| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
1b-Adrenoceptor with Green Fluorescent Protein
Department of Molecular and Cell Pharmacology National Children’s Medical Research Center Setagaya-ku, Tokyo, 154 Japan
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1b-adrenoceptor
tagged with the green fluorescent protein
(1bAR/GFP) can be used to determine the
molecular mechanism of internalization of
1bAR/GFP in living cells. In mouse T3
cells, 1bAR/GFP demonstrates strong, diffuse
fluorescence along the plasma membrane when observed by confocal laser
scanning microscope. The fluorescent receptor binds agonist and
antagonist and stimulates
phosphatidylinositol/Ca2+ signaling in a
similar fashion to the wild receptor. In addition,
1bAR/GFP can be internalized within minutes
when exposed to agonist, and the subcellular redistribution of this
receptor can be determined by measurement of endogenous fluorescence.
The phospholipase C inhibitor U73,122, the protein kinase C activator
PMA, and inhibitor staurosporine, and the
Ca2+-ATPase inhibitor thapsigargin were used to
examine the mechanism of agonist-promoted
1bAR/GFP redistribution. Agonist-promoted
internalization of 1bAR/GFP was closely
linked to phospholipase C activation and was dependent on protein
kinase C activation, but was independent of the increase in
intracellular free Ca2+ concentration. This
study demonstrated that real-time optical monitoring of the subcellular
localization of 1bAR (as well as other G
protein-coupled receptors) in living cells is feasible, and that this
may provide a valuable system for further study of the biochemical
mechanism(s) of agonist-induced receptor endocytosis. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1-Adrenoceptors (1ARs) play critical
roles in the regulation of a variety of physiological processes (1).
Considerable progress has been made toward a molecular description of
the structures and signal transduction mechanisms of
1ARs (2). The primary structure of cloned
1ARs corresponds to the predicted topographic model of
the superfamily of G protein-coupled receptors (GPCRs), and
substantial evidence indicates the importance of agonist and G
protein-regulated phospholipase C (PLC) for the generation of
phosphoinositide (PI)-derived second messengers for Ca2+
signaling in response to 1AR activation (2, 3, 4). The
convergence of recent pharmacological and molecular cloning studies has
revealed the presence of at least three subtypes of
1ARs, among which the 1bAR subtype was
the first to have its primary structure and is apparently prototypic of
the large family of Ca2+-mobilizing GPCRs.
Despite these important advances, much still remains unclear in our
understanding of regulation of 1AR function,
particularly regarding the disposition of the receptor in the cell
membrane and the influence of agonist on receptor distribution,
responsiveness, and metabolism. Although desensitization of
1AR responses by agonist has been reported, the kinetics
of these processes vary among different systems (5, 6, 7), and controversy
also exists over whether agonists cause sequestration of the receptor
from the extracellular surface (7, 8, 9). Furthermore, prolonged agonist
exposure has been reported to decrease total receptor number in some
(10, 11) but not all systems (5, 12). Attempts to study receptor
distribution at the subcellular level have been limited by the lack of
specific structural probes. In other systems, immunological approaches
have provided powerful tools for studying receptor localization and
organization at the cellular level (13, 14, 15). However, even this
technique has major limitations, including application in living cells,
nonstoichiometric labeling of receptors, the eventual dissociation of
the antibody from the receptor, and an inability to label intracellular
receptors in nonpermeabilized cells.
Green fluorescent protein (GFP) from the jellyfish Aequorea
victoria has been used as a reporter of gene expression and a
fusion tag to monitor protein localization within living cells
(16, 17, 18, 19). It has an inherent green bioluminescence that can be excited
optically by blue light or by nonradiative energy transfer (19, 20, 21),
and it stoichiometrically labels when integrated into cDNA as either an
amino- or a carboxyl-terminal fusion protein. Here, we report the
characterization of what seems to be a fully functional
carboxyl-terminal 1bAR/GFP fusion protein.
1bAR/GFP stably expressed in mouse T3 cells has
normal antagonist and agonist binding and activation of
Ca2+-mobilization and is sequestered (internalized) in
response to agonist stimulation. Furthermore, agonist-promoted
1bAR/GFP internalization can be readily monitored in
living cells and pharmacologically characterized. This study suggests
that 1bAR/GFP and other similarly conjugated GPCRs
should prove to be important tools for the optical measurement of
biochemical and biophysical processes that are relevant to GPCR signal
transduction.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1bAR and
1bAR/GFP
. Mouse T3 cells did not contain any
detectable
2-[ß-[4-hydroxy-3-[125I]iodo-4-hydroxyphenyl]-ethyl-aminomethyl]
tetralone ([125I]HEAT)-binding sites, and norepinephrine
(NE) (100 nM) did not elicit a response of intracellular
free Ca2+ concentration either before or after transfection
with the expression vector alone (data not shown). In contrast,
membrane preparations from T3 cells stably transfected with the
wild-type 1bAR genes or 1bAR/GFP genes
showed saturable bindings of [125I]HEAT (Table
1A). The saturation isotherms for both
receptors are nearly identical, as summarized in Table 1. The agonist-
and antagonist-binding characteristics of each receptor were likewise
similar (Table 1B). Pretreatment of the membrane preparation in
hypotonic buffer with 10 µM chloroethylclonidine (CEC)
for 30 min inactivated more than 95% of [125I]HEAT
binding sites in both cell lines.
|
|
1bAR and
1bAR/GFP was investigated by measuring their ability to
stimulate whole cell PLC (Fig. 2). Basal
levels of inositol triphosphate (IP3) production
were unaffected by the presence of the GFP, and the conjugated receptor
activated PLC as well. The EC50 values for PLC stimulation
by NE were similar: 53.4 ± 8.5 nM (n = 3) for
wild-type and 55.6 ± 5.3 nM (n = 3) for the
conjugate.
|
T3 cell stably
expressing wild-type 1bAR (Fig. 3B) and 1bAR/GFP (Fig. 3C); however, NE (100 nM) did not increase
[Ca2+]i in T3 cells transfected with only
GFP (Fig. 3A). Activation of endogenous PI-linked receptor GnRH
receptor by GnRH (100 nM) caused a rapid rise in
[Ca2+]i either in untransfected T3 cells
(data not shown) or in cells stably expressing 1bAR/GFP
(Fig. 3D). The effect of the PLC inhibitor U73,122 was also examined.
U73,122 (10 µM) did not cause any change in the basal
[Ca2+]i level. In both cell lines,
pretreatment with U73,122 (10 min) almost abolished the NE-induced
[Ca2+]i response, whereas an inactive analog,
U73,343, had no effect on the NE-induced
[Ca2+]i response (data not shown).
|
1bAR and
1bAR/GFP1bAR and 1bAR/GFP suggest
that their cellular distribution and trafficking might be similar. The
series of micrographs shown in Fig. 4
demonstrate that they have similar cellular distribution. We first
examined the cellular distribution of receptor using fluorescent
anti-1bAR antibody 1B-N1-C (Fig. 4, A–D) and also the
endogenous receptor GFP fluorescence (Fig. 4E) by the fluorescent
confocal microscopy. The immunocytochemical analysis with 1B-N1-C
showed that the fluorescence distribution of 1bAR is
typical of a plasma membrane-labeling pattern in T3 cells stably
transfected either with the wild-type 1bAR genes (fixed
cells, Fig. 4A; living cells, Fig. 4B) or 1bAR/GFP genes
(fixed cells, Fig. 4C; living cells, Fig. 4D). Furthermore, as shown in
Fig. 4F, the endogenous receptor fluorescence (Fig. 4E) was well
correlated with immunostaining (Fig. 4D) in living T3 cells stably
transfected with 1bAR/GFP genes, confirming a plasma
membrane-labeling pattern. No fluorescent signal was detected in
untransfected T3 cells, and the fluorescent signals were distributed
uniformly throughout whole cell in T3 cells transfected only with
the GFP gene (data not shown).
|
1bAR/GFP1bAR/GFP using this
experimental system. Figure 5 showed a
consecutive X-Y scan of a single T3 cell after the application of NE
(100 nM). The redistribution of GFP-associated fluorescent
signal became apparent about 8 min after the application of NE.
Redistribution reached a steady state at about 15 min, which lasted
unchanged until 60 min after application of NE. The time courses for
NE-induced subcellular distribution of the endogenous receptor GFP
fluorescence signal and immunofluorescent signal (expressed by a cell
surface localization ratio) are shown in Fig. 6. The internalization kinetics of
GFP-associated fluorescent signal and the immunofluorescent signal were
similar; however, consecutive monitoring could not be performed for
immunocytochemical analysis, since fluorescent dye became quickly
photobleached. On the other hand, GFP-associated fluorescent signal was
found to be bleach-resistant and could be consecutively monitored at
1-min intervals.
|
|
1bAR trafficking occurs by a
similar pathway, we further examined fluorescence colocalization of the
internalized receptors with Cy3-conjugated transferrin, a classic
endosomal marker. Confocal images obtained from control cells showed
that 1bAR/GFP is mainly localized to the cell surface
while transferrin receptors reside in internal vesicles (Fig. 7A). After 30 min of NE exposure, the
internalized 1bAR/GFP colocalizes with Cy3-conjugated
transferrin in endosomes (Fig. 7B). This result indicates that receptor
translocates to endosomes during agonist exposure. In addition,
agonist-induced receptor internalization was completely prevented by
pretreatment of cells with hyperosmotic sucrose solutions (0.45
M), a procedure that has been shown previously to inhibit
receptor-mediated endocytosis (23) (data not shown). In sum, these
results are consistent with an endocytic pathway of receptor
internalization.
|
Characterization of the Internalization of
1bAR/GFP
Without any stimulation (control), most of the GFP-associated
fluorescent signal was localized on plasma membrane (cell-surface
localization ratio = 0.98 ± 0.02, n = 6) (Fig. 8A). After 30 min of NE stimulation, this
ratio had decreased to 0.65 ± 0.12 (n = 6, Fig. 8B).
Pretreatment with -AR antagonist phentolamine (10 µM)
completely inhibited both the NE (100 nM)-induced
internalization of 1bAR/GFP (Fig. 8, C and D) and the
NE-stimulated increase in [Ca2+]i (data not
shown). In addition, the PLC inhibitor U73,122 (10 µM, 10
min) was found to inhibit both the NE-promoted internalization (Fig. 8, E and F) and NE-stimulated increase in
[Ca2+]i (data not shown).
|
1bAR/GFP (Fig. 8
, G and H). The protein kinase C (PKC) activator PMA (1
µM, 30 min) did not increase
[Ca2+]i, but did promote a redistribution of
1bAR/GFP in a similar fashion to NE stimulation (Fig. 8, I and J), although to a lesser extent. Staurosporine (10
µM, 10 min), which inhibits PKC activity, suppressed the
NE-mediated internalization of 1bAR/GFP (Fig. 8, K and
L). Furthermore, stimulation of endogenous PI-linked GnRH receptor by
GnRH (100 nM) was also found to cause internalization of
1bAR/GFP (Fig. 8, M and N). The internalization of
GFP-associated fluorescent intensity promoted by the various
pharmacological treatments is summarized in Fig. 9.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1bAR/GFP fusion protein has enabled us to
visualize 1bAR with subcellular resolution in live cells
and to pharmacologically characterize mechanisms of agonist-induced
receptor internalization. Our data demonstrate that the ligand binding,
signal-coupling properties, cellular distribution, and trafficking
behavior of 1bAR/GFP closely resemble those of the
wild-type 1bAR. In mouse T3 cells, the fluorescence
distribution of 1bAR/GFP is characteristic of a plasma
membrane-labeling pattern, and the application of agonist promoted the
internalization of 1bAR/GFP. The second messenger
mechanism for this internalization was pharmacologically determined by
using this optical experimental system. NE-promoted internalization of
1bAR/GFP was blocked by the 1AR
antagonist phentolamine and by the PLC inhibitor U73,122. The
agonist-induced internalization was mimicked either by activation of
PLC through endogenous PI-linked GnRH receptor (24) or by stimulation
of PKC with PMA, but not by a simple rise in
[Ca2+]i with thapsigargin. Furthermore, the
PKC inhibitor staurosporine blocked the NE-induced internalization.
Taken together, NE-promoted internalization of 1bAR/GFP
appears to be closely linked to PLC activation and dependent on PKC
activation in particular. Our present results, which were obtained by
real-time optical monitoring of subcellular localization in living
cells, are in good agreement with previous observations made by
cell-free biochemical assay (9) or by immunohistochemical analysis of
fixed cells (14).
GFP is now widely used to monitor intracellular localization of
proteins in intact cells. However, its size (238 amino acids) (25) in
comparison with the overall size of the 1bAR protein
(515 amino acids) (3) and other GPCRs (26, 27) makes it an unlikely
candidate for the formation of a functional GPCR/GFP fusion protein.
Both the present study and recent work with ß2-AR (28),
however, suggest that the GFP adduct does not significantly change the
inherent physical or biochemical behavior of GPCR and that optical
methods can be generally useful even for GPCRs. Optical studies in
cultured cells, of 1bAR in particular and of GPCRs in
general, are difficult due to the small number of membrane receptors
expressed. Thus, GPCRs produce only marginal signals when tagged with
fluorophores or labeled with fluorescent agonists or antagonists, a
procedure that often modifies the behavior of these compounds (29). In
addition, the introduction of foreign epitopes into receptor cDNA is
now a standard technique used to enhance detection, permitting antibody
recognition of 1AR (30) and other GPCRs in flow
cytometry or fluorescence microscopy (31). However, even this technique
has major limitations, including its applicability to living cells,
nonstoichiometric labeling of receptors, the eventual dissociation of
the antibody from the receptor, and an inability to label intracellular
receptors in nonpermeabilized cells. An ideally labeled receptor should
be relatively unperturbed by its fluorescent tag, exhibit little or no
change in its biochemical or biophysical behavior, have a large
fluorescence signal above background when excited by visible light in
addition to being photostable, and be stoichiometrically labeled. As
shown in this report, the observed behavior of
1bAR/GFP indicates that 1bAR/GFP and
other similarly conjugated GPCRs should be important tools both
in vitro and in vivo for the optical measurement
of biochemical and biophysical processes that are relevant to GPCR
signal transduction.
We observed a relatively minor degree (
35%) of internalization of
the 1bAR by the fluorescence detection method using GFP
and the fluorescent anti-1bAR antibody, compared with
the internalization observed by the use of other GPCRs such as
ß-adrenoceptor (32). However, the internalization of
1bAR/GFP, which was observed by optical monitoring of
the fluorescence signal in living cells, is in good agreement with
previous observations that were made using radioligand-binding assay on
membrane preparations (32, 33). Thus, both the time course and the
extent of 1bAR internalization after exposure to high
concentrations of an 1AR agonist are similar to that
found in previous studies that employed DDT1 MF-2 cells,
which express 1bAR naturally (33). Therefore, we
considered that, in general, the agonist-promoted internalization of
the 1bAR may not be as marked compared with that
promoted by other GPCRs. The reason for this relatively minor degree of
internalization of the 1bAR is not clear.
Furthermore, our data showed that agonist-promoted internalization of
1bAR/GFP appears to be closely linked to PLC activation
and is dependent on PKC activation, but independent of
[Ca2+]i increase. At present, the signals
controlling 1bAR internalization are not well known
because of the lack of specific structural probes for the receptor
in vivo. Using measurement of radioligand binding to assess
receptor redistribution in Chinese hamster ovary cells transfected with
receptor cDNA, Toews (12) reported that agonist or PMA
stimulation causes receptor internalization, which is blocked by
staurosporine. In addition, a recent immunohistochemical study by
Fonseca et al. (14) suggested that PKC-dependent
phosphorylation resulting from 1AR stimulation induces
receptor internalization. Our data obtained from real-time optical
monitoring of 1bAR/GFP are generally in good agreement
with these studies; moreover, we observed that not only homologous
stimulation (by NE) but also heterologous stimulation (by GnRH) of PLC,
and eventually PKC, resulted in the internalization of
1bAR, although the latter process appeared to be less
potent. Thus, phosphorylation of 1bAR by PKC clearly
plays an important role in the desensitization (7, 14) and
internalization of 1bAR.
In conclusion, this study demonstrates that real-time optical
monitoring of subcellular localization of 1bAR (as well
as other GPCRs) on living cells are feasible, and that this approach
combined with appropriate pharmacological tools would provide a
valuable system to further study the biochemical mechanism(s) of
agonist-induced receptor endocytosis.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
) were constructed on SR
promoter-based mammalian expression vector pME18S (34). The cDNA
for the hamster 1b-adrenoceptor (3) was the kind gift of
Dr. Susanna Cotecchia (Institute de Pharmacologie et Toxicologie,
Lausanne, Switzerland). To generate the 1bAR/GFP
construct, the coding region of GFP mutant S65T (20) (the kind gift of
Dr. H. Takahashi, Mitsubishi Kasei Inst. Life Sciences) was
amplified by primer 1(aaagggcccatgagtaaaggagaagaacttttc) and primer 2
(aaaactagttttgtatagttcatccatggc), which produced a 5'-ApaI
site for ligation. The 1bAR expression vector
pME-1b (35) was digested by ApaI and
XbaI. Both enzyme-digested products were ligated to obtain a
construct designated pME-1bAR/GFP. The modified region
of these construct was confirmed by sequencing with an ABI 373A DNA
sequencer (Applied Biosystems Inc., Foster City, CA). We chose the
ApaI site in the carboxyl terminus for the GFP to be
integrated because the region distal to the ApaI site varies
in 1aAR splice variants with similar pharmacological
properties (36), and deletion of the region in 1bAR was
shown not to affect the binding and signal transduction properties
(37). All experiments were performed with wild-type receptors in
parallel whenever possible.
Transfection and Selection of Stably Expressing Cells
T3 cells were maintained in DMEM with 10% FBS. The
constructs, pME18S-1b and pME-1bAR/GFP,
were transfected into T3 cells by Lipofectin (GIBCO, Life
Technologies, Gaithersburg, MD) according to manufacturer’s
instructions. Using a cell sorter (FACsort, Becton Dickinson & Co.,
Mountain View, CA), we selected and enriched anti-N terminus
antibody-positive and/or GFP-positive cells at 72 h, 1 week, and 2
months after transfection.
[125I]HEAT Binding Assay
Crude particulate membrane fractions were collected from T3
stable cells as described previously (38). Briefly, the harvested cells
were pelleted by centrifugation at 500 x g for 5 min
and washed, and the pellet was homogenized in 2 ml ice-cold buffer A
(250 mM sucrose, 5 mM Tris-HCl, 1
mM MgCl2, pH 7.4) and centrifuged at 1,000
x g at 4 C for 10 min to remove nuclei. The supernatant was
then centrifuged at 35,000 x g for 20 min at 4 C, the
pellet was homogenized, and the homogenates were resuspended in buffer
B (50 mM Tris-HCl, 10 mM MgCl2, 10
mM EGTA, pH 7.4) to a final protein concentration of 0.1
mg/ml. The protein concentration was measured using the bicinchoninic
acid protein assay kit (Pierce Chemical Co., Rockford, IL).
Radioligand binding with [125I]HEAT studies was performed
as described previously (35, 38, 39). Briefly, measurement of specific
[125I]HEAT binding was performed by incubating 0.1 ml of
membrane preparation (30 µg of protein) with
[125I]HEAT (2,200 Ci/mmol) in a final volume of 0.15 ml
buffer B for 60 min at 25 C in the presence or absence of competing
drugs. The incubation was terminated by adding ice-cold buffer B and
immediately filtering through Whatmann GF/C glass-fiber filters with a
Brandel cell harvester (model 30, Gaithersburg, MD). Each filter
was collected, and the radioactivity was measured. Binding assays were
always performed in duplicate. For competition curve analysis, each
assay contained about 70 pM [125I]HEAT. At
this concentration, nonspecific binding, defined as binding displaced
by 10 mM phentolamine, represented less than 40% of the
total binding. Data were analyzed by computer with an iterative
nonlinear regression program LIGAND (40).
In some experiments with CEC treatment, the membrane preparation was incubated in a 1 ml volume of hypotonic buffer (5 mM Tris-HCl, 5 mM EDTA, pH 7.6) with CEC (100 µM) for 30 min at 37 C, after which the reactions were stopped by adding 16 ml ice-cold buffer, and centrifuged at 35,000 x g for 20 min at 4 C. The membrane was washed two times and resuspended in buffer B and used for the binding assay.
Measurement of Inositol-1,4,5-Triphosphate
[Ins(1, 4, 5)P3]
A portion (106) of the suspended T3 cells
treated with NE (1 nM-10 µM) for 5 sec
were immediately added by 0.2 volume of ice-cold 20% perchloric acid.
After centrifugation, the supernatant was adjusted to pH 7.0 using
HEPES-KOH solution, and the sediment was eliminated by centrifugation.
Amounts of Ins(1, 4, 5)P3 in a sample were measured by a RRA
with a D-myo-inositol 1,4,5-triphosphate [3H]
assay kit, TRK 1000 (Amersham, Buckinghamshire, U.K.). Values of
Ins(1, 4, 5)P3 were expressed as picomoles/106 of
T3 cells.
Antibody Preparation
Generation of an antipeptide antibody (designated as 1B-N1-C)
was described previously (41). Briefly, peptide was synthesized
corresponding to amino acids 12–27 (peptide: 1B-N1;
(C)SAPAQWGELKDANFTG) of the published hamster 1bAR
sequence (3), conjugated to the carrier protein keyhole limpet
hemocyanin and injected to rabbits. Antisera were screened against the
peptides by using cross-dot systems (Sebia, Moulineaux, France) and
visualized by ABC system (Vector Laboratories, Burlingame, CA). By
immunoblotting and immunoprecipitation studies, we confirmed that the
antibodies detect the 1bAR (41).
Antiserum was purified on 1 ml of protein A-Sepharose CL-4B column (Pharmacia Biotech, Tokyo, Japan) equilibrated with 20 mM phosphate buffer, pH 7.5, and eluted with glycine-HCl buffer (100 mM, pH 2.2), into 1-ml fractions, which were immediately neutralized with 1 M Tris-HCl buffer, pH 8.5. The resulting antibody fractions were concentrated by a Centricon 30 microconcentrator (Amicon, Danvers, MA) and stored at -20 C. Antibody was labeled by Cy3 (Amersham) according to the protocol of Southwick et al. (42) and used for immunocytochemical analysis.
Confocal Laser Scanning Microscope Analysis
Immunofluorescence Detection (Fixed Cells)
T3 cells stably expressing wild-type 1bAR and
1bAR/GFP were seeded at 1 x 105 per
well of the eight-well Lab-Tek chamber slide (Nunc, Napervile, IL) in
0.5 ml medium. Fixation was performed in 80% acetone for 5 min. Cells
were then incubated with 0.05% Triton X-100 in PBS. Cy3-conjugated,
affinity-purified anti-1bAR antibody [5 µg/ml,
1B-N1-C, (41)], was brought in PBS containing 10% goat serum
and 0.05% Triton X-100, and applied to cells, which were subsequently
kept in a humidified chamber for 1 h at room temperature. Cells
were then washed twice with PBS, and coverslips were applied using
Gel/Mount (Biomeda, Foster City, CA).
Immunofluorescence Detection (Living Cells)
For immunocytochemical staining of living cells, T3 cells stably
expressing wild-type 1bAR and 1bAR/GFP
were washed three times with Tyrode solution (135.0 mM
NaCl, 5.4 mM KCl, 0.33 mM
NaH2PO4, 5.0 mM HEPES, 0.5
mM MgCl2, 5.55 mM glucose, 1.25
mM CaCl2, pH 7.4), and incubated with ice-cold
Tyrode solution containing 1 µg/ml of the Cy3-labeled antibody for 30
min at 4 C, after which the cells were washed three times with ice-cold
Tyrode solution.
After immunocytochemical staining, cells were examined by using LSM-GB200 laser scanning microscope (Olympus, Tokyo, Japan) with argon-ion laser set at 514 nm for excitation of Cy3.
GFP Detection
T3 cells stably expressing wild-type 1bAR and
1bAR/GFP were seeded at 1 x 105 per
well of the cover glass-bottom culture dish (MatTek Corp., Ashland, MA)
in 2.0 ml of medium and examined using LSM-GB200 within 30 min at room
temperature.
Labeling of Cells with Cy3-Transferrin
Transferrin was labeled by Cy3 (Amersham) according to manufacturer’s
instructions. T3 cells stably expressing 1bAR/GFP in
35-mm dishes were rinsed three times with serum-free DMEM and incubated
for 12 h with Cy3-transferrin. At the termination of labeling, the
cells were again rinsed three times with warm serum-free DMEM and
examined by using LSM-GB200 laser scanning microscope (Olympus) with
argon-ion laser set at 514 nm for excitation of Cy3.
Monitoring of
[Ca2+]i
and Subcellular Distribution of
1bAR/GFP
Changes in [Ca2+]i as well as the
distribution of fluorescent signal were monitored by GB-200 confocal
laser scanning microscope (Olympus). The fluorescence intensity
change of intracellularly loaded Fura Red was used to estimate the
[Ca2+]i change upon stimulation. T3 cells
stably expressing wild-type 1bAR and
1bAR/GFP cultured in a cover glass-bottom culture dish
(MatTek Corp.) were incubated with 0.5 µM Fura Red
tetrakisacetoxymethyl ester (Fura Red/AM) dissolved in Tyrode solution
containing 0.1% BSA for 30 min at 37 C. After the cells were washed
twice with Tyrode solution, changes in
[Ca2+]i were monitored with a sample interval
of 10 sec in Tyrode solution containing yohimbine 100 nM
and propranolol 100 nM. The argon laser beam (wavelength
488 nm) was focused with a water-immersion objective lens (Olympus UV
ApoLSM 40x). Fluorescent signals were split with a dichroic mirror
(550 nm), and change in fluorescence was measured through interference
filters of 590-nm highcut filter and 500- to 530-nm bandpass filter for
monitoring of [Ca2+]i and subcellular
distribution of 1bAR/GFP, respectively. Three frames
before the stimulation were averaged pixel by pixel to obtain resting
fluorescence (F0). The resting frame was then divided by
each frame in a pixel-by-pixel basis, and the normalized fluorescence
intensity value (Ft) was used to estimate the
[Ca2+]i change upon stimulation. We did not
convert the fluorescence intensity change to absolute values of
[Ca2+]i because it was difficult to
unambiguously determine the background fluorescence intensity and the
resting [Ca2+]i, both of which are required
for [Ca2+]i determination using
nonratiometric dyes.
Fluorescence Measurements
Confocal images were digitally acquired into two-dimensional arrays of
picture elements (pixels). Each pixel is a square with a width of 0.1
µm and assigned an intensity value ranging from 0 (black) to 255
(white). Cellular edges in each image were outlined manually, and the
intensity value of each pixel within the outlined area was measured.
The sum of the intensity value within the outlined area was considered
as the total cellular fluorescence intensity, while the sum of the
intensity value within 0.5 µm (5 pixel) depth from the cellular edge
was considered as fluorescence signal localized on plasma membrane.
Image analysis were performed using IPLab software (Signal Analytics
Corp., Vienna, VA). The subcellular distribution of Cy3- or
GFP-associated fluorescence was expressed by a cell surface
localization ratio: the fluorescent signal localized on plasma membrane
divided by the total cellular fluorescence intensity. To quantify the
effect that various pharmacological agents have on
1bAR/GFP redistribution, cells were chosen randomly in
each experiment, and one image was obtained from each dish of each
individual experiments (Fig. 9). Each image contains, on average, three
to seven cells, and all cells in the images were analyzed for
quantification. At least six independent experiments were performed for
each treatment.
Materials
Hamster 1bAR cDNA was a kind gift of Drs.
S. Cotecchia and R. J. Lefkowitz (Duke University Medical Center,
Durham, NC) (3). The following drugs were used:
[125I]HEAT (specific activity 2,200 Ci/mmol) (New England
Nuclear, Boston, MA); KMD-3213 dihydrobromide,
((-)-(R)-1-(3-hydroxypropyl)-5-[2-[2-[2-(2, 2, 2-trifluoroethoxy)
phenoxy]ethylamino]propyl] indoline-7-carboxamide dihydrobromide)
(Kissei Pharmaceutical Co., Matsumoto, Japan); phentolamine
hydrochloride (ClBA-Geigy, Summit, NJ); GnRH (Tanabe, Osaka, Japan);
prazosin hydrochloride (Pfizer, Groton, CT); yohimbine HCl (Wako Pure
Chemical Industries, Ltd., Osaka, Japan); CEC and 5-methylurapidil
(Research Biochemicals, Natick, MA); (-)-norepinephrine bitartrate
(Sigma, St. Louis, MO); lipofectin (GIBCO, Life Technologies,
Gaithersburg, MD); Fura Red/acetoxymethyl ester (Fura Red/AM)
(Molecular Probes, Eugene, OR); Triton X-100 (Wako Pure Chemical
Industries, Osaka, Japan); U73,122,
1-[6-[[17ß-3-methoxyestra-1,3,5(10)-trien-17-yl]amino]hexyl]-1H-pyrrole-2,5-dione;
U73,343,
1-[6-[[17ß-3-methoxyestra-1,3,5(10)-trien-17-yl]amino]hexyl]-2,5-pyrrolidine-dione;
Cy3 (Amersham); transferrin (Sigma). All other chemicals were of
reagent grade.
Statistics
ANOVA was performed and when a statistical difference was
detected, a Dunnett’s multiple comparison test was used to determine
the difference between groups. All data are presented as the mean
± SD, and the statistically significant difference was
determined at the P < 0.05 level unless otherwise
stated.
|
ACKNOWLEDGMENTS |
|---|
1bAR and to Dr.
Stojilkovic (National Institutes of Health, Bethesda, MD) for mouse
T3 cells. We also thank Dr. Thomson (International Medical
Information Center, Tokyo, Japan) for the language editing. |
FOOTNOTES |
|---|
Received for publication May 1, 1997. Revision received March 6, 1998. Accepted for publication April 20, 1998.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
This article has been cited by other articles:
 |
|
 |
|
  B. D. Schlag, Z. Lou, M. Fennell, and J. Dunlop Ligand Dependency of 5-Hydroxytryptamine 2C Receptor Internalization J. Pharmacol. Exp. Ther., September 1, 2004; 310(3): 865 - 870. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Miyamoto, J. Yamauchi, N. Mizuno, and H. Itoh The Adaptor Protein Nck1 Mediates Endothelin A Receptor-regulated Cell Migration through the Cdc42-dependent c-Jun N-terminal Kinase Pathway J. Biol. Chem., August 13, 2004; 279(33): 34336 - 34342. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Chalothorn, D. F. McCune, S. E. Edelmann, M. L. Garcia-Cazarin, G. Tsujimoto, and M. T. Piascik Differences in the Cellular Localization and Agonist-Mediated Internalization Properties of the alpha 1-Adrenoceptor Subtypes Mol. Pharmacol., May 1, 2002; 61(5): 1008 - 1016. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wang, L. Wang, J. L. Anderson, N. A. Schulte, and M. L. Toews Regulatory Properties of alpha 1B-Adrenergic Receptors Defective in Coupling to Phosphoinositide Hydrolysis J. Pharmacol. Exp. Ther., January 1, 2002; 300(1): 134 - 141. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Miserey-Lenkei, Z. Lenkei, C. Parnot, P. Corvol, and E. Clauser A Functional Enhanced Green Fluorescent Protein (EGFP)-Tagged Angiotensin II AT1A Receptor Recruits the Endogenous G{{alpha}}q/11 Protein to the Membrane and Induces Its Specific Internalization Independently of Receptor- G Protein Coupling in HEK-293 Cells Mol. Endocrinol., February 1, 2001; 15(2): 294 - 307. [Abstract] [Full Text]
|
|
|
|
 |
|
 Z. Lenkei, A. Beaudet, N. Chartrel, N. De Mota, T. Irinopoulou, B. Braun, H. Vaudry, and C. Llorens-Cortes A Highly Sensitive Quantitative Cytosensor Technique for the Identification of Receptor Ligands in Tissue Extracts J. Histochem. Cytochem., November 1, 2000; 48(11): 1553 - 1564. [Abstract] [Full Text]
|
|
|
|
 |
|
 R. Chen, Y. V. Mukhin, M. N. Garnovskaya, T. E. Thielen, Y. Iijima, C. Huang, J. R. Raymond, M. E. Ullian, and R. V. Paul A functional angiotensin II receptor-GFP fusion protein: evidence for agonist-dependent nuclear translocation Am J Physiol Renal Physiol, September 1, 2000; 279(3): F440 - F448. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Stevens, N. Bevan, S. Rees, and G. Milligan Resolution of Inverse Agonist-Induced Up-Regulation from Constitutive Activity of Mutants of the alpha 1b-Adrenoceptor Mol. Pharmacol., August 1, 2000; 58(2): 438 - 448. [Abstract] [Full Text]
|
|
|
|
|
|
D. F. McCune, S. E. Edelmann, J. R. Olges, G. R. Post, B. A. Waldrop, D. J. J. Waugh, D. M. Perez, and M. T. Piascik Regulation of the Cellular Localization and Signaling Properties of the alpha 1B- and alpha 1D-Adrenoceptors by Agonists and Inverse Agonists Mol. Pharmacol., April 1, 2000; 57(4): 659 - 666. [Abstract] [Full Text]
|
|
|
|
|
|
A. J. McLean, N. Bevan, S. Rees, and G. Milligan Visualizing Differences in Ligand Regulation of Wild-Type and Constitutively Active Mutant beta 2-Adrenoceptor-Green Fluorescent Protein Fusion Proteins Mol. Pharmacol., December 1, 1999; 56(6): 1182 - 1191. [Abstract] [Full Text]
|
|
|
|
|
|
S. L. Ferrari, V. Behar, M. Chorev, M. Rosenblatt, and A. Bisello Endocytosis of Ligand-Human Parathyroid Hormone Receptor 1 Complexes Is Protein Kinase C-dependent and Involves beta -Arrestin2. REAL-TIME MONITORING BY FLUORESCENCE MICROSCOPY J. Biol. Chem., October 15, 1999; 274(42): 29968 - 29975. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Xu, A. Hirasawa, H. Shinoura, and G. Tsujimoto Interaction of the alpha 1B-Adrenergic Receptor with gC1q-R, a Multifunctional Protein J. Biol. Chem., July 23, 1999; 274(30): 21149 - 21154. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Berrada, C. L. Plesnicher, X. Luo, and M. Thibonnier Dynamic Interaction of Human Vasopressin/Oxytocin Receptor Subtypes with G Protein-coupled Receptor Kinases and Protein Kinase C after Agonist Stimulation J. Biol. Chem., August 25, 2000; 275(35): 27229 - 27237. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
)
and 
