Molecular Endocrinology 12 (5): 675-687
Copyright © 1998 by The Endocrine Society
Binding of STAT5a and STAT5b to a Single Element Resembling a
-Interferon-Activated Sequence Mediates the Growth Hormone Induction of the Mouse Acid-Labile Subunit Promoter in Liver Cells
Guck T. Ooi,
Kelley R. Hurst,
Matthew N. Poy,
Matthew M. Rechler and
Yves R. Boisclair
Growth and Development Section (G.T.O., M.N.P., M.M.R.)
Molecular and Cellular Endocrinology Branch National Institute of
Diabetes and Digestive and Kidney Diseases National Institutes of
Health Bethesda, Maryland 20892
Department of Animal
Science (K.R.H., Y.R.B.) Cornell University Ithaca, New York
14853
 |
ABSTRACT
|
|---|
After birth, the endocrine actions of insulin-like
growth factor (IGF)-I and -II become increasingly important. In
postnatal animals, most of circulating IGFs occur in 150-kDa complexes
formed by association of an acid-labile subunit (ALS) with
complexes of IGF and IGF-binding protein-3. ALS is synthesized
almost exclusively in liver. GH stimulates the transcription of the ALS
gene, resulting in increased hepatic mRNA and circulating ALS levels.
To map the GH response element, a series of 5'-deletion fragments of
the mouse ALS promoter (nt -2001 to -49,
A+1TG) were inserted in the luciferase reporter
plasmid pGL3 and transfected into the H4-II-E rat hepatoma cell line.
GH stimulated the activity of promoter fragments with 5'-ends between
nucleotide (nt) -2001 and nt -653 by 1.9- to 2.7-fold. This
stimulation was abolished by deletion of the region located between nt
-653 and nt -483. This region contains two sites, ALS-GAS1 and
ALS-GAS2, that resemble the
-interferon activated sequence (GAS).
Mutation of the ALS-GAS1 site, but not of the ALS-GAS2 site, eliminated
the response to GH when assessed in the context of a GH-responsive
promoter fragment, indicating that ALS-GAS1 was necessary for GH
induction. Three tandem copies of ALS-GAS1 were sufficient to confer GH
inducibility to the minimal promoter of the thymidine kinase gene. In
electrophoretic mobility shift assays, ALS-GAS1 formed a specific,
GH-dependent protein-DNA complex with nuclear extracts from H4-II-E
cells. Using antibodies directed against members of the family of
signal transducers and activators of transcription (STAT), this complex
was shown to be composed of STAT5a and STAT5b. Identical results were
obtained when transfections and mobility shift assays were performed in
primary rat hepatocytes in which the endogenous ALS gene is expressed.
Thus, the transcriptional activation of the mouse ALS gene by GH is
mediated by the binding of STAT5 isoforms to a single GAS-like element.
 |
INTRODUCTION
|
|---|
Insulin-like growth factor (IGF)-I and -II are involved in the
regulation of cellular processes such as proliferation, prevention of
apoptosis, and differentiation (1, 2). Their importance for normal
growth and development was confirmed by targeted inactivation of
the IGF-I and -II genes in mice (1, 2). Before birth, most of the
effects of IGFs result from autocrine/paracrine action (1, 2). After
birth, however, the endocrine mode becomes increasingly important with
IGF-I mediating many of the effects of GH (1, 3) and linking anabolic
processes such as protein synthesis to nutrient availability (4).
In postnatal animals, 8085% of circulating IGFs is sequestered in a
complex of 150-kDa complexes composed of one molecule each of IGF,
IGF-binding protein-3 (IGFBP-3), and a serum protein called the
acid-labile subunit (ALS) (1, 5, 6). The ability of ALS to recruit IGFs
to the 150-kDa complex has important functional consequences on their
physiology. When present in the 150-kDa complex, IGFs can no longer
cross the capillary endothelium and have considerably longer half-lives
(7, 8). The 150-kDa complex serves both as a reservoir of IGFs for
tissues (9) and as a mechanism to prevent nonspecific effects
such as activation of the insulin receptor and the resulting
hypoglycemia (10, 11). Therefore, ALS is an important determinant of
the endocrine actions of IGFs on target cells.
Synthesis of ALS occurs almost exclusively in the parenchymal cells of
liver after birth (12, 13). GH is the most potent inducer of ALS mRNA
in liver and of ALS in the circulation (10, 14, 15, 16). These effects are
direct as GH increases the abundance of ALS mRNA and the secretion of
ALS in primary rat hepatocytes in vitro (17). The changes in
the levels of ALS mRNA in liver of hypophysectomized rats result from
regulation of ALS gene transcription (16).
We recently cloned the mouse ALS gene and demonstrated that the
fragment corresponding to nt -2001 to -49 contains a GH-responsive
promoter when assayed by transient transfection in the H4-II-E rat
hepatoma cell line and primary rat hepatocytes (16, 18). Using these
model systems, we now demonstrate that the effects of GH on the ALS
gene are mediated by the binding of members of the signal transducers
and activators of transcription (STAT) to a single element resembling a
-interferon-activated sequence (GAS).
 |
RESULTS
|
|---|
The GH-Responsive Region Is Located between nt -653 and nt -483
of the Mouse ALS Promoter
GH increased the luciferase activity in H4-II-E cells transiently
transfected with a reporter plasmid containing the nt -2001 to nt -49
promoter fragment of the mouse ALS gene (16). To map the region of the
promoter that confers GH responsiveness, a series of promoter deletion
fragments having variable 5'-ends and a common 3'-end at nt -49 were
inserted in the sense orientation into the luciferase reporter plasmid
pGL3-basic and transfected into H4-II-E cells (Fig. 1
).
Luciferase activity was determined 1824 h after treatment with 0 or
100 ng/ml of human GH (hGH). The luciferase activity of the construct
terminating at nt -2001 was increased 2.7 ± 0.5 fold (mean
± SE) by GH (Fig. 1
). Deletion of the region between nt
-2001 and nt -653 did not significantly decrease the GH stimulation.
In contrast, GH treatment did not increase the luciferase activity of
the cells transfected with the deletion constructs with 5'-ends at nt
-483, -323, or -245. These results indicate that the 170-bp region
between nt -653 and nt -483 is essential for the GH stimulation of
the mouse ALS promoter activity.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 1. Deletion Mapping of the Region That Confers GH
Responsiveness to the Mouse ALS Promoter
A family of 5'-deletion fragments (shown as thick lines,
left panel) was generated by PCR and inserted in the
sense orientation into the plasmid pGL3-basic (LUC). The 5'-end of each
fragment is given to the left relative to A+1TG of the
mouse ALS gene. All fragments shared a common 3'-end at nt -49.
Luciferase plasmids (2 µg) and the plasmid pCMV-SEAP (0.05 µg)
encoding secreted alkaline phosphatase were transfected in duplicate
into H4-II-E cells by the DEAE-dextran method. The transfected cells
were incubated for 1824 h in serum-free medium either in the absence
or presence of 100 ng/ml of hGH. Luciferase activity, measured in cell
lysate, was normalized to alkaline phosphatase secreted in medium. For
each construct, the fold-stimulation by GH (mean ± SE
of two experiments) corresponding to the ratio of luciferase activity
obtained in the presence and in the absence of GH, was calculated
(right panel). *, Significantly different
(P < 0.05) from the luciferase activity of
promoter constructs whose 5'-end is at nt -2001, -1653, -1273,
-703, and -653 using one-way ANOVA followed by Fisher Protected Least
Significant Difference analysis.
|
|
A Single GAS between nt -633 and nt -625 Is Necessary and
Sufficient for GH Stimulation of Mouse ALS Promoter Activity
Computer analysis of the nt -653 to nt -483 region identified
two sites that resemble the GAS consensus sequence, TTNCNNNAA (19).
Similar GAS-like sites have been shown to mediate the effects of
various cytokines, including GH, on the transcription of other genes
(19, 20). The first site, TTCCTAGAA (ALS-GAS1), is located between nt
-633 and nt -625; the second site, TTAGACAAA (ALS-GAS2), is located
between nt -553 and nt -545.
To ascertain whether one or both of these two ALS-GAS sites were
functionally important for GH stimulation of ALS promoter activity,
plasmids containing block mutations of either ALS-GAS1 (703
ALS1) or
ALS-GAS2 (703
ALS2) were prepared in the context of the luciferase
construct retaining full responsiveness to GH (703WT with 5'-end at nt
-703), and transfected into H4-II-E cells (Fig. 2
, top). Mutation of the
ALS-GAS1 element abolished the ability of the promoter to respond to GH
(Fig. 2
, top); mutation of the ALS-GAS2 element was without
effect. Thus, an intact ALS-GAS1 element is necessary for GH
stimulation of ALS promoter activity.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 2. A Single GAS-Like Element Is Necessary for GH
Responsiveness of the Mouse ALS Promoter and Confers GH Responsiveness
to an Heterologous Promoter
Top, Mouse ALS plasmids. The nt -703 to nt -49
promoter fragment (703WT) contains two GAS-like sequences, one located
between nt -633 and nt -625 (ALS-GAS1, oval box), the
other between nt -553 and nt -545 (ALS-GAS2, rectangular
box). Individual block substitution mutants were obtained by
replacing ALS-GAS1 (703 ALS1) or ALS-GAS2 (703 ALS2) by an
EcoRI linker (crossed boxes). These
plasmids (2 µg) were cotransfected with pCMV-SEAP (0.05 µg) in
duplicate into H4-II-E cells by the DEAE-dextran method. Transfected
H4-II-E cells were incubated for 1824 h in serum-free medium in the
absence or presence of 100 ng/ml of hGH. Luciferase activity, measured
in cell lysate, was normalized to alkaline phosphatase secreted in
medium. For each construct, the fold-stimulation by GH represents the
mean ± SE of three experiments. Bottom, Thymidine
kinase plasmids. Three tandem copies of the ALS-GAS1 sequence
(oval boxes) were inserted in front of the minimal
promoter for the thymidine kinase gene of the TK-LUC plasmid to give
TK-LUC-3GAS. TK-LUC and TK-LUC-3GAS (2 µg) were cotransfected with
pCMV-SEAP (0.05 µg) in duplicate into H4-II-E cells by the
DEAE-dextran method. Cell treatments, luciferase assays, and
calculations were performed as described above. For each construct, the
fold-stimulation by GH represents the mean ± SE of
three experiments.
|
|
To establish that the ALS-GAS1 sequence alone is sufficient to
mediate the stimulation by GH, three tandem copies of the 9-bp ALS-GAS1
element were introduced in TK-LUC to give TK-LUC-3GAS. In TK-LUC, the
luciferase gene is driven by the minimal promoter of the thymidine
kinase gene. GH stimulated luciferase activity 3.6 ± 0.2 fold in
H4-II-E cells transfected with TK-LUC-3GAS, but produced no significant
effects in cells transfected with TK-LUC (Fig. 2
, bottom).
Together, these results indicate that the 9-bp GAS-like sequence,
ALS-GAS1, is both necessary and sufficient to confer GH responsiveness
to the mouse ALS promoter.
The ALS-GAS1 Element Binds Nuclear Proteins in H4-II-E Cells in a
GH-Dependent Manner
Electrophoretic mobility shift assays (EMSAs) were performed to
identify nuclear proteins in H4-II-E cells that bind to the ALS-GAS1
element in a GH-dependent manner. H4-II-E cells, maintained for 16
h in serum-free medium, were incubated for 15 min with either 0 or 100
ng/ml of bovine GH (bGH).1
Nuclear extracts prepared from both groups of cells were incubated with
an oligonucleotide probe corresponding to the ALS-GAS1 site (Fig. 3
, lanes 16). Four specific protein-DNA
complexes (designated I to IV) were identified as shown by their
competition by an 100-fold excess of unlabeled ALS-GAS1, but not by a
100-fold excess of the unrelated unlabeled oligonucleotide Sp1.
Complexes I and II were detected only in nuclear extracts of untreated
cells while complex III was present in extracts of untreated and
GH-treated cells.2 More importantly, the
prominent complex IV, with a mobility intermediate between those of
complex I and II (see footnote 2), was detected only in extracts
prepared from GH-treated cells, suggesting that GH increased the
abundance or activity of some nuclear proteins. Incubation of the same
extracts with a probe corresponding to the ALS-GAS2 site did not
identify GH-dependent complexes (Fig. 3
, lanes 712).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 3. EMSA Showing that GH-Dependent Nuclear Proteins in
H4-II-E Cells Bind to the ALS-GAS1 Element
Nuclear extracts were prepared from H4-II-E cells cultivated in
serum-free medium for 16 h, followed by a 15-min period of
incubation in the absence (-) or presence (+) of 100 ng/ml of bGH.
Extract (6 µg) was incubated with labeled oligonucleotides containing
the ALS-GAS1 sequence of the mouse ALS gene (ALS-GAS1, lanes 16), the
ALS-GAS2 sequence of the mouse ALS gene (ALS-GAS2, lanes 712), or the
PRE of the rat ß-casein gene (PRE, lanes 1318). Each probe (20,000
cpm) was incubated alone (-), or together with a 100-fold molar excess
of the unlabeled homologous oligonucleotide (ALS-GAS1, ALS-GAS2, or
PRE), or the unlabeled oligonucleotide containing the consensus
sequence for the unrelated transcription factor Sp1. The position of
specific DNA-protein complexes is indicated by solid
arrowheads. The figure was assembled from autoradiograms
exposed for 16 h (PRE) or 48 h (ALS-GAS1 and ALS-GAS2). The
panels used for the ALS-GAS1 and the PRE portions of the figure are
from the same autoradiogram. The ALS-GAS2 panel is from a second
experiment. The signal intensity and position of complexes were
normalized to the other panels by using a set of reactions with the PRE
probe as standard.
|
|
The GH-Dependent Nuclear Proteins Binding ALS-GAS1 in H4-II-E Cells
Are STAT5a and STAT5b
Recently, sequences similar to the ALS-GAS1 element were shown to
mediate the action of GH by binding STAT1 and STAT3, or STAT5a and/or
STAT5b (20). To determine which of these STAT proteins are activated by
GH in H4-II-E cells, EMSAs were performed with the high-affinity
c-sis-inducible element (SIE) m67, which binds predominantly homo- and
heterodimers of STAT1 and STAT3 (21, 22, 23, 24), or with the PRL response
element (PRE) of the rat ß-casein gene, which binds predominantly
STAT5 isoforms (24, 25, 26). The m67 probe formed specific protein-DNA
complexes that were not increased by GH treatment (results not shown).
In contrast, a specific protein-DNA complex was observed when the PRE
probe was incubated with extracts prepared from GH-treated H4-II-E
cells (Fig. 3
, lanes 1318). This complex comigrated with the
GH-inducible complex IV observed with the ALS-GAS1 probe. These results
suggest that the GH-inducible nuclear proteins in H4-II-E that bind
to the ALS-GAS1 element could be STAT5a or STAT5b, but not STAT1 or
STAT3.
The preceding results suggest that the same nuclear proteins in
GH-treated H4-II-E cells were binding to both the ALS-GAS1 and PRE
elements. To examine this possibility, we compared the ability of the
ALS-GAS1 and other GAS-like elements to competitively inhibit formation
of the GH-dependent complex with the PRE probe (Fig. 4
). Formation of the GH-dependent
protein-DNA complex was significantly reduced by incubation with a
10-fold molar excess of unlabeled PRE. Unlabeled oligonucleotide
corresponding to the mouse ALS-GAS1 element also inhibited formation of
this complex, but had a 3-fold lower affinity than the PRE. Spi-GLE1, a
GAS-like element that binds STAT5 and mediates the stimulation of the
rat Spi 2.1 gene by GH (27, 28), inhibited binding to the PRE with
similar affinity as ALS-GAS1. Oligonucleotides corresponding to the
ALS-GAS2, m67, as well as the unrelated Sp1 sequences did not inhibit
binding. Therefore, in H4-II-E cells, the ALS-GAS1 element appears to
bind the same GH-inducible nuclear proteins as the PRE, presumably
STAT5 isoforms, but with lower affinity.

View larger version (45K):
[in this window]
[in a new window]
|
Figure 4. ALS-GAS1 Oligonucleotide Competitively Inhibits the
Binding of the GH-Dependent Protein in H4-II-E Extracts to the Rat PRE
Element in EMSAs
A labeled oligonucleotide probe corresponding to the PRE of the rat
ß-casein gene (PRE, 20,000 cpm) was incubated with 6 µg of nuclear
extract prepared from H4-II-E cells treated for 15 min with 100 ng/ml
of bGH. Reactions were performed in the absence (-, lane 1) or in the
presence of increasing molar excess (10-, 30-, and 100-fold) of
oligonucleotides corresponding to the PRE (PRE, lanes 24), ALS-GAS1
(ALS-GAS1, lanes 57), ALS-GAS2 (ALS-GAS2, lanes 810), to the
GAS-like element 1 of the rat Spi 2.1 gene (Spi-GLE1, lanes 1113),
and to the high-affinity SIE m67 (m67, lanes 1416). The specificity
of complex formation is demonstrated by the inability of the
oligonucleotide containing the Sp1 consensus sequence to competitively
inhibit binding when used at a 100-fold molar excess (Sp1, lane 17).
The figure is a composite of two autoradiograms. Their exposure time
was calibrated to the signal obtained on each autoradiogram with the
PRE in the absence of competitor.
|
|
To demonstrate directly that STAT5a and STAT5b were the proteins
binding to the ALS-GAS1 and PRE elements in GH-treated H4-II-E cells,
EMSAs were performed in the presence of antibodies to different STAT
proteins (Fig. 5
). Incubation of the
extracts with antibodies to STAT5a before the addition of the ALS-GAS1
probe (lanes 17) or PRE probe (lanes 814) decreased the abundance
of the GH-dependent complex by
60% and resulted in the formation of
two supershifted bands (Fig. 5
, lanes 4, 6, 11, and 13). Inhibition of
the specific protein-DNA complex was more complete, and the intensity
of the supershifted bands was increased when an antibody that reacted
with both STAT5a and STAT5b (STAT5a/b) was used. Doubling the amount of
either antibodies gave identical results (Fig. 5
, lanes 67, 1314),
indicating that differences observed using the two antibodies did not
represent different affinities for STAT5a. Antibodies against STAT1 or
STAT3 did not inhibit or shift the GH-dependent complex. We conclude
that, in nuclear extracts of GH-treated H4-II-E cells, STAT5, but not
STAT1 or STAT3, binds to the ALS-GAS1 and PRE elements. STAT5b
homodimers, and STAT5a homodimers and/or STAT5a-STAT5b heterodimers,
contribute to the observed binding.

View larger version (41K):
[in this window]
[in a new window]
|
Figure 5. Immunological Identification of the GH-Dependent
Proteins in H4-II-E Nuclear Extracts That Bind to the ALS-GAS1 and PRE
Sequences
Nuclear extracts (6 µg) prepared from H4-II-E cells treated for 15
min with 100 ng/ml of bGH were preincubated for 20 min in the absence
(-) or in the presence of antibodies (1 or 2 µl of a 1 mg/ml IgG
solution as indicated) reacting specifically with STAT1 (1), STAT3 (3),
STAT5a (5a), or both STAT5a and STAT5b (5a/b). Then, labeled
oligonucleotides (20,000 cpm) corresponding to the ALS-GAS1 sequence of
the mouse ALS promoter (ALS-GAS1, lanes 17) or to the PRE of the rat
ß-casein gene (PRE, lanes 814) were added and EMSA was performed.
The position of the comigrating specific protein-DNA complex obtained
with the ALS-GAS1 and PRE probes is shown by an
arrowhead on the left. The supershifted
complexes are shown on the right of each panel by the
closed arrows. Panels are from a single autoradiogram.
|
|
Binding of STAT5 to the ALS-GAS1 Element Occurs Rapidly
after GH Treatment of H4-II-E Cells
In many cell systems, the induction of STAT proteins by GH
and other cytokines is short-lived, lasting from minutes to a few hours
(19, 21, 29). To determine the time course of activation of STAT5 in
H4-II-E cells, EMSAs were conducted with nuclear extracts prepared from
cells that had been treated for various times with bGH (Fig. 6
). The GH-dependent protein-DNA complex
was detected 5 min after exposure to GH and peaked between 15 and 30
min after GH. Abundance after 8 and 24 h of GH treatment decreased
to 46% and 9% of the abundance at 15 min. These changes were specific
for STAT5, as formation of the specific protein-DNA complex with the
probe containing the consensus sequence for the transcription factor
Sp1 remained relatively constant over the same time period. These
results indicate that STAT5 is activated within 5 min of GH treatment
and that high levels remain in the nuclei for at least 8 h after
the initiation of GH treatment.

View larger version (69K):
[in this window]
[in a new window]
|
Figure 6. Time-Course of STAT5 Activation after GH Treatment
of H4-II-E Cells
H4-II-E cells were maintained in serum-free medium for 16 h.
Nuclear extracts were prepared at various times (0, 5, 15, and 30 min
and 1, 3, 8, and 24 h) after the addition of 100 ng/ml of bGH.
Each extract (6 µg) was incubated with a labeled oligonucleotide
probe (40,000 cpm) corresponding to the ALS-GAS1 element of the mouse
ALS promoter (ALS-GAS1 probe, top panel) or with a
labeled oligonucleotide (20,000 cpm) containing the consensus sequence
for the transcription factor Sp1 (Sp1 probe, bottom
panel). EMSA was performed as before. The specific complexes
formed with each probe are shown by arrowheads. Each
panel is a composite obtained by combining different regions of a
single autoradiogram. For the Sp1 probe, only the relevant portion of
the autoradiogram is shown.
|
|
GH Activation of the Mouse ALS Promoter in Primary Rat Hepatocytes
Is Also Mediated by STAT5a and STAT5b Binding to the ALS-GAS1
Element
H4-II-E cells do not express ALS mRNA, even when grown in the
presence of FCS and/or GH (Refs. 16 and 17 and G. T. Ooi and
Y. R. Boisclair, unpublished results). To establish that the same
mechanisms underlie the GH activation of the ALS gene in H4-II-E cells
and liver, we used primary rat hepatocytes, a cell system that retains
basal and GH-regulated expression of the ALS gene (17). Under our
conditions, incubation with GH for 24 or 48 h increased ALS mRNA
abundance by 8.0 ± 0.4 and 11.9 ± 1.1 fold (mean ±
SE), respectively (Fig. 7A
).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 7. Mechanisms Mediating the Effect of GH on the Mouse
ALS Promoter in Primary Rat Hepatocytes
Panel A, Primary rat hepatocytes retain the ability to express ALS
mRNA. Hepatocytes were isolated and plated as described in
Materials and Methods. After a 16-h period in serum-free
medium, they were incubated in the absence (-) or in the presence (+)
of 100 ng/ml of bGH for 24 or 48 h. Total RNA was isolated and 15
µg were analyzed by Northern blotting using a rat ALS cDNA probe.
Each lane represents RNA from a single culture dish. For comparison,
the mouse ALS signal obtained with 15 µg of total RNA from normal
adult rat liver (NRL) is shown. Identical results were obtained in a
duplicate experiment. Panel B, The ALS-GAS1 element is required for the
GH-activation of the mouse ALS promoter in primary rat hepatocytes. The
mouse luciferase plasmids 703WT and its derivatives 703 ALS1 and
703 ALS2 (containing block mutation of the ALS-GAS1 and ALS-GAS2
element, respectively) or the thymidine kinase plasmids TK-LUC and its
derivative TK-LUC-3GAS (containing three repeated ALS-GAS1 elements)
were cotransfected (3.5 µg) with pCMV-SEAP (0.05 µg) in triplicate
into primary rat hepatocytes using Lipofectin. After 48 h of
treatment in the absence or in the presence of 100 ng/ml of bGH,
luciferase activity was measured in cell lysates and corrected to the
alkaline phosphatase activity present in medium. For each construct,
the fold-stimulation by GH (mean ± SE of two
experiments) was calculated as before. Panel C, Nuclear proteins bind
the ALS-GAS1 element in primary rat hepatocytes treated with GH.
Labeled oligonucleotides corresponding to the ALS-GAS1 sequence of the
mouse ALS gene were incubated with nuclear extract (6 µg) prepared
from primary rat hepatocytes cultivated in serum-free medium for
16 h, followed by a 15-min period of incubation in the absence
(-, lanes 13) or in the presence (+, lanes 46) of 100 ng/ml of
bGH. The probe (40,000 cpm) was incubated alone (-), or together with
a 100-fold molar excess of unlabeled ALS-GAS1 oligonucleotide
(ALS-GAS1) or of unlabeled Sp1 oligonucleotide (Sp1). EMSA was
performed as before. Panel D, The GH-dependent proteins binding
ALS-GAS1 in primary rat hepatocytes are STAT5a and STAT5b. Nuclear
extract (6 µg) prepared from primary rat hepatocytes treated for 15
min with bGH (100 ng/ml) was preincubated for 20 min in the absence
(-) or in the presence of antibodies (1 µl of a 1 mg/ml IgG
solution) reacting specifically with STAT1 (1), STAT3 (3), STAT5a (5a),
or with both STAT5a and STAT5b (5a/b). Labeled oligonucleotides (40,000
cpm) corresponding to the ALS-GAS1 sequence of the mouse ALS promoter
were added, and EMSA was performed as before. The spots at the
top of lane 3 are artifacts created during the process of
autoradiography.
|
|
To determine the importance of the ALS-GAS1 element to the activation
of the mouse ALS promoter in liver, primary hepatocytes were
transfected with the wild-type luciferase construct 703WT, or with the
construct containing block substitution mutations in ALS-GAS1
(703
ALS1), or in ALS-GAS2 (703
ALS2) and grown in the absence or
presence of 100 ng/ml of bGH for 48 h. As shown above with H4-II-E
cells, stimulation of luciferase activity by GH was dependent on the
integrity of the ALS-GAS1 element but not on the integrity of the
ALS-GAS2 element (Fig. 7B
). Moreover, three tandem copies of ALS-GAS1
conferred GH stimulation to the TK-LUC construct when it was
transfected in primary hepatocytes. These results demonstrate that the
ALS-GAS1 element is necessary and sufficient for the GH activation of
the ALS promoter in primary rat hepatocytes as in H4-II-E cells.
Finally, the probe corresponding to the ALS-GAS1 site was used in EMSAs
with nuclear extracts prepared from primary rat hepatocytes. A specific
protein-DNA complex was detected only in extracts prepared from
GH-treated hepatocytes (Fig. 7C
). This complex was supershifted
partially with antibodies reacting with STAT5a and completely with
antibodies reacting with both STAT5a and STAT5b (Fig. 7D
). Antibodies
raised against STAT1 or STAT3 did not alter the formation or mobility
of the GH-dependent protein-DNA complex. Therefore, STAT5 isoforms
also bind the ALS-GAS1 element in a GH-dependent manner in primary rat
hepatocytes, indicating that the regulatory mechanisms through which GH
stimulates ALS promoter activity in both H4-II-E cells and in primary
rat hepatocytes are similar.
 |
DISCUSSION
|
|---|
ALS plays a critical role in determining the levels and fate of
endocrine IGFs (7, 8, 10, 11), and GH is the most important positive
regulator of ALS gene expression (16, 17). We have studied the
transcriptional regulation of the ALS gene to gain insights on the
mechanisms by which GH regulates the IGF system, and more generally
gene expression in liver. We have shown previously that a promoter
fragment extending from nt -2001 to nt -49 of the mouse ALS gene was
responsive to GH in the H4-II-E rat liver hepatoma cell line (16, 18).
We now map the GH-responsive element of this promoter to a single 9-bp
sequence located between nt -633 and nt -625, and identify nuclear
proteins present in H4-II-E cells that bind this sequence in a
GH-dependent manner. Moreover, we demonstrate that binding of this
cis-element by identical nuclear factors is also required for the GH
activation of the mouse ALS promoter in primary rat hepatocytes, a cell
model in which expression of the endogenous ALS gene is stimulated by
GH.
The sequence of events in the transmission of the GH signal include
homodimerization of the receptor by GH, recruitment of the tyrosine
kinase Jak2 to the cytoplasmic domain of the ligand-receptor complex,
phosphorylation of tyrosine residues in Jak2 and in the dimerized
receptor, and activation of many different transduction cascades (20).
STAT1, -3, -5a, and -5b are some of the signaling molecules activated
by GH (20). After their phosphorylation by Jak kinases, STAT proteins
form homo- or heterodimers that translocate to the nucleus where they
activate transcription by binding to target cis-elements
such as GAS or ISRE (interferon-stimulated response element) (19). The
GH-responsive element that we identified between nt -633 to nt -625
fits the consensus of a GAS element, suggesting that at least a portion
of the effect of GH on the mouse ALS gene is conveyed by the Jak-STAT
pathway (19, 20).
GAS-like sequences that have been shown to mediate the effect of GH on
chromosomal genes fall into two categories (Table 1
). Sequences of the first type are
occupied primarily by STAT5 isoforms in cells treated with GH and are
present in the promoters of the GH-regulated genes encoding Spi 2.1,
insulin, and CYP3A10/6B (27, 28, 29, 30). They resemble the PRE element of the
ß-casein gene, TTC TTG GAA, which was used to purify STAT5 from the
rat mammary gland (26). These GH-responsive elements and the PRE are
characterized by the presence of a palindrome (TTC NNN GAA) that is
critical for high-affinity binding by STAT5 (31, 32). The second type
of GH-responsive GAS-like element is represented by the SIE of the
c-fos gene, in which T replaces G at position 7 [Table 1
]
(22). The SIE and its high-affinity variant, m67, are occupied
preferentially by homo- and heterodimers of STAT1 and STAT3, but have
little affinity for the STAT5 isoforms (Fig. 4
and Refs. 2124, and
32). The ALS-GAS1 element belongs to the first class of GAS-like
element (i.e PRE-like) as it binds only STAT5a and STAT5b in
nuclear extracts prepared from H4-II-E cells and primary rat
hepatocytes treated with GH. The sequence of the ALS-GAS1 element, like
those of the other GH-responsive elements of this class, fits the
consensus TTC (C/T)N(A/G) GAA recently deduced for STAT5 binding
(33).
STAT5a and STAT5b are the products of two different genes that are
nearly identical and bind the PRE element with similar affinities (25).
They differ most markedly in their carboxyl termini, which are involved
in transcriptional activation (34). In this regard, defects observed in
the knockout models of these two isoforms differ. Inactivation of the
STAT5a gene affects primarily female mice, which fail to complete the
final phase of mammary development (35), whereas inactivation of the
STAT5b gene affects primarily males, which adopt growth rates and a
pattern of gene expression in liver that are characteristic of
wild-type female (36). These observations indicate that STAT5a and
STAT5b are not completely redundant and may activate different subsets
of genes. In the case of the ALS gene, binding of STAT5 to the ALS-GAS1
element occurs as STAT5b homodimers and as STAT5a homodimers and/or
STAT5a-5b heterodimers. The functional significance of these various
combinatory pairs to the activation of the ALS gene remains to be
ascertained.
Many functional GAS sites identified in chromosomal genes exhibit weak
binding affinities toward the various STATs when compared with
optimized GAS elements (37). For instance, the ALS-GAS1 and the
Spi-GLE1 elements have
3-fold lower affinity than the PRE
element toward the STAT5 isoforms present in H4-II-E cells (Fig. 4
). In
other genes, STAT1 and STAT4 were shown to overcome these low
affinities by binding cooperatively to nearby GAS elements (37, 38).
STAT5 isoforms may also be capable of cooperative interactions as GH
activation of the Spi 2.1 gene is maximal only when two adjacent
GAS-like sequences involved in binding STAT5 are present (28). In the
case of the mouse ALS gene, a second GAS-like sequence (ALS-GAS2) is
located between nt -553 and nt -545, but was not necessary for GH
induction and was unable to bind STAT5. The possibility remains,
however, that binding of STAT5 to ALS-GAS1 is enhanced by
protein-protein interaction with other transcription factors bound
nearby.
In addition to STAT, GH simultaneously activates other signaling
molecules such as SHC, members of the mitogen-activated protein kinase
cascade, IRS-1 and IRS-2, phospholipase A2, and protein kinase C (20).
It remains possible that some of these other signals activate
additional transcription factors and contribute to the overall effects
of GH on the mouse ALS gene. First, GH treatment of liver cells results
in phosphorylation of STAT1, -3, and -5 not only on tyrosine, but also
on serine (and/or threonine) (24, 39). This additional modification is
important for optimal binding and transactivation potential of STAT
proteins (24, 40, 41), suggesting that a second signaling pathway could
culminate on STAT5 and be important to the GH activation of the ALS
gene in liver. In this context, we have demonstrated that RAS is not
involved in mediating the effects of GH on the ALS gene as
cotransfection of expression plasmids for constitutively active or
dominant negative RAS did not alter the activity of the mouse ALS
promoter in H4-II-E cells (42). Second, our functional analysis
indicates that activation of the ALS promoter by GH requires
cis-elements located in the first
600 bp of the promoter.
The absolute requirement for an intact ALS-GAS1 element does not
preclude the participation of other cis-elements in
producing a full reponse to GH, as shown recently for the Spi 2.1 gene
(43).
The endogeneous ALS gene is not expressed in H4-II-E cells or in any of
the rat liver cell lines that we and others have tested (Refs. 16 and
17 and G. T. Ooi and Y. R. Boisclair, unpublished results).
In H4-II-E cells, this does not reflect the absence of liver-specific
transcription factors as the mouse ALS promoter is active in both
transiently (this study) or stably (Ooi and Boisclair, unpublished
results) transfected cells. Moreover, as shown in this study, GH
activates the ALS promoter in H4-II-E and in primary hepatocytes via
identical mechanisms, i.e. by inducing the binding of STAT5
isoforms to the ALS-GAS1 element. Rather, the absence of expression of
the ALS gene in H4-II-E cells may relate to the silencing of
nonessential genes in culture by modifications of chromatin structure
such as methylation of CpG islands (44). Therefore, despite not
expressing the endogenous gene, H4-II-E cells yield results that are
relevant to the mechanism of GH activation of the ALS gene in normal
liver cells.
In rodents, the pulsatile pattern of GH secretion in the male results
in a greater abundance of activated STAT5, but not of activated STAT1
and STAT3, in liver nuclei (24). Recently, this differential activation
of STAT5 by GH was proposed to underlie the expression of some liver
genes only in the male (24, 39, 45). This interpretation contrasts with
findings that STAT5 mediates the effect of GH on the ALS and Spi 2.1
genes, which are expressed equally in livers of both sexes (G. T.
Ooi and Y. R. Boisclair, unpublished results; S. A. Berry,
personal communication). However, this contradiction may be more
apparent than real. First, STAT5b appears to be the primary isoform
whose hepatic levels are modulated by the pattern of GH secretion (36, 39). Therefore, STAT5a may be more important in mediating the effect of
GH on genes that are expressed equally in both sexes such as ALS and
Spi 2.1, whereas STAT5b may be more important in mediating the effects
of GH on genes that are expressed only in the male. Second, sexual
dimorphism of gene expression in liver results from the interplay of
many transcription factors, one of which may be STAT5 (30). Third, the
ability of STAT proteins, including STAT5, to participate in
protein-protein interactions and to synergistically activate
transcription (37, 38, 46, 47) makes the activation of the ALS and Spi
2.1 genes by GH possible in both sexes despite differences in the
absolute levels of activated STAT5.
Finally, our findings have general significance to understanding the
GH-IGF axis. After birth, most of the IGFs circulate in the 150-kDa
complex. GH regulates the levels of each of the components of the
150-kDa complex either directly (ALS and IGF-I) or indirectly via IGF-I
and/or insulin (IGFBP-3) (1, 5). Because the IGF system is involved in
the mediation of the indirect action of GH, elucidation of the
mechanisms responsible for the effects of GH on the IGF-I and IGFBP-1
genes has been an active area of research (48, 49). However, these
studies have not identified the cis-elements and
transcription factors responsible for these actions (48, 49). In the
case of the ALS gene, we have demonstrated that STAT5 isoforms,
presumably activated by the tyrosine kinase Jak2, mediates the effect
of GH by binding to a single GAS-like element. Therefore, our study
raises the possibility that similar mechanisms may underlie the rapid
transcriptional effects of GH on the IGF-I and IGFBP-1 genes in
liver.
 |
MATERIALS AND METHODS
|
|---|
Reagents
Restriction endonucleases, DNA polymerase, and DNA-modifying
enzymes were purchased from New England Biolabs, Inc. (Beverly, MA) and
from Boehringer Mannheim (Indianapolis, IN). Tissue culture medium,
bovine insulin, and Lipofectin were from Life Technologies
(Gaithersburg, MD). Protease inhibitors and dexamethasone were from
Sigma Chemical Co. (St Louis, MO). The basement membrane Matrigel was
purchased from Becton Dickinson Labware (Bedford, MA). Recombinant hGH
was a gift from Genentech (South San Francisco, CA); recombinant bGH
was a gift from Protiva (St Louis, MO). Diethylaminoethyl
(DEAE)-dextran and the DNA alternating copolymers poly (dA-dT)·poly
(dA-dT) were purchased from Pharmacia Biotech Inc. (Piscataway, NJ).
Oligonucleotides were synthesized using a 393 DNA/RNA synthesizer from
Applied Biosystems (Foster City, CA) or were custom made by Life
Technologies. Radionucleotides were obtained from New England Nuclear
(Boston, MA).
Plasmids
A genomic DNA fragment corresponding to nt -2001 to nt -49
(A+1TG) of the mouse ALS gene served as template in PCR
reactions to create a series of 5'-deletion fragments with a common
3'-end at nt -49 (18). The sense primers (see Fig. 1
for position of
their 5' ends) and a single antisense primer incorporated unique
restriction sites for the endonucleases Asp718 I and
HindIII, respectively. After digestion with Asp718 I and
HindIII and purification by agarose gel electrophoresis,
amplified fragments were ligated into the corresponding sites of the
promoterless luciferase vector pGL3-basic (Promega Corp., Madison, WI).
Block substitution mutants of two GAS-like sites were generated in the
context of the deletion construct containing the nt -703 to -49
promoter fragment (plasmid 703WT) by replacing 9 bp of native sequence
with an EcoRI linker (5'-CGAATTCGC-3') between nt -633 to
-625 to give plasmid 703
ALS1, and between nt -553 to -545 to give
plasmid 703
ALS2. These mutants were prepared by PCR amplification of
appropriate pairs of 5'- and 3'-fragments incorporating an
EcoRI sequence in the site targeted for substitution. After
digesting the 5'- fragment with Asp718 I and EcoRI and the
3'-fragment with EcoRI and HindIII, they were
subcloned into pGL3-basic as described above. For each construct, two
independent PCR reactions were performed with the high-fidelity Vent
polymerase, and used to prepare duplicate plasmids. Plasmid TK-LUC-3GAS
was made by ligating a double-stranded oligonucleotide containing three
tandem copies of the ALS-GAS1 element into the HindIII and
XhoI sites of the plasmid pT109luc (referred to as TK-LUC).
The plasmid pT109luc contains the minimal promoter of the herpes
simplex I thymidine kinase gene inserted upstream of a luciferase
reporter gene (50). Luciferase plasmids were purified by ion-exchange
chromatography (Qiagen, Chatsworth, CA).
Transfection of Rat Liver-Derived Cells
Stock cultures of H4-II-E rat hepatoma cells were grown in RPMI
1640 medium supplemented with 10% FCS and incubated in 95% air-5%
CO2 at 37 C (16). For transfection, H4-II-E cells were
passaged at least twice in DMEM supplemented with 10% FCS and then
grown to 8090% confluence in 60-mm dishes. Monolayers were washed
twice with Tris-buffered saline (25 mM Tris-HCl, pH 7.5,
137 mM KCl, 5 mM NaCl, 0.7 mM
CaCl2, 0.5 mM MgCl2, and 0.6
mM Na2HPO4) and exposed for 15 min
to a 200 µl of a DNA solution (0.5 mg/ml DEAE-dextran, 2 µg
luciferase construct, and 0.05 µg of plasmid pCMV-SEAP in
Tris-buffered saline). pCMV-SEAP encodes secreted alkaline phosphatase
and was used to correct for variation in transfection efficiency. To
ascertain that changes in luciferase activity were caused by the
intended mutation rather than by a random base change introduced by
PCR, duplicate plasmids of each construct were used in separate
transfections. Cells were allowed to recover in DMEM supplemented with
10% FCS for 40 h, with a change to fresh medium after 16 h.
After this period, medium was changed to serum-free DMEM supplemented
with 0.1% BSA in the absence or presence of 100 ng/ml of hGH. Sixteen
to 24 h later, medium was assayed for secreted alkaline
phosphatase by chemiluminescence (Tropix, Bedford, MA), and cell
lysates were assayed for luciferase activity (16).
Primary hepatocytes were isolated from male Sprague-Dawley rats
(250300 g) by the recirculating collagenase perfusion method (51).
These procedures were approved by the Cornell University Institutional
Animal Care and Use Committee. Isolated hepatocytes were transfected by
a modification of the method of Shih and Towle (52). Briefly, they were
plated at 2.5 x 106 cells per 60-mm dish (Primaria,
Falcon) and allowed to attach for 5 h in modified Williams E
medium (MWEM) containing 10% FCS (MWEM is Williams E supplemented to
27.5 mM glucose, 23 mM HEPES, 26 mM
sodium bicarbonate, 2 mM glutamine, 10 nM
dexamethasone, 3.84 µg/ml bovine insulin, 50 U/ml penicillin, and 50
µg/ml streptomycin). The cell monolayers were washed twice with
serum-free MWEM and transfected for 14 h with a 3-ml solution of
serum-free MWEM containing 3.5 µg of the luciferase plasmid, 0.05
µg of pCMV-SEAP, and 42 µg of Lipofectin. After transfection, the
cells were cultivated for 48 h in MWEM (supplemented with 500
µg/ml of Matrigel for the first 24 h) in the absence or presence
of 100 ng/ml of bGH. Secreted alkaline phosphatase and luciferase
activity were measured at the end of this 48-h period as described
above.
Preparation of Nuclear Extracts
H4-II-E cells were grown to confluence in DMEM supplemented with
10% FCS as described above. Primary hepatocytes were isolated and
plated for 5 h in serum-containing MWEM as described above. Then,
each group of cells was washed three times with PBS and incubated for
16 h in the appropriate serum-free medium. Medium was changed to
fresh serum-free medium supplemented with 100 ng/ml of bGH. Nuclear
extracts were prepared at various times after the addition of GH by a
modification of the procedure of Lee et al. (53) (see Figs. 3
, 6
, and 7
for times). Briefly, cells were washed twice with ice-cold
PBS, scraped into fresh PBS, and collected by centrifugation (300
x g for 5 min). Cells were swelled for 15 min on ice in 1
packed cell volume of buffer A [10 mM HEPES, pH 7.9, 1.5
mM MgCl2, 10 mM KCl and 0.5
mM dithiotreitol, 10 mM NaF, 1 mM
Na3VO4, 0.5 mM
phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, and 1 µg/ml
aprotinin], and lysed by extrusion through a 25-gauge needle.
Nuclei were collected by centrifugation (12,000 x g
for 20 sec) and extracted in two thirds packed cell volume of buffer C
(20 mM HEPES, pH 7.9, 25% glycerol, 420 mM
NaCl, 1.5 mM MgCl2, 0.2 mM EDTA,
0.5 mM dithiothreitol, 10 mM NaF, 1
mM Na3VO4, 0.5 mM
phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, and 1 µg/ml
aprotinin) for 30 min on ice. The nuclear debris was removed by
centrifugation (12,000 x g for 5 min), and the
supernatants were dialyzed for 2 h against 100 volumes of buffer D
(same as buffer C except that glycerol is used at 20% vol/vol, NaF at
1 mM, and NaCl is replaced by 100 mM KCl).
Protein concentration of extracts was determined by the method of Lowry
et al. (54).
EMSA
Complementary oligonucleotides corresponding to nt -638 to nt
-621 (ALS-GAS1; top strand, AGGTGTTCCTAGAAGAGG, bottom strand,
CCTCTTCTAGGAACA) and to nt -561 to nt -537 of the mouse ALS promoter
(ALS-GAS2; top strand, ACTGGGCCTTAGACAAACCCCTGGA, bottom strand,
TCCAGGGGTTTGTCTAAGGC) were synthesized. In addition, oligonucleotides
containing previously characterized cis-elements (shown in
bold) were obtained: They correspond to the GAS-like element
1 of the rat Spi 2.1 gene [Spi-GLE1; top strand,
CCATGTTCTGAGAAATCAT, bottom strand,
GGATGATTTCTCAGAACATGG (27)], to the PRE of the rat
ß-casein gene [PRE; top strand, GGACTTCTTGGAATTAAGGGA,
bottom strand, TCCCTTAATTCCAAGAAGT (26)], to the
high-affinity SIE [m67; top strand, GTCGACATTTCCCGTAAATCG,
bottom strand, TCGACGAT-TTACGGGAAATGTC (22)], and to the
consensus site for the transcription factor Sp1 [Sp1; top strand,
CGATCGA-TCGGGGCGGGGCGATCG, bottom strand,
TGATCGAT-CGCCCCGCCCCGATCGATCG (55)]. Oligonucleotides
were purified by polyacrylamide gel electrophoresis, and equimolar
quantities of complementary strands were annealed in buffer (10
mM Tris, pH 8.0, 1 mM EDTA, 10 mM
NaCl) by heating at 100 C for 5 min and cooling to room temperature.
Annealed oligonucleotide pairs were labeled with
[
-32P]dCTP (3000 Ci/mmol) using the Klenow fragment of
DNA polymerase I.
Nuclear extracts were preincubated for 10 min in a buffer containing 1
µg poly (dA-dT)·poly (dA-dT), 20 mM HEPES, pH 7.9, 10%
glycerol, 50 mM NaCl, 1 mM MgCl2, 1
mM EDTA, and 1 mM dithiothreitol. Probes (49
fmol, 20,00040,000 cpm) were then added and the incubation continued
at room temperature for 15 min. When competition studies were
performed, unlabeled double-stranded oligonucleotides that had been
blunt-ended with the Klenow fragment of DNA polymerase I were added
immediately before the probe. In experiments to identify the protein
component of the protein-DNA complexes, antibodies raised against
various STAT proteins and reactive with the rat homologs were purchased
from Santa Cruz Biotechnology (Santa Cruz, CA). They include antibodies
reacting specifically with STAT1
and STAT1ß (sc-346), STAT3
(sc-482), STAT5a (sc-1081), and STAT5a and STAT5b (sc-835). Antibodies
were incubated with the nuclear extracts for 15 min at room temperature
before addition of the probe. Protein-DNA complexes were separated on a
5% nondenaturing polyacrylamide gel (38:1, acrylamide-bisacrylamide;
2% glycerol; 22 mM Tris-borate, 0.5 mM EDTA,
pH 8.3) at 15 mA (2 h at 4 C). Gels were dried and autoradiographed at
-70 C using intensifying screens. Relative intensity of the specific
protein-DNA complexes was quantified by phosphoimaging using a Fuji BAS
1000 unit (Fuji Medical Systems, Stamford, CT).
Northern Analysis of ALS mRNA in Primary Hepatocytes
Primary hepatocytes were isolated and plated as described above.
After a 5-h attachment period, cells were maintained for 16 h in
serum-free MWEM and then incubated in fresh serum-free MWEM in the
presence or in the absence of 100 ng/ml bGH for 24 or 48 h.
Matrigel was also present at 500 µg/ml of medium for the first
24 h. Total RNA was prepared by the acid guanidium thiocyanate
phenol-chloroform method and quantified by absorbance at 260 nm (16).
Total RNA (15 µg/lane) was electrophoresed on a 1.2%
agarose/formaldehyde gel, blotted onto a nylon membrane, and hybridized
to an [
-32P]dCTP- labeled DNA probe corresponding to
nt 1262 to nt 1555 of the rat cDNA (A+1TG) (56). Staining
with ethidium bromide confirmed that ribosomal RNA was intact and that
equal amounts of RNA were loaded in each lane. Phosphoimaging was used
to quantify the relative abundance of ALS mRNA.
 |
ACKNOWLEDGMENTS
|
|---|
The authors thank Mr. L. Hirschberger and Dr. M. H.
Stipanuk for their help in the studies with primary rat
hepatocytes.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Dr. Yves R. Boisclair, 259 Morrison Hall, Cornell University, Ithaca, New York 14853-4801. e-mail: yrb1@cornell.edu.
This work was supported in part by a grant from the Cornell Center for
Advanced Technology in Biotechnology, which is sponsored by the New
York State Science and Technology Foundation and industrial partners,
and by NIH Grant DK-5162401A1 (to Y.R.B.).
1 When used at identical concentrations, hGH and
bGH gave similar fold stimulations of luciferase activity in H4-II-E
cells transfected with the mouse ALS promoter constructs (16 ). 
2 These complexes may represent protein-DNA
interactions that are important for the basal activation of the gene.
Complexes I and II were more obvious after a longer exposure of the
autoradiogram. They can be seen clearly in lane 1 of Fig. 6
. In this
experiment, and in many other experiments not shown where extracts from
untreated and GH-treated cells were compared side by side, complex IV
migrated between complexes I and II. 
Received for publication November 14, 1997.
Revision received January 28, 1998.
Accepted for publication February 2, 1998.
 |
REFERENCES
|
|---|
-
Jones JI, Clemmons DR 1995 Insulin-like growth factors
and their binding proteins: biological actions. Endocr Rev 16:334[Abstract/Free Full Text]
-
Stewart CEH, Rotwein P 1996 Growth, differentiation, and
survival: multiple physiological functions for insulin-like growth
factors. Physiol Rev 76:10051026[Abstract/Free Full Text]
-
Rechler MM, Nissley SP 1990 Peptide growth factors and their
receptors. I. Insulin-like growth factors. In: Sporn MB, Roberts AB
(eds) Handbook of Experimental Pharmacology. Springer-Verlag, Berlin,
vol 95:263367
-
Thissen J-P, Ketelslegers J-M, Underwood LE 1994 Nutritional
regulation of the insulin-like growth factors. Endocr Rev 15:80101[Abstract/Free Full Text]
-
Rechler MM 1993 Insulin-like growth factor binding proteins.
Vitam Horm 47:1114[Medline]
-
Baxter RC 1994 Insulin-like growth factor binding proteins in
the human circulation: a review. Horm Res 42:140144[Medline]
-
Guler H-P, Zapf J, Schmid C, Froesch ER 1989 Insulin-like
growth factors I and II in healthy man. Estimations of half-lives and
production rates. Acta Endocrinol (Copenh) 121:753758[Abstract/Free Full Text]
-
Binoux M, Hossenlopp P 1988 Insulin-like growth factor (IGF)
and IGF-binding proteins: comparison of human serum and lymph. J
Clin Endocrinol Metab 67:509514[Abstract/Free Full Text]
-
Blat C, Villaudy J, Binoux M 1994 In vivo
proteolysis of serum insulin-like growth factor (IGF) binding protein-3
results in increased availability of IGF to target cells. J Clin
Invest 93:22862290
-
Gargosky SE, Tapanainen P, Rosenfeld RG 1994 Administration of
growth hormone (GH), but not insulin-like growth factor-I (IGF-I), by
continuous infusion can in-duce the formation of the 150-kilodalton
IGF-binding protein-3 complex in GH-deficient rats. Endocrinology 134:22672276[Abstract/Free Full Text]
-
Zapf J, Hauri C, Futo E, Hussain M, Rutishauser J, Maack CA,
Froesch ER 1995 Intravenously injected insulin-like growth factor (IGF)
I/IGF binding protein-3 complex exerts insulin-like effects in
hypophysectomized, but not in normal rats. J Clin Invest 95:179186
-
Chin E, Zhou J, Dai J, Baxter RC, Bondy CA 1994 Cellular
localization and regulation of gene expression for components of the
insulin-like growth factor ternary binding protein complex.
Endocrinology 134:24982504[Abstract/Free Full Text]
-
Dai J, Baxter RC 1994 Regulation in vivo of the
acid-labile subunit of the rat serum insulin-like growth factor-binding
protein complex. Endocrinology 135:23352341[Abstract]
-
Zapf J, Hauri C, Waldvogel M, Futo E, Hasler H, Binz K, Guler
HP, Schmid C, Froesch ER 1989 Recombinant human insulin-like growth
factor I induces its own specific carrier protein in hypophysectomized
and diabetic rats. Proc Natl Acad Sci USA 86:38133817[Abstract/Free Full Text]
-
Baxter RC, Dai J 1994 Purification and characterization of the
acid-labile subunit of rat serum insulin-like growth factor
binding protein complex. Endocrinology 134:848852[Abstract/Free Full Text]
-
Ooi GT, Cohen FJ, Tseng LY-H, Rechler MM, Boisclair YR 1997 Growth hormone stimulates transcription of the gene encoding the
acid-labile subunit (ALS) of the circulating insulin-like growth
factor-binding protein complex and ALS promoter activity in rat liver.
Mol Endocrinol 11:9971007[Abstract/Free Full Text]
-
Dai J, Scott CD, Baxter RC 1994 Regulation of the acid-labile
subunit of the insulin-like growth factor complex in cultured rat
hepatocytes. Endocrinology 135:10661072[Abstract]
-
Boisclair YR, Seto D, Hsieh S, Hurst KR, Ooi GT 1996 Organization and chromosomal localization of the gene encoding the
mouse acid labile subunit of the insulin-like growth factor binding
complex. Proc Natl Acad Sci USA 93:1002810033[Abstract/Free Full Text]
-
Schindler C, Darnell Jr JE 1995 Transcriptional responses to
polypeptide ligands: the JAK-STAT pathway. Annu Rev Biochem 64:621651[Medline]
-
Argetsinger LS, Carter-Su C 1996 Mechanism of signaling by
growth hormone receptor. Physiol Rev 76:10891107[Abstract/Free Full Text]
-
Meyer DJ, Campbell GS, Cochran BH, Argetsinger LS, Larner AC,
Finbloom DS, Carter-Su C, Schwartz J 1994 Growth hormone induces a DNA
binding factor related to the interferon-stimulated 91-kDa
transcription factor. J Biol Chem 269:47014704[Abstract/Free Full Text]
-
Wagner BJ, Hayes TE, Hoban CJ, Cochran BH 1990 The SIF binding
element confers sis/PDGF inducibility onto the
c-fos promoter. EMBO J 9:44774484[Medline]
-
Horvath CM, Wen Z, Darnell Jr JE 1995 A STAT protein domain
that determines DNA sequence recognition suggests a novel
DNA-binding domain. Genes Dev 9:984994[Abstract/Free Full Text]
-
Ram PA, Park S-H, Choi HK, Waxman DJ 1996 Growth hormone
activation of Stat 1, Stat 3, and Stat 5 in rat liver. J Biol Chem 271:59295940[Abstract/Free Full Text]
-
Liu X, Robinson GW, Gouilleux F, Groner B, Hennighausen L 1995 Cloning and expression of Stat5 and an additional homologue (Stat5b)
involved in prolactin signal transduction in mouse mammary tissue. Proc
Natl Acad Sci USA 92:88318835[Abstract/Free Full Text]
-
Wakao H, Schmitt-Ney M, Groner B 1992 Mammary gland-specific
nuclear factor is presented in lactating rodent and bovine mammary
tissue and composed of a single polypeptide of 89 kDa. J Biol
Chem 267:1636516370[Abstract/Free Full Text]
-
Sliva D, Wood TJJ, Schindler C, Lobie PE, Norstedt G 1994 Growth hormone specifically regulates serine protease inhibitor gene
transcription via g-activated sequence-like DNA elements. J
Biol Chem 269:2620826214[Abstract/Free Full Text]
-
Bergad PL, Shih H-M, Towles CL, Schwarzenberg SJ, Berry SA 1995 Growth hormone induction of hepatic serine protease inhibitor 2.1
transcription is mediated by a Stat5-related factor binding
synergistically to two g-activated sites. J Biol Chem 270:2490324910[Abstract/Free Full Text]
-
Galsgaard ED, Gouilleux F, Groner B, Serupt P, Neilsen JH,
Billestrup N 1996 Identification of a growth hormone-responsive
STAT5-binding element in the rat insulin 1 gene. Mol Endocrinol 10:652660[Abstract/Free Full Text]
-
Subramanian A, Teixeira J, Wang J, Gil G 1995 A STAT factor
mediates the sexually dimorphic regulation of hepatic cytochrome P450
3A10/lithocholic acid 6B-hydroxylase gene expression by growth hormone.
Mol Cell Biol 15:46724682[Abstract]
-
Beadling C, Ng J, Babbage JW, Cantrell DA 1996 Interleukin-2
activation of STAT5 requires the convergent action of tyrosine kinases
and a serine/threonine kinase pathway distinct from the Raf1/ERK2 MAP
kinase. EMBO J 15:19021913[Medline]
-
Gouilleux F, Pallard C, Dusanter-Fourt I, Wakao H, Haldosen
L-A, Norstedt G, Levy D, Groner B 1995 Prolactin, growth hormone,
erythropoietin and granulocyte-macrophage colony stimulating factor
induce MGF-Stat5 DNA binding activity. EMBO J 14:20052013[Medline]
-
Berry SA, Bergad PL, Schwarzenberg SJ, Towle HC, Sequence
requirements for binding to a growth hormone response element (GHRE).
Program of the 10th International Congress of Endocrinology, San
Francisco, CA, 1996 (Abstract 1:55)
-
Moriggl R, Gouilleux-Gruart V, Jaehne R, Berchtold S, Gartmann
C, Liu X, Hennighausen L, Sotiropoulos A, Groner B, Gouilleux F 1996 Deletion of the carboxy-terminal transactivation domain of MGF-Stat5
results in sustained DNA binding and a dominant negative phenotype. Mol
Cell Biol 16:56915700[Abstract]
-
Liu X, Robinson GW, Wagner K-U, Garrett L, Wynshaw-Boris A,
Hennighausen L 1997 Stat5a is mandatory for adult mammary gland
development and lactogenesis. Genes Dev 11:179186[Abstract/Free Full Text]
-
Udy GB, Towers RP, Snell RG, Wilkins RJ, Park S-H, Ram RA,
Waxman DJ, Davey Helen W 1997 Requirement of STAT5b for sexual
dimorphism of body growth rates and liver gene expression. Proc Natl
Acad Sci USA 94:72397244[Abstract/Free Full Text]
-
Vinkemeiser U, Cohen SL, Moarefi I, Chait BT, Kuriyan J,
Darnell Jr JE 1996 DNA binding of in vitro activated Stat1a,
Stat1b and truncated Stat1: interaction between
NH2-terminal domains stabilizes binding of two dimers to
tandem DNA sites. EMBO J 15:56165626[Medline]
-
Xu X, Sun Y-L, Hoey T 1996 Cooperative DNA binding and
sequence-selective recognition conferred by the Stat amino-terminal
domain. Science 273:794797[Abstract]
-
Gebert CA, Park S-H, Waxman DJ 1996 Regulation of signal
transducer and activator of transcription (STAT) 5b activation by the
temporal pattern of growth hormone stimulation. Mol Endocrinol 11:400411[Abstract/Free Full Text]
-
Wen Z, Zhong Z, Darnell Jr JE 1995 Maximal activation of
transcription by Stat1 and Stat3 requires both tyrosine and serine
phosphorylation. Cell 82:241250[CrossRef][Medline]
-
Zhang X, Blenis J, Li H-C, Schindler C, Chen-Kiang S 1995 Requirement of serine phosphorylation for formation of
STAT-promoter complexes. Science 267:19901994[Abstract/Free Full Text]
-
Boisclair YR, Bassal S, Rechler MM, Ooi GT 1997 Regulation of
ALS gene expression by growth hormone. In: Takano K (ed) Proceedings of
the 4th International Symposium on Insulin-like Growth Factors.
Elsevier Science B.V., Amsterdam, In press
-
Legraverend C, Simar-Blanchet A-E, Paul C, Sotiropoulos A,
Finidori J, Le Cam A 1996 A novel growth hormone response element
unrelated to STAT (signal transducer and activator of
transcription)-binding sites is a bifunctional enhancer. Mol Endocrinol 10:15071518[Abstract/Free Full Text]
-
Antequera F, Boyes J, Bird A 1990 High levels of de
novo methylation and altered chromatin structure at CpG islands in
cell lines. Cell 62:503514[CrossRef][Medline]
-
Waxman DJ, Ram PA, Park S-H, Choi HK 1995 Intermittent plasma
growth hormone triggers tyrosine phosphorylation and nuclear
translocation of a liver-expressed, stat 5-related DNA binding protein.
J Biol Chem 270:1326213270[Abstract/Free Full Text]
-
Stocklin E, Wissler M, Gouilleux F, Groner B 1996 Functional
interactions between Stat5 and the glucocorticoid receptor. Nature 383:726728[CrossRef][Medline]
-
Look DC, Pelletiert MR, Tidwell RM, Roswitt WT, Holtzman MJ 1995 Stat1 depends on transcriptional synergy with Sp1. J Biol
Chem 270:3026430267[Abstract/Free Full Text]
-
Thomas MJ, Kikuchi K, Bichell DP, Rotwein P 1995 Characterization of deoxyribonucleic acid-protein interactions at a
growth hormone-inducible nuclease hypersensitive site in the rat
insulin-like growth factor-I gene. Endocrinology 136:562569[Abstract]
-
Hu M, Robertson DG, Murphy LJ 1996 Growth hormone modulates
insulin regulation of hepatic insulin-like growth factor binding
protein-1 transcription. Endocrinology 137:37023709[Abstract]
-
Nordeen SK 1988 Luciferase reporter gene vectors for analysis
of promoters and enhancers. Biotechniques 5:454458
-
Berry MN, Edwards AM, Barritt GJ 1991 Isolated hepatocytes
preparation, properties and applications. In: Burdon RH, van
Knippenberg (eds) Laboratory Techniques in Biochemistry and Molecular
Biology. Elsevier, New York, vol 21:1460
-
Shih H-M, Towle HC 1995 Matrigel treatment of primary
hepatocytes following DNA transfection enhances responsiveness to
extracellular stimuli. Biotechniques 18:813816[Medline]
-
Lee KA, Bindereif A, Green MR 1988 A small-scale procedure for
preparation of nuclear extracts that support efficient transcription
and pre-mRNA splicing. Gene Anal Tech 5:2231[CrossRef][Medline]
-
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ 1951 Protein
measurements with Folin phenol reagent. J Biol Chem 193:265275[Free Full Text]
-
Faisst S, Meyer S 1992 Compilation of vertebrate-encoded
transcription factors. Nucleic Acids Res 20:326[Free Full Text]
-
Dai J, Baxter RC 1992 Molecular cloning of the acid-labile
subunit of the rat insulin-like growth factor binding protein complex.
Biochem Biophys Res Commun 188:304309[CrossRef][Medline]
-
Gronowski AM, Le Stunff C, Rotwein P 1996 Acute nuclear
actions of growth hormone (GH): cycloheximide inhibits inducible
activator protein-1 activity, but does not block GH-regulated signal
transducer and activator of transcription or gene expression.
Endocrinology 137:5564[Abstract]
-
Gronowski AM, Zhong Z, Wen Z, Thomas MJ, Darnell Jr JE,
Rotwein P 1995 In vivo growth hormone treatment rapidly
stimulates the tyrosine phosphorylation and activation of Stat3. Mol
Endocrinol 9:171177[Abstract/Free Full Text]
-
Gronowski AM, Rotwein P 1994 Rapid changes in nuclear protein
tyrosine phosphorylation after growth hormone treatment in
vivo. J Biol Chem 269:78747878[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
X. Wang, N. Yang, L. Deng, X. Li, J. Jiang, Y. Gan, and S. J. Frank
Interruption of Growth Hormone Signaling via SHC and ERK in 3T3-F442A Preadipocytes upon Knockdown of Insulin Receptor Substrate-1
Mol. Endocrinol.,
April 1, 2009;
23(4):
486 - 496.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Jiang, Y. Wang, M. Wu, Z. Gu, S. J. Frank, and R. Torres-Diaz
Growth Hormone Stimulates Hepatic Expression of Bovine Growth Hormone Receptor Messenger Ribonucleic Acid through Signal Transducer and Activator of Transcription 5 Activation of a Major Growth Hormone Receptor Gene Promoter
Endocrinology,
July 1, 2007;
148(7):
3307 - 3315.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Anzulovich, A. Mir, M. Brewer, G. Ferreyra, C. Vinson, and R. Baler
Elovl3: a model gene to dissect homeostatic links between the circadian clock and nutritional status
J. Lipid Res.,
December 1, 2006;
47(12):
2690 - 2700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W Kim, R. P Rhoads, N. Segoale, N. B Kristensen, D. E Bauman, and Y. R Boisclair
Isolation of the cDNA encoding the acid labile subunit (ALS) of the 150 kDa IGF-binding protein complex in cattle and ALS regulation during the transition from pregnancy to lactation.
J. Endocrinol.,
June 1, 2006;
189(3):
583 - 593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Chia, M. Ono, J. Woelfle, M. Schlesinger-Massart, H. Jiang, and P. Rotwein
Characterization of Distinct Stat5b Binding Sites That Mediate Growth Hormone-stimulated IGF-I Gene Transcription
J. Biol. Chem.,
February 10, 2006;
281(6):
3190 - 3197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K Iida, C J Rosen, C Ackert-Bicknell, and M O Thorner
Genetic differences in the IGF-I gene among inbred strains of mice with different serum IGF-I levels
J. Endocrinol.,
September 1, 2005;
186(3):
481 - 489.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Shumate, G. Yumet, T. A. Ahmed, and R. N. Cooney
Interleukin-1 inhibits the induction of insulin-like growth factor-I by growth hormone in CWSV-1 hepatocytes
Am J Physiol Gastrointest Liver Physiol,
August 1, 2005;
289(2):
G227 - G239.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Endo, Y. Takahashi, Y. Sasaki, T. Saito, and T. Kamataki
Novel Gender-Related Regulation of CYP2C12 Gene Expression in Rats
Mol. Endocrinol.,
May 1, 2005;
19(5):
1181 - 1190.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Tronche, C. Opherk, R. Moriggl, C. Kellendonk, A. Reimann, L. Schwake, H. M. Reichardt, K. Stangl, D. Gau, A. Hoeflich, et al.
Glucocorticoid receptor function in hepatocytes is essential to promote postnatal body growth
Genes & Dev.,
March 1, 2004;
18(5):
492 - 497.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Woelfle and P. Rotwein
In vivo regulation of growth hormone-stimulated gene transcription by STAT5b
Am J Physiol Endocrinol Metab,
March 1, 2004;
286(3):
E393 - E401.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Gu, N. Dube, J. W. Kim, A. Cheng, M. d. J. Ibarra-Sanchez, M. L. Tremblay, and Y. R. Boisclair
Protein Tyrosine Phosphatase 1B Attenuates Growth Hormone-Mediated JAK2-STAT Signaling
Mol. Cell. Biol.,
June 1, 2003;
23(11):
3753 - 3762.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Schwartz
Editorial: Pulsatile Hormone Patterns Governing Transcription Factor Function
Endocrinology,
November 1, 2001;
142(11):
4595 - 4598.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Colson, A. Le Cam, D. Maiter, M. Edery, and J.-P. Thissen
Potentiation of Growth Hormone-Induced Liver Suppressors of Cytokine Signaling Messenger Ribonucleic Acid by Cytokines
Endocrinology,
October 1, 2000;
141(10):
3687 - 3695.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Sawka-Verhelle, S. Tartare-Deckert, J.-F. Decaux, J. Girard, and E. Van Obberghen
Stat 5B, Activated by Insulin in a Jak-Independent Fashion, Plays a Role in Glucokinase Gene Transcription
Endocrinology,
June 1, 2000;
141(6):
1977 - 1988.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. P. Rhoads, P. L. Greenwood, A. W. Bell, and Y. R. Boisclair
Organization and Regulation of the Gene Encoding the Sheep Acid-Labile Subunit of the 150-Kilodalton Insulin-Like Growth Factor-Binding Protein Complex
Endocrinology,
April 1, 2000;
141(4):
1425 - 1433.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. R. Boisclair, J. Wang, J. Shi, K. R. Hurst, and G. T. Ooi
Role of the Suppressor of Cytokine Signaling-3 in Mediating the Inhibitory Effects of Interleukin-1beta on the Growth Hormone-dependent Transcription of the Acid-labile Subunit Gene in Liver Cells
J. Biol. Chem.,
February 11, 2000;
275(6):
3841 - 3847.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Suwanichkul, Y. R. Boisclair, R. C. Olney, S. K. Durham, and D. R. Powell
Conservation of a Growth Hormone-Responsive Promoter Element in the Human and Mouse Acid-Labile Subunit Genes
Endocrinology,
February 1, 2000;
141(2):
833 - 838.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Sasaki, Y. Takahashi, K. Nakayama, and T. Kamataki
Cooperative Regulation of CYP2C12 Gene Expression by STAT5 and Liver-specific Factors in Female Rats
J. Biol. Chem.,
December 24, 1999;
274(52):
37117 - 37124.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Gebert, S.-H. Park, and D. J. Waxman
Termination of Growth Hormone Pulse-Induced STAT5b Signaling
Mol. Endocrinol.,
January 1, 1999;
13(1):
38 - 56.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. B. Ehret, P. Reichenbach, U. Schindler, C. M. Horvath, S. Fritz, M. Nabholz, and P. Bucher
DNA Binding Specificity of Different STAT Proteins. COMPARISON OF IN VITRO SPECIFICITY WITH NATURAL TARGET SITES
J. Biol. Chem.,
February 23, 2001;
276(9):
6675 - 6688.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Shi, W. Xu, F. Loechel, U. M. Wewer, and L. J. Murphy
ADAM 12, a Disintegrin Metalloprotease, Interacts with Insulin-like Growth Factor-binding Protein-3
J. Biol. Chem.,
June 9, 2000;
275(24):
18574 - 18580.
[Abstract]
[Full Text]
[PDF]
|
 |
|