| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Institute of Human Genetics University of Göttingen 37073 Göttingen, Germany
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The Ley I-L gene is expressed at a high level in the adult testis and at a much lower level in the adult ovary. Analyses of Ley I-L transcripts in testis and ovary throughout the pre- and postnatal life of the mouse revealed a sexual dimorphic pattern of Ley I-L expression during development. No Ley I-L transcripts are detected in female embryos of any stage, whereas in male embryos transcripts are first detected at day 13.5. After birth, the level of Ley I-L transcription in testis remains constant during the first 3 weeks, increases at the time at which the first wave of round spermatids undergoes spermiogenesis, and reaches the highest level in adult testis. These results suggest that the Ley I-L peptide plays a role in germ cell maturation. In the female, expression of the Ley I-L gene is first detected in the ovary at day 6 after birth. This, taken together with the distinct expression pattern of Ley I-L during the estrous cycle and pregnancy, implies a functional role of Ley I-L during follicular development (5).
As a first step in identification of the regulatory elements that control Ley I-L gene transcription and its cell-specific expression, we have cloned and sequenced the human, porcine, and mouse Ley I-L gene as well as their 5'-flanking sequences (4, 5). Alignment of the 5'-flanking region of these genes did not reveal any significant sequence homologies. However, the TATA-box and two sequence stretches are conserved and located at equivalent positions in all three genes. The nucleotide sequence of one of the conserved sequences is identical to the consensus binding site for steroidogenic factor-1 (SF-1) (6), also designated as Ad4BP. SF-1, an orphan nuclear receptor, has been found to regulate several genes in testis, ovary, adrenal cortex, and pituitary gland (7, 8, 9, 10, 11, 12, 13, 14, 15) by binding to specific cis-acting elements in the regulatory region of these genes. The conservation of the consensus sequence of the SF-1-binding site in the 5'-flanking region of mammalian Ley I-L genes and the observation that SF-1 expression precedes the Ley I-L expression in testis and ovary suggests that SF-1 regulates the expression of the Ley I-L gene (5).
In the present study, we demonstrate that SF-1 binds to the SF-1-binding sites in the Ley I-L promoter and transactivates the mouse Ley I-L promoter.
| RESULTS |
|---|
|
|
|---|
|
The cell type-specific activity of the Ley I-L promoter was demonstrated by measuring CAT activity in extracts of F9 and LTK- cells, which do not express Ley I-L (our unpublished data). No significant CAT activity was found in these cell lines, either transfected with p2109-CAT or with other constructs. These results demonstrate that the 5'-flanking region of the Ley I-L gene can direct the cell type-specific expression of the Ley I-L gene.
The Transcription Factor SF-1 Binds to the Ley I-L Promoter
As shown above, the region between bp -157 and -53
was determined to be sufficient for the regulation of the Ley I-L
promoter in MA10 cells. DNase I footprinting analysis was carried out
to identify the binding sites involved in the Ley I-L regulation. A DNA
fragment spanning the region -157/+4 was labeled at each strand and
allowed to bind to MA10 nuclear proteins. In the experiments depicted
in Fig. 2
, four protected DNA segments
located between -43 to -37 (F1), -62 to -53 (F2), -110 to -102
(F3), and -142 to -130 (F4) were detected. The motif CCAAGGCC in
the protected site F2 was found to be conserved in sequence and located
at an equivalent position in the mouse, porcine, and human Ley I-L gene
and was identical to the consensus sequence
![]() |
|
|
|
SF-1 Transactivates the Ley I-L Promoter
The results of EMSA have demonstrated that SF-1 binds to the three
SF-1 sites of the murine Ley I-L promoter. To examine whether the SF-1
can activate the transcription of the Ley I-L promoter by binding to
the three sites and to establish the contribution of each of the three
SF-1 elements to the promoter activity, a series of mutant reporter
constructs were generated, in which one, two, or all three of the SF-1
elements were deleted (Fig. 5
). The
constructs were introduced into MA10 cells, and the relative CAT
activity was determined as a percentage of the activity of the
wild-type p157-CAT construct. Transfection of the
p157
SF-1/1-CAT with a deletion of 6 bp in the SF-1/1 site
resulted in a reduction in promoter activity to 19% relative to
the p157-CAT. A similar reduction in promoter activity was observed
when the construct p100-CAT with progressive deletion of the sequence
-157 to -101, was introduced into MA10 cells. A drastic decrease in
CAT activity was observed with p100
SF-1/1-CAT, in which all three
SF-1 sites were absent. The possibility that the reduction in CAT
activity in the cell lysate transfected with p100-CAT was due to the
absence of a further binding site in a deleted sequence (-157/-100)
can be excluded, because the results of DNase I footprinting (Fig. 2
)
and EMSA (Fig. 4B
, lane 7) with the oligonucleotide N1 spanning the
nucleotide sequence between SF-1/2 and SF-1/3 sites failed to
demonstrate a further binding site.
|
|
| DISCUSSION |
|---|
|
|
|---|
SF-1 was first recognized to regulate genes coding for steroidogenic
enzymes in the adrenal gland and testicular Leydig cells (7, 8).
Recently, the arrest of gonadal development in SF-1-deficient mice (18)
has led to the suggestion that SF-1 also activates other genes that are
required for the differentiation of the reproductive system. It has
been established that SF-1 regulates the specific expression of
Müllerian inhibitor substance (MIS) gene in Sertoli cells (12)
and the genes coding for the
-subunit of LH and FSH (13) and for the
ß-subunit of LH in pituitary gonadotropes (14). Because the Ley I-L
gene is also regulated by SF-1 and Ley I-L deficient mice show a
failure of outgrowth and differentiation of the gubernaculum, which is
essential for testicular descent (our unpublished results), it is
evident that the Ley I-L gene is involved in the SF-1-regulated gene
cascade required for sexual differentiation.
Our analysis of the regulatory region of the Ley I-L gene revealed that the sequence from -157 to +4 is sufficient for Leydig cell-specific transcription. DNase I footprint experiments revealed three protected segments between -157/-53 that contain DNA sequences homologous to the consensus SF-1-binding site. Deletions of these sequences led to a drastic decrease of the CAT activity in the MA10 cells. Antibody inhibition and competition assay indicated that each of the three SF-1-binding sites in the Ley I-L promoter possess equal binding affinities to SF-1. Moreover, transient transfection experiments in MA10 cells showed that mutant reporter constructs, in which the sequence for the SF-1/1-binding site or for both SF-1/2- and SF-1/3-binding sites were deleted, could be activated by SF-1 to a similar extent, approximately 1719% of the wild-type construct. In conclusion, the three SF-1-binding sites in the Ley I-L promoter have similar binding affinities for SF-1 and contribute to transactivation of the Ley I-L promoter by SF-1. Contribution of more than one SF-1 binding site in the transcriptional activation of other SF-1-regulated genes has been demonstrated for the gene coding for the ß-subunit of LH. The mutation of only one of the SF-1-binding sites in the 5'-flanking region of this gene did not fully diminish promoter activity (14).
Furthermore, we demonstrated that SF-1 transactivates the Ley I-L promoter in cotransfection experiments in HeLa cells. Since SF-1 is able to activate the promoter of Ley I-L in HeLa cells, it is likely that transactivation occurs mainly via a direct binding of SF-1 to the three SF-1 binding sites, and that a cofactor or a ligand is not required for the transactivational properties of the SF-1 on the Ley I-L promoter. These data are consistent with previous reports that showed that SF-1 apparently activates rat LHß and salmon gonadotropin IIß subunit genes in a ligand-independent manner (14, 19). In contrast, the regulation of the MIS gene by SF-1 requires a SF1-specific ligand or a cofactor (12). SF-1 by itself was unable to activate the MIS promoter in HeLa cells. Removal of the SF-1 ligand-binding domain enabled the truncated SF-1 to stimulate the MIS promoter in HeLa cells and led to the hypothesis that a cofactor specific for Sertoli cells was required for the SF-1 activation of the MIS gene. SF-1 is present in gonads, adrenal cortex, and brain, but the expression of certain SF-1-regulated genes is restricted to one of these organs. Therefore, other factors or SF-1 ligands must further distinguish gonadal from adrenal and brain-specific expression of SF-1-regulated genes. A synergistic interaction of SF-1 with other factors or a SF-1 cofactor specific for these organs may contribute to cell-specific and organ-specific expression of SF-1 responsive genes.
The pattern of Ley I-L expression during pre- and postnatal development of the testis and postnatal development of the ovary is correlated with the presence of SF-1 in these developmental stages. Marked differences were observed between the expression of Ley I-L and SF-1 in the testis during postnatal life. The amount of Ley I-L transcript increases after the third postnatal week and reaches its highest level in adult testis (5), whereas the level of SF-1 transcript drops slightly at postnatal day 15 and remains at a low level thereafter (12, 16). These differences between relative expression of Ley I-L and SF-1 in postnatal testis could be explained by the presence of other transcription factors or hormonal influences that act in synergism with SF-1 to drastically enhance the expression of Ley I-L in adult testis. Such synergistic interactions have been observed between SF-1 and estrogen receptor in the regulation of the salmon gonadotrophin IIß subunit gene in the pituitary gland (19). In the mouse, serum levels of LH and FSH increase sharply between day 20 and 35 (20, 21), precisely when Ley I-L expression increases. Therefore, transgenic experiments with reporter constructs containing the Ley I-L promoter may directly address whether the SF-1 binding sites are a key regulator of Ley I-L promoter activity in vivo as has been shown for the LHß (22) and MIS (23) genes and whether the increase of the Ley I-L expression in adult testis is the result of interactions between SF-1 and hormone-stimulated responses.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Using the subclone pBam1 as a template, a fragment -690 bp/+4 and -157/+4 with an artificial HindIII site at the 5'-end and an XbaI site at the 3'-end was amplified by PCR and subcloned into the plasmid pCAT basic to produce p690-CAT and p157-CAT. The nucleotide sequence of these truncated clones was confirmed by sequencing. The p100-CAT was generated by digestion of p157-CAT with HindIII/XhoI and religated. The HindIII/XhoI fragment -2109/-101 was isolated from the pBam-1 clone and ligated with the HindIII/XhoI-digested p157-CAT construct to create p2109-CAT. The p1361-CAT vector was constructed by digestion of the p2109-CAT construct with PstI and the -1361/+4-CAT fusion fragment was purified from the agarose gel and subcloned by blunt-end ligation.
The vector p157
SF-1/1-CAT in which the conserved sequence CCAAGG
(-61/-56) was deleted was generated by a two-step PCR-directed
mutagenesis by the following procedures. First, a fragment -157/-41
was prepared using a 5'-HindIII site-GCACCTGGGAGAGGACTTC-3'
as 5'-primer and 5'-CGCGCCGCCCATGGGCG GGAACACAGCCAA-3' as 3'-primer,
and a fragment -63/+4 was prepared using
5'-GCTGTGTTCCCGCCCATGGGCGGCGCGAGG-3' as 5'-primer and 5'-TGGTGGC
AGGAGGCAGTGGGC-XbaI site-3' as 3'-primer. The p157-CAT
construct was used as the template to amplify the two fragments.
Subsequently, these two fragments were mixed and used for another round
of PCR in the presence of the 5'-primer and the 3'-primer which have
been used for amplification of the -157/-41 and -63/+4 fragments,
respectively. The final PCR product was digested with
HindIII/XbaI, subcloned into a promoterless CAT
vector, and the internal deletion was confirmed by sequencing. The
p100
SF-1/1-CAT was generated by digestion of p157
SF-1/1-CAT with
HindIII/XhoI followed by blunt-end ligation.
Cell Culture
The mouse fibroblast LTK-, mouse embryonic
carcinoma F9 cells, and human HeLa cells were cultured in DMEM
(Life Technologies, Inc., Gaithersburg, MD) supplemented
with 10% heat-inactivated FCS (Boehringer, Mannheim,
Germany) under 5% CO2. All media included penicillin
(100 U/ml) and streptomycin (100 µg/ml). The mouse tumor Leydig cell
line MA10 was maintained as described (24).
Transfection and CAT Assay
Mouse MA10, LTK-, and F9 cells were cotransfected
with 10 µg of the tested plasmid and 2 µg of pCMV-ß-galactosidase
control plasmid (CLONTECH, Palo Alto, CA) by the calcium phosphate
coprecipitation method (25). After exposure to the DNA precipitate for
1216 h, cells were washed and fresh medium was then added. The cells
were harvested 48 h later, and CAT activities were measured in the
cell lysates (26). One tenth of cell lysate was used to determine
ß-galactosidase activity. For each CAT reaction, cell extract was
combined with 4 µl of [14C] chloramphenicol (Amersham,
Arlington Heights, IL), 10 µl of 20 mg/ml acetyl-coenzyme A (Sigma,
St. Louis, MO), and 250 mM Tris, pH 7.8, to a final volume
of 150 µl. The mixtures were incubated at 37 C for 2 h, and the
reactions were stopped by extraction with 1 ml ethyl acetate.
Acetylated and nonacetylated chloramphenicol were separated by TLC.
Nuclear Extract
Nuclear protein extracts from MA10, LTK-, and F9
cells were prepared according to Dignam et al. (27), whereas
nuclear extracts from tissues were prepared by a modified method of
Gorski et al. (28). Briefly, 0.51 g of tissue was minced
and homogenized in 10 ml homogenization buffer using a Teflon glass
homogenizer. The homogenate was layered over 3.2 ml of homogenization
buffer (10 mM HEPES, pH 7.3, 25 mM KCl, 0.15
mM spermine, 0.5 mM spermidine, 1
mM EDTA, 2 M sucrose, 2 µg/ml leupeptin, 2
µg/ml pepstatin A, 10% glycerol) and centrifuged in a SW40 rotor at
25,000 rpm for 30 min at -4 C. The pelleted nuclei were resuspended in
2 ml of nuclear lysis buffer (20 mM HEPES, pH 7.9, 420
mM NaCl, 1.5 mM MgCl2, 0.2
mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride,
0.5 mM dithiothreitol, 2 µg/ml leupeptin, 2 µg/ml
pepstatin A, 25% glycerol) and lysed using an all-glass Dounce
homogenizer. The lysate was mixed for 30 min at 4 C and then
centrifuged in a microcentrifuge at 12,000 rpm for 20 min at 4 C. The
supernatant was dialyzed several hours against dialysis buffer (20
mM HEPES, pH 7.9, 100 mM KCl, 0.2
mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride,
0.5 mM dithiothreitol, 2 µg/ml leupeptin, 2 µg/ml
pepstatin A, 20% glycerol), frozen in liquid nitrogen, and stored at
-70 C. The concentration of the nuclear proteins was measured by a
protein assay kit (Bio-Rad, Richmond, CA).
EMSA
From the sequence around the three footprinted regions F2, F3,
and F4, double-stranded DNA fragments were prepared by annealing of
complementary oligonucleotides. The sequences of the sense strands of
the double-stranded oligonucleotides were: SF-1/1:
5'-agcttTCCCGCCAAGGCCC-ATGG (-66/-49); SF-1/1 M:
5'-agcttTCCCGACAATTCC CATGG; SF-1/2:
5'-agcttACACAGCCCCTGACCGTGAC-TCG (-121/-99); SF-1/3: 5'-agctt
GACTTCAAGGTCCCAAGCTGGAC (-144/-122); N1: 5'-agcttCAAGCTGGACACACAG
CCCC (-131/-112). The SF-1/1 M has three nucleotide
substitutions in the consensus SF-1 binding site. The localization of
the oligonucleotides within the promoter sequence are given in
parentheses. Five nucleotides were added to the 5'-end of the synthetic
oligonucleotides to use for labeling reaction with Klenow fragment and
[
-32P]dCTP (Amersham). In each gel shift assay, 10
µg nuclear extract were preincubated in a 20 µl reaction mixture
containing 20 mM HEPES, pH 7.9, 0.5 mM EDTA, 25
mM KCl, 25 mM NaCl, 0.5 mM
dithiothreitol, 7% glycerol, and 24 µg
poly(deoxyinosinic-deoxycytidylic)acid. After 10 min, approximately
1 x 104 cpm of 32P-labeled probe was
added, and the incubation was continued for 20 min on ice, then loaded
onto 6% nondenaturing polyacrylamide gel. The gels were fixed in a
solution of 10% acetic acid and 30% methanol, dried, and exposed to
Hyperfilm-MP (Amersham). In competition assay, 100-fold excess of
unlabeled double-stranded oligonucleotide was incubated for 15 min
together with the nuclear extracts before addition of the
32P-labeled probe. For antibody cross-reaction, 1 µl of
anti-SF-1 antibody (16) or rabbit preserum was incubated with the
nuclear proteins for 30 min before addition of the
32P-labeled probe.
DNase I Footprinting
The DNA fragments used for DNase I footprint analysis of the Ley
I-L promoter were prepared from the p157-CAT construct by digestion of
the plasmid with either XbaI or HindIII to label
the coding and noncoding strand, respectively. Ends were filled in with
[
-32P]dCTP using the Klenow fragment of
Escherichia coli DNA polymerase I, and the fragments were
subsequently released by XbaI or HindIII
digestion as appropriate. In the binding reaction, 30100 µg MA10
nuclear extract and 5 x 104 cpm of
32P-labeled probe were used under the same conditions as in
EMSA in a total volume of 100 µl. The reactions were chilled on ice
for 20 min. After the concentration of CaCl2 had been
adjusted to 2.5 mM, DNase I (3 U) was added, and the
digestion was carried out at 20 C for 1 min. The reaction was
terminated by adding 90 µl of prewarmed (37 C) stop solution (20
mM Tris, pH 7.5, 20 mM EDTA, 0.4% SDS, 80
µg/ml proteinase K, 80 µg/ml yeast tRNA), and the probe was
extracted with phenol-chloroform-isoamylalcohol. The reaction products
were precipitated and analyzed on a 6% sequencing gel along with a
Maxam-Gilbert G+A sequencing reaction as a size marker.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
This work was supported by a grant from the Deutsche Forschungsgemeinschaft through SFB 271 (to I.M.A.).
Received for publication December 1, 1997. Revision received January 27, 1998. Accepted for publication January 30, 1998.
| REFERENCES |
|---|
|
|
|---|
-subunit
gene in pituitary gonadotropes. Mol Endocrinol 8:878885
This article has been cited by other articles:
![]() |
R. Ivell and R. Anand-Ivell Biology of insulin-like factor 3 in human reproduction Hum. Reprod. Update, July 1, 2009; 15(4): 463 - 476. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ventura, R. Manor, E. D. Aflalo, S. Weil, S. Raviv, L. Glazer, and A. Sagi Temporal Silencing of an Androgenic Gland-Specific Insulin-Like Gene Affecting Phenotypical Gender Differences and Spermatogenesis Endocrinology, March 1, 2009; 150(3): 1278 - 1286. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lague and J. J. Tremblay Antagonistic Effects of Testosterone and the Endocrine Disruptor Mono-(2-Ethylhexyl) Phthalate on INSL3 Transcription in Leydig Cells Endocrinology, September 1, 2008; 149(9): 4688 - 4694. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Cederroth, O. Schaad, P. Descombes, P. Chambon, J.-D. Vassalli, and S. Nef Estrogen Receptor {alpha} Is a Major Contributor to Estrogen-Mediated Fetal Testis Dysgenesis and Cryptorchidism Endocrinology, November 1, 2007; 148(11): 5507 - 5519. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Feng, N. V Bogatcheva, A. Truong, B. Korchin, C. E Bishop, T. Klonisch, I. U Agoulnik, and A. I Agoulnik Developmental Expression and Gene Regulation of Insulin-like 3 Receptor RXFP2 in Mouse Male Reproductive Organs Biol Reprod, October 1, 2007; 77(4): 671 - 680. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. De Rienzo, F. Aniello, M. Branno, G. Izzo, and S. Minucci The expression level of frog relaxin mRNA (fRLX), in the testis of Rana esculenta, is influenced by testosterone J. Exp. Biol., October 1, 2006; 209(19): 3806 - 3811. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Robert, L. J. Martin, and J. J. Tremblay The Orphan Nuclear Receptor NR4A1 Regulates Insulin-Like 3 Gene Transcription in Leydig Cells Biol Reprod, February 1, 2006; 74(2): 322 - 330. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Truong, N. V. Bogatcheva, C. Schelling, G. Dolf, and A. I. Agoulnik Isolation and Expression Analysis of the Canine Insulin-Like Factor 3 Gene Biol Reprod, November 1, 2003; 69(5): 1658 - 1664. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Klonisch, K. Steger, A. Kehlen, W. R. Allen, C. Froehlich, J. Kauffold, M. Bergmann, and S. Hombach-Klonisch INSL3 Ligand-Receptor System in the Equine Testis Biol Reprod, June 1, 2003; 68(6): 1975 - 1981. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ivell and S. Hartung The molecular basis of cryptorchidism Mol. Hum. Reprod., April 1, 2003; 9(4): 175 - 181. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ivell and R. A.D. Bathgate Reproductive Biology of the Relaxin-Like Factor (RLF/INSL3) Biol Reprod, September 1, 2002; 67(3): 699 - 705. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H.-C. Shen and H. A. Ingraham Regulation of the Orphan Nuclear Receptor Steroidogenic Factor 1 by Sox Proteins Mol. Endocrinol., March 1, 2002; 16(3): 529 - 540. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Koskimies, J. Levallet, P. Sipila, I. Huhtaniemi, and M. Poutanen Murine Relaxin-Like Factor Promoter: Functional Characterization and Regulation by Transcription Factors Steroidogenic Factor 1 and DAX-1 Endocrinology, March 1, 2002; 143(3): 909 - 919. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, D. C. Newton, T. L. Miller, A.-M. Teichert, M. J. Phillips, M. S. Davidoff, and P. A. Marsden An Alternative Promoter of the Human Neuronal Nitric Oxide Synthase Gene Is Expressed Specifically in Leydig Cells Am. J. Pathol., January 1, 2002; 160(1): 369 - 380. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. de Rienzo, F. Aniello, M. Branno, and S. Minucci Isolation and Characterization of a Novel Member of the Relaxin/Insulin Family from the Testis of the Frog Rana esculenta Endocrinology, July 1, 2001; 142(7): 3231 - 3238. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. J. Wang, B. Jeffs, M. Ito, J. C. Achermann, R. N. Yu, D. B. Hales, and J. L. Jameson Aromatase (Cyp19) expression is up-regulated by targeted disruption of Dax1 PNAS, June 20, 2001; (2001) 141543298. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. O'Donnell, K. M. Robertson, M. E. Jones, and E. R. Simpson Estrogen and Spermatogenesis Endocr. Rev., June 1, 2001; 22(3): 289 - 318. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Klonisch, J. Kauffold, K. Steger, M. Bergmann, R. Leiser, B. Fischer, and S. Hombach-Klonisch Canine Relaxin-Like Factor: Unique Molecular Structure and Differential Expression Within Reproductive Tissues of the Dog Biol Reprod, February 1, 2001; 64(2): 442 - 450. [Abstract] [Full Text] |
||||
![]() |
J. Levallet, P. Koskimies, N. Rahman, and I. Huhtaniemi The Promoter of Murine Follicle-Stimulating Hormone Receptor: Functional Characterization and Regulation by Transcription Factor Steroidogenic Factor 1 Mol. Endocrinol., January 1, 2001; 15(1): 80 - 92. [Abstract] [Full Text] |
||||
![]() |
D. Boerboom, N. Pilon, R. Behdjani, D. W. Silversides, and J. Sirois Expression and Regulation of Transcripts Encoding Two Members of the NR5A Nuclear Receptor Subfamily of Orphan Nuclear Receptors, Steroidogenic Factor-1 and NR5A2, in Equine Ovarian Cells during the Ovulatory Process Endocrinology, December 1, 2000; 141(12): 4647 - 4656. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tomboc, P. A. Lee, M. F. Mitwally, F. X. Schneck, M. Bellinger, and S. F. Witchel Insulin-like 3/Relaxin-Like Factor Gene Mutations Are Associated with Cryptorchidism J. Clin. Endocrinol. Metab., November 1, 2000; 85(11): 4013 - 4018. [Abstract] [Full Text] |
||||
![]() |
C. Krausz, L. Quintana-Murci, M. Fellous, J.-P. Siffroi, and K. McElreavey Absence of mutations involving the INSL3 gene in human idiopathic cryptorchidism Mol. Hum. Reprod., April 1, 2000; 6(4): 298 - 302. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Bullesbach and C. Schwabe Specific, High Affinity Relaxin-like Factor Receptors J. Biol. Chem., August 6, 1999; 274(32): 22354 - 22358. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Morohashi, H. Tsuboi-Asai, S. Matsushita, M. Suda, M. Nakashima, H. Sasano, Y. Hataba, C.-L. Li, J. Fukata, J. Irie, et al. Structural and Functional Abnormalities in the Spleen of an mFtz-F1 Gene-Disrupted Mouse Blood, March 1, 1999; 93(5): 1586 - 1594. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. d. S. Barbara, B. Moniot, F. Poulat, B. Boizet, and P. Berta Steroidogenic Factor-1 Regulates Transcription of the Human Anti-mullerian Hormone Receptor J. Biol. Chem., November 6, 1998; 273(45): 29654 - 29660. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. J. Wang, B. Jeffs, M. Ito, J. C. Achermann, R. N. Yu, D. B. Hales, and J. L. Jameson Aromatase (Cyp19) expression is up-regulated by targeted disruption of Dax1 PNAS, July 3, 2001; 98(14): 7988 - 7993. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |