help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zimmermann, S.
Right arrow Articles by Adham, I. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zimmermann, S.
Right arrow Articles by Adham, I. M.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
Molecular Endocrinology 12 (5): 706-713
Copyright © 1998 by The Endocrine Society

Transcription of the Leydig Insulin-Like Gene Is Mediated by Steroidogenic Factor-1

Stephan Zimmermann, Anja Schwärzler, Sabine Buth, Wolfgang Engel and Ibrahim M. Adham

Institute of Human Genetics University of Göttingen 37073 Göttingen, Germany


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Leydig insulin-like gene (Ley I-L), a member of the insulin-related gene family, is specifically expressed in pre- and postnatal Leydig cells of the testis and in postnatal theca cells of the ovary. To determine the functional region of the mouse Ley I-L promoter and factors controlling the Ley I-L gene expression, we used 2.1 kb of the 5'-flanking region of the mouse Ley I-L gene to generate chimeric constructs with the chloramphenicol acetyltransferase gene (CAT). Transient transfections of MA10 Leydig cells, LTK- fibroblasts, and F9 embryonic cells by a series of 5'-deleted mouse Ley I-L promoter-CAT constructs revealed that the sequence between nucleotides -157 to +4 directs the transcription of the reporter gene in MA10 but not in LTK- and F9 cells, indicating that the determinants of Leydig cell-specific expression reside within this region. Deoxyribonuclease I (DNase I) footprint analysis revealed that the sequences designated SF-1/1, SF-1/2, and SF-1/3 within three DNase I-protected regions are homologous to the consensus binding site of the steroidogenic factor-1 (SF-1). Competition and antibody studies showed that the three SF-1-binding sites in the Ley I-L promoter have similar binding affinities for SF-1. Furthermore, transient transfections of MA10 cells with mutant reporter constructs, in which SF-1/1 or both SF-1/2 and SF-1/3 were deleted, demonstrated that all three SF-1- binding sites are required for SF-1-mediated stimulation of Ley I-L transcription. Cotransfection of an SF-1-containing expression vector together with a Ley I-L promoter-CAT construct into HeLa cells, which lack the endogenous SF-1 protein, resulted in CAT gene transcription, which indicated that SF-1 can transactivate the Ley I-L promoter. These data demonstrate an essential role of SF-1 in transcriptional activation of the Ley I-L promoter.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Recently, we have characterized a new member of the insulin-like hormone superfamily, termed Ley I-L, which is specifically expressed in Leydig cells of the fetal and adult testis (1) and in the theca cells of the postnatal ovary (2). The Ley I-L cDNA and gene were isolated from different mammalian species and characterized (1, 2, 3, 4, 5). Sequencing revealed that the primary structure of the prepro-Ley I-L factor and exon-intron organization of the gene are more similar to those of preproinsulin and preprorelaxin than to those of preproinsulin-like growth factor I and II (1, 4).

The Ley I-L gene is expressed at a high level in the adult testis and at a much lower level in the adult ovary. Analyses of Ley I-L transcripts in testis and ovary throughout the pre- and postnatal life of the mouse revealed a sexual dimorphic pattern of Ley I-L expression during development. No Ley I-L transcripts are detected in female embryos of any stage, whereas in male embryos transcripts are first detected at day 13.5. After birth, the level of Ley I-L transcription in testis remains constant during the first 3 weeks, increases at the time at which the first wave of round spermatids undergoes spermiogenesis, and reaches the highest level in adult testis. These results suggest that the Ley I-L peptide plays a role in germ cell maturation. In the female, expression of the Ley I-L gene is first detected in the ovary at day 6 after birth. This, taken together with the distinct expression pattern of Ley I-L during the estrous cycle and pregnancy, implies a functional role of Ley I-L during follicular development (5).

As a first step in identification of the regulatory elements that control Ley I-L gene transcription and its cell-specific expression, we have cloned and sequenced the human, porcine, and mouse Ley I-L gene as well as their 5'-flanking sequences (4, 5). Alignment of the 5'-flanking region of these genes did not reveal any significant sequence homologies. However, the TATA-box and two sequence stretches are conserved and located at equivalent positions in all three genes. The nucleotide sequence of one of the conserved sequences is identical to the consensus binding site for steroidogenic factor-1 (SF-1) (6), also designated as Ad4BP. SF-1, an orphan nuclear receptor, has been found to regulate several genes in testis, ovary, adrenal cortex, and pituitary gland (7, 8, 9, 10, 11, 12, 13, 14, 15) by binding to specific cis-acting elements in the regulatory region of these genes. The conservation of the consensus sequence of the SF-1-binding site in the 5'-flanking region of mammalian Ley I-L genes and the observation that SF-1 expression precedes the Ley I-L expression in testis and ovary suggests that SF-1 regulates the expression of the Ley I-L gene (5).

In the present study, we demonstrate that SF-1 binds to the SF-1-binding sites in the Ley I-L promoter and transactivates the mouse Ley I-L promoter.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Proximal 157-bp Region of the Ley I-L Promoter Is Required for Leydig Cell-Specific Transcription
To determine the region necessary for transcriptional regulation of the Ley I-L gene, MA10, LTK-, and F9 cells were transiently transfected with chloramphenicol acetyl transferase (CAT) constructs containing different lengths of the 5'-flanking region of the mouse Ley I-L gene obtained by progressive deletion (Fig. 1Go). CAT activities were determined in cell extracts (Fig. 1Go). For control experiments, these cell lines were also transfected with pSV40-CAT and pCAT basic.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Expression of CAT Activities in MA10, LTK-, and F9 Cells

Left, Partial map of murine Ley I-L promoter illustrating the restriction sites that were used for construction of the 5'-deletion constructs and schematic diagram of various Ley I-L-CAT fusion constructs. The Ley I-L start of transcription is indicated by an arrow. Restriction enzymes are abbreviated as follows: B, BamHI; P, PstI; S, SstI; E, EcoRI; X, XhoI. The CAT activity in MA10, LTK-, and F9 transiently transfected cells with each construct is illustrated at the right. The relative CAT activity was correlated to ß-galactosidase activity and expressed as a percentage of pSV40-CAT. The relative CAT activity represents at least three independent transfections, each done in duplicate.

 
The progressive removal of 5'-sequences of the Ley I-L gene from nucleotide position -2109 to -690 resulted in a slight increase of the promoter activity in MA10 cells. Further deletion of the sequence from -690 to -157 did not significantly affect the expression of the CAT reporter gene. However, a drastic decrease of CAT activity was observed when the sequence from -157 to -53 was deleted. These results suggest that the region between -157 to -53 of the Ley I-L promoter contains regulatory elements sufficient to direct the transcription of the reporter gene in the Leydig cells (MA10).

The cell type-specific activity of the Ley I-L promoter was demonstrated by measuring CAT activity in extracts of F9 and LTK- cells, which do not express Ley I-L (our unpublished data). No significant CAT activity was found in these cell lines, either transfected with p2109-CAT or with other constructs. These results demonstrate that the 5'-flanking region of the Ley I-L gene can direct the cell type-specific expression of the Ley I-L gene.

The Transcription Factor SF-1 Binds to the Ley I-L Promoter
As shown above, the region between bp -157 and -53 was determined to be sufficient for the regulation of the Ley I-L promoter in MA10 cells. DNase I footprinting analysis was carried out to identify the binding sites involved in the Ley I-L regulation. A DNA fragment spanning the region -157/+4 was labeled at each strand and allowed to bind to MA10 nuclear proteins. In the experiments depicted in Fig. 2Go, four protected DNA segments located between -43 to -37 (F1), -62 to -53 (F2), -110 to -102 (F3), and -142 to -130 (F4) were detected. The motif CCAAGGCC in the protected site F2 was found to be conserved in sequence and located at an equivalent position in the mouse, porcine, and human Ley I-L gene and was identical to the consensus sequence

of the SF-1-binding site (5). A further search of the nucleotide sequence in F1, F3, and F4 revealed that the sequences TCAAGGTC on the coding strand of F3 and TCACGGTC on the noncoding strand of F2 (Fig. 3Go) share homology with the consensus sequence of the SF-1-binding site. We named to the SF-1-binding site homologous sequences in the protected F2, F3, and F4 segment as an SF-1/1, SF-1/2, and SF-1/3 element, respectively.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 2. DNase I Footprinting Analysis of Ley I-L Promoter Using Nuclear Extracts of MA10 Cells

DNase I footprinting experiments were performed with the coding (left) and noncoding (right) strand of the DNA fragment extending from -157 to +4. The probes were incubated with nuclear protein (+) or without protein (-). The protected regions on each strand are indicated by boxes. The line G+A represents the Maxam and Gilbert sequence ladder obtained with the respective probes.

 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. Mapping of DNase I-Protected Segments in the Sequence of Ley I-L Promoter

The sequence of the murine Ley I-L is shown. The DNase I footprints identified in Fig. 2Go are boxed and designated F1–F4. Bold sequences correspond to the identified SF-1-binding sites. The sequences of the oligonucleotides used in EMSA experiments are underlined. The Ley I-L start of transcription is indicated by an arrow and +1.

 
To examine whether the same nuclear protein binds to the sequence elements SF-1/1, SF-1/2, and SF-1/3 of the Ley I-L promoter, three oligonucleotides containing the sequences of SF-1/1, SF-1/2, and SF-1/3 sites were designed (Fig. 3Go) and used in electrophoretic mobility shift assay (EMSA) (Fig. 4Go). When the SF-1/1 oligonucleotide was incubated with the nuclear extracts of MA10 cells, one DNA/protein complex was observed (Fig. 4AGo, lane 1). The 100-fold competition with the unlabeled SF-1/2 and SF-1/3 oligonucleotides abolished the formation of the complex (Fig. 4AGo, lanes 2, 3), whereas competition with a nonspecific oligonucleotide (N1) spanning the sequence -131 to -112 of the Ley I-L promoter (Fig. 3Go) and the SF-1/1 M oligonucleotide, which has a 3-bp substitution in the SF-1/1 site did not affect the formation of this complex (Fig. 4AGo, lanes 4 and 5). Protein complexes to the SF-1/2 and SF-1/3 oligonucleotide had the same mobility as that formed with the SF-1/1 oligonucleotide (Fig. 4BGo, lanes 1 and 4). The protein binding to the SF-1/2 and SF-1/3 oligonucleotides could be effectively abolished with a 100-fold excess of the SF-1/1 as well as the SF-1/2 or SF-1/3 oligonucleotides (Fig. 4BGo, lanes 2–3 and lanes 5–6). These results indicate that the same nuclear protein in the MA10 cells interacts with the sequence elements SF-1/1, SF-1/2, and SF-1/3.



View larger version (72K):
[in this window]
[in a new window]
 
Figure 4. The Affinity Binding of SF-1 to the Three SF-1-Binding Sites in the Ley I-L Promoter and Tissue Specificity of SF1/1-Binding Protein Analyzed by EMSA

A, The double-stranded SF-1/1 oligonucleotide (Fig. 3Go) was end-labeled and incubated with the nuclear extract of MA10 cells in the absence (lane 1) or in the presence of 100 molar excess of unlabeled SF-1/2 (lane 2), SF-1/3 (lane 3), N1 (lane 4), and SF-1/1 M (lane 5) oligonucleotides. This specific DNA-protein complex (SF-1) is indicated by an arrow. B, Double-stranded SF-1/2, SF-1/3, and N1 oligonucleotides were end-labeled and incubated with nuclear extracts of MA10 cells in the absence (lanes 1, 4, and 7) or presence of 100 molar excess of unlabeled competitors (lanes 2, 3, 5, and 6). C, The nuclear extract of MA10 cells was incubated without (lane 1) or with polyclonal SF-1 antibody (lane 2) or normal rabbit serum (lane 3) for 30 min and then incubated with the labeled SF-1/1 oligonucleotide. D, Nuclear extracts from MA10 cells (lane 1), testis (lane 2), spleen (lane 3), and kidney (lane 4) were incubated with the SF-1/1 oligonucleotide to test the presence of SF-1/1-binding activity.

 
The DNA/protein complex was further analyzed using an antibody inhibition assay with polyclonal antibodies directed against the purified bovine SF-1 (16). As shown in Fig. 4CGo, the SF-1-antiserum (lane 2) but not rabbit preimmune serum (lane 3) disrupted the formation of the SF-1/1 oligonucleotide-nuclear factor complex. EMSA was also performed with nuclear extracts of 15-day-old mouse testis, spleen, kidney, and MA10 cells. Binding of a nuclear protein to the SF-1/1 oligonucleotide was observed with nuclear extracts of MA10 cells and testis but not with extracts of spleen and kidney (Fig. 4DGo), which do not express the SF-1 gene. These results confirm that the SF-1 protein is the component of the complex formed using the SF-1/1, SF-1/2, and SF-1/3 oligonucleotides.

SF-1 Transactivates the Ley I-L Promoter
The results of EMSA have demonstrated that SF-1 binds to the three SF-1 sites of the murine Ley I-L promoter. To examine whether the SF-1 can activate the transcription of the Ley I-L promoter by binding to the three sites and to establish the contribution of each of the three SF-1 elements to the promoter activity, a series of mutant reporter constructs were generated, in which one, two, or all three of the SF-1 elements were deleted (Fig. 5Go). The constructs were introduced into MA10 cells, and the relative CAT activity was determined as a percentage of the activity of the wild-type p157-CAT construct. Transfection of the p157{Delta}SF-1/1-CAT with a deletion of 6 bp in the SF-1/1 site resulted in a reduction in promoter activity to 19% relative to the p157-CAT. A similar reduction in promoter activity was observed when the construct p100-CAT with progressive deletion of the sequence -157 to -101, was introduced into MA10 cells. A drastic decrease in CAT activity was observed with p100{Delta}SF-1/1-CAT, in which all three SF-1 sites were absent. The possibility that the reduction in CAT activity in the cell lysate transfected with p100-CAT was due to the absence of a further binding site in a deleted sequence (-157/-100) can be excluded, because the results of DNase I footprinting (Fig. 2Go) and EMSA (Fig. 4BGo, lane 7) with the oligonucleotide N1 spanning the nucleotide sequence between SF-1/2 and SF-1/3 sites failed to demonstrate a further binding site.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 5. Effect of SF-1-Binding Sites Located in the Ley I-L Promoter on the Expression of the CAT Reporter Gene

Schematic diagram on the left represents the Ley I-L-CAT fusion constructs used in this experiment. The sequence of SF-1-binding sites in the Ley I-L promoter is indicated with shaded boxes, and the deleted SF-1-binding site with a triangle. The relative CAT activity in MA10 cells transfected with each construct is illustrated on the right. The relative CAT activity was normalized relative to ß-galactosidase activity. All CAT activities are expressed as a percentage of the CAT activity obtained with p157-CAT. Each bar represents average relative CAT activity from at least three independent transfections, each assayed in duplicate.

 
To examine more directly whether the SF-1 could transactivate the Ley I-L promoter, cotransfection experiments were performed in HeLa cells, which are known to lack the endogenous SF-1 protein (12). The cotransfection of the p157-CAT together with the expression vector pRc/RSV did not result in CAT activity. However, cotransfection of the reporter construct p157-CAT with the expression vector pRSV/Ad4BP (17), which encodes SF-1, resulted in a significant transactivation of the Ley I-L promoter in HeLa cells (Fig. 6Go).



View larger version (65K):
[in this window]
[in a new window]
 
Figure 6. Activation of the Ley I-L Promoter in HeLa Cells in the Presence of SF-1

Shown in upper panel are CAT activities obtained from HeLa cells transfected with 10 µg p157-CAT construct together with 2.5 µg mammalian expression vector pRc/RSV (Invitrogen, San Diego, CA) or SF-1 expression vector. The control assays were performed by transfections with pCAT basic (promoterless) or pSV40-CAT (SV40 promoter). Histograms in the lower panel are derived from quantitation of CAT assays. The relative CAT activity was expressed as percentage of that with pSV40-CAT construct. Results are given as means and SDs from three independent transfections, each assayed in duplicate.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this report, we demonstrate that SF-1 binds to and activates the murine Ley I-L promoter. Cotransfection of a plasmid producing SF-1 with a Ley I-L-CAT reporter construct containing the sequence between -157 to +4 of the Ley I-L gene into HeLa cells clearly demonstrates that SF-1 is required for activation of the Ley I-L promoter.

SF-1 was first recognized to regulate genes coding for steroidogenic enzymes in the adrenal gland and testicular Leydig cells (7, 8). Recently, the arrest of gonadal development in SF-1-deficient mice (18) has led to the suggestion that SF-1 also activates other genes that are required for the differentiation of the reproductive system. It has been established that SF-1 regulates the specific expression of Müllerian inhibitor substance (MIS) gene in Sertoli cells (12) and the genes coding for the {alpha}-subunit of LH and FSH (13) and for the ß-subunit of LH in pituitary gonadotropes (14). Because the Ley I-L gene is also regulated by SF-1 and Ley I-L deficient mice show a failure of outgrowth and differentiation of the gubernaculum, which is essential for testicular descent (our unpublished results), it is evident that the Ley I-L gene is involved in the SF-1-regulated gene cascade required for sexual differentiation.

Our analysis of the regulatory region of the Ley I-L gene revealed that the sequence from -157 to +4 is sufficient for Leydig cell-specific transcription. DNase I footprint experiments revealed three protected segments between -157/-53 that contain DNA sequences homologous to the consensus SF-1-binding site. Deletions of these sequences led to a drastic decrease of the CAT activity in the MA10 cells. Antibody inhibition and competition assay indicated that each of the three SF-1-binding sites in the Ley I-L promoter possess equal binding affinities to SF-1. Moreover, transient transfection experiments in MA10 cells showed that mutant reporter constructs, in which the sequence for the SF-1/1-binding site or for both SF-1/2- and SF-1/3-binding sites were deleted, could be activated by SF-1 to a similar extent, approximately 17–19% of the wild-type construct. In conclusion, the three SF-1-binding sites in the Ley I-L promoter have similar binding affinities for SF-1 and contribute to transactivation of the Ley I-L promoter by SF-1. Contribution of more than one SF-1 binding site in the transcriptional activation of other SF-1-regulated genes has been demonstrated for the gene coding for the ß-subunit of LH. The mutation of only one of the SF-1-binding sites in the 5'-flanking region of this gene did not fully diminish promoter activity (14).

Furthermore, we demonstrated that SF-1 transactivates the Ley I-L promoter in cotransfection experiments in HeLa cells. Since SF-1 is able to activate the promoter of Ley I-L in HeLa cells, it is likely that transactivation occurs mainly via a direct binding of SF-1 to the three SF-1 binding sites, and that a cofactor or a ligand is not required for the transactivational properties of the SF-1 on the Ley I-L promoter. These data are consistent with previous reports that showed that SF-1 apparently activates rat LHß and salmon gonadotropin IIß subunit genes in a ligand-independent manner (14, 19). In contrast, the regulation of the MIS gene by SF-1 requires a SF1-specific ligand or a cofactor (12). SF-1 by itself was unable to activate the MIS promoter in HeLa cells. Removal of the SF-1 ligand-binding domain enabled the truncated SF-1 to stimulate the MIS promoter in HeLa cells and led to the hypothesis that a cofactor specific for Sertoli cells was required for the SF-1 activation of the MIS gene. SF-1 is present in gonads, adrenal cortex, and brain, but the expression of certain SF-1-regulated genes is restricted to one of these organs. Therefore, other factors or SF-1 ligands must further distinguish gonadal from adrenal and brain-specific expression of SF-1-regulated genes. A synergistic interaction of SF-1 with other factors or a SF-1 cofactor specific for these organs may contribute to cell-specific and organ-specific expression of SF-1 responsive genes.

The pattern of Ley I-L expression during pre- and postnatal development of the testis and postnatal development of the ovary is correlated with the presence of SF-1 in these developmental stages. Marked differences were observed between the expression of Ley I-L and SF-1 in the testis during postnatal life. The amount of Ley I-L transcript increases after the third postnatal week and reaches its highest level in adult testis (5), whereas the level of SF-1 transcript drops slightly at postnatal day 15 and remains at a low level thereafter (12, 16). These differences between relative expression of Ley I-L and SF-1 in postnatal testis could be explained by the presence of other transcription factors or hormonal influences that act in synergism with SF-1 to drastically enhance the expression of Ley I-L in adult testis. Such synergistic interactions have been observed between SF-1 and estrogen receptor in the regulation of the salmon gonadotrophin IIß subunit gene in the pituitary gland (19). In the mouse, serum levels of LH and FSH increase sharply between day 20 and 35 (20, 21), precisely when Ley I-L expression increases. Therefore, transgenic experiments with reporter constructs containing the Ley I-L promoter may directly address whether the SF-1 binding sites are a key regulator of Ley I-L promoter activity in vivo as has been shown for the LHß (22) and MIS (23) genes and whether the increase of the Ley I-L expression in adult testis is the result of interactions between SF-1 and hormone-stimulated responses.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid Construction
The 3.5-kb BamHI genomic fragment (5) containing the 5'-flanking region, exons 1 and 2 of the Ley I-L gene, was subcloned into pBluescript IIKS+ (pBam-1). A promoterless CAT basic vector (Promega, Madison, WI) and the genomic subclone (pBam-1) were used for preparation of the chimeric expression constructs (Fig. 1Go).

Using the subclone pBam1 as a template, a fragment -690 bp/+4 and -157/+4 with an artificial HindIII site at the 5'-end and an XbaI site at the 3'-end was amplified by PCR and subcloned into the plasmid pCAT basic to produce p690-CAT and p157-CAT. The nucleotide sequence of these truncated clones was confirmed by sequencing. The p100-CAT was generated by digestion of p157-CAT with HindIII/XhoI and religated. The HindIII/XhoI fragment -2109/-101 was isolated from the pBam-1 clone and ligated with the HindIII/XhoI-digested p157-CAT construct to create p2109-CAT. The p1361-CAT vector was constructed by digestion of the p2109-CAT construct with PstI and the -1361/+4-CAT fusion fragment was purified from the agarose gel and subcloned by blunt-end ligation.

The vector p157{Delta}SF-1/1-CAT in which the conserved sequence CCAAGG (-61/-56) was deleted was generated by a two-step PCR-directed mutagenesis by the following procedures. First, a fragment -157/-41 was prepared using a 5'-HindIII site-GCACCTGGGAGAGGACTTC-3' as 5'-primer and 5'-CGCGCCGCCCATGGGCG GGAACACAGCCAA-3' as 3'-primer, and a fragment -63/+4 was prepared using 5'-GCTGTGTTCCCGCCCATGGGCGGCGCGAGG-3' as 5'-primer and 5'-TGGTGGC AGGAGGCAGTGGGC-XbaI site-3' as 3'-primer. The p157-CAT construct was used as the template to amplify the two fragments. Subsequently, these two fragments were mixed and used for another round of PCR in the presence of the 5'-primer and the 3'-primer which have been used for amplification of the -157/-41 and -63/+4 fragments, respectively. The final PCR product was digested with HindIII/XbaI, subcloned into a promoterless CAT vector, and the internal deletion was confirmed by sequencing. The p100{Delta}SF-1/1-CAT was generated by digestion of p157{Delta}SF-1/1-CAT with HindIII/XhoI followed by blunt-end ligation.

Cell Culture
The mouse fibroblast LTK-, mouse embryonic carcinoma F9 cells, and human HeLa cells were cultured in DMEM (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% heat-inactivated FCS (Boehringer, Mannheim, Germany) under 5% CO2. All media included penicillin (100 U/ml) and streptomycin (100 µg/ml). The mouse tumor Leydig cell line MA10 was maintained as described (24).

Transfection and CAT Assay
Mouse MA10, LTK-, and F9 cells were cotransfected with 10 µg of the tested plasmid and 2 µg of pCMV-ß-galactosidase control plasmid (CLONTECH, Palo Alto, CA) by the calcium phosphate coprecipitation method (25). After exposure to the DNA precipitate for 12–16 h, cells were washed and fresh medium was then added. The cells were harvested 48 h later, and CAT activities were measured in the cell lysates (26). One tenth of cell lysate was used to determine ß-galactosidase activity. For each CAT reaction, cell extract was combined with 4 µl of [14C] chloramphenicol (Amersham, Arlington Heights, IL), 10 µl of 20 mg/ml acetyl-coenzyme A (Sigma, St. Louis, MO), and 250 mM Tris, pH 7.8, to a final volume of 150 µl. The mixtures were incubated at 37 C for 2 h, and the reactions were stopped by extraction with 1 ml ethyl acetate. Acetylated and nonacetylated chloramphenicol were separated by TLC.

Nuclear Extract
Nuclear protein extracts from MA10, LTK-, and F9 cells were prepared according to Dignam et al. (27), whereas nuclear extracts from tissues were prepared by a modified method of Gorski et al. (28). Briefly, 0.5–1 g of tissue was minced and homogenized in 10 ml homogenization buffer using a Teflon glass homogenizer. The homogenate was layered over 3.2 ml of homogenization buffer (10 mM HEPES, pH 7.3, 25 mM KCl, 0.15 mM spermine, 0.5 mM spermidine, 1 mM EDTA, 2 M sucrose, 2 µg/ml leupeptin, 2 µg/ml pepstatin A, 10% glycerol) and centrifuged in a SW40 rotor at 25,000 rpm for 30 min at -4 C. The pelleted nuclei were resuspended in 2 ml of nuclear lysis buffer (20 mM HEPES, pH 7.9, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, 2 µg/ml leupeptin, 2 µg/ml pepstatin A, 25% glycerol) and lysed using an all-glass Dounce homogenizer. The lysate was mixed for 30 min at 4 C and then centrifuged in a microcentrifuge at 12,000 rpm for 20 min at 4 C. The supernatant was dialyzed several hours against dialysis buffer (20 mM HEPES, pH 7.9, 100 mM KCl, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, 2 µg/ml leupeptin, 2 µg/ml pepstatin A, 20% glycerol), frozen in liquid nitrogen, and stored at -70 C. The concentration of the nuclear proteins was measured by a protein assay kit (Bio-Rad, Richmond, CA).

EMSA
From the sequence around the three footprinted regions F2, F3, and F4, double-stranded DNA fragments were prepared by annealing of complementary oligonucleotides. The sequences of the sense strands of the double-stranded oligonucleotides were: SF-1/1: 5'-agcttTCCCGCCAAGGCCC-ATGG (-66/-49); SF-1/1 M: 5'-agcttTCCCGACAATTCC CATGG; SF-1/2: 5'-agcttACACAGCCCCTGACCGTGAC-TCG (-121/-99); SF-1/3: 5'-agctt GACTTCAAGGTCCCAAGCTGGAC (-144/-122); N1: 5'-agcttCAAGCTGGACACACAG CCCC (-131/-112). The SF-1/1 M has three nucleotide substitutions in the consensus SF-1 binding site. The localization of the oligonucleotides within the promoter sequence are given in parentheses. Five nucleotides were added to the 5'-end of the synthetic oligonucleotides to use for labeling reaction with Klenow fragment and [{alpha}-32P]dCTP (Amersham). In each gel shift assay, 10 µg nuclear extract were preincubated in a 20 µl reaction mixture containing 20 mM HEPES, pH 7.9, 0.5 mM EDTA, 25 mM KCl, 25 mM NaCl, 0.5 mM dithiothreitol, 7% glycerol, and 2–4 µg poly(deoxyinosinic-deoxycytidylic)acid. After 10 min, approximately 1 x 104 cpm of 32P-labeled probe was added, and the incubation was continued for 20 min on ice, then loaded onto 6% nondenaturing polyacrylamide gel. The gels were fixed in a solution of 10% acetic acid and 30% methanol, dried, and exposed to Hyperfilm-MP (Amersham). In competition assay, 100-fold excess of unlabeled double-stranded oligonucleotide was incubated for 15 min together with the nuclear extracts before addition of the 32P-labeled probe. For antibody cross-reaction, 1 µl of anti-SF-1 antibody (16) or rabbit preserum was incubated with the nuclear proteins for 30 min before addition of the 32P-labeled probe.

DNase I Footprinting
The DNA fragments used for DNase I footprint analysis of the Ley I-L promoter were prepared from the p157-CAT construct by digestion of the plasmid with either XbaI or HindIII to label the coding and noncoding strand, respectively. Ends were filled in with [{alpha}-32P]dCTP using the Klenow fragment of Escherichia coli DNA polymerase I, and the fragments were subsequently released by XbaI or HindIII digestion as appropriate. In the binding reaction, 30–100 µg MA10 nuclear extract and 5 x 104 cpm of 32P-labeled probe were used under the same conditions as in EMSA in a total volume of 100 µl. The reactions were chilled on ice for 20 min. After the concentration of CaCl2 had been adjusted to 2.5 mM, DNase I (3 U) was added, and the digestion was carried out at 20 C for 1 min. The reaction was terminated by adding 90 µl of prewarmed (37 C) stop solution (20 mM Tris, pH 7.5, 20 mM EDTA, 0.4% SDS, 80 µg/ml proteinase K, 80 µg/ml yeast tRNA), and the probe was extracted with phenol-chloroform-isoamylalcohol. The reaction products were precipitated and analyzed on a 6% sequencing gel along with a Maxam-Gilbert G+A sequencing reaction as a size marker.


    ACKNOWLEDGMENTS
 
We thank Dr. Ken-ichirou Morohashi, University of Kyushu (Fukuoka, Japan), for providing the SF-1 antibody and plasmid RSV/Ad4BP, and Dr. Ascoli, University of Iowa (Iowa City, IA), for providing the MA10 cells. We also thank Mrs. Angelika Winkler and Mr. Peter Richter for secretarial and photographic assistance.


    FOOTNOTES
 
Address requests for reprints to: Dr. Ibrahim M. Adham, Institut für Humangenetik der Universität, Gosslerstrasse 12d, 37073 Göttingen, Germany.

This work was supported by a grant from the Deutsche Forschungsgemeinschaft through SFB 271 (to I.M.A.).

Received for publication December 1, 1997. Revision received January 27, 1998. Accepted for publication January 30, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Adham IM, Burkhardt E, Benahmed M, Engel W 1993 Cloning of a cDNA for a novel insulin-like peptide of the testicular Leydig cells. J Biol Chem 268:26668–26672
  2. Roche PJ, Butkus A, Wintour EM, Tregear G 1996 Structure and expression of Leydig insulin-like peptide mRNA in the sheep. Mol Cell Endocrinol 121:171–177
  3. Burkhardt E, Adham IM, Hobohm U, Murphy D, Sander C, Engel W 1994 A human cDNA coding for the Leydig insulin-like peptide (Ley I-L). Hum Genet 94:91–94
  4. Burkhardt E, Adham IM, Brosig B, Gastmann A, Mattei M-G, Engel W 1994 Structural organization of the porcine and human genes coding for a Leydig cell-specific insulin-like peptide (Ley I-L) and chromosomal localization of the human gene (INSL 3). Genomics 20:13–19
  5. Zimmermann S, Schöttler P, Engel W, Adham IM 1997 Mouse Leydig insulin-like (Ley I-L) gene: structure and expression during testis and ovary development. Mol Reprod Dev 47:30–38
  6. Morohashi K-I, Honda S-I, Inamata Y, Honda H, Omura T 1992 A common trans-acting factor, Ad4-binding protein, to the promoters of steroidogenic P-450 s. J Biol Chem 267:17913–17919
  7. Rice DA, Mouw AR, Bogerd AM, Parker KL 1991 A shared promoter element regulates the expression of three steroidogenic enzymes. Mol Endocrinol 5:1552–1561
  8. Honda S, Morohashi K, Nomura M, Takeya H, Kitajima M, Omura T 1993 Ad4BP regulating steroidogenic P-450 genes is a member of steroid hormone receptor superfamily. J Biol Chem 268:7494–7502
  9. Lynch JP, Lala DS, Peluso JJ, Luo W, Parker KL, White BA 1993 Steroidogenic factor 1, an orphan nuclear receptor, regulates the expression of the rat aromatase gene in gonadal tissues. Mol Endocrinol 7:776–786
  10. Barnhart KM, Mellon PL 1994 The orphan nuclear receptor steroidogenic factor-1, regulates the glycoprotein hormone {alpha}-subunit gene in pituitary gonadotropes. Mol Endocrinol 8:878–885
  11. Wehrenberg U, Ivell R, Jansen M, von Goedecke S, Walther N 1994 Two orphan receptors binding to a common site are involved in the regulation of the oxytocin gene in the bovine ovary. Proc Natl Acad Sci USA 91:1440–1444
  12. Shen WH, Moore CC, Ikeda Y, Parker KL, Ingraham HA 1994 Nuclear receptor steroidogenic factor 1 regulates the Müllerian inhibiting substance gene: a link to the sex determination cascade. Cell 77:651–661
  13. Ingraham HA, Lala DS, Ikeda Y, Luo X, Shen W-H, Nachtigal MW, Abbud R, Nilson JH, Parker KL 1994 The nuclear receptor steroidogenic factor 1 acts at multiple levels of the reproductive axis. Genes Dev 8:2302–2312
  14. Halvorson LM, Kaiser UB, Chin WW 1996 Stimulation of luteinizing hormone ß gene promoter activity by the orphan nuclear receptor, steroidogenic factor-1. J Biol Chem 271:6645–6650
  15. Hu Z, Zhuang L, Guan X, Meng J, Dufau ML 1997 Steroidogenic factor-1 is an essential transcriptional activator for gonad-specific expression of promoter I of the rat prolactin receptor gene. J Biol Chem 272:14263–14271
  16. Hatano O, Takayama K, Imai T, Waterman MR, Takakusu A, Omura T, Morohashi K-I 1994 Sex-dependent expression of a transcription factor, Ad4BP, regulating steroidogenic P-450 genes in the gonads during prenatal and postnatal rat development. Development 120:2787–2797
  17. Morohashi K-I, Zanger UM, Honda S-I, Hara M, Waterman MR, Omura T 1993 Activation of CYP11A and CYP11B gene promoters by the steroidogenic cell-specific transcription factor, Ad4BP. Mol Endocrinol 7:1196–1204
  18. Luo X, Ikeda Y, Parker KL 1994 A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77:481–490
  19. Le Drean Y, Liu D, Wong AOL, Xiong F, Hew CL 1996 Steroidogenic factor 1 and estradiol receptor act in synergism to regulate the expression of the salmon gonadotropin IIß subunit gene. Mol Endocrinol 10:217–229
  20. Selmanoff MK, Goldman BD, Ginsburg BE 1976 Developmental changes in serum luteinizing hormone, follicle stimulating hormone and androgen levels in males of two inbred mouse strains. Endocrinology 100:122–127
  21. Jean-Faucher C, Berger M, de Turkleim M, Veyssiere G, Jean C 1977 Developmental pattern of plasma and testicular testosterone in mice from birth to adulthood. Acta Endocrinol (Copenh) 89:780–788
  22. Keri RA, Nilson JH 1996 A steroidogenic factor-1 binding site is required for activity of the luteinizing hormone beta subunit promoter in gonadotropes of transgenic mice. J Biol Chem 271:10782–10785
  23. Giuili G, Shen W-H, Ingraham HA 1997 The nuclear receptor SF-1 mediates sexually dimorphic expression of Müllerian inhibiting substance, in vivo. Development 124:1977–1807
  24. Ascoli A 1981 Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin receptors and localization of corticotropin releasing factor in testis. Biochim Biophys Acta 995:10–16
  25. Chen C, Okayama H 1987 High efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol 7:2745–2752
  26. Gorman CM, Moffat LF, Howard BH 1982 Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044–1051
  27. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489
  28. Gorski K, Garneiro M, Schibler U 1986 Tissue-specific in vitro transcription from the mouse albumin promoter. Cell 47:767–776



This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
R. Ivell and R. Anand-Ivell
Biology of insulin-like factor 3 in human reproduction
Hum. Reprod. Update, July 1, 2009; 15(4): 463 - 476.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Ventura, R. Manor, E. D. Aflalo, S. Weil, S. Raviv, L. Glazer, and A. Sagi
Temporal Silencing of an Androgenic Gland-Specific Insulin-Like Gene Affecting Phenotypical Gender Differences and Spermatogenesis
Endocrinology, March 1, 2009; 150(3): 1278 - 1286.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Lague and J. J. Tremblay
Antagonistic Effects of Testosterone and the Endocrine Disruptor Mono-(2-Ethylhexyl) Phthalate on INSL3 Transcription in Leydig Cells
Endocrinology, September 1, 2008; 149(9): 4688 - 4694.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. R. Cederroth, O. Schaad, P. Descombes, P. Chambon, J.-D. Vassalli, and S. Nef
Estrogen Receptor {alpha} Is a Major Contributor to Estrogen-Mediated Fetal Testis Dysgenesis and Cryptorchidism
Endocrinology, November 1, 2007; 148(11): 5507 - 5519.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Feng, N. V Bogatcheva, A. Truong, B. Korchin, C. E Bishop, T. Klonisch, I. U Agoulnik, and A. I Agoulnik
Developmental Expression and Gene Regulation of Insulin-like 3 Receptor RXFP2 in Mouse Male Reproductive Organs
Biol Reprod, October 1, 2007; 77(4): 671 - 680.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
G. De Rienzo, F. Aniello, M. Branno, G. Izzo, and S. Minucci
The expression level of frog relaxin mRNA (fRLX), in the testis of Rana esculenta, is influenced by testosterone
J. Exp. Biol., October 1, 2006; 209(19): 3806 - 3811.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. M. Robert, L. J. Martin, and J. J. Tremblay
The Orphan Nuclear Receptor NR4A1 Regulates Insulin-Like 3 Gene Transcription in Leydig Cells
Biol Reprod, February 1, 2006; 74(2): 322 - 330.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. Truong, N. V. Bogatcheva, C. Schelling, G. Dolf, and A. I. Agoulnik
Isolation and Expression Analysis of the Canine Insulin-Like Factor 3 Gene
Biol Reprod, November 1, 2003; 69(5): 1658 - 1664.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. Klonisch, K. Steger, A. Kehlen, W. R. Allen, C. Froehlich, J. Kauffold, M. Bergmann, and S. Hombach-Klonisch
INSL3 Ligand-Receptor System in the Equine Testis
Biol Reprod, June 1, 2003; 68(6): 1975 - 1981.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
R. Ivell and S. Hartung
The molecular basis of cryptorchidism
Mol. Hum. Reprod., April 1, 2003; 9(4): 175 - 181.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. Ivell and R. A.D. Bathgate
Reproductive Biology of the Relaxin-Like Factor (RLF/INSL3)
Biol Reprod, September 1, 2002; 67(3): 699 - 705.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. H.-C. Shen and H. A. Ingraham
Regulation of the Orphan Nuclear Receptor Steroidogenic Factor 1 by Sox Proteins
Mol. Endocrinol., March 1, 2002; 16(3): 529 - 540.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Koskimies, J. Levallet, P. Sipila, I. Huhtaniemi, and M. Poutanen
Murine Relaxin-Like Factor Promoter: Functional Characterization and Regulation by Transcription Factors Steroidogenic Factor 1 and DAX-1
Endocrinology, March 1, 2002; 143(3): 909 - 919.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Wang, D. C. Newton, T. L. Miller, A.-M. Teichert, M. J. Phillips, M. S. Davidoff, and P. A. Marsden
An Alternative Promoter of the Human Neuronal Nitric Oxide Synthase Gene Is Expressed Specifically in Leydig Cells
Am. J. Pathol., January 1, 2002; 160(1): 369 - 380.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. de Rienzo, F. Aniello, M. Branno, and S. Minucci
Isolation and Characterization of a Novel Member of the Relaxin/Insulin Family from the Testis of the Frog Rana esculenta
Endocrinology, July 1, 2001; 142(7): 3231 - 3238.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. J. Wang, B. Jeffs, M. Ito, J. C. Achermann, R. N. Yu, D. B. Hales, and J. L. Jameson
Aromatase (Cyp19) expression is up-regulated by targeted disruption of Dax1
PNAS, June 20, 2001; (2001) 141543298.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
L. O'Donnell, K. M. Robertson, M. E. Jones, and E. R. Simpson
Estrogen and Spermatogenesis
Endocr. Rev., June 1, 2001; 22(3): 289 - 318.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. Klonisch, J. Kauffold, K. Steger, M. Bergmann, R. Leiser, B. Fischer, and S. Hombach-Klonisch
Canine Relaxin-Like Factor: Unique Molecular Structure and Differential Expression Within Reproductive Tissues of the Dog
Biol Reprod, February 1, 2001; 64(2): 442 - 450.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
J. Levallet, P. Koskimies, N. Rahman, and I. Huhtaniemi
The Promoter of Murine Follicle-Stimulating Hormone Receptor: Functional Characterization and Regulation by Transcription Factor Steroidogenic Factor 1
Mol. Endocrinol., January 1, 2001; 15(1): 80 - 92.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
D. Boerboom, N. Pilon, R. Behdjani, D. W. Silversides, and J. Sirois
Expression and Regulation of Transcripts Encoding Two Members of the NR5A Nuclear Receptor Subfamily of Orphan Nuclear Receptors, Steroidogenic Factor-1 and NR5A2, in Equine Ovarian Cells during the Ovulatory Process
Endocrinology, December 1, 2000; 141(12): 4647 - 4656.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Tomboc, P. A. Lee, M. F. Mitwally, F. X. Schneck, M. Bellinger, and S. F. Witchel
Insulin-like 3/Relaxin-Like Factor Gene Mutations Are Associated with Cryptorchidism
J. Clin. Endocrinol. Metab., November 1, 2000; 85(11): 4013 - 4018.
[Abstract] [Full Text]


Home page
Mol Hum ReprodHome page
C. Krausz, L. Quintana-Murci, M. Fellous, J.-P. Siffroi, and K. McElreavey
Absence of mutations involving the INSL3 gene in human idiopathic cryptorchidism
Mol. Hum. Reprod., April 1, 2000; 6(4): 298 - 302.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. E. Bullesbach and C. Schwabe
Specific, High Affinity Relaxin-like Factor Receptors
J. Biol. Chem., August 6, 1999; 274(32): 22354 - 22358.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K.-i. Morohashi, H. Tsuboi-Asai, S. Matsushita, M. Suda, M. Nakashima, H. Sasano, Y. Hataba, C.-L. Li, J. Fukata, J. Irie, et al.
Structural and Functional Abnormalities in the Spleen of an mFtz-F1 Gene-Disrupted Mouse
Blood, March 1, 1999; 93(5): 1586 - 1594.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. d. S. Barbara, B. Moniot, F. Poulat, B. Boizet, and P. Berta
Steroidogenic Factor-1 Regulates Transcription of the Human Anti-mullerian Hormone Receptor
J. Biol. Chem., November 6, 1998; 273(45): 29654 - 29660.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. J. Wang, B. Jeffs, M. Ito, J. C. Achermann, R. N. Yu, D. B. Hales, and J. L. Jameson
Aromatase (Cyp19) expression is up-regulated by targeted disruption of Dax1
PNAS, July 3, 2001; 98(14): 7988 - 7993.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zimmermann, S.
Right arrow Articles by Adham, I. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zimmermann, S.
Right arrow Articles by Adham, I. M.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals