help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ooi, G. T.
Right arrow Articles by Boisclair, Y. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ooi, G. T.
Right arrow Articles by Boisclair, Y. R.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Dietary Proteins
Molecular Endocrinology 12 (5): 675-687
Copyright © 1998 by The Endocrine Society

Binding of STAT5a and STAT5b to a Single Element Resembling a {gamma}-Interferon-Activated Sequence Mediates the Growth Hormone Induction of the Mouse Acid-Labile Subunit Promoter in Liver Cells

Guck T. Ooi, Kelley R. Hurst, Matthew N. Poy, Matthew M. Rechler and Yves R. Boisclair

Growth and Development Section (G.T.O., M.N.P., M.M.R.) Molecular and Cellular Endocrinology Branch National Institute of Diabetes and Digestive and Kidney Diseases National Institutes of Health Bethesda, Maryland 20892
Department of Animal Science (K.R.H., Y.R.B.) Cornell University Ithaca, New York 14853


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
After birth, the endocrine actions of insulin-like growth factor (IGF)-I and -II become increasingly important. In postnatal animals, most of circulating IGFs occur in 150-kDa complexes formed by association of an acid-labile subunit (ALS) with complexes of IGF and IGF-binding protein-3. ALS is synthesized almost exclusively in liver. GH stimulates the transcription of the ALS gene, resulting in increased hepatic mRNA and circulating ALS levels. To map the GH response element, a series of 5'-deletion fragments of the mouse ALS promoter (nt -2001 to -49, A+1TG) were inserted in the luciferase reporter plasmid pGL3 and transfected into the H4-II-E rat hepatoma cell line. GH stimulated the activity of promoter fragments with 5'-ends between nucleotide (nt) -2001 and nt -653 by 1.9- to 2.7-fold. This stimulation was abolished by deletion of the region located between nt -653 and nt -483. This region contains two sites, ALS-GAS1 and ALS-GAS2, that resemble the {gamma}-interferon activated sequence (GAS). Mutation of the ALS-GAS1 site, but not of the ALS-GAS2 site, eliminated the response to GH when assessed in the context of a GH-responsive promoter fragment, indicating that ALS-GAS1 was necessary for GH induction. Three tandem copies of ALS-GAS1 were sufficient to confer GH inducibility to the minimal promoter of the thymidine kinase gene. In electrophoretic mobility shift assays, ALS-GAS1 formed a specific, GH-dependent protein-DNA complex with nuclear extracts from H4-II-E cells. Using antibodies directed against members of the family of signal transducers and activators of transcription (STAT), this complex was shown to be composed of STAT5a and STAT5b. Identical results were obtained when transfections and mobility shift assays were performed in primary rat hepatocytes in which the endogenous ALS gene is expressed. Thus, the transcriptional activation of the mouse ALS gene by GH is mediated by the binding of STAT5 isoforms to a single GAS-like element.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Insulin-like growth factor (IGF)-I and -II are involved in the regulation of cellular processes such as proliferation, prevention of apoptosis, and differentiation (1, 2). Their importance for normal growth and development was confirmed by targeted inactivation of the IGF-I and -II genes in mice (1, 2). Before birth, most of the effects of IGFs result from autocrine/paracrine action (1, 2). After birth, however, the endocrine mode becomes increasingly important with IGF-I mediating many of the effects of GH (1, 3) and linking anabolic processes such as protein synthesis to nutrient availability (4).

In postnatal animals, 80–85% of circulating IGFs is sequestered in a complex of 150-kDa complexes composed of one molecule each of IGF, IGF-binding protein-3 (IGFBP-3), and a serum protein called the acid-labile subunit (ALS) (1, 5, 6). The ability of ALS to recruit IGFs to the 150-kDa complex has important functional consequences on their physiology. When present in the 150-kDa complex, IGFs can no longer cross the capillary endothelium and have considerably longer half-lives (7, 8). The 150-kDa complex serves both as a reservoir of IGFs for tissues (9) and as a mechanism to prevent nonspecific effects such as activation of the insulin receptor and the resulting hypoglycemia (10, 11). Therefore, ALS is an important determinant of the endocrine actions of IGFs on target cells.

Synthesis of ALS occurs almost exclusively in the parenchymal cells of liver after birth (12, 13). GH is the most potent inducer of ALS mRNA in liver and of ALS in the circulation (10, 14, 15, 16). These effects are direct as GH increases the abundance of ALS mRNA and the secretion of ALS in primary rat hepatocytes in vitro (17). The changes in the levels of ALS mRNA in liver of hypophysectomized rats result from regulation of ALS gene transcription (16).

We recently cloned the mouse ALS gene and demonstrated that the fragment corresponding to nt -2001 to -49 contains a GH-responsive promoter when assayed by transient transfection in the H4-II-E rat hepatoma cell line and primary rat hepatocytes (16, 18). Using these model systems, we now demonstrate that the effects of GH on the ALS gene are mediated by the binding of members of the signal transducers and activators of transcription (STAT) to a single element resembling a {gamma}-interferon-activated sequence (GAS).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The GH-Responsive Region Is Located between nt -653 and nt -483 of the Mouse ALS Promoter
GH increased the luciferase activity in H4-II-E cells transiently transfected with a reporter plasmid containing the nt -2001 to nt -49 promoter fragment of the mouse ALS gene (16). To map the region of the promoter that confers GH responsiveness, a series of promoter deletion fragments having variable 5'-ends and a common 3'-end at nt -49 were inserted in the sense orientation into the luciferase reporter plasmid pGL3-basic and transfected into H4-II-E cells (Fig. 1Go). Luciferase activity was determined 18–24 h after treatment with 0 or 100 ng/ml of human GH (hGH). The luciferase activity of the construct terminating at nt -2001 was increased 2.7 ± 0.5 fold (mean ± SE) by GH (Fig. 1Go). Deletion of the region between nt -2001 and nt -653 did not significantly decrease the GH stimulation. In contrast, GH treatment did not increase the luciferase activity of the cells transfected with the deletion constructs with 5'-ends at nt -483, -323, or -245. These results indicate that the 170-bp region between nt -653 and nt -483 is essential for the GH stimulation of the mouse ALS promoter activity.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. Deletion Mapping of the Region That Confers GH Responsiveness to the Mouse ALS Promoter

A family of 5'-deletion fragments (shown as thick lines, left panel) was generated by PCR and inserted in the sense orientation into the plasmid pGL3-basic (LUC). The 5'-end of each fragment is given to the left relative to A+1TG of the mouse ALS gene. All fragments shared a common 3'-end at nt -49. Luciferase plasmids (2 µg) and the plasmid pCMV-SEAP (0.05 µg) encoding secreted alkaline phosphatase were transfected in duplicate into H4-II-E cells by the DEAE-dextran method. The transfected cells were incubated for 18–24 h in serum-free medium either in the absence or presence of 100 ng/ml of hGH. Luciferase activity, measured in cell lysate, was normalized to alkaline phosphatase secreted in medium. For each construct, the fold-stimulation by GH (mean ± SE of two experiments) corresponding to the ratio of luciferase activity obtained in the presence and in the absence of GH, was calculated (right panel). *, Significantly different (P < 0.05) from the luciferase activity of promoter constructs whose 5'-end is at nt -2001, -1653, -1273, -703, and -653 using one-way ANOVA followed by Fisher Protected Least Significant Difference analysis.

 
A Single GAS between nt -633 and nt -625 Is Necessary and Sufficient for GH Stimulation of Mouse ALS Promoter Activity
Computer analysis of the nt -653 to nt -483 region identified two sites that resemble the GAS consensus sequence, TTNCNNNAA (19). Similar GAS-like sites have been shown to mediate the effects of various cytokines, including GH, on the transcription of other genes (19, 20). The first site, TTCCTAGAA (ALS-GAS1), is located between nt -633 and nt -625; the second site, TTAGACAAA (ALS-GAS2), is located between nt -553 and nt -545.

To ascertain whether one or both of these two ALS-GAS sites were functionally important for GH stimulation of ALS promoter activity, plasmids containing block mutations of either ALS-GAS1 (703{Delta}ALS1) or ALS-GAS2 (703{Delta}ALS2) were prepared in the context of the luciferase construct retaining full responsiveness to GH (703WT with 5'-end at nt -703), and transfected into H4-II-E cells (Fig. 2Go, top). Mutation of the ALS-GAS1 element abolished the ability of the promoter to respond to GH (Fig. 2Go, top); mutation of the ALS-GAS2 element was without effect. Thus, an intact ALS-GAS1 element is necessary for GH stimulation of ALS promoter activity.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2. A Single GAS-Like Element Is Necessary for GH Responsiveness of the Mouse ALS Promoter and Confers GH Responsiveness to an Heterologous Promoter

Top, Mouse ALS plasmids. The nt -703 to nt -49 promoter fragment (703WT) contains two GAS-like sequences, one located between nt -633 and nt -625 (ALS-GAS1, oval box), the other between nt -553 and nt -545 (ALS-GAS2, rectangular box). Individual block substitution mutants were obtained by replacing ALS-GAS1 (703{Delta}ALS1) or ALS-GAS2 (703{Delta}ALS2) by an EcoRI linker (crossed boxes). These plasmids (2 µg) were cotransfected with pCMV-SEAP (0.05 µg) in duplicate into H4-II-E cells by the DEAE-dextran method. Transfected H4-II-E cells were incubated for 18–24 h in serum-free medium in the absence or presence of 100 ng/ml of hGH. Luciferase activity, measured in cell lysate, was normalized to alkaline phosphatase secreted in medium. For each construct, the fold-stimulation by GH represents the mean ± SE of three experiments. Bottom, Thymidine kinase plasmids. Three tandem copies of the ALS-GAS1 sequence (oval boxes) were inserted in front of the minimal promoter for the thymidine kinase gene of the TK-LUC plasmid to give TK-LUC-3GAS. TK-LUC and TK-LUC-3GAS (2 µg) were cotransfected with pCMV-SEAP (0.05 µg) in duplicate into H4-II-E cells by the DEAE-dextran method. Cell treatments, luciferase assays, and calculations were performed as described above. For each construct, the fold-stimulation by GH represents the mean ± SE of three experiments.

 
To establish that the ALS-GAS1 sequence alone is sufficient to mediate the stimulation by GH, three tandem copies of the 9-bp ALS-GAS1 element were introduced in TK-LUC to give TK-LUC-3GAS. In TK-LUC, the luciferase gene is driven by the minimal promoter of the thymidine kinase gene. GH stimulated luciferase activity 3.6 ± 0.2 fold in H4-II-E cells transfected with TK-LUC-3GAS, but produced no significant effects in cells transfected with TK-LUC (Fig. 2Go, bottom). Together, these results indicate that the 9-bp GAS-like sequence, ALS-GAS1, is both necessary and sufficient to confer GH responsiveness to the mouse ALS promoter.

The ALS-GAS1 Element Binds Nuclear Proteins in H4-II-E Cells in a GH-Dependent Manner
Electrophoretic mobility shift assays (EMSAs) were performed to identify nuclear proteins in H4-II-E cells that bind to the ALS-GAS1 element in a GH-dependent manner. H4-II-E cells, maintained for 16 h in serum-free medium, were incubated for 15 min with either 0 or 100 ng/ml of bovine GH (bGH).1 Nuclear extracts prepared from both groups of cells were incubated with an oligonucleotide probe corresponding to the ALS-GAS1 site (Fig. 3Go, lanes 1–6). Four specific protein-DNA complexes (designated I to IV) were identified as shown by their competition by an 100-fold excess of unlabeled ALS-GAS1, but not by a 100-fold excess of the unrelated unlabeled oligonucleotide Sp1. Complexes I and II were detected only in nuclear extracts of untreated cells while complex III was present in extracts of untreated and GH-treated cells.2 More importantly, the prominent complex IV, with a mobility intermediate between those of complex I and II (see footnote 2), was detected only in extracts prepared from GH-treated cells, suggesting that GH increased the abundance or activity of some nuclear proteins. Incubation of the same extracts with a probe corresponding to the ALS-GAS2 site did not identify GH-dependent complexes (Fig. 3Go, lanes 7–12).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 3. EMSA Showing that GH-Dependent Nuclear Proteins in H4-II-E Cells Bind to the ALS-GAS1 Element

Nuclear extracts were prepared from H4-II-E cells cultivated in serum-free medium for 16 h, followed by a 15-min period of incubation in the absence (-) or presence (+) of 100 ng/ml of bGH. Extract (6 µg) was incubated with labeled oligonucleotides containing the ALS-GAS1 sequence of the mouse ALS gene (ALS-GAS1, lanes 1–6), the ALS-GAS2 sequence of the mouse ALS gene (ALS-GAS2, lanes 7–12), or the PRE of the rat ß-casein gene (PRE, lanes 13–18). Each probe (20,000 cpm) was incubated alone (-), or together with a 100-fold molar excess of the unlabeled homologous oligonucleotide (ALS-GAS1, ALS-GAS2, or PRE), or the unlabeled oligonucleotide containing the consensus sequence for the unrelated transcription factor Sp1. The position of specific DNA-protein complexes is indicated by solid arrowheads. The figure was assembled from autoradiograms exposed for 16 h (PRE) or 48 h (ALS-GAS1 and ALS-GAS2). The panels used for the ALS-GAS1 and the PRE portions of the figure are from the same autoradiogram. The ALS-GAS2 panel is from a second experiment. The signal intensity and position of complexes were normalized to the other panels by using a set of reactions with the PRE probe as standard.

 
The GH-Dependent Nuclear Proteins Binding ALS-GAS1 in H4-II-E Cells Are STAT5a and STAT5b
Recently, sequences similar to the ALS-GAS1 element were shown to mediate the action of GH by binding STAT1 and STAT3, or STAT5a and/or STAT5b (20). To determine which of these STAT proteins are activated by GH in H4-II-E cells, EMSAs were performed with the high-affinity c-sis-inducible element (SIE) m67, which binds predominantly homo- and heterodimers of STAT1 and STAT3 (21, 22, 23, 24), or with the PRL response element (PRE) of the rat ß-casein gene, which binds predominantly STAT5 isoforms (24, 25, 26). The m67 probe formed specific protein-DNA complexes that were not increased by GH treatment (results not shown). In contrast, a specific protein-DNA complex was observed when the PRE probe was incubated with extracts prepared from GH-treated H4-II-E cells (Fig. 3Go, lanes 13–18). This complex comigrated with the GH-inducible complex IV observed with the ALS-GAS1 probe. These results suggest that the GH-inducible nuclear proteins in H4-II-E that bind to the ALS-GAS1 element could be STAT5a or STAT5b, but not STAT1 or STAT3.

The preceding results suggest that the same nuclear proteins in GH-treated H4-II-E cells were binding to both the ALS-GAS1 and PRE elements. To examine this possibility, we compared the ability of the ALS-GAS1 and other GAS-like elements to competitively inhibit formation of the GH-dependent complex with the PRE probe (Fig. 4Go). Formation of the GH-dependent protein-DNA complex was significantly reduced by incubation with a 10-fold molar excess of unlabeled PRE. Unlabeled oligonucleotide corresponding to the mouse ALS-GAS1 element also inhibited formation of this complex, but had a 3-fold lower affinity than the PRE. Spi-GLE1, a GAS-like element that binds STAT5 and mediates the stimulation of the rat Spi 2.1 gene by GH (27, 28), inhibited binding to the PRE with similar affinity as ALS-GAS1. Oligonucleotides corresponding to the ALS-GAS2, m67, as well as the unrelated Sp1 sequences did not inhibit binding. Therefore, in H4-II-E cells, the ALS-GAS1 element appears to bind the same GH-inducible nuclear proteins as the PRE, presumably STAT5 isoforms, but with lower affinity.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 4. ALS-GAS1 Oligonucleotide Competitively Inhibits the Binding of the GH-Dependent Protein in H4-II-E Extracts to the Rat PRE Element in EMSAs

A labeled oligonucleotide probe corresponding to the PRE of the rat ß-casein gene (PRE, 20,000 cpm) was incubated with 6 µg of nuclear extract prepared from H4-II-E cells treated for 15 min with 100 ng/ml of bGH. Reactions were performed in the absence (-, lane 1) or in the presence of increasing molar excess (10-, 30-, and 100-fold) of oligonucleotides corresponding to the PRE (PRE, lanes 2–4), ALS-GAS1 (ALS-GAS1, lanes 5–7), ALS-GAS2 (ALS-GAS2, lanes 8–10), to the GAS-like element 1 of the rat Spi 2.1 gene (Spi-GLE1, lanes 11–13), and to the high-affinity SIE m67 (m67, lanes 14–16). The specificity of complex formation is demonstrated by the inability of the oligonucleotide containing the Sp1 consensus sequence to competitively inhibit binding when used at a 100-fold molar excess (Sp1, lane 17). The figure is a composite of two autoradiograms. Their exposure time was calibrated to the signal obtained on each autoradiogram with the PRE in the absence of competitor.

 
To demonstrate directly that STAT5a and STAT5b were the proteins binding to the ALS-GAS1 and PRE elements in GH-treated H4-II-E cells, EMSAs were performed in the presence of antibodies to different STAT proteins (Fig. 5Go). Incubation of the extracts with antibodies to STAT5a before the addition of the ALS-GAS1 probe (lanes 1–7) or PRE probe (lanes 8–14) decreased the abundance of the GH-dependent complex by~ 60% and resulted in the formation of two supershifted bands (Fig. 5Go, lanes 4, 6, 11, and 13). Inhibition of the specific protein-DNA complex was more complete, and the intensity of the supershifted bands was increased when an antibody that reacted with both STAT5a and STAT5b (STAT5a/b) was used. Doubling the amount of either antibodies gave identical results (Fig. 5Go, lanes 6–7, 13–14), indicating that differences observed using the two antibodies did not represent different affinities for STAT5a. Antibodies against STAT1 or STAT3 did not inhibit or shift the GH-dependent complex. We conclude that, in nuclear extracts of GH-treated H4-II-E cells, STAT5, but not STAT1 or STAT3, binds to the ALS-GAS1 and PRE elements. STAT5b homodimers, and STAT5a homodimers and/or STAT5a-STAT5b heterodimers, contribute to the observed binding.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 5. Immunological Identification of the GH-Dependent Proteins in H4-II-E Nuclear Extracts That Bind to the ALS-GAS1 and PRE Sequences

Nuclear extracts (6 µg) prepared from H4-II-E cells treated for 15 min with 100 ng/ml of bGH were preincubated for 20 min in the absence (-) or in the presence of antibodies (1 or 2 µl of a 1 mg/ml IgG solution as indicated) reacting specifically with STAT1 (1), STAT3 (3), STAT5a (5a), or both STAT5a and STAT5b (5a/b). Then, labeled oligonucleotides (20,000 cpm) corresponding to the ALS-GAS1 sequence of the mouse ALS promoter (ALS-GAS1, lanes 1–7) or to the PRE of the rat ß-casein gene (PRE, lanes 8–14) were added and EMSA was performed. The position of the comigrating specific protein-DNA complex obtained with the ALS-GAS1 and PRE probes is shown by an arrowhead on the left. The supershifted complexes are shown on the right of each panel by the closed arrows. Panels are from a single autoradiogram.

 
Binding of STAT5 to the ALS-GAS1 Element Occurs Rapidly after GH Treatment of H4-II-E Cells
In many cell systems, the induction of STAT proteins by GH and other cytokines is short-lived, lasting from minutes to a few hours (19, 21, 29). To determine the time course of activation of STAT5 in H4-II-E cells, EMSAs were conducted with nuclear extracts prepared from cells that had been treated for various times with bGH (Fig. 6Go). The GH-dependent protein-DNA complex was detected 5 min after exposure to GH and peaked between 15 and 30 min after GH. Abundance after 8 and 24 h of GH treatment decreased to 46% and 9% of the abundance at 15 min. These changes were specific for STAT5, as formation of the specific protein-DNA complex with the probe containing the consensus sequence for the transcription factor Sp1 remained relatively constant over the same time period. These results indicate that STAT5 is activated within 5 min of GH treatment and that high levels remain in the nuclei for at least 8 h after the initiation of GH treatment.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 6. Time-Course of STAT5 Activation after GH Treatment of H4-II-E Cells

H4-II-E cells were maintained in serum-free medium for 16 h. Nuclear extracts were prepared at various times (0, 5, 15, and 30 min and 1, 3, 8, and 24 h) after the addition of 100 ng/ml of bGH. Each extract (6 µg) was incubated with a labeled oligonucleotide probe (40,000 cpm) corresponding to the ALS-GAS1 element of the mouse ALS promoter (ALS-GAS1 probe, top panel) or with a labeled oligonucleotide (20,000 cpm) containing the consensus sequence for the transcription factor Sp1 (Sp1 probe, bottom panel). EMSA was performed as before. The specific complexes formed with each probe are shown by arrowheads. Each panel is a composite obtained by combining different regions of a single autoradiogram. For the Sp1 probe, only the relevant portion of the autoradiogram is shown.

 
GH Activation of the Mouse ALS Promoter in Primary Rat Hepatocytes Is Also Mediated by STAT5a and STAT5b Binding to the ALS-GAS1 Element
H4-II-E cells do not express ALS mRNA, even when grown in the presence of FCS and/or GH (Refs. 16 and 17 and G. T. Ooi and Y. R. Boisclair, unpublished results). To establish that the same mechanisms underlie the GH activation of the ALS gene in H4-II-E cells and liver, we used primary rat hepatocytes, a cell system that retains basal and GH-regulated expression of the ALS gene (17). Under our conditions, incubation with GH for 24 or 48 h increased ALS mRNA abundance by 8.0 ± 0.4 and 11.9 ± 1.1 fold (mean ± SE), respectively (Fig. 7AGo).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 7. Mechanisms Mediating the Effect of GH on the Mouse ALS Promoter in Primary Rat Hepatocytes

Panel A, Primary rat hepatocytes retain the ability to express ALS mRNA. Hepatocytes were isolated and plated as described in Materials and Methods. After a 16-h period in serum-free medium, they were incubated in the absence (-) or in the presence (+) of 100 ng/ml of bGH for 24 or 48 h. Total RNA was isolated and 15 µg were analyzed by Northern blotting using a rat ALS cDNA probe. Each lane represents RNA from a single culture dish. For comparison, the mouse ALS signal obtained with 15 µg of total RNA from normal adult rat liver (NRL) is shown. Identical results were obtained in a duplicate experiment. Panel B, The ALS-GAS1 element is required for the GH-activation of the mouse ALS promoter in primary rat hepatocytes. The mouse luciferase plasmids 703WT and its derivatives 703{Delta}ALS1 and 703{Delta}ALS2 (containing block mutation of the ALS-GAS1 and ALS-GAS2 element, respectively) or the thymidine kinase plasmids TK-LUC and its derivative TK-LUC-3GAS (containing three repeated ALS-GAS1 elements) were cotransfected (3.5 µg) with pCMV-SEAP (0.05 µg) in triplicate into primary rat hepatocytes using Lipofectin. After 48 h of treatment in the absence or in the presence of 100 ng/ml of bGH, luciferase activity was measured in cell lysates and corrected to the alkaline phosphatase activity present in medium. For each construct, the fold-stimulation by GH (mean ± SE of two experiments) was calculated as before. Panel C, Nuclear proteins bind the ALS-GAS1 element in primary rat hepatocytes treated with GH. Labeled oligonucleotides corresponding to the ALS-GAS1 sequence of the mouse ALS gene were incubated with nuclear extract (6 µg) prepared from primary rat hepatocytes cultivated in serum-free medium for 16 h, followed by a 15-min period of incubation in the absence (-, lanes 1–3) or in the presence (+, lanes 4–6) of 100 ng/ml of bGH. The probe (40,000 cpm) was incubated alone (-), or together with a 100-fold molar excess of unlabeled ALS-GAS1 oligonucleotide (ALS-GAS1) or of unlabeled Sp1 oligonucleotide (Sp1). EMSA was performed as before. Panel D, The GH-dependent proteins binding ALS-GAS1 in primary rat hepatocytes are STAT5a and STAT5b. Nuclear extract (6 µg) prepared from primary rat hepatocytes treated for 15 min with bGH (100 ng/ml) was preincubated for 20 min in the absence (-) or in the presence of antibodies (1 µl of a 1 mg/ml IgG solution) reacting specifically with STAT1 (1), STAT3 (3), STAT5a (5a), or with both STAT5a and STAT5b (5a/b). Labeled oligonucleotides (40,000 cpm) corresponding to the ALS-GAS1 sequence of the mouse ALS promoter were added, and EMSA was performed as before. The spots at the top of lane 3 are artifacts created during the process of autoradiography.

 
To determine the importance of the ALS-GAS1 element to the activation of the mouse ALS promoter in liver, primary hepatocytes were transfected with the wild-type luciferase construct 703WT, or with the construct containing block substitution mutations in ALS-GAS1 (703{Delta}ALS1), or in ALS-GAS2 (703{Delta}ALS2) and grown in the absence or presence of 100 ng/ml of bGH for 48 h. As shown above with H4-II-E cells, stimulation of luciferase activity by GH was dependent on the integrity of the ALS-GAS1 element but not on the integrity of the ALS-GAS2 element (Fig. 7BGo). Moreover, three tandem copies of ALS-GAS1 conferred GH stimulation to the TK-LUC construct when it was transfected in primary hepatocytes. These results demonstrate that the ALS-GAS1 element is necessary and sufficient for the GH activation of the ALS promoter in primary rat hepatocytes as in H4-II-E cells.

Finally, the probe corresponding to the ALS-GAS1 site was used in EMSAs with nuclear extracts prepared from primary rat hepatocytes. A specific protein-DNA complex was detected only in extracts prepared from GH-treated hepatocytes (Fig. 7CGo). This complex was supershifted partially with antibodies reacting with STAT5a and completely with antibodies reacting with both STAT5a and STAT5b (Fig. 7DGo). Antibodies raised against STAT1 or STAT3 did not alter the formation or mobility of the GH-dependent protein-DNA complex. Therefore, STAT5 isoforms also bind the ALS-GAS1 element in a GH-dependent manner in primary rat hepatocytes, indicating that the regulatory mechanisms through which GH stimulates ALS promoter activity in both H4-II-E cells and in primary rat hepatocytes are similar.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ALS plays a critical role in determining the levels and fate of endocrine IGFs (7, 8, 10, 11), and GH is the most important positive regulator of ALS gene expression (16, 17). We have studied the transcriptional regulation of the ALS gene to gain insights on the mechanisms by which GH regulates the IGF system, and more generally gene expression in liver. We have shown previously that a promoter fragment extending from nt -2001 to nt -49 of the mouse ALS gene was responsive to GH in the H4-II-E rat liver hepatoma cell line (16, 18). We now map the GH-responsive element of this promoter to a single 9-bp sequence located between nt -633 and nt -625, and identify nuclear proteins present in H4-II-E cells that bind this sequence in a GH-dependent manner. Moreover, we demonstrate that binding of this cis-element by identical nuclear factors is also required for the GH activation of the mouse ALS promoter in primary rat hepatocytes, a cell model in which expression of the endogenous ALS gene is stimulated by GH.

The sequence of events in the transmission of the GH signal include homodimerization of the receptor by GH, recruitment of the tyrosine kinase Jak2 to the cytoplasmic domain of the ligand-receptor complex, phosphorylation of tyrosine residues in Jak2 and in the dimerized receptor, and activation of many different transduction cascades (20). STAT1, -3, -5a, and -5b are some of the signaling molecules activated by GH (20). After their phosphorylation by Jak kinases, STAT proteins form homo- or heterodimers that translocate to the nucleus where they activate transcription by binding to target cis-elements such as GAS or ISRE (interferon-stimulated response element) (19). The GH-responsive element that we identified between nt -633 to nt -625 fits the consensus of a GAS element, suggesting that at least a portion of the effect of GH on the mouse ALS gene is conveyed by the Jak-STAT pathway (19, 20).

GAS-like sequences that have been shown to mediate the effect of GH on chromosomal genes fall into two categories (Table 1Go). Sequences of the first type are occupied primarily by STAT5 isoforms in cells treated with GH and are present in the promoters of the GH-regulated genes encoding Spi 2.1, insulin, and CYP3A10/6B (27, 28, 29, 30). They resemble the PRE element of the ß-casein gene, TTC TTG GAA, which was used to purify STAT5 from the rat mammary gland (26). These GH-responsive elements and the PRE are characterized by the presence of a palindrome (TTC NNN GAA) that is critical for high-affinity binding by STAT5 (31, 32). The second type of GH-responsive GAS-like element is represented by the SIE of the c-fos gene, in which T replaces G at position 7 [Table 1Go] (22). The SIE and its high-affinity variant, m67, are occupied preferentially by homo- and heterodimers of STAT1 and STAT3, but have little affinity for the STAT5 isoforms (Fig. 4Go and Refs. 21–24, and 32). The ALS-GAS1 element belongs to the first class of GAS-like element (i.e PRE-like) as it binds only STAT5a and STAT5b in nuclear extracts prepared from H4-II-E cells and primary rat hepatocytes treated with GH. The sequence of the ALS-GAS1 element, like those of the other GH-responsive elements of this class, fits the consensus TTC (C/T)N(A/G) GAA recently deduced for STAT5 binding (33).


View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of GAS-Like Elements Shown to Mediate the Effect of GH on Chromosomal Genes

 
STAT5a and STAT5b are the products of two different genes that are nearly identical and bind the PRE element with similar affinities (25). They differ most markedly in their carboxyl termini, which are involved in transcriptional activation (34). In this regard, defects observed in the knockout models of these two isoforms differ. Inactivation of the STAT5a gene affects primarily female mice, which fail to complete the final phase of mammary development (35), whereas inactivation of the STAT5b gene affects primarily males, which adopt growth rates and a pattern of gene expression in liver that are characteristic of wild-type female (36). These observations indicate that STAT5a and STAT5b are not completely redundant and may activate different subsets of genes. In the case of the ALS gene, binding of STAT5 to the ALS-GAS1 element occurs as STAT5b homodimers and as STAT5a homodimers and/or STAT5a-5b heterodimers. The functional significance of these various combinatory pairs to the activation of the ALS gene remains to be ascertained.

Many functional GAS sites identified in chromosomal genes exhibit weak binding affinities toward the various STATs when compared with optimized GAS elements (37). For instance, the ALS-GAS1 and the Spi-GLE1 elements have ~3-fold lower affinity than the PRE element toward the STAT5 isoforms present in H4-II-E cells (Fig. 4Go). In other genes, STAT1 and STAT4 were shown to overcome these low affinities by binding cooperatively to nearby GAS elements (37, 38). STAT5 isoforms may also be capable of cooperative interactions as GH activation of the Spi 2.1 gene is maximal only when two adjacent GAS-like sequences involved in binding STAT5 are present (28). In the case of the mouse ALS gene, a second GAS-like sequence (ALS-GAS2) is located between nt -553 and nt -545, but was not necessary for GH induction and was unable to bind STAT5. The possibility remains, however, that binding of STAT5 to ALS-GAS1 is enhanced by protein-protein interaction with other transcription factors bound nearby.

In addition to STAT, GH simultaneously activates other signaling molecules such as SHC, members of the mitogen-activated protein kinase cascade, IRS-1 and IRS-2, phospholipase A2, and protein kinase C (20). It remains possible that some of these other signals activate additional transcription factors and contribute to the overall effects of GH on the mouse ALS gene. First, GH treatment of liver cells results in phosphorylation of STAT1, -3, and -5 not only on tyrosine, but also on serine (and/or threonine) (24, 39). This additional modification is important for optimal binding and transactivation potential of STAT proteins (24, 40, 41), suggesting that a second signaling pathway could culminate on STAT5 and be important to the GH activation of the ALS gene in liver. In this context, we have demonstrated that RAS is not involved in mediating the effects of GH on the ALS gene as cotransfection of expression plasmids for constitutively active or dominant negative RAS did not alter the activity of the mouse ALS promoter in H4-II-E cells (42). Second, our functional analysis indicates that activation of the ALS promoter by GH requires cis-elements located in the first~ 600 bp of the promoter. The absolute requirement for an intact ALS-GAS1 element does not preclude the participation of other cis-elements in producing a full reponse to GH, as shown recently for the Spi 2.1 gene (43).

The endogeneous ALS gene is not expressed in H4-II-E cells or in any of the rat liver cell lines that we and others have tested (Refs. 16 and 17 and G. T. Ooi and Y. R. Boisclair, unpublished results). In H4-II-E cells, this does not reflect the absence of liver-specific transcription factors as the mouse ALS promoter is active in both transiently (this study) or stably (Ooi and Boisclair, unpublished results) transfected cells. Moreover, as shown in this study, GH activates the ALS promoter in H4-II-E and in primary hepatocytes via identical mechanisms, i.e. by inducing the binding of STAT5 isoforms to the ALS-GAS1 element. Rather, the absence of expression of the ALS gene in H4-II-E cells may relate to the silencing of nonessential genes in culture by modifications of chromatin structure such as methylation of CpG islands (44). Therefore, despite not expressing the endogenous gene, H4-II-E cells yield results that are relevant to the mechanism of GH activation of the ALS gene in normal liver cells.

In rodents, the pulsatile pattern of GH secretion in the male results in a greater abundance of activated STAT5, but not of activated STAT1 and STAT3, in liver nuclei (24). Recently, this differential activation of STAT5 by GH was proposed to underlie the expression of some liver genes only in the male (24, 39, 45). This interpretation contrasts with findings that STAT5 mediates the effect of GH on the ALS and Spi 2.1 genes, which are expressed equally in livers of both sexes (G. T. Ooi and Y. R. Boisclair, unpublished results; S. A. Berry, personal communication). However, this contradiction may be more apparent than real. First, STAT5b appears to be the primary isoform whose hepatic levels are modulated by the pattern of GH secretion (36, 39). Therefore, STAT5a may be more important in mediating the effect of GH on genes that are expressed equally in both sexes such as ALS and Spi 2.1, whereas STAT5b may be more important in mediating the effects of GH on genes that are expressed only in the male. Second, sexual dimorphism of gene expression in liver results from the interplay of many transcription factors, one of which may be STAT5 (30). Third, the ability of STAT proteins, including STAT5, to participate in protein-protein interactions and to synergistically activate transcription (37, 38, 46, 47) makes the activation of the ALS and Spi 2.1 genes by GH possible in both sexes despite differences in the absolute levels of activated STAT5.

Finally, our findings have general significance to understanding the GH-IGF axis. After birth, most of the IGFs circulate in the 150-kDa complex. GH regulates the levels of each of the components of the 150-kDa complex either directly (ALS and IGF-I) or indirectly via IGF-I and/or insulin (IGFBP-3) (1, 5). Because the IGF system is involved in the mediation of the indirect action of GH, elucidation of the mechanisms responsible for the effects of GH on the IGF-I and IGFBP-1 genes has been an active area of research (48, 49). However, these studies have not identified the cis-elements and transcription factors responsible for these actions (48, 49). In the case of the ALS gene, we have demonstrated that STAT5 isoforms, presumably activated by the tyrosine kinase Jak2, mediates the effect of GH by binding to a single GAS-like element. Therefore, our study raises the possibility that similar mechanisms may underlie the rapid transcriptional effects of GH on the IGF-I and IGFBP-1 genes in liver.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents
Restriction endonucleases, DNA polymerase, and DNA-modifying enzymes were purchased from New England Biolabs, Inc. (Beverly, MA) and from Boehringer Mannheim (Indianapolis, IN). Tissue culture medium, bovine insulin, and Lipofectin were from Life Technologies (Gaithersburg, MD). Protease inhibitors and dexamethasone were from Sigma Chemical Co. (St Louis, MO). The basement membrane Matrigel was purchased from Becton Dickinson Labware (Bedford, MA). Recombinant hGH was a gift from Genentech (South San Francisco, CA); recombinant bGH was a gift from Protiva (St Louis, MO). Diethylaminoethyl (DEAE)-dextran and the DNA alternating copolymers poly (dA-dT)·poly (dA-dT) were purchased from Pharmacia Biotech Inc. (Piscataway, NJ). Oligonucleotides were synthesized using a 393 DNA/RNA synthesizer from Applied Biosystems (Foster City, CA) or were custom made by Life Technologies. Radionucleotides were obtained from New England Nuclear (Boston, MA).

Plasmids
A genomic DNA fragment corresponding to nt -2001 to nt -49 (A+1TG) of the mouse ALS gene served as template in PCR reactions to create a series of 5'-deletion fragments with a common 3'-end at nt -49 (18). The sense primers (see Fig. 1Go for position of their 5' ends) and a single antisense primer incorporated unique restriction sites for the endonucleases Asp718 I and HindIII, respectively. After digestion with Asp718 I and HindIII and purification by agarose gel electrophoresis, amplified fragments were ligated into the corresponding sites of the promoterless luciferase vector pGL3-basic (Promega Corp., Madison, WI). Block substitution mutants of two GAS-like sites were generated in the context of the deletion construct containing the nt -703 to -49 promoter fragment (plasmid 703WT) by replacing 9 bp of native sequence with an EcoRI linker (5'-CGAATTCGC-3') between nt -633 to -625 to give plasmid 703{Delta}ALS1, and between nt -553 to -545 to give plasmid 703{Delta}ALS2. These mutants were prepared by PCR amplification of appropriate pairs of 5'- and 3'-fragments incorporating an EcoRI sequence in the site targeted for substitution. After digesting the 5'- fragment with Asp718 I and EcoRI and the 3'-fragment with EcoRI and HindIII, they were subcloned into pGL3-basic as described above. For each construct, two independent PCR reactions were performed with the high-fidelity Vent polymerase, and used to prepare duplicate plasmids. Plasmid TK-LUC-3GAS was made by ligating a double-stranded oligonucleotide containing three tandem copies of the ALS-GAS1 element into the HindIII and XhoI sites of the plasmid pT109luc (referred to as TK-LUC). The plasmid pT109luc contains the minimal promoter of the herpes simplex I thymidine kinase gene inserted upstream of a luciferase reporter gene (50). Luciferase plasmids were purified by ion-exchange chromatography (Qiagen, Chatsworth, CA).

Transfection of Rat Liver-Derived Cells
Stock cultures of H4-II-E rat hepatoma cells were grown in RPMI 1640 medium supplemented with 10% FCS and incubated in 95% air-5% CO2 at 37 C (16). For transfection, H4-II-E cells were passaged at least twice in DMEM supplemented with 10% FCS and then grown to 80–90% confluence in 60-mm dishes. Monolayers were washed twice with Tris-buffered saline (25 mM Tris-HCl, pH 7.5, 137 mM KCl, 5 mM NaCl, 0.7 mM CaCl2, 0.5 mM MgCl2, and 0.6 mM Na2HPO4) and exposed for 15 min to a 200 µl of a DNA solution (0.5 mg/ml DEAE-dextran, 2 µg luciferase construct, and 0.05 µg of plasmid pCMV-SEAP in Tris-buffered saline). pCMV-SEAP encodes secreted alkaline phosphatase and was used to correct for variation in transfection efficiency. To ascertain that changes in luciferase activity were caused by the intended mutation rather than by a random base change introduced by PCR, duplicate plasmids of each construct were used in separate transfections. Cells were allowed to recover in DMEM supplemented with 10% FCS for 40 h, with a change to fresh medium after 16 h. After this period, medium was changed to serum-free DMEM supplemented with 0.1% BSA in the absence or presence of 100 ng/ml of hGH. Sixteen to 24 h later, medium was assayed for secreted alkaline phosphatase by chemiluminescence (Tropix, Bedford, MA), and cell lysates were assayed for luciferase activity (16).

Primary hepatocytes were isolated from male Sprague-Dawley rats (250–300 g) by the recirculating collagenase perfusion method (51). These procedures were approved by the Cornell University Institutional Animal Care and Use Committee. Isolated hepatocytes were transfected by a modification of the method of Shih and Towle (52). Briefly, they were plated at 2.5 x 106 cells per 60-mm dish (Primaria, Falcon) and allowed to attach for 5 h in modified William’s E medium (MWEM) containing 10% FCS (MWEM is William’s E supplemented to 27.5 mM glucose, 23 mM HEPES, 26 mM sodium bicarbonate, 2 mM glutamine, 10 nM dexamethasone, 3.84 µg/ml bovine insulin, 50 U/ml penicillin, and 50 µg/ml streptomycin). The cell monolayers were washed twice with serum-free MWEM and transfected for 14 h with a 3-ml solution of serum-free MWEM containing 3.5 µg of the luciferase plasmid, 0.05 µg of pCMV-SEAP, and 42 µg of Lipofectin. After transfection, the cells were cultivated for 48 h in MWEM (supplemented with 500 µg/ml of Matrigel for the first 24 h) in the absence or presence of 100 ng/ml of bGH. Secreted alkaline phosphatase and luciferase activity were measured at the end of this 48-h period as described above.

Preparation of Nuclear Extracts
H4-II-E cells were grown to confluence in DMEM supplemented with 10% FCS as described above. Primary hepatocytes were isolated and plated for 5 h in serum-containing MWEM as described above. Then, each group of cells was washed three times with PBS and incubated for 16 h in the appropriate serum-free medium. Medium was changed to fresh serum-free medium supplemented with 100 ng/ml of bGH. Nuclear extracts were prepared at various times after the addition of GH by a modification of the procedure of Lee et al. (53) (see Figs. 3Go, 6Go, and 7Go for times). Briefly, cells were washed twice with ice-cold PBS, scraped into fresh PBS, and collected by centrifugation (300 x g for 5 min). Cells were swelled for 15 min on ice in 1 packed cell volume of buffer A [10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl and 0.5 mM dithiotreitol, 10 mM NaF, 1 mM Na3VO4, 0.5 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, and 1 µg/ml aprotinin], and lysed by extrusion through a 25-gauge needle. Nuclei were collected by centrifugation (12,000 x g for 20 sec) and extracted in two thirds packed cell volume of buffer C (20 mM HEPES, pH 7.9, 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM dithiothreitol, 10 mM NaF, 1 mM Na3VO4, 0.5 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, and 1 µg/ml aprotinin) for 30 min on ice. The nuclear debris was removed by centrifugation (12,000 x g for 5 min), and the supernatants were dialyzed for 2 h against 100 volumes of buffer D (same as buffer C except that glycerol is used at 20% vol/vol, NaF at 1 mM, and NaCl is replaced by 100 mM KCl). Protein concentration of extracts was determined by the method of Lowry et al. (54).

EMSA
Complementary oligonucleotides corresponding to nt -638 to nt -621 (ALS-GAS1; top strand, AGGTGTTCCTAGAAGAGG, bottom strand, CCTCTTCTAGGAACA) and to nt -561 to nt -537 of the mouse ALS promoter (ALS-GAS2; top strand, ACTGGGCCTTAGACAAACCCCTGGA, bottom strand, TCCAGGGGTTTGTCTAAGGC) were synthesized. In addition, oligonucleotides containing previously characterized cis-elements (shown in bold) were obtained: They correspond to the GAS-like element 1 of the rat Spi 2.1 gene [Spi-GLE1; top strand, CCATGTTCTGAGAAATCAT, bottom strand, GGATGATTTCTCAGAACATGG (27)], to the PRE of the rat ß-casein gene [PRE; top strand, GGACTTCTTGGAATTAAGGGA, bottom strand, TCCCTTAATTCCAAGAAGT (26)], to the high-affinity SIE [m67; top strand, GTCGACATTTCCCGTAAATCG, bottom strand, TCGACGAT-TTACGGGAAATGTC (22)], and to the consensus site for the transcription factor Sp1 [Sp1; top strand, CGATCGA-TCGGGGCGGGGCGATCG, bottom strand, TGATCGAT-CGCCCCGCCCCGATCGATCG (55)]. Oligonucleotides were purified by polyacrylamide gel electrophoresis, and equimolar quantities of complementary strands were annealed in buffer (10 mM Tris, pH 8.0, 1 mM EDTA, 10 mM NaCl) by heating at 100 C for 5 min and cooling to room temperature. Annealed oligonucleotide pairs were labeled with [{alpha}-32P]dCTP (3000 Ci/mmol) using the Klenow fragment of DNA polymerase I.

Nuclear extracts were preincubated for 10 min in a buffer containing 1 µg poly (dA-dT)·poly (dA-dT), 20 mM HEPES, pH 7.9, 10% glycerol, 50 mM NaCl, 1 mM MgCl2, 1 mM EDTA, and 1 mM dithiothreitol. Probes (4–9 fmol, 20,000–40,000 cpm) were then added and the incubation continued at room temperature for 15 min. When competition studies were performed, unlabeled double-stranded oligonucleotides that had been blunt-ended with the Klenow fragment of DNA polymerase I were added immediately before the probe. In experiments to identify the protein component of the protein-DNA complexes, antibodies raised against various STAT proteins and reactive with the rat homologs were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). They include antibodies reacting specifically with STAT1{alpha} and STAT1ß (sc-346), STAT3 (sc-482), STAT5a (sc-1081), and STAT5a and STAT5b (sc-835). Antibodies were incubated with the nuclear extracts for 15 min at room temperature before addition of the probe. Protein-DNA complexes were separated on a 5% nondenaturing polyacrylamide gel (38:1, acrylamide-bisacrylamide; 2% glycerol; 22 mM Tris-borate, 0.5 mM EDTA, pH 8.3) at 15 mA (2 h at 4 C). Gels were dried and autoradiographed at -70 C using intensifying screens. Relative intensity of the specific protein-DNA complexes was quantified by phosphoimaging using a Fuji BAS 1000 unit (Fuji Medical Systems, Stamford, CT).

Northern Analysis of ALS mRNA in Primary Hepatocytes
Primary hepatocytes were isolated and plated as described above. After a 5-h attachment period, cells were maintained for 16 h in serum-free MWEM and then incubated in fresh serum-free MWEM in the presence or in the absence of 100 ng/ml bGH for 24 or 48 h. Matrigel was also present at 500 µg/ml of medium for the first 24 h. Total RNA was prepared by the acid guanidium thiocyanate phenol-chloroform method and quantified by absorbance at 260 nm (16). Total RNA (15 µg/lane) was electrophoresed on a 1.2% agarose/formaldehyde gel, blotted onto a nylon membrane, and hybridized to an [{alpha}-32P]dCTP- labeled DNA probe corresponding to nt 1262 to nt 1555 of the rat cDNA (A+1TG) (56). Staining with ethidium bromide confirmed that ribosomal RNA was intact and that equal amounts of RNA were loaded in each lane. Phosphoimaging was used to quantify the relative abundance of ALS mRNA.


    ACKNOWLEDGMENTS
 
The authors thank Mr. L. Hirschberger and Dr. M. H. Stipanuk for their help in the studies with primary rat hepatocytes.


    FOOTNOTES
 
Address requests for reprints to: Dr. Yves R. Boisclair, 259 Morrison Hall, Cornell University, Ithaca, New York 14853-4801. e-mail: yrb1@cornell.edu.

This work was supported in part by a grant from the Cornell Center for Advanced Technology in Biotechnology, which is sponsored by the New York State Science and Technology Foundation and industrial partners, and by NIH Grant DK-51624–01A1 (to Y.R.B.).

1 When used at identical concentrations, hGH and bGH gave similar fold stimulations of luciferase activity in H4-II-E cells transfected with the mouse ALS promoter constructs (16 ). Back

2 These complexes may represent protein-DNA interactions that are important for the basal activation of the gene. Complexes I and II were more obvious after a longer exposure of the autoradiogram. They can be seen clearly in lane 1 of Fig. 6Go. In this experiment, and in many other experiments not shown where extracts from untreated and GH-treated cells were compared side by side, complex IV migrated between complexes I and II. Back

Received for publication November 14, 1997. Revision received January 28, 1998. Accepted for publication February 2, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Jones JI, Clemmons DR 1995 Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 16:3–34[CrossRef][Medline]
  2. Stewart CEH, Rotwein P 1996 Growth, differentiation, and survival: multiple physiological functions for insulin-like growth factors. Physiol Rev 76:1005–1026[Abstract/Free Full Text]
  3. Rechler MM, Nissley SP 1990 Peptide growth factors and their receptors. I. Insulin-like growth factors. In: Sporn MB, Roberts AB (eds) Handbook of Experimental Pharmacology. Springer-Verlag, Berlin, vol 95:263–367
  4. Thissen J-P, Ketelslegers J-M, Underwood LE 1994 Nutritional regulation of the insulin-like growth factors. Endocr Rev 15:80–101[Abstract]
  5. Rechler MM 1993 Insulin-like growth factor binding proteins. Vitam Horm 47:1–114[Medline]
  6. Baxter RC 1994 Insulin-like growth factor binding proteins in the human circulation: a review. Horm Res 42:140–144[Medline]
  7. Guler H-P, Zapf J, Schmid C, Froesch ER 1989 Insulin-like growth factors I and II in healthy man. Estimations of half-lives and production rates. Acta Endocrinol (Copenh) 121:753–758[Medline]
  8. Binoux M, Hossenlopp P 1988 Insulin-like growth factor (IGF) and IGF-binding proteins: comparison of human serum and lymph. J Clin Endocrinol Metab 67:509–514[Abstract]
  9. Blat C, Villaudy J, Binoux M 1994 In vivo proteolysis of serum insulin-like growth factor (IGF) binding protein-3 results in increased availability of IGF to target cells. J Clin Invest 93:2286–2290
  10. Gargosky SE, Tapanainen P, Rosenfeld RG 1994 Administration of growth hormone (GH), but not insulin-like growth factor-I (IGF-I), by continuous infusion can in-duce the formation of the 150-kilodalton IGF-binding protein-3 complex in GH-deficient rats. Endocrinology 134:2267–2276[Abstract]
  11. Zapf J, Hauri C, Futo E, Hussain M, Rutishauser J, Maack CA, Froesch ER 1995 Intravenously injected insulin-like growth factor (IGF) I/IGF binding protein-3 complex exerts insulin-like effects in hypophysectomized, but not in normal rats. J Clin Invest 95:179–186
  12. Chin E, Zhou J, Dai J, Baxter RC, Bondy CA 1994 Cellular localization and regulation of gene expression for components of the insulin-like growth factor ternary binding protein complex. Endocrinology 134:2498–2504[Abstract]
  13. Dai J, Baxter RC 1994 Regulation in vivo of the acid-labile subunit of the rat serum insulin-like growth factor-binding protein complex. Endocrinology 135:2335–2341[Abstract]
  14. Zapf J, Hauri C, Waldvogel M, Futo E, Hasler H, Binz K, Guler HP, Schmid C, Froesch ER 1989 Recombinant human insulin-like growth factor I induces its own specific carrier protein in hypophysectomized and diabetic rats. Proc Natl Acad Sci USA 86:3813–3817[Abstract/Free Full Text]
  15. Baxter RC, Dai J 1994 Purification and characterization of the acid-labile subunit of rat serum insulin-like growth factor binding protein complex. Endocrinology 134:848–852[Abstract]
  16. Ooi GT, Cohen FJ, Tseng LY-H, Rechler MM, Boisclair YR 1997 Growth hormone stimulates transcription of the gene encoding the acid-labile subunit (ALS) of the circulating insulin-like growth factor-binding protein complex and ALS promoter activity in rat liver. Mol Endocrinol 11:997–1007[Abstract/Free Full Text]
  17. Dai J, Scott CD, Baxter RC 1994 Regulation of the acid-labile subunit of the insulin-like growth factor complex in cultured rat hepatocytes. Endocrinology 135:1066–1072[Abstract]
  18. Boisclair YR, Seto D, Hsieh S, Hurst KR, Ooi GT 1996 Organization and chromosomal localization of the gene encoding the mouse acid labile subunit of the insulin-like growth factor binding complex. Proc Natl Acad Sci USA 93:10028–10033[Abstract/Free Full Text]
  19. Schindler C, Darnell Jr JE 1995 Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu Rev Biochem 64:621–651[Medline]
  20. Argetsinger LS, Carter-Su C 1996 Mechanism of signaling by growth hormone receptor. Physiol Rev 76:1089–1107[Abstract/Free Full Text]
  21. Meyer DJ, Campbell GS, Cochran BH, Argetsinger LS, Larner AC, Finbloom DS, Carter-Su C, Schwartz J 1994 Growth hormone induces a DNA binding factor related to the interferon-stimulated 91-kDa transcription factor. J Biol Chem 269:4701–4704[Abstract/Free Full Text]
  22. Wagner BJ, Hayes TE, Hoban CJ, Cochran BH 1990 The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter. EMBO J 9:4477–4484[Medline]
  23. Horvath CM, Wen Z, Darnell Jr JE 1995 A STAT protein domain that determines DNA sequence recognition suggests a novel DNA-binding domain. Genes Dev 9:984–994[Abstract/Free Full Text]
  24. Ram PA, Park S-H, Choi HK, Waxman DJ 1996 Growth hormone activation of Stat 1, Stat 3, and Stat 5 in rat liver. J Biol Chem 271:5929–5940[Abstract/Free Full Text]
  25. Liu X, Robinson GW, Gouilleux F, Groner B, Hennighausen L 1995 Cloning and expression of Stat5 and an additional homologue (Stat5b) involved in prolactin signal transduction in mouse mammary tissue. Proc Natl Acad Sci USA 92:8831–8835[Abstract/Free Full Text]
  26. Wakao H, Schmitt-Ney M, Groner B 1992 Mammary gland-specific nuclear factor is presented in lactating rodent and bovine mammary tissue and composed of a single polypeptide of 89 kDa. J Biol Chem 267:16365–16370[Abstract/Free Full Text]
  27. Sliva D, Wood TJJ, Schindler C, Lobie PE, Norstedt G 1994 Growth hormone specifically regulates serine protease inhibitor gene transcription via g-activated sequence-like DNA elements. J Biol Chem 269:26208–26214[Abstract/Free Full Text]
  28. Bergad PL, Shih H-M, Towles CL, Schwarzenberg SJ, Berry SA 1995 Growth hormone induction of hepatic serine protease inhibitor 2.1 transcription is mediated by a Stat5-related factor binding synergistically to two g-activated sites. J Biol Chem 270:24903–24910[Abstract/Free Full Text]
  29. Galsgaard ED, Gouilleux F, Groner B, Serupt P, Neilsen JH, Billestrup N 1996 Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene. Mol Endocrinol 10:652–660[Abstract]
  30. Subramanian A, Teixeira J, Wang J, Gil G 1995 A STAT factor mediates the sexually dimorphic regulation of hepatic cytochrome P450 3A10/lithocholic acid 6B-hydroxylase gene expression by growth hormone. Mol Cell Biol 15:4672–4682[Abstract]
  31. Beadling C, Ng J, Babbage JW, Cantrell DA 1996 Interleukin-2 activation of STAT5 requires the convergent action of tyrosine kinases and a serine/threonine kinase pathway distinct from the Raf1/ERK2 MAP kinase. EMBO J 15:1902–1913[Medline]
  32. Gouilleux F, Pallard C, Dusanter-Fourt I, Wakao H, Haldosen L-A, Norstedt G, Levy D, Groner B 1995 Prolactin, growth hormone, erythropoietin and granulocyte-macrophage colony stimulating factor induce MGF-Stat5 DNA binding activity. EMBO J 14:2005–2013[Medline]
  33. Berry SA, Bergad PL, Schwarzenberg SJ, Towle HC, Sequence requirements for binding to a growth hormone response element (GHRE). Program of the 10th International Congress of Endocrinology, San Francisco, CA, 1996 (Abstract 1:55)
  34. Moriggl R, Gouilleux-Gruart V, Jaehne R, Berchtold S, Gartmann C, Liu X, Hennighausen L, Sotiropoulos A, Groner B, Gouilleux F 1996 Deletion of the carboxy-terminal transactivation domain of MGF-Stat5 results in sustained DNA binding and a dominant negative phenotype. Mol Cell Biol 16:5691–5700[Abstract]
  35. Liu X, Robinson GW, Wagner K-U, Garrett L, Wynshaw-Boris A, Hennighausen L 1997 Stat5a is mandatory for adult mammary gland development and lactogenesis. Genes Dev 11:179–186[Abstract/Free Full Text]
  36. Udy GB, Towers RP, Snell RG, Wilkins RJ, Park S-H, Ram RA, Waxman DJ, Davey Helen W 1997 Requirement of STAT5b for sexual dimorphism of body growth rates and liver gene expression. Proc Natl Acad Sci USA 94:7239–7244[Abstract/Free Full Text]
  37. Vinkemeiser U, Cohen SL, Moarefi I, Chait BT, Kuriyan J, Darnell Jr JE 1996 DNA binding of in vitro activated Stat1a, Stat1b and truncated Stat1: interaction between NH2-terminal domains stabilizes binding of two dimers to tandem DNA sites. EMBO J 15:5616–5626[Medline]
  38. Xu X, Sun Y-L, Hoey T 1996 Cooperative DNA binding and sequence-selective recognition conferred by the Stat amino-terminal domain. Science 273:794–797[Abstract]
  39. Gebert CA, Park S-H, Waxman DJ 1996 Regulation of signal transducer and activator of transcription (STAT) 5b activation by the temporal pattern of growth hormone stimulation. Mol Endocrinol 11:400–411[Abstract/Free Full Text]
  40. Wen Z, Zhong Z, Darnell Jr JE 1995 Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82:241–250[CrossRef][Medline]
  41. Zhang X, Blenis J, Li H-C, Schindler C, Chen-Kiang S 1995 Requirement of serine phosphorylation for formation of STAT-promoter complexes. Science 267:1990–1994[Abstract/Free Full Text]
  42. Boisclair YR, Bassal S, Rechler MM, Ooi GT 1997 Regulation of ALS gene expression by growth hormone. In: Takano K (ed) Proceedings of the 4th International Symposium on Insulin-like Growth Factors. Elsevier Science B.V., Amsterdam, In press
  43. Legraverend C, Simar-Blanchet A-E, Paul C, Sotiropoulos A, Finidori J, Le Cam A 1996 A novel growth hormone response element unrelated to STAT (signal transducer and activator of transcription)-binding sites is a bifunctional enhancer. Mol Endocrinol 10:1507–1518[Abstract]
  44. Antequera F, Boyes J, Bird A 1990 High levels of de novo methylation and altered chromatin structure at CpG islands in cell lines. Cell 62:503–514[CrossRef][Medline]
  45. Waxman DJ, Ram PA, Park S-H, Choi HK 1995 Intermittent plasma growth hormone triggers tyrosine phosphorylation and nuclear translocation of a liver-expressed, stat 5-related DNA binding protein. J Biol Chem 270:13262–13270[Abstract/Free Full Text]
  46. Stocklin E, Wissler M, Gouilleux F, Groner B 1996 Functional interactions between Stat5 and the glucocorticoid receptor. Nature 383:726–728[CrossRef][Medline]
  47. Look DC, Pelletiert MR, Tidwell RM, Roswitt WT, Holtzman MJ 1995 Stat1 depends on transcriptional synergy with Sp1. J Biol Chem 270:30264–30267[Abstract/Free Full Text]
  48. Thomas MJ, Kikuchi K, Bichell DP, Rotwein P 1995 Characterization of deoxyribonucleic acid-protein interactions at a growth hormone-inducible nuclease hypersensitive site in the rat insulin-like growth factor-I gene. Endocrinology 136:562–569[Abstract]
  49. Hu M, Robertson DG, Murphy LJ 1996 Growth hormone modulates insulin regulation of hepatic insulin-like growth factor binding protein-1 transcription. Endocrinology 137:3702–3709[Abstract]
  50. Nordeen SK 1988 Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 5:454–458
  51. Berry MN, Edwards AM, Barritt GJ 1991 Isolated hepatocytes preparation, properties and applications. In: Burdon RH, van Knippenberg (eds) Laboratory Techniques in Biochemistry and Molecular Biology. Elsevier, New York, vol 21:1–460
  52. Shih H-M, Towle HC 1995 Matrigel treatment of primary hepatocytes following DNA transfection enhances responsiveness to extracellular stimuli. Biotechniques 18:813–816[Medline]
  53. Lee KA, Bindereif A, Green MR 1988 A small-scale procedure for preparation of nuclear extracts that support efficient transcription and pre-mRNA splicing. Gene Anal Tech 5:22–31[CrossRef][Medline]
  54. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ 1951 Protein measurements with Folin phenol reagent. J Biol Chem 193:265–275[Free Full Text]
  55. Faisst S, Meyer S 1992 Compilation of vertebrate-encoded transcription factors. Nucleic Acids Res 20:3–26[Free Full Text]
  56. Dai J, Baxter RC 1992 Molecular cloning of the acid-labile subunit of the rat insulin-like growth factor binding protein complex. Biochem Biophys Res Commun 188:304–309[CrossRef][Medline]
  57. Gronowski AM, Le Stunff C, Rotwein P 1996 Acute nuclear actions of growth hormone (GH): cycloheximide inhibits inducible activator protein-1 activity, but does not block GH-regulated signal transducer and activator of transcription or gene expression. Endocrinology 137:55–64[Abstract]
  58. Gronowski AM, Zhong Z, Wen Z, Thomas MJ, Darnell Jr JE, Rotwein P 1995 In vivo growth hormone treatment rapidly stimulates the tyrosine phosphorylation and activation of Stat3. Mol Endocrinol 9:171–177[Abstract]
  59. Gronowski AM, Rotwein P 1994 Rapid changes in nuclear protein tyrosine phosphorylation after growth hormone treatment in vivo. J Biol Chem 269:7874–7878[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
H. Jiang, Y. Wang, M. Wu, Z. Gu, S. J. Frank, and R. Torres-Diaz
Growth Hormone Stimulates Hepatic Expression of Bovine Growth Hormone Receptor Messenger Ribonucleic Acid through Signal Transducer and Activator of Transcription 5 Activation of a Major Growth Hormone Receptor Gene Promoter
Endocrinology, July 1, 2007; 148(7): 3307 - 3315.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
A. Anzulovich, A. Mir, M. Brewer, G. Ferreyra, C. Vinson, and R. Baler
Elovl3: a model gene to dissect homeostatic links between the circadian clock and nutritional status
J. Lipid Res., December 1, 2006; 47(12): 2690 - 2700.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. W Kim, R. P Rhoads, N. Segoale, N. B Kristensen, D. E Bauman, and Y. R Boisclair
Isolation of the cDNA encoding the acid labile subunit (ALS) of the 150 kDa IGF-binding protein complex in cattle and ALS regulation during the transition from pregnancy to lactation.
J. Endocrinol., June 1, 2006; 189(3): 583 - 593.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. J. Chia, M. Ono, J. Woelfle, M. Schlesinger-Massart, H. Jiang, and P. Rotwein
Characterization of Distinct Stat5b Binding Sites That Mediate Growth Hormone-stimulated IGF-I Gene Transcription
J. Biol. Chem., February 10, 2006; 281(6): 3190 - 3197.
[Abstract] [Full Text] [PDF]