavage of the tryptophan residues at position 476 would
leave peptides 3 and 4 together to yield an incomplete degradation
product with a predicted size of 25 kDa, while incomplete digestion of
the tryptophan residues at positions 450 and 476 would leave peptides
2, 3, and 4 together to yield an incomplete degradation product with a
predicted size of 28.6 kDa. The 25-kDa phosphopeptide resulting from
incomplete digestion would, like predicted peptide 4, have only those
S/T residues present in the third intracellular loop and the C-terminal
tail. The 28.6-kDa phosphopeptide resulting from incomplete digestion
would, however, also contain the two T residues present in the second
intracellular loop.
Clearly an unambiguous identification of the phosphopeptides shown in
Fig. 2
cannot be done without amino acid sequencing. The small amounts
of radioactive peptides obtained precluded this possibility, however.
On the other hand, we believe that it is reasonable to conclude that
the
7-kDa phosphopeptide shown in Fig. 2
represents the peptide
containing the first intracellular loop, and we thus targeted these
residues for mutagenesis. We also directed our attention to the S/T
residues present in the third intracellular loop, and to
S624 present in the C-terminal tail. The other 12 S/T
residues present in the C-terminal tail downstream of S624
have already been excluded as potential phosphorylation sites by the
finding that a C-terminal truncation of the rFSHR at residue 635
(c.f. Fig. 1
) does not affect phosphorylation (16).
Expression vectors encoding for mutations of the phosphorylation sites
present in the first and third intracellular loops of the rFSHR were
constructed and analyzed. Initially we mutated three or all four S/T
residues present in the first intracellular loop to A (Fig. 1
) but
found that the mutated rFSHR were not expressed at the cell surface
upon transfection. Rat FSHR-1L, a mutant in which three of the four S/T
residues present in the first intracellular loop were mutated to I or N
as shown in Fig. 1
was eventually used because this was the only mutant
that was appropriately expressed upon transfection (see below). These
mutations were designed based on the sequences of the first
intracellular loop of the ovine, bovine, and porcine FSHR (19, 20, 21), the
human TSH receptor (22), and the two glycoprotein hormone-like
receptors recently identified in sea urchins and Drosophila
(23, 24). One or more of these receptors have an I in the position
equivalent to T371 and S373 of the rFSHR and/or
a N in the position equivalent to T378 of the rFSHR (Fig. 1
). T372, the other potential phosphorylation site present
in the first intracellular loop of the rFSHR, was left intact in
rFSHR-1L simply because mutations of this residue prevented cell
surface expression of the transfected cDNA.
rFSHR-3L was prepared by mutating all S/T residues in the third
intracellular loop to A as shown in Fig. 1
. rFSHR-(3L + CT) was
prepared by mutating all S/T residues in the third intracellular loop
and S624 in the C-terminal tail to A as shown in Fig. 1
.
This last mutant was constructed because S624 is the only
potential phosphorylation site present in the C-terminal tail that was
not excluded by our previous experiments (16). All of these mutations
were well tolerated as judged by cell surface expression of the mutant
receptors. We also constructed one additional mutant that combined the
mutations introduced in the first and third intracellular loop. This
mutant was not expressed upon transfection, however.
Stable cell lines expressing rFSHR-1L, rFSHR-3L, and rFSHR-(3L+CT) were
readily obtained by transfection and selection of human kidney 293
cells. One clonal cell line for each mutant was selected for further
study. This selection was based entirely on binding capacity and our
ability to match the binding capacity of cell lines expressing mutant
receptors with a cell line expressing an equivalent density of rFSHR-wt
(Table 1
). Table 1
also shows that
all mutant receptors bound hFSH with comparable affinities to that of
the rFSHR-wt. As shown in Table 2
all
cell lines expressing the mutant receptors respond to hFSH with a
robust increase in cAMP accumulation. When compared with cell lines
expressing an equivalent density of rFSHR-wt, cells expressing rFSHR-3L
have an elevated basal level of cAMP and an elevated maximal response
to hFSH. The EC50 for hFSH-induced cAMP accumulation is
comparable to that of cells expressing rFSHR-wt, however. The maximal
response to hFSH is also elevated in cells expressing rFSHR-(3L + CT),
but the basal levels and the EC50 for the FSH response are
comparable to those expressing rFSHR-wt. Cells expressing rFSHR-1L also
display an elevated basal level of cAMP, but the EC50 for
the hFSH response and the maximal hFSH response are comparable to those
of cells expressing an equivalent density of rFSHR-wt. The elevated
basal levels of cAMP observed in cells expressing rFSHR-3L or rFSHR-1L
operationally define these mutants as being constitutively active. The
results obtained with rFSHR-3L are not necessarily unexpected as
mutations in some residues of the third intracellular loop of other
GPCRs such as the
2-adrenergic receptor (25) and the closely related
TSH receptor (26) have been previously shown to induce constitutive
activation. To our knowledge, however, there are no reports of
mutations of the first intracellular loop that result in the
constitutive activation of other GPCRs. Lastly, the data presented in
Tables 1
and 2
also show that, when comparing cell lines expressing
different densities of rFSHR-wt [such as 293F(wt-103) and
293F(wt-10)], the EC50 for the hFSH-induced cAMP response
is inversely proportional to receptor density, while the maximal cAMP
response is basically independent of receptor density. While these
findings are not unexpected (27), conclusions about changes in the
maximal cAMP response should be made with caution because there is an
inherent variability in these experiments that is difficult to correct
for. This is illustrated in Table 2
by the variable cAMP response of
the different cell lines to cholera toxin (CT).
|
|
Phosphorylation of rFSHR Mutants
Although the principal aim of this study is to identify the sites
of the rFSHR that become phosphorylated in response to agonist
stimulation, all cells expressing rFSHR mutants were also tested for
PMA-induced phosphorylation (15, 16). The finding that addition of PMA
leads to the phosphorylation of the rFSHR should not be taken to mean
that protein kinase C is the mediator of the phosphorylation induced by
agonist stimulation, however, as our previous data indicate that prior
down-regulation of protein kinase C has only a small effect on the
agonist-stimulated phosphorylation of the rFSHR (15).
Cells expressing each of the mutants described above were metabolically
labeled with 32Pi, and then stimulated with hFSH or PMA
(15, 16). Cell extracts were prepared, and equal amounts of the
wild-type (wt) and mutant receptors (calculated based on the binding
data shown in Table 1
) were immunoprecipitated, resolved on SDS gel,
and visualized by autoradiography as shown in Fig. 3
. The results of several experiments
were quantitated by densitometry, and these data are summarized in Fig. 4
.
|
|
The data presented in Fig. 4
also show that the hFSH-induced
phosphorylation is decreased by 89% in rFSHR-1L. The magnitude of this
decrease in phosphorylation is surprising because rFSHR-1L retains all
the phosphorylation sites present in the third intracellular loop,
which as shown above account for roughly 50% of the phosphorylation
detected in the rFSHR-wt. Clearly then, the mutation of S/T residues in
loop 1 affects phosphorylation above and beyond that expected from the
loss of phosphorylation of these sites. There are two possible
explanations for this result: 1) the S/T residues present in loop 1 are
not phosphorylated at all, and the mutation of these S/T residues
indirectly prevents the phosphorylation of the other S/T residues left
unchanged in rFSHR-1L; 2) the S/T residues present in loop 1 are
phosphorylated and that the virtual loss of phosphorylation
detected in rFSHR-1L is due to the prevention of phosphorylation of the
S/T residues present in loop 1 as well as to an indirect effect that
prevents phosphorylation of the other S/T residues left unchanged in
this mutant. The identification of a major
7-kDa phosphopeptide
in Fig. 2
corresponding to the size of that predicted to contain loop 1
provides compelling evidence for the phosphorylation of loop 1 and
favors the latter explanation.
The results presented in Fig. 4
show that the PMA-induced
phosphorylation of the rFSHR also occurs in the first and third
intracellular loops. In contrast to the results discussed above,
however, the PMA-induced phosphorylation signal detected in cells
expressing rFSHR-3L, rFSHR-(3L + CT), or rFSHR-1L is reduced to
3040% of that detected in cells expressing rFSHR-wt. These results
indicate that the first and third intracellular loops are
phosphorylated to about the same extent when cells are stimulated with
PMA and underscore an additional difference between the agonist- and
PMA-induced phosphorylation (see Discussion).
Functional Correlates of rFSHR Phosphorylation
Based on the data presented above, we focused our attention on
cells expressing rFSHR-1L and rFSHR-3L as tools to determine the impact
of rFSHR phosphorylation on agonist-induced uncoupling and
internalization. rFSHR-3L was chosen over rFSHR-(3L+CT) because a few
preliminary experiments (not shown) showed that the functional
properties of these two mutants were indistinguishable.
We use the term uncoupling to describe a phenomenon whereby cells
exposed to hFSH lose responsiveness (measured by cAMP accumulation) to
a subsequent stimulation with hFSH without a change in the density of
cell surface rFSHR (16). A time course for the hFSH-induced uncoupling
of cells expressing rFSHR-wt, rFSHR-1L, or rFSHR-3L is illustrated
in Fig. 4
. These data show that a 15-min exposure of cells expressing
the rFSHR-wt result in a 50% reduction in the cAMP response stimulated
by hFSH. In contrast, the hFSH-induced uncoupling is retarded, but not
abolished, in cells expressing rFSHR-1L or rFSHR-3L. Since the extent
of the retardation is very similar in cells expressing rFSHR-1L and in
cells expressing rFSHR-3L, we conclude that the phosphorylation of the
third intracellular loop is particularly important for agonist-induced
uncoupling.
We use the term internalization to describe the actual movement of the
hormone-receptor complex from the cell surface to the cell interior.
Biochemically the surface-bound and internalized
[125I]hFSH can be differentiated by briefly exposing the
cells to an isotonic pH 3 buffer (28, 29), and the rate of
internalization of [125I]hFSH can be measured by
comparing the ratio of internalized to surface-bound radioactivity in
cells incubated with [125I]hFSH at 37 C for short periods
of time (30). The results of a representative experiment designed to
measure internalization of [125I]hFSH are shown in Fig. 6
, and a summary of the results obtained in several experiments is
shown in Table 3
. These results show that
the rate of internalization of hFSH is slightly enhanced in cells
expressing rFSHR-3L, but it is decreased about 2-fold in cells
expressing rFSHR-1L. We conclude from these experiments that the
agonist-induced phosphorylation of the rFSHR at the third intracellular
loop is not necessary for agonist-induced internalization. The results
obtained with cells expressing rFSHR-1L clearly show that the
agonist-induced phosphorylation of the rFSHR is needed to attain a rate
of internalization comparable to that of the rFSHR-wt. We cannot
determine, however, whether this is due to the phosphorylation of the
first loop only or of the first and third loops. It is also worth
noting that there is no correlation between the levels of cAMP
generated in a given cell line and the rate of internalization inasmuch
as the cAMP response of cells expressing rFSHR-1L or rFSHR-3L is as
good or better than that of cells expressing rFSHR-wt (c.f.
Table 2
). These results are, in fact, quite similar to those obtained
with the closely related rLHR where the mutation of phosphorylation
sites has also been shown to retard agonist-induced internalization
(14). Moreover, other studies performed with the rLHR have shown that
agonist-induced internalization is retarded in activation-deficient
mutants of this receptor (31), but this retardation is not due to the
inability of these mutants to respond with increased levels of cAMP
(32).
|
|
|
| DISCUSSION |
|---|
|
|
|---|
The data presented here show that the rFSHR is phosphorylated in the
first and third intracellular loops. The presence of phosphorylation
sites in the first intracellular loop is supported by the
peptide-mapping experiments, which revealed a phosphopeptide of the
predicted size for the cleavage product expected to contain the first
intracellular loop (Fig. 2
). Moreover, the simultaneous mutation of
several S/T residues present in the first intracellular loop
substantially reduced receptor phosphorylation (Figs. 3
and 4
). The
presence of phosphorylation sites in the third intracellular loop is
supported by similar experiments. Although the peptide-mapping
experiments revealed a phosphopeptide somewhat larger than that
predicted to contain the third intracellular loop (Fig. 2
), mutation of
all the S/T residues in the third intracellular loop reduced receptor
phosphorylation by at least 50% (Figs. 3
and 4
). Together these data
provide compelling evidence for the phosphorylation of the rFSHR at the
first and third intracellular loops. The presence of phosphorylation
sites in the second intracellular loop cannot yet be formally excluded,
however, because we have not performed mutagenesis of the
phosphorylation sites present in this loop. To our knowledge this is
the first report of a GPCR that is phosphorylated in two different
intracellular loops. The majority of the GPCRs are phosphorylated in
the C-terminal tail. There are only two other GPCRs, the
2A-adrenergic (33) and the m2 muscarinic (34, 35) receptors, that
are known to be phosphorylated in the third intracellular loop.
The simultaneous mutation of all S/T residues present in the third
intracellular loop of the rFSHR does not reduce hFSH binding affinity
or signal transduction (Tables 1
and 2
). It does, however, reduce
hFSH-stimulated receptor phosphorylation by 4060% (Figs. 3
and 4
).
This partial reduction in phosphorylation is associated with a
retardation of the hFSH-induced uncoupling of the hFSH-responsive
adenylyl cyclase (Fig. 5
) and a slight
increase in the rate of endocytosis of the bound hFSH (Fig. 6
and Table 3
). The simultaneous mutation
of all S/T residues present in the third intracellular loop and
S624, the only residue in the C-terminal tail that had not
been previously excluded as a potential phosphorylation site (16),
results in a slight additional reduction in agonist-induced
phosphorylation over that detected in the rFSHR in which only the S/T
residues present in the third loop were mutated (Figs. 3
and 4
). While
these data do not allow us to make firm conclusions about
S624 as a potential phosphorylation site, they clearly show
that some, but not all, of the phosphorylation sites are present in the
third intracellular loop, and that the phosphorylation of these
residues facilitates agonist-induced uncoupling.
|
Since the retardation of agonist-induced uncoupling is similar in
rFSHR-1L and rFSHR-3L (Fig. 5
), we can readily conclude that the
phosphorylation of the third intracellular loop is particularly
important for this effect. In contrast, a comparison of the rates of
internalization of rFSHR-1L and rFSHR-3L (Fig. 6
and Table 3
) clearly
show that the loss of phosphorylation of the third loop alone does not
slow down agonist-induced internalization. The data presented do not
allow us to determine whether the decrease in the rate of
agonist-induced internalization detected in the
phosphorylation-deficient mutant is due to the phosphorylation of the
first loop alone or to the phosphorylation of both the first and third
loops. It seems clear from these studies, however, that the
phosphorylation of different domains is needed for agonist-uncoupling
and for agonist-induced internalization. This conclusion is
consistent with recent studies of the m2 muscarinic receptor showing
that the agonist-induced uncoupling and internalization of this
receptor are mediated by the phosphorylation of different domains
present in the third cytoplasmic loop (35).
The rFSHR is also phosphorylated when transfected cells are stimulated
with PMA (15), and this phosphorylation is fully preserved in
rFSHR-t635, a C-terminal truncation that removes 12 of the 25 potential
phosphorylation sites (16). The studies presented here show that
PMA-induced phosphorylation is reduced by 4060% in rFSHR-3L and
rFSHR-(3L+CT). This reduction is similar to that detected when the
phosphorylation of these mutants is stimulated by agonist (Figs. 3
and 4
). In contrast to the virtual loss of agonist-induced phosphorylation
detected in rFSHR-1L, PMA-induced phosphorylation is again reduced by
only 4060% in this mutant (Figs. 3
and 4
). Thus, together with our
previous studies utilizing rFSHR-t635, we can now conclude that the
first and third intracellular loops have sites that become
phosphorylated in response to PMA stimulation. Unfortunately, a mutant
in which the S/T residues present in both the first and third
intracellular loops were mutated was not expressed and could not be
analyzed for PMA-induced phosphorylation. Moreover, we cannot exclude
the second intracellular loop as an additional locus for PMA-stimulated
phosphorylation until additional mutagenesis studies are performed.
The two mutants, rFSHR-1L and rFSHR-3L, which are partially deficient
in PMA-induced phosphorylation, still exhibit a PMA-induced uncoupling
of the hFSH-responsive adenylyl cyclase comparable to that detected in
cells expressing rFSHR-wt (Table 4
). Therefore, if the PMA-induced
phosphorylation of the rFSHR is responsible for the PMA-induced
uncoupling, the phosphorylation of sites present in both the first and
third intracellular loops must be needed before this uncoupling can
occur. The differences reported here between the hFSH- and
PMA-stimulated phosphorylation of the rFSHR are not surprising in view
of the findings that protein kinase C is at best only partially
responsible for the rFSHR phosphorylation stimulated by hFSH (15).
Moreover, the functional properties of the hFSH- and PMA-induced
phosphorylation are different. The hFSH-induced uncoupling results in a
reduction in agonist efficacy without affecting its potency, while the
PMA-induced uncoupling results mostly in a reduction in agonist
efficacy (15, 16).
As already mentioned above, there are two other GPCRs that have been
shown to be phosphorylated in the third intracellular loop, the
2A-adrenergic and the m2 muscarinic receptors. Although the third
intracellular loops of these two receptors are much longer (more than
150 residues) than that of the rFSHR (
20 residues), the third
intracellular loops of all three receptors are characterized by the
presence of one or more clusters of three to four S/T residues.
Phosphorylation of the m2 muscarinic receptor occurs in two clusters of
three adjacent S/T residues separated from a fourth S/T by a single
amino acid and flanked by one or more acidic residues (34, 35). The
residues of the
2A-adrenergic receptor that become phosphorylated
after agonist stimulation have been identified as four adjacent serine
residues that are followed by a D
(S296,S297,S298,S299,D300),
and the suggestion was made that similar sequences found in several
other GPCRs may be an important phosphorylation motif (33). It is thus
interesting to note that the third intracellular loop of the rFSHR,
which is identified in this paper as an important locus for
phosphorylation, contains a four-serine cluster followed by a D (Fig. 1
). In this respect it is also interesting to note that the
S545,S546,S547,S548,D549
cluster, as well as T537 and T550 in the third
intracellular loop of the rFSHR, is fully conserved among the human,
rat, bovine, ovine, and porcine FSH receptors (19, 20, 21, 24, 36, 37).
Lastly, it is interesting to compare the amino acid sequences of the
rFSHR and the highly related rLHR because the phosphorylation sites of
the latter have been recently identified as four serine residues
(S635, S639, S649, and
S652) located in the C-terminal tail (11, 12, 14). Only two
of the four residues phosphorylated in the rLHR (S635 and
S649) are conserved in the rFSHR as S641 and
S655 (Fig. 1
), but neither are phosphorylated (16).
Likewise, while some of the rFSHR residues identified here as
phosphorylation sites are conserved in the rLHR, they are not
phosphorylated in the latter. These include the equivalent of
T372, S373, and T378 present in the
first intracellular loop as well as T550 present in the
third intracellular loop of the rFSHR (Fig. 1
).
In summary, four conclusions can be drawn from the present studies. First, the phosphorylated rFSHR is a common molecular intermediate in agonist-induced uncoupling and internalization. Second, the agonist-induced phosphorylation of the rFSHR occurs in the first and third intracellular loops. Third, the phosphorylation of the third intracellular loop facilitates agonist-induced uncoupling but is not necessary for agonist-induced internalization. Fourth, agonist-induced internalization is facilitated by phosphorylation but it is not known whether only the first loop, only the third loop, or both the first and third loops need to be phosphorylated for this response.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The mutants used here were constructed by PCR with overlap extension
(38). rFSHR-1L was constructed by mutating the nucleotide sequence
within the first intracellular loop of the rFSHR from
1159ACCACAAGCCAATACAAACTAACT1182 to
1159ATCACAATCCAATACAAACTAAAT1182
thus changing the amino acid sequence within the first loop from
T369TSQYKLT376 to
I369TIQYKLN376
(see Fig. 1
). rFSHR-3L was constructed by mutating the nucleotide
sequence around the third intracellular loop of the rFSHR from
1659A-CAGTGAGGAATCCTACCATTGTGTCCTCATCAAGCGACA-CC1701
to
1659GCAGTGAGGAATCCTGCCATTGTGGCCGCAGCAGCCGACGCC1701
thus changing the amino acid sequence within the third loop from
T536VRNPTIVSSSSDT549 to
A536VRNPAIVAAAADA549
(see Fig. 1
). Rat FSHR-(3L+CT) was constructed using rFSHR-3L as the
template and mutating codon 1920 from ACG to GCC
thus mutating residue 624 from S to A (see Fig. 1
). The sequence of the
entire region of each mutant cDNA generated by PCR was verified by
automated DNA sequencing.
The origin and handling of the parental human embryonic kidney (293) cells and the methods used for transfection and isolation of clonal cell lines stably transfected with the wt or mutant rFSHR cDNAs have been described in detail elsewhere (15, 16).
Hormone Binding and cAMP Accumulation
Binding parameters for hFSH were measured during a 1-h
incubation of intact cells (plated in 35-mm wells) with increasing
concentrations of [125I]hFSH at 37 C. All binding assays
were corrected for nonspecific binding, which was measured in the
presence of 100 µg/ml PMSG. The binding of hFSH to intact cells at 37
C is clearly not reversible because the bound hormone is internalized
(c.f. Fig. 6
). Since the irreversible nature of the binding
reaction precludes the measurement of equilibrium binding parameters
(i.e. binding affinity and maximal binding capacity), we
simply fitted the binding data to a sigmoidal equation (39) using the
DeltaGraph software Deltapoint (Monterey, CA) and used this equation to
calculate the maximal amount of cell-associated hormone and the
concentration of hFSH required to attain half of this value
(EC50).
Concentration-response curves for the hFSH-induced increases in cAMP accumulation were obtained by measuring total cAMP levels in cells (plated in 35-mm wells) that had been incubated with at least five different concentrations of hFSH for 15 min at 37 C in the presence of a phosphodiesterase inhibitor. The different parameters that describe the concentration response curves were calculated as described elsewhere (16).
Phosphorylation
Metabolic labeling of cells with 32Pi
immunoprecipitation of the rFSHR and electrophoresis of the
immunoprecipitated receptor were done as previously described (15, 16, 40). Receptor phosphorylation was ascertained after the
32Pi-prelabeled cells were incubated at 37 C with buffer
only for 1560 min, 100 ng/ml hFSH for 60 min, or 200 nM
PMA for 15 min (16). One cell line expressing rFSHR-wt and one cell
line expressing one of the rFSHR mutants were used in each experiment.
Experiments using 293F(3L) or 293F(3L+CT) cells used 293F(wt-10) cells
as control, while those using 293F(1L) cells used 293F(wt-103) as
control. Regardless of the cell lines used, the amount of wt and mutant
receptor used for immunoprecipitation was equalized based on the
binding data shown on Table 1
. Autoradiograms of the dried gels were
obtained using Kodak BioMax MS film (Eastman Kodak, Rochester, NY) and
intensifying screens. The autoradiograms were scanned and quantitated
using a Bio-Rad Molecular Imaging System (Bio-Rad Laboratories,
Richmond, CA). All images were captured in a digital format for
presentation.
Peptide Mapping
The rFSHR immunoprecipitated from 32Pi-labeled cells
that had been stimulated with hFSH (see above) was detected by
autoradiography of dried gels and excised. The dried gel piece was then
rehydrated with water for 10 min, and the paper backing was removed
before the gel was cut into smaller pieces. These were shaken overnight
a 37 C in 1 ml of 50 mM NH4HCO3,
0.1% SDS, pH 7.8. The supernatant was collected, and the gel pieces
were rinsed with 500 µl of the same buffer. This wash was combined
with the original supernatant, centrifuged at 10,000 x
g for 10 min. and then concentrated to about 60 µl using a
Centricon-30 (Fisher Scientific, Pittsburgh, PA). This sample was
diluted with 60 µl of glacial acetic acid followed by the addition of
60 mg urea. The sample was then incubated for 15 min at 60 C before the
addition of N-chlorosuccinimide at a final concentration of
50 mM. The incubation was continued at room temperature for
60 min before the addition of the same amount of
N-chlorosuccinimide for a second time. After an additional
60-min incubation at room temperature, the reaction was diluted with 1
ml of 50 mM NH4HCO3, 0.1% SDS, pH
7.8, and cooled on ice. The peptides were precipitated by adding
trichloroacetic acid to give a final concentration of 12.5% and 20
µg RNAseI as carrier. The precipitate was collected by
centrifugation, washed with ice-cold acetone, and solubilized in
tricine gel sample buffer (12% glycerol (wt/vol), 4% SDS (wt/vol),
2% mercaptoethanol (vol/vol), and 0.01% bromophenol blue (wt/vol) in
50 mM Tris-HCl, pH 6.8). The generated peptides were then
separated using a discontinuous tricine-urea-SDS-PAGE system as
described previously (16). After electrophoresis the peptides were
electrophoretically transferred to a polyvinylidene difluoride membrane
to increase resolution during analysis with a phosphorimager (41). The
phosphorimager data were captured in digital format for
presentation.
Uncoupling and Internalization
Measurements of agonist-induced uncoupling were performed as
follows. Cells expressing rFSHR-wt or the mutant receptors were plated
in 35-mm wells and incubated without (group A) or with (group B) 100
ng/ml hFSH for increasing periods of time. The free and bound hormones
were removed by washing with neutral and acidic buffers, respectively,
and each group of cells was subsequently incubated with (A1, B1) or
without (A2, B2) 100 ng/ml hFSH for 15 min at 37 C (16). Intracellular
levels of cAMP were measured at the end of this incubation, and
agonist-induced uncoupling was calculated as follows:
[(B1-B2)/(A1-A2)] x 100. PMA-induced uncoupling was measured by
incubating cells expressing rFSHR-wt or the mutant receptors without
(group A) or with (group B) 200 nM PMA for 30 min (16).
Each group of cells was subsequently incubated with (A1, B1) or without
(A2, B2) the indicated concentrations of hFSH for 15 min at 37 C.
Intracellular levels of cAMP were measured at the end of this
incubation, and agonist-induced uncoupling was calculated for each
concentration of hFSH used as follows: [(B1-B2)/(A1-A2)] x 100.
The endocytosis of [125I]hFSH was measured as follows. Cells, plated in 35-mm wells, were preincubated in 1 ml of Waymouths MB752/1 containing 1 mg/ml BSA and 20 mM HEPES, pH 7.4, for 60 min at 37 C. Each well then received 40 ng/ml [125I]hFSH, and the incubation was continued at 37 C. Groups of cells were placed on ice at 3-min intervals and washed twice with 2-ml aliquots of cold HBSS containing 1 mg/ml BSA. The surface-bound hormone was then released by incubating the cells in 1 ml of cold 50 mM glycine, 100 mM NaCl, pH 3, for 24 min (28, 29). The acidic buffer was removed, and the cells were washed once more with another aliquot of the same buffer. The acid buffer washes were combined and counted, and the cells were solubilized with 100 µl of 0.5 N NaOH, collected with a cotton swab, and counted to determine the amount of internalized hormone. Six different data points collected at 3-min intervals were used in each experiment, and the rate constant for internalization (ke) was calculated from the slope of the line obtained by plotting the internalized radioactivity against the integral of the surface-bound radioactivity (30). The half-life of internalization (t1/2) is defined as 0.693/ke.
Hormones and Supplies
The rabbit antibody to the rFSHR (Anti-F) has been described
(40). Purified hFSH (AFP-5720D) was kindly provided by the National
Hormone and Pituitary Agency of the National Institute of Diabetes and
Digestive and Kidney Diseases. [125I]FSH was prepared as
previously described (42). PMSG was obtained from the National Hormone
and Pituitary Agency of the National Institute of Diabetes and
Digestive and Kidney Diseases or purchased from Sigma.
[32P]orthophosphate was obtained from Du Pont-New England
Nuclear (Boston, MA). Phosphate-free DMEM was purchased from ICN
Biomedicals (Irvine, CA). Nonidet P-40, protease inhibitors,
N,N',N"-triacetylchitotriose, protein A-agarose,
and BSA were from Sigma (St. Louis, MO). Okadaic acid and cypermethrin
were purchased from Alexis Biochemicals (Woburn, MA). Wheat germ
agglutinin agarose was from Vector Laboratories (Burlingame, CA). Cell
culture supplies and reagents were obtained from Corning (Corning, NY)
and GIBCO (Grand Island, NY), respectively. All other materials were
obtained from commonly used suppliers.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by a grant from the National Institute of Child Health and Human Development (HD-28962) to M.A. The services and facilities provided by the Diabetes and Endocrinology Research Center of the University of Iowa were supported by NIH Grant DK-25295. K.N. was partially supported by a fellowship from the Lalor Foundation. R.W.H. was partially supported by a fellowship from the Juvenile Diabetes Foundation.
Received for publication November 13, 1997. Revision received December 31, 1997. Accepted for publication January 12, 1998.
| REFERENCES |
|---|
|
|
|---|
2-adrenergic receptor. J Biol Chem 268:1648316487
2A-adrenergic receptor. J Biol Chem 270:4681-4688This article has been cited by other articles:
![]() |
E. Kara, P. Crepieux, C. Gauthier, N. Martinat, V. Piketty, F. Guillou, and E. Reiter A Phosphorylation Cluster of Five Serine and Threonine Residues in the C-Terminus of the Follicle-Stimulating Hormone Receptor Is Important for Desensitization But Not for ss-Arrestin-Mediated ERK Activation Mol. Endocrinol., November 1, 2006; 20(11): 3014 - 3026. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. H Walker and J. Cheng FSH and testosterone signaling in Sertoli cells Reproduction, July 1, 2005; 130(1): 15 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ronacher, N. Matsiliza, N. Nkwanyana, A. J. Pawson, T. Adam, C. A. Flanagan, R. P. Millar, and A. A. Katz Serine Residues 338 and 339 in the Carboxyl-Terminal Tail of the Type II Gonadotropin-Releasing Hormone Receptor Are Critical for {beta}-Arrestin-Independent Internalization Endocrinology, October 1, 2004; 145(10): 4480 - 4488. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Krishnamurthy, H. Kishi, M. Shi, C. Galet, R. S. Bhaskaran, T. Hirakawa, and M. Ascoli Postendocytotic Trafficking of the Follicle-Stimulating Hormone (FSH)-FSH Receptor Complex Mol. Endocrinol., November 1, 2003; 17(11): 2162 - 2176. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Cohen, J. T. Bariteau, L. M. Magenis, and J. A. Dias Regulation of Follitropin Receptor Cell Surface Residency by the Ubiquitin-Proteasome Pathway Endocrinology, October 1, 2003; 144(10): 4393 - 4402. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kishi, H. Krishnamurthy, C. Galet, R. S. Bhaskaran, and M. Ascoli Identification of a Short Linear Sequence Present in the C-terminal Tail of the Rat Follitropin Receptor That Modulates Arrestin-3 Binding in a Phosphorylation-independent Fashion J. Biol. Chem., June 7, 2002; 277(24): 21939 - 21946. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Marion, F. Robert, P. Crepieux, N. Martinat, C. Troispoux, F. Guillou, and E. Reiter G Protein-Coupled Receptor Kinases and Beta Arrestins Are Relocalized and Attenuate Cyclic 3',5'-Adenosine Monophosphate Response to Follicle-Stimulating Hormone in Rat Primary Sertoli Cells Biol Reprod, January 1, 2002; 66(1): 70 - 76. [Abstract] [Full Text] |
||||
![]() |
F. Clement, D. Monniaux, J. Stark, K. Hardy, J. C. Thalabard, S. Franks, and D. Claude Mathematical model of FSH-induced cAMP production in ovarian follicles Am J Physiol Endocrinol Metab, July 1, 2001; 281(1): E35 - E53. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. N. Themmen and I. T. Huhtaniemi Mutations of Gonadotropins and Gonadotropin Receptors: Elucidating the Physiology and Pathophysiology of Pituitary-Gonadal Function Endocr. Rev., October 1, 2000; 21(5): 551 - 583. [Abstract] [Full Text] |
||||
![]() |
K. Nakamura, X. Liu, and M. Ascoli Seven Non-contiguous Intracellular Residues of the Lutropin/Choriogonadotropin Receptor Dictate the Rate of Agonist-induced Internalization and Its Sensitivity to Non-visual Arrestins J. Biol. Chem., January 7, 2000; 275(1): 241 - 247. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Blomenröhr, A. Heding, R. Sellar, R. Leurs, J. Bogerd, K. A. Eidne, and G. B. Willars Pivotal Role for the Cytoplasmic Carboxyl-Terminal Tail of a Nonmammalian Gonadotropin-Releasing Hormone Receptor in Cell Surface Expression, Ligand Binding, and Receptor Phosphorylation and Internalization Mol. Pharmacol., December 1, 1999; 56(6): 1229 - 1237. [Abstract] [Full Text] |
||||
![]() |
K. Nakamura, X. Liu, and M. Ascoli The Rate of Internalization of the Gonadotropin Receptors Is Greatly Affected by the Origin of the Extracellular Domain J. Biol. Chem., September 3, 1999; 274(36): 25426 - 25432. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Troispoux, F. Guillou, J.-M. Elalouf, D. Firsov, L. Iacovelli, A. De Blasi, Y. Combarnous, and E. Reiter Involvement of G Protein-Coupled Receptor Kinases and Arrestins in Desensitization to Follicle-Stimulating Hormone Action Mol. Endocrinol., September 1, 1999; 13(9): 1599 - 1614. [Abstract] [Full Text] |
||||
![]() |
M. d. F. M. Lazari, X. Liu, K. Nakamura, J. L. Benovic, and M. Ascoli Role of G Protein-Coupled Receptor Kinases on the Agonist-Induced Phosphorylation and Internalization of the Follitropin Receptor Mol. Endocrinol., June 1, 1999; 13(6): 866 - 878. [Abstract] [Full Text] |
||||
![]() |
K. Nakamura, J. G. Krupnick, J. L. Benovic, and M. Ascoli Signaling and Phosphorylation-impaired Mutants of the Rat Follitropin Receptor Reveal an Activation- and Phosphorylation-independent but Arrestin-dependent Pathway for Internalization J. Biol. Chem., September 18, 1998; 273(38): 24346 - 24354. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kishi and M. Ascoli Multiple Distant Amino Acid Residues Present in the Serpentine Region of the Follitropin Receptor Modulate the Rate of Agonist-induced Internalization J. Biol. Chem., September 29, 2000; 275(40): 31030 - 31037. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |