help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakamura, K.
Right arrow Articles by Ascoli, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakamura, K.
Right arrow Articles by Ascoli, M.
Molecular Endocrinology 12 (4): 580-591
Copyright © 1998 by The Endocrine Society

The Agonist-Induced Phosphorylation of the Rat Follitropin Receptor Maps to the First and Third Intracellular Loops

Kazuto Nakamura, R. Wiliam Hipkin and Mario Ascoli

Department of Pharmacology (K.N., M.A.) The University of Iowa College of Medicine Iowa City, Iowa 52242
Department of Pharmacology (R.W.H.) The University of Texas Medical School Houston, Texas 77225


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Previous results from this laboratory have shown that the rat FSH receptor (rFSHR) becomes phosphorylated on S/T residues upon stimulation of transfected cells with human (h)FSH and that a truncation of the C-terminal tail that removes 12 of the 25 intracellular S/T residues does not affect phosphorylation. Based on the results of phosphopeptide-mapping experiments we analyzed three new mutants. rFSHR-1L and rFSHR-3L were constructed by mutating the S/T residues in the first intracellular loop or the third intracellular loop, respectively. rFSHR-(3L+CT) was constructed by mutating all the S/T residues in the third loop as well as S624, the only C-terminal tail residue that was not previously eliminated as a potential phosphorylation site. All mutants were biologically active. The agonist-induced phosphorylation of rFSHR-3L and rFSHR-(3L+CT) were partially reduced, while that of rFSHR-1L was almost completely lost. The agonist-induced uncoupling of rFSHR-1L and rFSHR-3L are retarded to about the same extent, while the agonist-induced internalization is retarded only in rFSHR-1L. Four major conclusions can be made from the present studies: 1) the phosphorylated rFSHR is a common molecular intermediate in agonist-induced uncoupling and internalization; 2) agonist-induced phosphorylation of the rFSHR maps to the first and third intracellular loops; 3) the phosphorylation of the third intracellular loop facilitates agonist-induced uncoupling but is not necessary for agonist-induced internalization; 4) agonist-induced internalization is facilitated by phosphorylation but it is not known if only the first loop, only the third loop, or both the first and third loops need to be phosphorylated for this response.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
One of the consequences of the activation of G protein-coupled receptors (GPCRs) by agonists is the phosphorylation of the agonist-occupied receptor by a G protein-coupled receptor kinase. This phosphorylation, which occurs on serine and/or threonine residues, promotes the interaction of the receptor with arrestin, leading to the rapid uncoupling of the receptor from its cognate G protein (reviewed in Refs. 1, and 2–4). More recent studies have shown that in some cases the interaction of the phosphorylated receptors with arrestins is also important in targeting the activated receptors to coated pits leading to the internalization of the agonist-receptor complex (5, 6, 7). The molecular interactions involved in the agonist-induced internalization of the GPCRs are not as clearly delineated as those involved in the agonist-induced uncoupling, however.

The LH/CG (LHR) and FSH (FSHR) receptors, collectively known as the gonadotropin receptors, are members of the rhodopsin-like subfamily of GPCRs (8) and bind their respective ligands with high affinities (10-9-10-10 M). Since the bound hormones dissociate very slowly, we reasoned that the LHR and FSHR may utilize unusual mechanisms for deactivation, and we embarked on a series of studies designed to determine the molecular basis of their deactivation.

Like other GPCRs, the rat LHR (rLHR) and rat FSHR (rFSHR) become rapidly phosphorylated in response to agonist stimulation and, at least in the case of the LHR, phosphorylation facilitates agonist-induced uncoupling and internalization (reviewed in Refs. 9 and 10). Our studies on the rLHR have progressed to the point where the phosphorylation sites have been identified as four serine residues located in the C-terminal tail (11, 12, 13, 14). On the other hand, the studies on the identification of the rFSHR phosphorylation sites and their functional significance have lagged behind because of the abundance of potential phosphorylation sites. In contrast to the rLHR, which is phosphorylated only on serine residues (12), the rFSHR is phosphorylated on serine and threonine residues, and there are 25 such residues in the intracellular regions of the rFSHR that may serve as phosphorylation sites (15).

In a previous publication we prepared a C-terminally truncated mutant of the rFSHR that removed all but one of the S/T residues present in the C-terminal tail and showed that the agonist-induced phosphorylation of this mutant is completely preserved (16). While these studies eliminated 12 of the 25 S/T residues as potential phosphorylation sites, they provided little information about the location of the residues that become phosphorylated. The experiments presented herein were thus designed to determine the location of the phosphorylation sites in the rFSHR and to characterize the functional impact of rFSHR phosphorylation.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Construction and Characterization of rFSHR Mutants
In a previous attempt at identifying the phosphorylation sites of the rFSHR, we showed that removal of 12 S/T residues by truncation of the C-terminal tail at residue 635 (Fig. 1Go) does not affect the agonist- or phorbol 12-myristate-13-acetate (PMA)-induced phosphorylation of the rFSHR (16). Moreover, digestion of the phosphorylated rFSHR with N-chlorosuccinimide suggested that phosphorylation occurred in the first and third intracellular loops (16). We have now repeated these experiments by exhaustive digestion of the phosphorylated rFSHR under denaturing conditions and separation of the resulting peptides on Tricine-SDS gels (Fig. 2Go).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 1. Intracellular Regions of the rFSHR

The three cytoplasmic loops and the C-terminal cytoplasmic tail of the rFSHR are shown (36). Amino acid residues enclosed in squares are identical in the rFSHR and the rLHR (8). All S/T residues are shown enclosed in black or gray. Those enclosed in black are the residues mutated in the present study. These residues are also identified by an arrow indicating the nature of the mutations introduced. The location of residue 635, which is the C-terminal end of a truncated version of the rFSHR used previously (16), and the position of two conserved C-terminal serines (641 and 655), which have been identified as phosphorylation sites in the rLHR, are also shown.

 


View larger version (66K):
[in this window]
[in a new window]
 
Figure 2. Phosphopeptide Map of rFSHR-wt

The 32P-labeled FSHR-wt was isolated from prelabeled cells that had been stimulated with 100 ng/ml hFSH for 60 min at 37 C. Cell lysates were prepared, immunoprecipitated, and resolved on SDS gels as described in Materials and Methods. The relevant portion of the gels were cut, digested with N-chlorosuccinimide, subjected to electrophoresis on Tricine-Urea-SDS gels, electrophoretically transferred to polyvinylidene difluoride membranes, and analyzed using a phosphorimager as described in Materials and Methods. The apparent molecular weights shown were calculated based on the migration of molecular weight standards.

 
N-Chlorosuccinimide, a reagent that cleaves polypeptides at tryptophan residues (17, 18) is predicted to generate four peptides containing the transmembrane regions and the intervening loops. Peptide 1 is a 7.4-kDa peptide encompassing residues 353–418 that contains all the S/T residues present in the first intracellular loop and may thus be detectable as a phosphopeptide if these residues are phosphorylated. Peptide 2 is a 3.4-kDa peptide encompassing residues 419–450 that should not be detectable as a phosphopeptide because it contains only transmembrane and extracellular loop residues. Peptide 3 is a 3.0-kDa peptide encompassing residues 451–476 that contains the two T residues present in the second intracellular loop and may thus be detectable as a phosphopeptide if these residues are phosphorylated. Peptide 4 is a 22.2-kDa peptide encompassing residues 477–675 that contains the S/T residues present in the third intracellular loop and all the C-terminal tail. This would also be detectable as a phosphopeptide if the S/T residues present in either or both of these regions are phosphorylated.

The results presented in Fig. 2Go show that the most prominent peptide generated by exhaustive N-chlorosuccinimide cleavage of the phosphorylated rFSHR migrates slightly above the 6.5-kDa size marker with an apparent size similar to the predicted molecular mass of peptide 1 (7.4 kDa, see above), which contains the first intracellular loop. There is an additional faint band slightly above this prominent peptide and another prominent phosphopeptide that is resolved in the gel and migrates slightly above the 26.6-kDa size marker. This phosphopeptide is larger than peptide 4 (22 kDa, see above), which is the largest putative phosphopeptide and is predicted to contain the third intracellular loop and C-terminal tail. The largest phosphopeptide shown in Fig. 2Go may represent peptide 4, which migrates anomalously because of the phosphate groups or an incomplete degradation product. The latter is not an unlikely possibility as incomplete cleavage of the tryptophan residues at position 476 would leave peptides 3 and 4 together to yield an incomplete degradation product with a predicted size of 25 kDa, while incomplete digestion of the tryptophan residues at positions 450 and 476 would leave peptides 2, 3, and 4 together to yield an incomplete degradation product with a predicted size of 28.6 kDa. The 25-kDa phosphopeptide resulting from incomplete digestion would, like predicted peptide 4, have only those S/T residues present in the third intracellular loop and the C-terminal tail. The 28.6-kDa phosphopeptide resulting from incomplete digestion would, however, also contain the two T residues present in the second intracellular loop.

Clearly an unambiguous identification of the phosphopeptides shown in Fig. 2Go cannot be done without amino acid sequencing. The small amounts of radioactive peptides obtained precluded this possibility, however. On the other hand, we believe that it is reasonable to conclude that the ~7-kDa phosphopeptide shown in Fig. 2Go represents the peptide containing the first intracellular loop, and we thus targeted these residues for mutagenesis. We also directed our attention to the S/T residues present in the third intracellular loop, and to S624 present in the C-terminal tail. The other 12 S/T residues present in the C-terminal tail downstream of S624 have already been excluded as potential phosphorylation sites by the finding that a C-terminal truncation of the rFSHR at residue 635 (c.f. Fig. 1Go) does not affect phosphorylation (16).

Expression vectors encoding for mutations of the phosphorylation sites present in the first and third intracellular loops of the rFSHR were constructed and analyzed. Initially we mutated three or all four S/T residues present in the first intracellular loop to A (Fig. 1Go) but found that the mutated rFSHR were not expressed at the cell surface upon transfection. Rat FSHR-1L, a mutant in which three of the four S/T residues present in the first intracellular loop were mutated to I or N as shown in Fig. 1Go was eventually used because this was the only mutant that was appropriately expressed upon transfection (see below). These mutations were designed based on the sequences of the first intracellular loop of the ovine, bovine, and porcine FSHR (19, 20, 21), the human TSH receptor (22), and the two glycoprotein hormone-like receptors recently identified in sea urchins and Drosophila (23, 24). One or more of these receptors have an I in the position equivalent to T371 and S373 of the rFSHR and/or a N in the position equivalent to T378 of the rFSHR (Fig. 1Go). T372, the other potential phosphorylation site present in the first intracellular loop of the rFSHR, was left intact in rFSHR-1L simply because mutations of this residue prevented cell surface expression of the transfected cDNA.

rFSHR-3L was prepared by mutating all S/T residues in the third intracellular loop to A as shown in Fig. 1Go. rFSHR-(3L + CT) was prepared by mutating all S/T residues in the third intracellular loop and S624 in the C-terminal tail to A as shown in Fig. 1Go. This last mutant was constructed because S624 is the only potential phosphorylation site present in the C-terminal tail that was not excluded by our previous experiments (16). All of these mutations were well tolerated as judged by cell surface expression of the mutant receptors. We also constructed one additional mutant that combined the mutations introduced in the first and third intracellular loop. This mutant was not expressed upon transfection, however.

Stable cell lines expressing rFSHR-1L, rFSHR-3L, and rFSHR-(3L+CT) were readily obtained by transfection and selection of human kidney 293 cells. One clonal cell line for each mutant was selected for further study. This selection was based entirely on binding capacity and our ability to match the binding capacity of cell lines expressing mutant receptors with a cell line expressing an equivalent density of rFSHR-wt (Table 1Go). Table 1Go also shows that all mutant receptors bound hFSH with comparable affinities to that of the rFSHR-wt. As shown in Table 2Go all cell lines expressing the mutant receptors respond to hFSH with a robust increase in cAMP accumulation. When compared with cell lines expressing an equivalent density of rFSHR-wt, cells expressing rFSHR-3L have an elevated basal level of cAMP and an elevated maximal response to hFSH. The EC50 for hFSH-induced cAMP accumulation is comparable to that of cells expressing rFSHR-wt, however. The maximal response to hFSH is also elevated in cells expressing rFSHR-(3L + CT), but the basal levels and the EC50 for the FSH response are comparable to those expressing rFSHR-wt. Cells expressing rFSHR-1L also display an elevated basal level of cAMP, but the EC50 for the hFSH response and the maximal hFSH response are comparable to those of cells expressing an equivalent density of rFSHR-wt. The elevated basal levels of cAMP observed in cells expressing rFSHR-3L or rFSHR-1L operationally define these mutants as being constitutively active. The results obtained with rFSHR-3L are not necessarily unexpected as mutations in some residues of the third intracellular loop of other GPCRs such as the {alpha}2-adrenergic receptor (25) and the closely related TSH receptor (26) have been previously shown to induce constitutive activation. To our knowledge, however, there are no reports of mutations of the first intracellular loop that result in the constitutive activation of other GPCRs. Lastly, the data presented in Tables 1Go and 2Go also show that, when comparing cell lines expressing different densities of rFSHR-wt [such as 293F(wt-103) and 293F(wt-10)], the EC50 for the hFSH-induced cAMP response is inversely proportional to receptor density, while the maximal cAMP response is basically independent of receptor density. While these findings are not unexpected (27), conclusions about changes in the maximal cAMP response should be made with caution because there is an inherent variability in these experiments that is difficult to correct for. This is illustrated in Table 2Go by the variable cAMP response of the different cell lines to cholera toxin (CT).


View this table:
[in this window]
[in a new window]
 
Table 1. Binding of [125I]hFSH to Cell Lines Expressing rFSHR Mutants

 

View this table:
[in this window]
[in a new window]
 
Table 2. cAMP Responses of 293 Cells Expressing rFSHR Mutants

 
In all subsequent experiments we used 293F(wt-103) as a control for 293F(1L) cells and 293F(wt-10) as a control for 293F(3L) and 293F(3L+CT) cells. This choice was based on the similarity in the hFSH-binding capacity of these cell lines (c.f. Table 1Go). In spite of the large difference in hFSH binding capacity, however, the fold-increase in phosphorylation, as well as the time course and magnitude of agonist-induced uncoupling, agonist-induced internalization, and PMA-induced uncoupling, turned out to be very similar in 293F(wt-10) and 293F(wt-103). Thus, all the results presented below for the FSHR-wt are a summary of the results obtained with both of these cell lines.

Phosphorylation of rFSHR Mutants
Although the principal aim of this study is to identify the sites of the rFSHR that become phosphorylated in response to agonist stimulation, all cells expressing rFSHR mutants were also tested for PMA-induced phosphorylation (15, 16). The finding that addition of PMA leads to the phosphorylation of the rFSHR should not be taken to mean that protein kinase C is the mediator of the phosphorylation induced by agonist stimulation, however, as our previous data indicate that prior down-regulation of protein kinase C has only a small effect on the agonist-stimulated phosphorylation of the rFSHR (15).

Cells expressing each of the mutants described above were metabolically labeled with 32Pi, and then stimulated with hFSH or PMA (15, 16). Cell extracts were prepared, and equal amounts of the wild-type (wt) and mutant receptors (calculated based on the binding data shown in Table 1Go) were immunoprecipitated, resolved on SDS gel, and visualized by autoradiography as shown in Fig. 3Go. The results of several experiments were quantitated by densitometry, and these data are summarized in Fig. 4Go.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 3. Phosphorylation of rFSHR Mutants

Immunoprecipitates of the rFSHR were prepared as described in Materials and Methods from cells that had been labeled with 32Pi for 3 h and further incubated with buffer only (lane 1), 100 ng/ml hFSH for 60 min (lane 2), or 200 nM PMA for 15 min (lane 3), conditions that are known to elicit a maximal response (16). 293F(wt-10) cells were used as controls for 293F(3L) cells, and 293F(wt-103) cells were used as controls for 293F(1L) cells. The results presented are from densitometric scans of representative autoradiograms obtained using immunoprecipitates containing equivalent amounts of receptor.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. Quantification of rFSH Phosphorylation

Autoradiograms such as those shown in Fig. 3Go were quantitated by densitometry, and the magnitude of the signal measured in hFSH- or PMA-stimulated cells was expressed as fold over basal. The results shown for rFSHR-wt are a combination of those obtained using 293F(wt-10) and 293F(wt-103) cells. These results were combined because they seemed to be indistinguishable. The results obtained with the rFSHR mutants were obtained using the cell lines described in Tables 1Go and 2Go. For rFSHR-wt, the results shown represent the average ± SEM of five independent experiments [two with 293F(wt103) and three with 293F(wt-10) cells]. The results shown for rFSHR-3L and rFSHR-(3L+CT) are the average ± SEM of six and three independent experiments, respectively. The results shown for rFSHR-1L are the mean ± range of two experiments.

 
The results presented in Fig. 3Go show that the basal phosphorylation state of the three different mutants of the rFSHR is basically the same as that of the rFSHR-wt. This is an important observation because two of these mutants, rFSHR-1L and rFSHR-3L, may be classified as constitutively active mutants (see above) and may thus be expected to have an enhanced level of basal phosphorylation. This is clearly not the case as shown in Fig. 3Go. A potential explanation for this finding is that the level of constitutive activation is rather weak compared with that detected upon agonist stimulation (c.f. Table 2Go). The results presented in Fig. 4Go show that cells expressing rFSHR-wt respond to hFSH with an 18-fold increase in the 32P content of the rFSHR. The magnitude of the hFSH-induced phosphorylation is reduced by 40–60% in cells expressing rFSHR-3L or rFSHR-(3L + CT). These results show that some of the S/T residues phosphorylated in response to hFSH stimulation are located in the third intracellular loop. The similarity in the magnitude of the residual phosphorylation detected in rFSHR-3L and rFSHR-(3L+CT) indicate that S624, which is present in rFSHR-3L but absent in rFSHR-(3L+CT) (c.f. Fig. 1Go), is not a major phosphorylation site.

The data presented in Fig. 4Go also show that the hFSH-induced phosphorylation is decreased by 89% in rFSHR-1L. The magnitude of this decrease in phosphorylation is surprising because rFSHR-1L retains all the phosphorylation sites present in the third intracellular loop, which as shown above account for roughly 50% of the phosphorylation detected in the rFSHR-wt. Clearly then, the mutation of S/T residues in loop 1 affects phosphorylation above and beyond that expected from the loss of phosphorylation of these sites. There are two possible explanations for this result: 1) the S/T residues present in loop 1 are not phosphorylated at all, and the mutation of these S/T residues indirectly prevents the phosphorylation of the other S/T residues left unchanged in rFSHR-1L; 2) the S/T residues present in loop 1 are phosphorylated and that the virtual loss of phosphorylation detected in rFSHR-1L is due to the prevention of phosphorylation of the S/T residues present in loop 1 as well as to an indirect effect that prevents phosphorylation of the other S/T residues left unchanged in this mutant. The identification of a major ~7-kDa phosphopeptide in Fig. 2Go corresponding to the size of that predicted to contain loop 1 provides compelling evidence for the phosphorylation of loop 1 and favors the latter explanation.

The results presented in Fig. 4Go show that the PMA-induced phosphorylation of the rFSHR also occurs in the first and third intracellular loops. In contrast to the results discussed above, however, the PMA-induced phosphorylation signal detected in cells expressing rFSHR-3L, rFSHR-(3L + CT), or rFSHR-1L is reduced to 30–40% of that detected in cells expressing rFSHR-wt. These results indicate that the first and third intracellular loops are phosphorylated to about the same extent when cells are stimulated with PMA and underscore an additional difference between the agonist- and PMA-induced phosphorylation (see Discussion).

Functional Correlates of rFSHR Phosphorylation
Based on the data presented above, we focused our attention on cells expressing rFSHR-1L and rFSHR-3L as tools to determine the impact of rFSHR phosphorylation on agonist-induced uncoupling and internalization. rFSHR-3L was chosen over rFSHR-(3L+CT) because a few preliminary experiments (not shown) showed that the functional properties of these two mutants were indistinguishable.

We use the term uncoupling to describe a phenomenon whereby cells exposed to hFSH lose responsiveness (measured by cAMP accumulation) to a subsequent stimulation with hFSH without a change in the density of cell surface rFSHR (16). A time course for the hFSH-induced uncoupling of cells expressing rFSHR-wt, rFSHR-1L, or rFSHR-3L is illustrated in Fig. 4Go. These data show that a 15-min exposure of cells expressing the rFSHR-wt result in a 50% reduction in the cAMP response stimulated by hFSH. In contrast, the hFSH-induced uncoupling is retarded, but not abolished, in cells expressing rFSHR-1L or rFSHR-3L. Since the extent of the retardation is very similar in cells expressing rFSHR-1L and in cells expressing rFSHR-3L, we conclude that the phosphorylation of the third intracellular loop is particularly important for agonist-induced uncoupling.

We use the term internalization to describe the actual movement of the hormone-receptor complex from the cell surface to the cell interior. Biochemically the surface-bound and internalized [125I]hFSH can be differentiated by briefly exposing the cells to an isotonic pH 3 buffer (28, 29), and the rate of internalization of [125I]hFSH can be measured by comparing the ratio of internalized to surface-bound radioactivity in cells incubated with [125I]hFSH at 37 C for short periods of time (30). The results of a representative experiment designed to measure internalization of [125I]hFSH are shown in Fig. 6Go, and a summary of the results obtained in several experiments is shown in Table 3Go. These results show that the rate of internalization of hFSH is slightly enhanced in cells expressing rFSHR-3L, but it is decreased about 2-fold in cells expressing rFSHR-1L. We conclude from these experiments that the agonist-induced phosphorylation of the rFSHR at the third intracellular loop is not necessary for agonist-induced internalization. The results obtained with cells expressing rFSHR-1L clearly show that the agonist-induced phosphorylation of the rFSHR is needed to attain a rate of internalization comparable to that of the rFSHR-wt. We cannot determine, however, whether this is due to the phosphorylation of the first loop only or of the first and third loops. It is also worth noting that there is no correlation between the levels of cAMP generated in a given cell line and the rate of internalization inasmuch as the cAMP response of cells expressing rFSHR-1L or rFSHR-3L is as good or better than that of cells expressing rFSHR-wt (c.f. Table 2Go). These results are, in fact, quite similar to those obtained with the closely related rLHR where the mutation of phosphorylation sites has also been shown to retard agonist-induced internalization (14). Moreover, other studies performed with the rLHR have shown that agonist-induced internalization is retarded in activation-deficient mutants of this receptor (31), but this retardation is not due to the inability of these mutants to respond with increased levels of cAMP (32).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. Internalization of [125I]hFSH in Cells Expressing rFSHR Mutants

Cells were preincubated in warm medium for 1 h and then incubated with 40 ng/ml [125I]hFSH at 37 C for a maximum of 18 min. At 3-min intervals groups of cells were placed on ice, and the amounts of surface-bound and internalized radioactivity were measured as described in Materials and Methods. The internalized radioactivity was then plotted as function of the integral of the surface-bound radioactivity as shown, and the slopes of the lines were calculated by linear regression. The results of a representative experiment performed with the indicated cell lines are shown.

 

View this table:
[in this window]
[in a new window]
 
Table 3. Rates of Internalization of [125I]hFSH in Cells Expressing rFSHR Mutants

 
The PMA-induced phosphorylation of the rFSHR is also correlated with a functional uncoupling of the rFSHR from adenylyl cyclase, an effect that is particularly evident when cells are restimulated with low concentrations of hFSH (15, 16). The data presented in Table 4Go show that this effect of PMA is fully preserved in the cell lines expressing rFSHR-1L or rFSHR-3L. It is important to stress that the PMA-induced phosphorylation of the rFSHR is reduced only by about 50% in either of these mutants (c.f. Fig. 4Go). Thus, if phosphorylation is responsible for the ability of PMA to uncouple the rFSHR from adenylyl cyclase, this effect must require the phosphorylation of both the first and third intracellular loops.


View this table:
[in this window]
[in a new window]
 
Table 4. PMA-Induced Uncoupling in Cells Expressing rFSHR Mutants

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Previous results from this laboratory have shown that the rFSHR becomes phosphorylated on S and T residues when transfected cells are stimulated with hFSH or PMA (15). Since the construction and characterization of a C-terminally truncated mutant of the rFSHR eliminated 12 of the 25 intracellular S/T residues as potential phosphorylation sites (16), the experiments presented here were designed to determine which of the remaining 13 residues are phosphorylated and to define the impact of phosphorylation on the functions of the rFSHR.

The data presented here show that the rFSHR is phosphorylated in the first and third intracellular loops. The presence of phosphorylation sites in the first intracellular loop is supported by the peptide-mapping experiments, which revealed a phosphopeptide of the predicted size for the cleavage product expected to contain the first intracellular loop (Fig. 2Go). Moreover, the simultaneous mutation of several S/T residues present in the first intracellular loop substantially reduced receptor phosphorylation (Figs. 3Go and 4Go). The presence of phosphorylation sites in the third intracellular loop is supported by similar experiments. Although the peptide-mapping experiments revealed a phosphopeptide somewhat larger than that predicted to contain the third intracellular loop (Fig. 2Go), mutation of all the S/T residues in the third intracellular loop reduced receptor phosphorylation by at least 50% (Figs. 3Go and 4Go). Together these data provide compelling evidence for the phosphorylation of the rFSHR at the first and third intracellular loops. The presence of phosphorylation sites in the second intracellular loop cannot yet be formally excluded, however, because we have not performed mutagenesis of the phosphorylation sites present in this loop. To our knowledge this is the first report of a GPCR that is phosphorylated in two different intracellular loops. The majority of the GPCRs are phosphorylated in the C-terminal tail. There are only two other GPCRs, the {alpha}2A-adrenergic (33) and the m2 muscarinic (34, 35) receptors, that are known to be phosphorylated in the third intracellular loop.

The simultaneous mutation of all S/T residues present in the third intracellular loop of the rFSHR does not reduce hFSH binding affinity or signal transduction (Tables 1Go and 2Go). It does, however, reduce hFSH-stimulated receptor phosphorylation by 40–60% (Figs. 3Go and 4Go). This partial reduction in phosphorylation is associated with a retardation of the hFSH-induced uncoupling of the hFSH-responsive adenylyl cyclase (Fig. 5Go) and a slight increase in the rate of endocytosis of the bound hFSH (Fig. 6Go and Table 3Go). The simultaneous mutation of all S/T residues present in the third intracellular loop and S624, the only residue in the C-terminal tail that had not been previously excluded as a potential phosphorylation site (16), results in a slight additional reduction in agonist-induced phosphorylation over that detected in the rFSHR in which only the S/T residues present in the third loop were mutated (Figs. 3Go and 4Go). While these data do not allow us to make firm conclusions about S624 as a potential phosphorylation site, they clearly show that some, but not all, of the phosphorylation sites are present in the third intracellular loop, and that the phosphorylation of these residues facilitates agonist-induced uncoupling.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. Time Course of Agonist-Induced Uncoupling in Cells Expressing rFSHR Mutants

Individual cell lines were initially divided into two groups and preincubated with or without hFSH (100 ng/ml) for the times indicated at 37 C to induce receptor uncoupling. At the end of this preincubation the free and receptor-bound hormone were removed (see Materials and Methods), and each group of cells was divided into two subgroups. One subgroup of cells was further incubated without hormone for 15 min at 37 C to determine the residual levels of cAMP present after the preincubation. The other subgroup was restimulated with 100 ng/ml hFSH for 15 min at 37 C. For each group of cells the residual level of cAMP (i.e. that measured in the second incubation without hormone) was subtracted from the stimulated level of cAMP (i.e. that measured in the second incubation with hormone) and the corrected cAMP response detected in the group of cells preincubated with hFSH was expressed as the percentage of the cAMP response determined in the group of cells incubated without hFSH. Each number represents the average ± SEM of four (mutant cell lines) or seven (wt cell lines) independent experiments. The results obtained with 293F(wt-103) and 293F(wt-10) were combined because they seem to be indistinguishable.

 
The simultaneous mutation of three of the four potential phosphorylation sites present in the first intracellular loop also has no effect on hFSH binding or signal transduction (Tables 1Go and 2Go). Based on the peptide-mapping experiments and the results obtained with rFSHR-3L and rFSHR-(3L+CT), we expected rFSHR-1L to display roughly a 50% reduction in agonist-stimulated phosphorylation. The observed 89% decrease in agonist-stimulated phosphorylation clearly cannot be explained only by the expected reduction in the phosphorylation of the first intracellular loop that results from the mutation of the S/T residues present in this loop. Instead, one must invoke a more complex phenomenon where the mutation of the phosphorylation sites present in the first loop directly prevents the agonist-induced phosphorylation of this loop and also indirectly prevents the agonist-induced phosphorylation of the third loop. The indirect effect of the first intracellular loop mutation on the phosphorylation of the third intracellular loop may be due to a sequential phosphorylation event in which the first loop needs to be phosphorylated before the third loop is phosphorylated or may simply indicate a more generalized conformation change that prevents phosphorylation. Regardless of the actual mechanism involved, however, rFSHR-1L provided us an active rFSHR mutant that is virtually deficient in agonist-induced phosphorylation (Figs. 3Go and 4Go) and could thus be used to analyze the impact of phosphorylation on the functions of the rFSHR. The functional studies performed with this phosphorylation-deficient mutant clearly show that rFSHR phosphorylation is necessary, but not sufficient, for agonist-induced uncoupling (Fig. 5Go) and internalization (Fig. 6Go and Table 3Go).

Since the retardation of agonist-induced uncoupling is similar in rFSHR-1L and rFSHR-3L (Fig. 5Go), we can readily conclude that the phosphorylation of the third intracellular loop is particularly important for this effect. In contrast, a comparison of the rates of internalization of rFSHR-1L and rFSHR-3L (Fig. 6Go and Table 3Go) clearly show that the loss of phosphorylation of the third loop alone does not slow down agonist-induced internalization. The data presented do not allow us to determine whether the decrease in the rate of agonist-induced internalization detected in the phosphorylation-deficient mutant is due to the phosphorylation of the first loop alone or to the phosphorylation of both the first and third loops. It seems clear from these studies, however, that the phosphorylation of different domains is needed for agonist-uncoupling and for agonist-induced internalization. This conclusion is consistent with recent studies of the m2 muscarinic receptor showing that the agonist-induced uncoupling and internalization of this receptor are mediated by the phosphorylation of different domains present in the third cytoplasmic loop (35).

The rFSHR is also phosphorylated when transfected cells are stimulated with PMA (15), and this phosphorylation is fully preserved in rFSHR-t635, a C-terminal truncation that removes 12 of the 25 potential phosphorylation sites (16). The studies presented here show that PMA-induced phosphorylation is reduced by 40–60% in rFSHR-3L and rFSHR-(3L+CT). This reduction is similar to that detected when the phosphorylation of these mutants is stimulated by agonist (Figs. 3Go and 4Go). In contrast to the virtual loss of agonist-induced phosphorylation detected in rFSHR-1L, PMA-induced phosphorylation is again reduced by only 40–60% in this mutant (Figs. 3Go and 4Go). Thus, together with our previous studies utilizing rFSHR-t635, we can now conclude that the first and third intracellular loops have sites that become phosphorylated in response to PMA stimulation. Unfortunately, a mutant in which the S/T residues present in both the first and third intracellular loops were mutated was not expressed and could not be analyzed for PMA-induced phosphorylation. Moreover, we cannot exclude the second intracellular loop as an additional locus for PMA-stimulated phosphorylation until additional mutagenesis studies are performed.

The two mutants, rFSHR-1L and rFSHR-3L, which are partially deficient in PMA-induced phosphorylation, still exhibit a PMA-induced uncoupling of the hFSH-responsive adenylyl cyclase comparable to that detected in cells expressing rFSHR-wt (Table 4Go). Therefore, if the PMA-induced phosphorylation of the rFSHR is responsible for the PMA-induced uncoupling, the phosphorylation of sites present in both the first and third intracellular loops must be needed before this uncoupling can occur. The differences reported here between the hFSH- and PMA-stimulated phosphorylation of the rFSHR are not surprising in view of the findings that protein kinase C is at best only partially responsible for the rFSHR phosphorylation stimulated by hFSH (15). Moreover, the functional properties of the hFSH- and PMA-induced phosphorylation are different. The hFSH-induced uncoupling results in a reduction in agonist efficacy without affecting its potency, while the PMA-induced uncoupling results mostly in a reduction in agonist efficacy (15, 16).

As already mentioned above, there are two other GPCRs that have been shown to be phosphorylated in the third intracellular loop, the {alpha}2A-adrenergic and the m2 muscarinic receptors. Although the third intracellular loops of these two receptors are much longer (more than 150 residues) than that of the rFSHR (~20 residues), the third intracellular loops of all three receptors are characterized by the presence of one or more clusters of three to four S/T residues. Phosphorylation of the m2 muscarinic receptor occurs in two clusters of three adjacent S/T residues separated from a fourth S/T by a single amino acid and flanked by one or more acidic residues (34, 35). The residues of the {alpha}2A-adrenergic receptor that become phosphorylated after agonist stimulation have been identified as four adjacent serine residues that are followed by a D (S296,S297,S298,S299,D300), and the suggestion was made that similar sequences found in several other GPCRs may be an important phosphorylation motif (33). It is thus interesting to note that the third intracellular loop of the rFSHR, which is identified in this paper as an important locus for phosphorylation, contains a four-serine cluster followed by a D (Fig. 1Go). In this respect it is also interesting to note that the S545,S546,S547,S548,D549 cluster, as well as T537 and T550 in the third intracellular loop of the rFSHR, is fully conserved among the human, rat, bovine, ovine, and porcine FSH receptors (19, 20, 21, 24, 36, 37).

Lastly, it is interesting to compare the amino acid sequences of the rFSHR and the highly related rLHR because the phosphorylation sites of the latter have been recently identified as four serine residues (S635, S639, S649, and S652) located in the C-terminal tail (11, 12, 14). Only two of the four residues phosphorylated in the rLHR (S635 and S649) are conserved in the rFSHR as S641 and S655 (Fig. 1Go), but neither are phosphorylated (16). Likewise, while some of the rFSHR residues identified here as phosphorylation sites are conserved in the rLHR, they are not phosphorylated in the latter. These include the equivalent of T372, S373, and T378 present in the first intracellular loop as well as T550 present in the third intracellular loop of the rFSHR (Fig. 1Go).

In summary, four conclusions can be drawn from the present studies. First, the phosphorylated rFSHR is a common molecular intermediate in agonist-induced uncoupling and internalization. Second, the agonist-induced phosphorylation of the rFSHR occurs in the first and third intracellular loops. Third, the phosphorylation of the third intracellular loop facilitates agonist-induced uncoupling but is not necessary for agonist-induced internalization. Fourth, agonist-induced internalization is facilitated by phosphorylation but it is not known whether only the first loop, only the third loop, or both the first and third loops need to be phosphorylated for this response.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmids and Cells
The cloning of the rFSHR cDNA containing the full-length coding region plus portions of the 5'- and 3'-untranslated regions of the wt rFSHR cDNA have been previously described (36). This cDNA was subcloned into the eukaryotic expression vector pcDNAI/Neo (Invitrogen, San Diego, CA) and used as a template for mutagenesis and for transfections.

The mutants used here were constructed by PCR with overlap extension (38). rFSHR-1L was constructed by mutating the nucleotide sequence within the first intracellular loop of the rFSHR from 1159ACCACAAGCCAATACAAACTAACT1182 to 1159ATCACAATCCAATACAAACTAAAT1182 thus changing the amino acid sequence within the first loop from T369TSQYKLT376 to I369TIQYKLN376 (see Fig. 1Go). rFSHR-3L was constructed by mutating the nucleotide sequence around the third intracellular loop of the rFSHR from 1659A-CAGTGAGGAATCCTACCATTGTGTCCTCATCAAGCGACA-CC1701 to 1659GCAGTGAGGAATCCTGCCATTGTGGCCGCAGCAGCCGACGCC1701 thus changing the amino acid sequence within the third loop from T536VRNPTIVSSSSDT549 to A536VRNPAIVAAAADA549 (see Fig. 1Go). Rat FSHR-(3L+CT) was constructed using rFSHR-3L as the template and mutating codon 1920 from ACG to GCC thus mutating residue 624 from S to A (see Fig. 1Go). The sequence of the entire region of each mutant cDNA generated by PCR was verified by automated DNA sequencing.

The origin and handling of the parental human embryonic kidney (293) cells and the methods used for transfection and isolation of clonal cell lines stably transfected with the wt or mutant rFSHR cDNAs have been described in detail elsewhere (15, 16).

Hormone Binding and cAMP Accumulation
Binding parameters for hFSH were measured during a 1-h incubation of intact cells (plated in 35-mm wells) with increasing concentrations of [125I]hFSH at 37 C. All binding assays were corrected for nonspecific binding, which was measured in the presence of 100 µg/ml PMSG. The binding of hFSH to intact cells at 37 C is clearly not reversible because the bound hormone is internalized (c.f. Fig. 6Go). Since the irreversible nature of the binding reaction precludes the measurement of equilibrium binding parameters (i.e. binding affinity and maximal binding capacity), we simply fitted the binding data to a sigmoidal equation (39) using the DeltaGraph software Deltapoint (Monterey, CA) and used this equation to calculate the maximal amount of cell-associated hormone and the concentration of hFSH required to attain half of this value (EC50).

Concentration-response curves for the hFSH-induced increases in cAMP accumulation were obtained by measuring total cAMP levels in cells (plated in 35-mm wells) that had been incubated with at least five different concentrations of hFSH for 15 min at 37 C in the presence of a phosphodiesterase inhibitor. The different parameters that describe the concentration response curves were calculated as described elsewhere (16).

Phosphorylation
Metabolic labeling of cells with 32Pi immunoprecipitation of the rFSHR and electrophoresis of the immunoprecipitated receptor were done as previously described (15, 16, 40). Receptor phosphorylation was ascertained after the 32Pi-prelabeled cells were incubated at 37 C with buffer only for 15–60 min, 100 ng/ml hFSH for 60 min, or 200 nM PMA for 15 min (16). One cell line expressing rFSHR-wt and one cell line expressing one of the rFSHR mutants were used in each experiment. Experiments using 293F(3L) or 293F(3L+CT) cells used 293F(wt-10) cells as control, while those using 293F(1L) cells used 293F(wt-103) as control. Regardless of the cell lines used, the amount of wt and mutant receptor used for immunoprecipitation was equalized based on the binding data shown on Table 1Go. Autoradiograms of the dried gels were obtained using Kodak BioMax MS film (Eastman Kodak, Rochester, NY) and intensifying screens. The autoradiograms were scanned and quantitated using a Bio-Rad Molecular Imaging System (Bio-Rad Laboratories, Richmond, CA). All images were captured in a digital format for presentation.

Peptide Mapping
The rFSHR immunoprecipitated from 32Pi-labeled cells that had been stimulated with hFSH (see above) was detected by autoradiography of dried gels and excised. The dried gel piece was then rehydrated with water for 10 min, and the paper backing was removed before the gel was cut into smaller pieces. These were shaken overnight a 37 C in 1 ml of 50 mM NH4HCO3, 0.1% SDS, pH 7.8. The supernatant was collected, and the gel pieces were rinsed with 500 µl of the same buffer. This wash was combined with the original supernatant, centrifuged at 10,000 x g for 10 min. and then concentrated to about 60 µl using a Centricon-30 (Fisher Scientific, Pittsburgh, PA). This sample was diluted with 60 µl of glacial acetic acid followed by the addition of 60 mg urea. The sample was then incubated for 15 min at 60 C before the addition of N-chlorosuccinimide at a final concentration of 50 mM. The incubation was continued at room temperature for 60 min before the addition of the same amount of N-chlorosuccinimide for a second time. After an additional 60-min incubation at room temperature, the reaction was diluted with 1 ml of 50 mM NH4HCO3, 0.1% SDS, pH 7.8, and cooled on ice. The peptides were precipitated by adding trichloroacetic acid to give a final concentration of 12.5% and 20 µg RNAseI as carrier. The precipitate was collected by centrifugation, washed with ice-cold acetone, and solubilized in tricine gel sample buffer (12% glycerol (wt/vol), 4% SDS (wt/vol), 2% mercaptoethanol (vol/vol), and 0.01% bromophenol blue (wt/vol) in 50 mM Tris-HCl, pH 6.8). The generated peptides were then separated using a discontinuous tricine-urea-SDS-PAGE system as described previously (16). After electrophoresis the peptides were electrophoretically transferred to a polyvinylidene difluoride membrane to increase resolution during analysis with a phosphorimager (41). The phosphorimager data were captured in digital format for presentation.

Uncoupling and Internalization
Measurements of agonist-induced uncoupling were performed as follows. Cells expressing rFSHR-wt or the mutant receptors were plated in 35-mm wells and incubated without (group A) or with (group B) 100 ng/ml hFSH for increasing periods of time. The free and bound hormones were removed by washing with neutral and acidic buffers, respectively, and each group of cells was subsequently incubated with (A1, B1) or without (A2, B2) 100 ng/ml hFSH for 15 min at 37 C (16). Intracellular levels of cAMP were measured at the end of this incubation, and agonist-induced uncoupling was calculated as follows: [(B1-B2)/(A1-A2)] x 100. PMA-induced uncoupling was measured by incubating cells expressing rFSHR-wt or the mutant receptors without (group A) or with (group B) 200 nM PMA for 30 min (16). Each group of cells was subsequently incubated with (A1, B1) or without (A2, B2) the indicated concentrations of hFSH for 15 min at 37 C. Intracellular levels of cAMP were measured at the end of this incubation, and agonist-induced uncoupling was calculated for each concentration of hFSH used as follows: [(B1-B2)/(A1-A2)] x 100.

The endocytosis of [125I]hFSH was measured as follows. Cells, plated in 35-mm wells, were preincubated in 1 ml of Waymouths MB752/1 containing 1 mg/ml BSA and 20 mM HEPES, pH 7.4, for 60 min at 37 C. Each well then received 40 ng/ml [125I]hFSH, and the incubation was continued at 37 C. Groups of cells were placed on ice at 3-min intervals and washed twice with 2-ml aliquots of cold HBSS containing 1 mg/ml BSA. The surface-bound hormone was then released by incubating the cells in 1 ml of cold 50 mM glycine, 100 mM NaCl, pH 3, for 2–4 min (28, 29). The acidic buffer was removed, and the cells were washed once more with another aliquot of the same buffer. The acid buffer washes were combined and counted, and the cells were solubilized with 100 µl of 0.5 N NaOH, collected with a cotton swab, and counted to determine the amount of internalized hormone. Six different data points collected at 3-min intervals were used in each experiment, and the rate constant for internalization (ke) was calculated from the slope of the line obtained by plotting the internalized radioactivity against the integral of the surface-bound radioactivity (30). The half-life of internalization (t1/2) is defined as 0.693/ke.

Hormones and Supplies
The rabbit antibody to the rFSHR (Anti-F) has been described (40). Purified hFSH (AFP-5720D) was kindly provided by the National Hormone and Pituitary Agency of the National Institute of Diabetes and Digestive and Kidney Diseases. [125I]FSH was prepared as previously described (42). PMSG was obtained from the National Hormone and Pituitary Agency of the National Institute of Diabetes and Digestive and Kidney Diseases or purchased from Sigma. [32P]orthophosphate was obtained from Du Pont-New England Nuclear (Boston, MA). Phosphate-free DMEM was purchased from ICN Biomedicals (Irvine, CA). Nonidet P-40, protease inhibitors, N,N',N"-triacetylchitotriose, protein A-agarose, and BSA were from Sigma (St. Louis, MO). Okadaic acid and cypermethrin were purchased from Alexis Biochemicals (Woburn, MA). Wheat germ agglutinin agarose was from Vector Laboratories (Burlingame, CA). Cell culture supplies and reagents were obtained from Corning (Corning, NY) and GIBCO (Grand Island, NY), respectively. All other materials were obtained from commonly used suppliers.


    ACKNOWLEDGMENTS
 
We wish to thank Dr. Deborah L. Segaloff for critically reading this manuscript and Dr. Xuebo Liu for many helpful suggestions on the construction of rFSHR mutants. We also thank other members of the Ascoli laboratory for their suggestions throughout the course of these experiments.


    FOOTNOTES
 
Address requests for reprints to: Dr. Mario Ascoli, Department of Pharmacology, 2–512 BSB, The University of Iowa, Iowa City, Iowa 52242.

This work was supported by a grant from the National Institute of Child Health and Human Development (HD-28962) to M.A. The services and facilities provided by the Diabetes and Endocrinology Research Center of the University of Iowa were supported by NIH Grant DK-25295. K.N. was partially supported by a fellowship from the Lalor Foundation. R.W.H. was partially supported by a fellowship from the Juvenile Diabetes Foundation.

Received for publication November 13, 1997. Revision received December 31, 1997. Accepted for publication January 12, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Premont RT, Inglese J, Lefkowitz RJ 1995 Protein kinases that phosphorylate activated G protein-coupled receptors. FASEB J 9:175–182[Abstract]
  2. Lefkowitz RJ 1993 G protein-coupled receptor kinases. Cell 74:409–412[CrossRef][Medline]
  3. Hausdorff WP, Caron MG, Lefkowitz RJ 1990 Turning off the signal: desensitization of ß-adrenergic receptor function. FASEB J 4:2881–2889[Abstract]
  4. Ferguson SSG, Zhang J, Barak LS, Caron MG 1997 Pleiotropic role for GRKs and ß-arrestins in receptor regulation. News Physiol Sci 12:145–151[Abstract/Free Full Text]
  5. Ferguson SSG, Downey WE, Colapietro A, Barak LB, Menard L, Caron MC 1996 Role of ß-arrestin in mediating agonist-promoted G protein-coupled receptor internalization. Science 271:363–365[Abstract]
  6. Zhang J, Ferguson SSG, Barak LS, Menard L, Caron MG 1996 Dynamin and ß-arrestin reveal distinct mechanisms of G protein-coupled receptor internalization. J Biol Chem 271:18302–18305[Abstract/Free Full Text]
  7. Goodman J, OB, Krupnick JG, Santini F, Gurevich VV, Penn RB, Gagnon AW, Keen JH, Benovic JL 1996 ß-arrestin acts as a clathrin adaptor in endocytosis of the ß2-adrenergic receptor. Nature 383:447–450[CrossRef][Medline]
  8. Segaloff DL, Ascoli M 1993 The lutropin/choriogonadotropin (LH/CG) receptor... 4 years later. Endocr Rev 14:324–347[Abstract/Free Full Text]
  9. Ascoli M 1996 Functional consequences of the phosphorylation of the gonadotropin receptors. Biochem Pharmacol 52:1647–1655[CrossRef][Medline]
  10. Ascoli M 1997 Molecular basis of the regulation of the lutropin/choriogonadotropin (LH/CG) receptor. Biochem Soc Trans 25:1021–1026[Medline]
  11. Wang Z, Hipkin RW, Ascoli M 1996 Progressive cytoplasmic tail truncations of the lutropin-choriogonadotropin receptor prevent agonist- or phorbol ester-induced phosphorylation, impair agonist- or phorbol ester-induced desensitization and enhance agonist-induced receptor down-regulation. Mol Endocrinol 10:748–759[Abstract/Free Full Text]
  12. Hipkin RW, Wang Z, Ascoli M 1995 Human chorionic gonadotropin- and phorbol ester stimulated phosphorylation of the LH/CG receptor maps to serines 635, 639, 645 and 652 in the C-terminal cytoplasmic tail. Mol Endocrinol 9:151–158[Abstract/Free Full Text]
  13. Hipkin RW, Sánchez-Yagüe J, Ascoli M 1993 Agonist-induced phosphorylation of the luteinizing hormone/chorionic gonadotropin (LH/CG) receptor expressed in a stably transfected cell line. Mol Endocrinol 7:823–832[Abstract/Free Full Text]
  14. Wang Z, Liu X, Ascoli M 1997 Phosphorylation of the lutropin/choriogonadotropin receptor facilitates uncoupling of the receptor from adenylyl cyclase and endocytosis of the bound hormone. Mol Endocrinol 11:183–192[Abstract/Free Full Text]
  15. Quintana J, Hipkin RW, Sánchez-Yagüe J, Ascoli M 1994 Follitropin (FSH) and a phorbol ester stimulate the phosphorylation of the FSH receptor in intact cells. J Biol Chem 269:8772–8779[Abstract/Free Full Text]
  16. Hipkin RW, Liu X, Ascoli M 1995 Truncation of the C-terminal tail of the follitropin (FSH) receptor does not impair the agonist- or phorbol ester-induced receptor phosphorylation and uncoupling. J Biol Chem 270:26683–26689[Abstract/Free Full Text]
  17. Mahoney WC, Hermodson MA 1979 High-yield cleavage of tryptophanyl peptide bonds by o-iodosobenzoic acid. Biochemistry 18:3810–3814[CrossRef][Medline]
  18. Lischwe MA, Ochs D 1982 A new method for partial peptide mapping using N-chlorosuccinimide/urea and peptide silver staining in sodium dodecyl sufate-polyacrylamide gels. Anal Biochem 127:453–457[CrossRef][Medline]
  19. Remy JJ, Lahbib-Mansais Y, Yerle M, Bozon V, Couture L, Pajot E, Greber D, Salesse R 1995 The porcine follitropin receptor: cDNA cloning, functional expression and chromosomal localization of the gene. Gene 163:257–261[CrossRef][Medline]
  20. Yarney TA, Sairam MR, Khan H, Ravindranath N, Payne S, Seidah NG 1993 Molecular cloning and expression of the ovine testicular follicle stimulating hormone receptor. Mol Cell Endocrinol 93:219–226[CrossRef][Medline]
  21. Robert P, Amsellem S, Christophe S, Benifla JL, Bellet D, Koman A, Bidart JM 1996 Cloning and sequencing of the equine testicular follitropin receptor. Biochem Biophys Res Commun 201:201–207
  22. Libert F, Lefort A, Gerard C, Parmentier M, Perret J, Ludgate M, Dumont JE, Vassart G 1989 Cloning, sequencing and expression of the human thyrotropin (TSH) receptor: evidence for binding of autoantibodies. Biochem Biophys Res Commun 165:1250–1255[CrossRef][Medline]
  23. Nothacker HP, Grimmelikhuijzen CJ 1993 Molecular cloning of a novel, putative G protein-coupled receptor from sea anemones structurally related to members of the FSH, TSH and LH/CG receptor family from mammals. Biochem Biophys Res Commun 197:1062–1069[CrossRef][Medline]
  24. Hauser F, Nothacker H-P, Grimmelikhuijzen CJP 1997 Molecular cloning, genomic organization, and developmental regulation of a novel receptor from Drosophila melanogaster structurally related to members of the thyroid-stimulating hormone, follicle stimulating hormone, luteinizing hormone/choriogonadotropin receptor family from mammals. J Biol Chem 272:1002–1010[Abstract/Free Full Text]
  25. Ren Q, Kurose H, Lefkowitz RJ, Cotecchia S 1993 Constitutively active mutants of the {alpha}2-adrenergic receptor. J Biol Chem 268:16483–16487[Abstract/Free Full Text]
  26. Kosugi S, Okajima F, Ban T, Hidaka A, Shenker A, Kohn LD 1993 Substitutions of different regions of the third cytoplasmic loop of the thyrotropin (TSH) receptor have selective effects on constitutive, TSH-, and TSH receptor autoantibody-stimulated phosphoinositide and 3', 5'-cyclic adenosine monophosphate signal generation. Mol Endocrinol 7:1009–1020[Abstract/Free Full Text]
  27. Whaley BS, Yuan N, Birnbaumer L, Clark RB, Barber R 1994 Differential expression of the ß-adrenergic receptor modifies agonist stimulation of adenylyl cyclase: a quantitative evaluation. Mol Pharmacol 45:481–489[Abstract]
  28. Ascoli M 1982 Internalization and degradation of receptor-bound human choriogonadotropin in Leydig tumor cells. Fate of the hormone subunits. J Biol Chem 257:13306–13311[Abstract/Free Full Text]
  29. Fletcher PW, Reichert Jr LE 1984 Cellular processing of follicle-stimulating hormone by Sertoli cells in serum-free culture. Mol Cell Endocrinol 34:39–49[CrossRef][Medline]
  30. Wiley HS, Cunningham DD 1982 The endocytotic rate constant. A cellular parameter for quantitating receptor-mediated endocytosis. J Biol Chem 257:4222–4229[Free Full Text]
  31. Dhanwada KR, Vijapurkar U, Ascoli M 1996 Two mutations of the lutropin/choriogonadotropin receptor that impair signal transduction also interfere with receptor-mediated endocytosis. Mol Endocrinol 10:544–554[Abstract/Free Full Text]
  32. Hoelscher SR, Sairam MR, Ascoli M 1991 The slow rate of internalization of deglycosylated hCG is not due to its inability to stimulate cAMP accumulation. Endocrinology 128:2837–2843[Abstract/Free Full Text]
  33. Eason MG, Moreira SP, Liggett SB 1995 Four consecutive serines in the third intracellular loop are the sites for ß-adrenergic receptor kinase-mediated phosphorylation and desensitization of the {alpha}2A-adrenergic receptor. J Biol Chem 270:4681-4688[Abstract/Free Full Text]
  34. Pals-Rylaarsdam R, Xu Y, Witt-Enderby P, Benovic JL, Hosey M 1995 Desensitization and internalization of the m2 muscarinic acetylcholine receptor are directed by independent mechanisms. J Biol Chem 270:29004–29011[Abstract/Free Full Text]
  35. Pals-Rylaarsdam R, Hosey MM 1997 Two homologous phosphorylation domains differentially contribute to desensitization and internalization of the m2 muscarinic acetylcholine receptor. J Biol Chem 272:14152–14158[Abstract/Free Full Text]
  36. Sprengel R, Braun T, Nikolics K, Segaloff DL, Seeburg PH 1990 The testicular receptor for follicle stimulating hormone: structure and functional expression of cloned cDNA. Mol Endocrinol 4:525–530[Abstract/Free Full Text]
  37. Minegishi T, Nakamura K, Takakura Y, Ibuki Y, Igarashi M 1991 Cloning and sequencing of human FSH receptor cDNA. Biochem Biophys Res Commun 175:1125–1130[CrossRef][Medline]
  38. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR 1989 Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59[CrossRef][Medline]
  39. De Lean A, Munson PJ, Rodbard D 1978 Simultaneous analysis of families of sigmoidal curves: application to bioassay, radioligand assay and physiological dose-response curves. Am J Physiol 235:E97–E102
  40. Quintana J, Hipkin RW, Ascoli M 1993 A polyclonal antibody to a synthetic peptide derived from the rat FSH receptor reveals the recombinant receptor as a 74 kDa protein. Endocrinology 133:2098–2104[Abstract/Free Full Text]
  41. Hipkin RW, Friedman J, Clark R, Eppler CM, Schonbrunn A 1997 Agonist-induced desensitization, internalization, and phosphorylation of the sst2A somatostatin receptor. J Biol Chem 272:13869–13876[Abstract/Free Full Text]
  42. Ascoli M, Puett D 1978 Gonadotropin binding and stimulation of steroidogenesis in Leydig tumor cells. Proc Natl Acad Sci USA 75:99–102[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
E. Kara, P. Crepieux, C. Gauthier, N. Martinat, V. Piketty, F. Guillou, and E. Reiter
A Phosphorylation Cluster of Five Serine and Threonine Residues in the C-Terminus of the Follicle-Stimulating Hormone Receptor Is Important for Desensitization But Not for ss-Arrestin-Mediated ERK Activation
Mol. Endocrinol., November 1, 2006; 20(11): 3014 - 3026.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
W. H Walker and J. Cheng
FSH and testosterone signaling in Sertoli cells
Reproduction, July 1, 2005; 130(1): 15 - 28.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Ronacher, N. Matsiliza, N. Nkwanyana, A. J. Pawson, T. Adam, C. A. Flanagan, R. P. Millar, and A. A. Katz
Serine Residues 338 and 339 in the Carboxyl-Terminal Tail of the Type II Gonadotropin-Releasing Hormone Receptor Are Critical for {beta}-Arrestin-Independent Internalization
Endocrinology, October 1, 2004; 145(10): 4480 - 4488.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Krishnamurthy, H. Kishi, M. Shi, C. Galet, R. S. Bhaskaran, T. Hirakawa, and M. Ascoli
Postendocytotic Trafficking of the Follicle-Stimulating Hormone (FSH)-FSH Receptor Complex
Mol. Endocrinol., November 1, 2003; 17(11): 2162 - 2176.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. D. Cohen, J. T. Bariteau, L. M. Magenis, and J. A. Dias
Regulation of Follitropin Receptor Cell Surface Residency by the Ubiquitin-Proteasome Pathway
Endocrinology, October 1, 2003; 144(10): 4393 - 4402.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Kishi, H. Krishnamurthy, C. Galet, R. S. Bhaskaran, and M. Ascoli
Identification of a Short Linear Sequence Present in the C-terminal Tail of the Rat Follitropin Receptor That Modulates Arrestin-3 Binding in a Phosphorylation-independent Fashion
J. Biol. Chem., June 7, 2002; 277(24): 21939 - 21946.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Marion, F. Robert, P. Crepieux, N. Martinat, C. Troispoux, F. Guillou, and E. Reiter
G Protein-Coupled Receptor Kinases and Beta Arrestins Are Relocalized and Attenuate Cyclic 3',5'-Adenosine Monophosphate Response to Follicle-Stimulating Hormone in Rat Primary Sertoli Cells
Biol Reprod, January 1, 2002; 66(1): 70 - 76.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
F. Clement, D. Monniaux, J. Stark, K. Hardy, J. C. Thalabard, S. Franks, and D. Claude
Mathematical model of FSH-induced cAMP production in ovarian follicles
Am J Physiol Endocrinol Metab, July 1, 2001; 281(1): E35 - E53.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. P. N. Themmen and I. T. Huhtaniemi
Mutations of Gonadotropins and Gonadotropin Receptors: Elucidating the Physiology and Pathophysiology of Pituitary-Gonadal Function
Endocr. Rev., October 1, 2000; 21(5): 551 - 583.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. Nakamura, X. Liu, and M. Ascoli
Seven Non-contiguous Intracellular Residues of the Lutropin/Choriogonadotropin Receptor Dictate the Rate of Agonist-induced Internalization and Its Sensitivity to Non-visual Arrestins
J. Biol. Chem., January 7, 2000; 275(1): 241 - 247.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Blomenröhr, A. Heding, R. Sellar, R. Leurs, J. Bogerd, K. A. Eidne, and G. B. Willars
Pivotal Role for the Cytoplasmic Carboxyl-Terminal Tail of a Nonmammalian Gonadotropin-Releasing Hormone Receptor in Cell Surface Expression, Ligand Binding, and Receptor Phosphorylation and Internalization
Mol. Pharmacol., December 1, 1999; 56(6): 1229 - 1237.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. Nakamura, X. Liu, and M. Ascoli
The Rate of Internalization of the Gonadotropin Receptors Is Greatly Affected by the Origin of the Extracellular Domain
J. Biol. Chem., September 3, 1999; 274(36): 25426 - 25432.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. Troispoux, F. Guillou, J.-M. Elalouf, D. Firsov, L. Iacovelli, A. De Blasi, Y. Combarnous, and E. Reiter
Involvement of G Protein-Coupled Receptor Kinases and Arrestins in Desensitization to Follicle-Stimulating Hormone Action
Mol. Endocrinol., September 1, 1999; 13(9): 1599 - 1614.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
M. d. F. M. Lazari, X. Liu, K. Nakamura, J. L. Benovic, and M. Ascoli
Role of G Protein-Coupled Receptor Kinases on the Agonist-Induced Phosphorylation and Internalization of the Follitropin Receptor
Mol. Endocrinol., June 1, 1999; 13(6): 866 - 878.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. Nakamura, J. G. Krupnick, J. L. Benovic, and M. Ascoli
Signaling and Phosphorylation-impaired Mutants of the Rat Follitropin Receptor Reveal an Activation- and Phosphorylation-independent but Arrestin-dependent Pathway for Internalization
J. Biol. Chem., September 18, 1998; 273(38): 24346 - 24354.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Kishi and M. Ascoli
Multiple Distant Amino Acid Residues Present in the Serpentine Region of the Follitropin Receptor Modulate the Rate of Agonist-induced Internalization
J. Biol. Chem., September 29, 2000; 275(40): 31030 - 31037.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakamura, K.
Right arrow Articles by Ascoli, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakamura, K.
Right arrow Articles by Ascoli, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals