help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Awaji, T.
Right arrow Articles by Tsujimoto, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Awaji, T.
Right arrow Articles by Tsujimoto, G.
Molecular Endocrinology 12 (8): 1099-1111
Copyright © 1998 by The Endocrine Society

Real-Time Optical Monitoring of Ligand-Mediated Internalization of {alpha}1b-Adrenoceptor with Green Fluorescent Protein

Takeo Awaji, Akira Hirasawa, Masakazu Kataoka, Hitomi Shinoura, Yasuhisa Nakayama, Tatsuo Sugawara, Shun-ichiro Izumi and Gozoh Tsujimoto

Department of Molecular and Cell Pharmacology National Children’s Medical Research Center Setagaya-ku, Tokyo, 154 Japan


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The study of G protein-coupled receptor signal transduction and behavior in living cells is technically difficult because of a lack of useful biological reagents. We show here that a fully functional {alpha}1b-adrenoceptor tagged with the green fluorescent protein ({alpha}1bAR/GFP) can be used to determine the molecular mechanism of internalization of {alpha}1bAR/GFP in living cells. In mouse {alpha}T3 cells, {alpha}1bAR/GFP demonstrates strong, diffuse fluorescence along the plasma membrane when observed by confocal laser scanning microscope. The fluorescent receptor binds agonist and antagonist and stimulates phosphatidylinositol/Ca2+ signaling in a similar fashion to the wild receptor. In addition, {alpha}1bAR/GFP can be internalized within minutes when exposed to agonist, and the subcellular redistribution of this receptor can be determined by measurement of endogenous fluorescence. The phospholipase C inhibitor U73,122, the protein kinase C activator PMA, and inhibitor staurosporine, and the Ca2+-ATPase inhibitor thapsigargin were used to examine the mechanism of agonist-promoted {alpha}1bAR/GFP redistribution. Agonist-promoted internalization of {alpha}1bAR/GFP was closely linked to phospholipase C activation and was dependent on protein kinase C activation, but was independent of the increase in intracellular free Ca2+ concentration. This study demonstrated that real-time optical monitoring of the subcellular localization of {alpha}1bAR (as well as other G protein-coupled receptors) in living cells is feasible, and that this may provide a valuable system for further study of the biochemical mechanism(s) of agonist-induced receptor endocytosis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
{alpha}1-Adrenoceptors ({alpha}1ARs) play critical roles in the regulation of a variety of physiological processes (1). Considerable progress has been made toward a molecular description of the structures and signal transduction mechanisms of {alpha}1ARs (2). The primary structure of cloned {alpha}1ARs corresponds to the predicted topographic model of the superfamily of G protein-coupled receptors (GPCRs), and substantial evidence indicates the importance of agonist and G protein-regulated phospholipase C (PLC) for the generation of phosphoinositide (PI)-derived second messengers for Ca2+ signaling in response to {alpha}1AR activation (2, 3, 4). The convergence of recent pharmacological and molecular cloning studies has revealed the presence of at least three subtypes of {alpha}1ARs, among which the {alpha}1bAR subtype was the first to have its primary structure and is apparently prototypic of the large family of Ca2+-mobilizing GPCRs.

Despite these important advances, much still remains unclear in our understanding of regulation of {alpha}1AR function, particularly regarding the disposition of the receptor in the cell membrane and the influence of agonist on receptor distribution, responsiveness, and metabolism. Although desensitization of {alpha}1AR responses by agonist has been reported, the kinetics of these processes vary among different systems (5, 6, 7), and controversy also exists over whether agonists cause sequestration of the receptor from the extracellular surface (7, 8, 9). Furthermore, prolonged agonist exposure has been reported to decrease total receptor number in some (10, 11) but not all systems (5, 12). Attempts to study receptor distribution at the subcellular level have been limited by the lack of specific structural probes. In other systems, immunological approaches have provided powerful tools for studying receptor localization and organization at the cellular level (13, 14, 15). However, even this technique has major limitations, including application in living cells, nonstoichiometric labeling of receptors, the eventual dissociation of the antibody from the receptor, and an inability to label intracellular receptors in nonpermeabilized cells.

Green fluorescent protein (GFP) from the jellyfish Aequorea victoria has been used as a reporter of gene expression and a fusion tag to monitor protein localization within living cells (16, 17, 18, 19). It has an inherent green bioluminescence that can be excited optically by blue light or by nonradiative energy transfer (19, 20, 21), and it stoichiometrically labels when integrated into cDNA as either an amino- or a carboxyl-terminal fusion protein. Here, we report the characterization of what seems to be a fully functional carboxyl-terminal {alpha}1bAR/GFP fusion protein. {alpha}1bAR/GFP stably expressed in mouse {alpha}T3 cells has normal antagonist and agonist binding and activation of Ca2+-mobilization and is sequestered (internalized) in response to agonist stimulation. Furthermore, agonist-promoted {alpha}1bAR/GFP internalization can be readily monitored in living cells and pharmacologically characterized. This study suggests that {alpha}1bAR/GFP and other similarly conjugated GPCRs should prove to be important tools for the optical measurement of biochemical and biophysical processes that are relevant to GPCR signal transduction.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Pharmacological Comparison of Wild-Type {alpha}1bAR and {alpha}1bAR/GFP
Expression constructs used in the present study are shown in Fig. 1Go. Mouse {alpha}T3 cells did not contain any detectable 2-[ß-[4-hydroxy-3-[125I]iodo-4-hydroxyphenyl]-ethyl-aminomethyl] tetralone ([125I]HEAT)-binding sites, and norepinephrine (NE) (100 nM) did not elicit a response of intracellular free Ca2+ concentration either before or after transfection with the expression vector alone (data not shown). In contrast, membrane preparations from {alpha}T3 cells stably transfected with the wild-type {alpha}1bAR genes or {alpha}1bAR/GFP genes showed saturable bindings of [125I]HEAT (Table 1A). The saturation isotherms for both receptors are nearly identical, as summarized in Table 1Go. The agonist- and antagonist-binding characteristics of each receptor were likewise similar (Table 1B). Pretreatment of the membrane preparation in hypotonic buffer with 10 µM chloroethylclonidine (CEC) for 30 min inactivated more than 95% of [125I]HEAT binding sites in both cell lines.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Constructs for Wild-Type and GFP-Fused {alpha}1bARs

As described in Materials and Methods, we constructed GFP-fused {alpha}1bAR. Dashed boxes are the putative membrane-spanning domains. Black boxes are the epitope regions for antipeptide antibodies. The amino acid compositions of the epitope regions for antipeptide antibodies and those across the fusion point are also shown in the figure.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of Wild-Type {alpha}1bAR and {alpha}1bAR/GFP Ligand Binding

 
The coupling to G protein of the wild-type {alpha}1bAR and {alpha}1bAR/GFP was investigated by measuring their ability to stimulate whole cell PLC (Fig. 2Go). Basal levels of inositol triphosphate (IP3) production were unaffected by the presence of the GFP, and the conjugated receptor activated PLC as well. The EC50 values for PLC stimulation by NE were similar: 53.4 ± 8.5 nM (n = 3) for wild-type and 55.6 ± 5.3 nM (n = 3) for the conjugate.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Concentration-Dependent IP3 Production by NE in {alpha}T3 Cells Transfected with Wild-Type {alpha}1bAR or {alpha}1bAR/GFP

Both {alpha}T3 cells stably expressing wild-type {alpha}1bAR ({circ}) and {alpha}1bAR/GFP (•) were stimulated by NE for 5 sec, after which IP3 produced was measured as described in Materials and Methods. Value are given as mean ± SD of three independent experiments, which were performed in duplicate.

 
The effects of NE on the elevation of [Ca2+]i were also compared. NE (100 nM) caused a rapid increase in [Ca2+]i in a single {alpha}T3 cell stably expressing wild-type {alpha}1bAR (Fig. 3BGo) and {alpha}1bAR/GFP (Fig. 3CGo); however, NE (100 nM) did not increase [Ca2+]i in {alpha}T3 cells transfected with only GFP (Fig. 3AGo). Activation of endogenous PI-linked receptor GnRH receptor by GnRH (100 nM) caused a rapid rise in [Ca2+]i either in untransfected {alpha}T3 cells (data not shown) or in cells stably expressing {alpha}1bAR/GFP (Fig. 3DGo). The effect of the PLC inhibitor U73,122 was also examined. U73,122 (10 µM) did not cause any change in the basal [Ca2+]i level. In both cell lines, pretreatment with U73,122 (10 min) almost abolished the NE-induced [Ca2+]i response, whereas an inactive analog, U73,343, had no effect on the NE-induced [Ca2+]i response (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Agonist-Mediated [Ca2+]i Response in {alpha}T3 Cells Transfected with GFP, Wild-Type {alpha}1bAR, or {alpha}1bAR/GFP

Cells were loaded with Fura Red/AM as described in Materials and Methods. Application of NE (100 nM) caused no detectable change in [Ca2+]i in GFP transfected cells (A), while it caused a rapid increase in [Ca2+]i in {alpha}T3 cells stably expressing wild-type {alpha}1bAR (B) and {alpha}1bAR/GFP (C), respectively. Application of GnRH (100 nM) caused a rapid increase in [Ca2+]i both in {alpha}T3 cells stably expressing the {alpha}1bAR/GFP (D) and in nontransfected {alpha}T3 cells (data not shown). The results presented are representative of at least three similar experiments.

 
Localization of {alpha}1bAR and {alpha}1bAR/GFP
The similar pharmacological and biochemical properties exhibited by wild-type {alpha}1bAR and {alpha}1bAR/GFP suggest that their cellular distribution and trafficking might be similar. The series of micrographs shown in Fig. 4Go demonstrate that they have similar cellular distribution. We first examined the cellular distribution of receptor using fluorescent anti-{alpha}1bAR antibody 1B-N1-C (Fig. 4Go, A–D) and also the endogenous receptor GFP fluorescence (Fig. 4EGo) by the fluorescent confocal microscopy. The immunocytochemical analysis with 1B-N1-C showed that the fluorescence distribution of {alpha}1bAR is typical of a plasma membrane-labeling pattern in {alpha}T3 cells stably transfected either with the wild-type {alpha}1bAR genes (fixed cells, Fig. 4AGo; living cells, Fig. 4BGo) or {alpha}1bAR/GFP genes (fixed cells, Fig. 4CGo; living cells, Fig. 4DGo). Furthermore, as shown in Fig. 4FGo, the endogenous receptor fluorescence (Fig. 4EGo) was well correlated with immunostaining (Fig. 4DGo) in living {alpha}T3 cells stably transfected with {alpha}1bAR/GFP genes, confirming a plasma membrane-labeling pattern. No fluorescent signal was detected in untransfected {alpha}T3 cells, and the fluorescent signals were distributed uniformly throughout whole cell in {alpha}T3 cells transfected only with the GFP gene (data not shown).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 4. Fluorescence Micrographs of the Wild-Type {alpha}1bAR and {alpha}1bAR/GFP Distribution in {alpha}T3 Cells

Confocal microscopy images of immunofluorescence are shown of fixed (A) and living (B) {alpha}T3 cells stably expressing the wild-type {alpha}1bAR; and fixed (C) and living (D) {alpha}T3 cells stably expressing the {alpha}1bAR/GFP, respectively. E, Confocal microscopy images of GFP-associated fluorescence in living {alpha}T3 cells stably expressing the {alpha}1bAR/GFP. F, Colocalization of immunofluorescence (red) and GFP-associated fluorescence (green) in living {alpha}T3 cells stably expressing the {alpha}1bAR/GFP. Scale bar, 10 µm.

 
NE-Stimulated Redistribution of {alpha}1bAR/GFP
We next investigated whether we could monitor the changes in the subcellular localization of {alpha}1bAR/GFP using this experimental system. Figure 5Go showed a consecutive X-Y scan of a single {alpha}T3 cell after the application of NE (100 nM). The redistribution of GFP-associated fluorescent signal became apparent about 8 min after the application of NE. Redistribution reached a steady state at about 15 min, which lasted unchanged until 60 min after application of NE. The time courses for NE-induced subcellular distribution of the endogenous receptor GFP fluorescence signal and immunofluorescent signal (expressed by a cell surface localization ratio) are shown in Fig. 6Go. The internalization kinetics of GFP-associated fluorescent signal and the immunofluorescent signal were similar; however, consecutive monitoring could not be performed for immunocytochemical analysis, since fluorescent dye became quickly photobleached. On the other hand, GFP-associated fluorescent signal was found to be bleach-resistant and could be consecutively monitored at 1-min intervals.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 5. Real-Time Monitoring of NE-promoted Internalization of {alpha}1bAR/GFP

Internalization of {alpha}1bAR/GFP was monitored at 1-min intervals after NE (100 nM) stimulation using a confocal laser scanning microscope. Shown are images obtained at 5, 10, 15, and 30 min after NE stimulation. The internalization of GFP-associated fluorescent signal became apparent about 8 min after the application of NE. The internalization reached a steady state after about 15 min. The results presented are representative of at least three similar experiments.

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. Time Course for NE-Induced Subcellular Distribution of GFP-Associated Fluorescence and Immunofluorescence Signals

GFP-associated fluorescence (•) was consecutively monitored in a single living {alpha}T3 cells stably expressing the {alpha}1bAR/GFP. Monitoring of immunofluorescence ({circ}) was performed in living {alpha}T3 cells stably expressing the wild-type {alpha}1bAR; however, because of rapid photobleaching, immunofluorescence could not be consecutively monitored in a single cell. Thus, the data for immunofluorescence were obtained in different cells at each time. As described in Materials and Methods, the sum of the intensity value within the outlined area was considered as the total cellular fluorescence intensity, while the sum of the intensity value within 0.5 µm (5 pixel) depth from the cellular edge was considered as fluorescence signal localized on plasma membrane. The subcellular distribution of Cy3- or GFP-associated fluorescence was expressed by a cell surface localization ratio: the fluorescent signal localized on plasma membrane divided by the total cellular fluorescence intensity. Values are given as mean ± SD of three independent experiments.

 
Internalization of many receptors and integral membrane proteins occurs by endocytosis to a common endosomal compartment from which further intracellular sorting or recycling to the cell surface proceeds (22). To determine whether {alpha}1bAR trafficking occurs by a similar pathway, we further examined fluorescence colocalization of the internalized receptors with Cy3-conjugated transferrin, a classic endosomal marker. Confocal images obtained from control cells showed that {alpha}1bAR/GFP is mainly localized to the cell surface while transferrin receptors reside in internal vesicles (Fig. 7AGo). After 30 min of NE exposure, the internalized {alpha}1bAR/GFP colocalizes with Cy3-conjugated transferrin in endosomes (Fig. 7BGo). This result indicates that receptor translocates to endosomes during agonist exposure. In addition, agonist-induced receptor internalization was completely prevented by pretreatment of cells with hyperosmotic sucrose solutions (0.45 M), a procedure that has been shown previously to inhibit receptor-mediated endocytosis (23) (data not shown). In sum, these results are consistent with an endocytic pathway of receptor internalization.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 7. Colocalization of {alpha}1bAR/GFP and Cy3-Transferrin in {alpha}T3 Cells Stably Expressing {alpha}1bAR/GFP

Cells were loaded with Cy3-transferrin as described in Materials and Methods. Thirty minutes after the {alpha}T3 cells stably expressing the {alpha}1bAR/GFP were treated with 100 nM NE, GFP-associated fluorescence (green) and Cy3-transferrin fluorescence (red) were examined by confocal microscopy. Confocal images are shown of a control cell (A) and a NE-treated cell (B). Before NE stimulation, {alpha}1bAR/GFP was distributed over the cell surface (A). Exposure to NE resulted in the colocalization of both {alpha}1bAR/GFP and Cy3-transferrin (B). Scale bar, 10 µm.

 
In the following series of experiments, we therefore examined effects of various pharmacological treatments on the NE (100 nM)-induced redistribution of GFP-associated fluorescent signal at 30 min after application of NE.

Characterization of the Internalization of {alpha}1bAR/GFP
Without any stimulation (control), most of the GFP-associated fluorescent signal was localized on plasma membrane (cell-surface localization ratio = 0.98 ± 0.02, n = 6) (Fig. 8AGo). After 30 min of NE stimulation, this ratio had decreased to 0.65 ± 0.12 (n = 6, Fig. 8BGo). Pretreatment with {alpha}-AR antagonist phentolamine (10 µM) completely inhibited both the NE (100 nM)-induced internalization of {alpha}1bAR/GFP (Fig. 8Go, C and D) and the NE-stimulated increase in [Ca2+]i (data not shown). In addition, the PLC inhibitor U73,122 (10 µM, 10 min) was found to inhibit both the NE-promoted internalization (Fig. 8Go, E and F) and NE-stimulated increase in [Ca2+]i (data not shown).



View larger version (73K):
[in this window]
[in a new window]
 
Figure 8. Effects of Various Agents on Redistribution of {alpha}1bAR/GFP

{alpha}1bAR/GFP distribution was recorded by a confocal laser scanning microscope. A and B, The effect of NE on {alpha}1bAR/GFP distribution. Before NE stimulation, {alpha}1bAR/GFP was distributed over the cell surface (A). Exposure to NE (100 nM) for 30 min resulted in the internalization of {alpha}1bAR/GFP (B). C and D, the effect of pretreatment with phentolamine (10 µM, 10 min) on NE-promoted internalization of {alpha}1bAR/GFP. Before NE stimulation, {alpha}1bAR/GFP was distributed over the cell surface (C). Pretreatment with phentolamine inhibited NE (100 nM, 30 min)-promoted internalization of {alpha}1bAR/GFP (D). E and F, The effect of pretreatment with U73,122 (10 µM, 10 min) on NE-promoted internalization. Before NE stimulation, {alpha}1bAR/GFP was distributed over the cell surface (E). Pretreatment with U73,122 inhibited NE (100 nM, 30 min)-promoted internalization of {alpha}1bAR/GFP (F). G and H, The effect of thapsigargin on {alpha}1bAR/GFP distribution. Before application of thapsigargin, {alpha}1bAR/GFP was distributed over the cell surface (G). Application of thapsigargin (1 µM) for 30 min did not cause any internalization of {alpha}1bAR/GFP (H). I and J, The effect of PMA on {alpha}1bAR/GFP distribution. Before application of PMA, {alpha}1bAR/GFP was distributed over the cell surface (I). Application of PMA (1 µM, 30 min) caused an internalization of {alpha}1bAR/GFP (J). K and L, The effect of pretreatment with staurosporine (10 µM, 10 min) on NE-promoted internalization. Before NE stimulation, {alpha}1bAR/GFP was distributed over the cell surface (K). Pretreatment with staurosporine inhibited NE (100 nM, 30 min)-promoted internalization of {alpha}1bAR/GFP (L). M and N, The effect of GnRH on {alpha}1bAR/GFP distribution. Before GnRH stimulation, {alpha}1bAR/GFP was distributed over the cell surface (M). Application of GnRH (100 nM, 30 min) caused the internalization of {alpha}1bAR/GFP (N). Each result presented is representative of at least six experiments.

 
Thapsigargin, which blocks ATP-dependent Ca2+ uptake into endoplasmic reticulum and elicits an increase in [Ca2+]i without activating PLC, did not cause any change in subcellular localization of {alpha}1bAR/GFP (Fig. 8Go, G and H). The protein kinase C (PKC) activator PMA (1 µM, 30 min) did not increase [Ca2+]i, but did promote a redistribution of {alpha}1bAR/GFP in a similar fashion to NE stimulation (Fig. 8Go, I and J), although to a lesser extent. Staurosporine (10 µM, 10 min), which inhibits PKC activity, suppressed the NE-mediated internalization of {alpha}1bAR/GFP (Fig. 8Go, K and L). Furthermore, stimulation of endogenous PI-linked GnRH receptor by GnRH (100 nM) was also found to cause internalization of {alpha}1bAR/GFP (Fig. 8Go, M and N). The internalization of GFP-associated fluorescent intensity promoted by the various pharmacological treatments is summarized in Fig. 9Go.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 9. Effects of Various Pharmacological Agents on {alpha}1bAR/GFP Redistribution

Internalized GFP-associated fluorescent intensity as shown in Fig. 8Go was summarized in a quantitative fashion as described in Materials and Methods. A, Effects of pretreatment with phentolamine (Phe), U73,122, or staurosporine (Stauro) on NE-promoted {alpha}1bAR/GFP internalization. {alpha}T3 cells stably expressing {alpha}1bAR/GFP were treated with NE alone (100 nM) for 30 min, or pretreated for 10 min with phentolamine (10 µM) or U73,122 (10 µM) or with staurosporine (10 µM) and then stimulated by NE (100 nM) for 30 min. *, P < 0.05 vs. NE alone. B, Effects of NE, GnRH, PMA, or thapsigargin (Thap) on {alpha}1bAR/GFP internalization. {alpha}T3 cells stably expressing {alpha}1bAR/GFP were treated for 30 min by NE (100 nM), GnRH (100 nM), PMA (1 µM), or thapsigargin (1 µM). *, P < 0.05 vs. without stimulation. Values are given as mean ± SD of at least six independent experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The {alpha}1bAR/GFP fusion protein has enabled us to visualize {alpha}1bAR with subcellular resolution in live cells and to pharmacologically characterize mechanisms of agonist-induced receptor internalization. Our data demonstrate that the ligand binding, signal-coupling properties, cellular distribution, and trafficking behavior of {alpha}1bAR/GFP closely resemble those of the wild-type {alpha}1bAR. In mouse {alpha}T3 cells, the fluorescence distribution of {alpha}1bAR/GFP is characteristic of a plasma membrane-labeling pattern, and the application of agonist promoted the internalization of {alpha}1bAR/GFP. The second messenger mechanism for this internalization was pharmacologically determined by using this optical experimental system. NE-promoted internalization of {alpha}1bAR/GFP was blocked by the {alpha}1AR antagonist phentolamine and by the PLC inhibitor U73,122. The agonist-induced internalization was mimicked either by activation of PLC through endogenous PI-linked GnRH receptor (24) or by stimulation of PKC with PMA, but not by a simple rise in [Ca2+]i with thapsigargin. Furthermore, the PKC inhibitor staurosporine blocked the NE-induced internalization. Taken together, NE-promoted internalization of {alpha}1bAR/GFP appears to be closely linked to PLC activation and dependent on PKC activation in particular. Our present results, which were obtained by real-time optical monitoring of subcellular localization in living cells, are in good agreement with previous observations made by cell-free biochemical assay (9) or by immunohistochemical analysis of fixed cells (14).

GFP is now widely used to monitor intracellular localization of proteins in intact cells. However, its size (238 amino acids) (25) in comparison with the overall size of the {alpha}1bAR protein (515 amino acids) (3) and other GPCRs (26, 27) makes it an unlikely candidate for the formation of a functional GPCR/GFP fusion protein. Both the present study and recent work with ß2-AR (28), however, suggest that the GFP adduct does not significantly change the inherent physical or biochemical behavior of GPCR and that optical methods can be generally useful even for GPCRs. Optical studies in cultured cells, of {alpha}1bAR in particular and of GPCRs in general, are difficult due to the small number of membrane receptors expressed. Thus, GPCRs produce only marginal signals when tagged with fluorophores or labeled with fluorescent agonists or antagonists, a procedure that often modifies the behavior of these compounds (29). In addition, the introduction of foreign epitopes into receptor cDNA is now a standard technique used to enhance detection, permitting antibody recognition of {alpha}1AR (30) and other GPCRs in flow cytometry or fluorescence microscopy (31). However, even this technique has major limitations, including its applicability to living cells, nonstoichiometric labeling of receptors, the eventual dissociation of the antibody from the receptor, and an inability to label intracellular receptors in nonpermeabilized cells. An ideally labeled receptor should be relatively unperturbed by its fluorescent tag, exhibit little or no change in its biochemical or biophysical behavior, have a large fluorescence signal above background when excited by visible light in addition to being photostable, and be stoichiometrically labeled. As shown in this report, the observed behavior of {alpha}1bAR/GFP indicates that {alpha}1bAR/GFP and other similarly conjugated GPCRs should be important tools both in vitro and in vivo for the optical measurement of biochemical and biophysical processes that are relevant to GPCR signal transduction.

We observed a relatively minor degree (~35%) of internalization of the {alpha}1bAR by the fluorescence detection method using GFP and the fluorescent anti-{alpha}1bAR antibody, compared with the internalization observed by the use of other GPCRs such as ß-adrenoceptor (32). However, the internalization of {alpha}1bAR/GFP, which was observed by optical monitoring of the fluorescence signal in living cells, is in good agreement with previous observations that were made using radioligand-binding assay on membrane preparations (32, 33). Thus, both the time course and the extent of {alpha}1bAR internalization after exposure to high concentrations of an {alpha}1AR agonist are similar to that found in previous studies that employed DDT1 MF-2 cells, which express {alpha}1bAR naturally (33). Therefore, we considered that, in general, the agonist-promoted internalization of the {alpha}1bAR may not be as marked compared with that promoted by other GPCRs. The reason for this relatively minor degree of internalization of the {alpha}1bAR is not clear.

Furthermore, our data showed that agonist-promoted internalization of {alpha}1bAR/GFP appears to be closely linked to PLC activation and is dependent on PKC activation, but independent of [Ca2+]i increase. At present, the signals controlling {alpha}1bAR internalization are not well known because of the lack of specific structural probes for the receptor in vivo. Using measurement of radioligand binding to assess receptor redistribution in Chinese hamster ovary cells transfected with receptor cDNA, Toews (12) reported that agonist or PMA stimulation causes receptor internalization, which is blocked by staurosporine. In addition, a recent immunohistochemical study by Fonseca et al. (14) suggested that PKC-dependent phosphorylation resulting from {alpha}1AR stimulation induces receptor internalization. Our data obtained from real-time optical monitoring of {alpha}1bAR/GFP are generally in good agreement with these studies; moreover, we observed that not only homologous stimulation (by NE) but also heterologous stimulation (by GnRH) of PLC, and eventually PKC, resulted in the internalization of {alpha}1bAR, although the latter process appeared to be less potent. Thus, phosphorylation of {alpha}1bAR by PKC clearly plays an important role in the desensitization (7, 14) and internalization of {alpha}1bAR.

In conclusion, this study demonstrates that real-time optical monitoring of subcellular localization of {alpha}1bAR (as well as other GPCRs) on living cells are feasible, and that this approach combined with appropriate pharmacological tools would provide a valuable system to further study the biochemical mechanism(s) of agonist-induced receptor endocytosis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
cDNA Construction
Expression vectors (Fig. 1Go) were constructed on SR{alpha} promoter-based mammalian expression vector pME18S (34). The cDNA for the hamster {alpha}1b-adrenoceptor (3) was the kind gift of Dr. Susanna Cotecchia (Institute de Pharmacologie et Toxicologie, Lausanne, Switzerland). To generate the {alpha}1bAR/GFP construct, the coding region of GFP mutant S65T (20) (the kind gift of Dr. H. Takahashi, Mitsubishi Kasei Inst. Life Sciences) was amplified by primer 1(aaagggcccatgagtaaaggagaagaacttttc) and primer 2 (aaaactagttttgtatagttcatccatggc), which produced a 5'-ApaI site for ligation. The {alpha}1bAR expression vector pME-{alpha}1b (35) was digested by ApaI and XbaI. Both enzyme-digested products were ligated to obtain a construct designated pME-{alpha}1bAR/GFP. The modified region of these construct was confirmed by sequencing with an ABI 373A DNA sequencer (Applied Biosystems Inc., Foster City, CA). We chose the ApaI site in the carboxyl terminus for the GFP to be integrated because the region distal to the ApaI site varies in {alpha}1aAR splice variants with similar pharmacological properties (36), and deletion of the region in {alpha}1bAR was shown not to affect the binding and signal transduction properties (37). All experiments were performed with wild-type receptors in parallel whenever possible.

Transfection and Selection of Stably Expressing Cells
{alpha}T3 cells were maintained in DMEM with 10% FBS. The constructs, pME18S-{alpha}1b and pME-{alpha}1bAR/GFP, were transfected into {alpha}T3 cells by Lipofectin (GIBCO, Life Technologies, Gaithersburg, MD) according to manufacturer’s instructions. Using a cell sorter (FACsort, Becton Dickinson & Co., Mountain View, CA), we selected and enriched anti-N terminus antibody-positive and/or GFP-positive cells at 72 h, 1 week, and 2 months after transfection.

[125I]HEAT Binding Assay
Crude particulate membrane fractions were collected from {alpha}T3 stable cells as described previously (38). Briefly, the harvested cells were pelleted by centrifugation at 500 x g for 5 min and washed, and the pellet was homogenized in 2 ml ice-cold buffer A (250 mM sucrose, 5 mM Tris-HCl, 1 mM MgCl2, pH 7.4) and centrifuged at 1,000 x g at 4 C for 10 min to remove nuclei. The supernatant was then centrifuged at 35,000 x g for 20 min at 4 C, the pellet was homogenized, and the homogenates were resuspended in buffer B (50 mM Tris-HCl, 10 mM MgCl2, 10 mM EGTA, pH 7.4) to a final protein concentration of 0.1 mg/ml. The protein concentration was measured using the bicinchoninic acid protein assay kit (Pierce Chemical Co., Rockford, IL).

Radioligand binding with [125I]HEAT studies was performed as described previously (35, 38, 39). Briefly, measurement of specific [125I]HEAT binding was performed by incubating 0.1 ml of membrane preparation (~30 µg of protein) with [125I]HEAT (2,200 Ci/mmol) in a final volume of 0.15 ml buffer B for 60 min at 25 C in the presence or absence of competing drugs. The incubation was terminated by adding ice-cold buffer B and immediately filtering through Whatmann GF/C glass-fiber filters with a Brandel cell harvester (model 30, Gaithersburg, MD). Each filter was collected, and the radioactivity was measured. Binding assays were always performed in duplicate. For competition curve analysis, each assay contained about 70 pM [125I]HEAT. At this concentration, nonspecific binding, defined as binding displaced by 10 mM phentolamine, represented less than 40% of the total binding. Data were analyzed by computer with an iterative nonlinear regression program LIGAND (40).

In some experiments with CEC treatment, the membrane preparation was incubated in a 1 ml volume of hypotonic buffer (5 mM Tris-HCl, 5 mM EDTA, pH 7.6) with CEC (100 µM) for 30 min at 37 C, after which the reactions were stopped by adding 16 ml ice-cold buffer, and centrifuged at 35,000 x g for 20 min at 4 C. The membrane was washed two times and resuspended in buffer B and used for the binding assay.

Measurement of Inositol-1,4,5-Triphosphate [Ins(1, 4, 5)P3]
A portion (106) of the suspended {alpha}T3 cells treated with NE (1 nM-10 µM) for 5 sec were immediately added by 0.2 volume of ice-cold 20% perchloric acid. After centrifugation, the supernatant was adjusted to pH 7.0 using HEPES-KOH solution, and the sediment was eliminated by centrifugation. Amounts of Ins(1, 4, 5)P3 in a sample were measured by a RRA with a D-myo-inositol 1,4,5-triphosphate [3H] assay kit, TRK 1000 (Amersham, Buckinghamshire, U.K.). Values of Ins(1, 4, 5)P3 were expressed as picomoles/106 of {alpha}T3 cells.

Antibody Preparation
Generation of an antipeptide antibody (designated as 1B-N1-C) was described previously (41). Briefly, peptide was synthesized corresponding to amino acids 12–27 (peptide: 1B-N1; (C)SAPAQWGELKDANFTG) of the published hamster {alpha}1bAR sequence (3), conjugated to the carrier protein keyhole limpet hemocyanin and injected to rabbits. Antisera were screened against the peptides by using cross-dot systems (Sebia, Moulineaux, France) and visualized by ABC system (Vector Laboratories, Burlingame, CA). By immunoblotting and immunoprecipitation studies, we confirmed that the antibodies detect the {alpha}1bAR (41).

Antiserum was purified on 1 ml of protein A-Sepharose CL-4B column (Pharmacia Biotech, Tokyo, Japan) equilibrated with 20 mM phosphate buffer, pH 7.5, and eluted with glycine-HCl buffer (100 mM, pH 2.2), into 1-ml fractions, which were immediately neutralized with 1 M Tris-HCl buffer, pH 8.5. The resulting antibody fractions were concentrated by a Centricon 30 microconcentrator (Amicon, Danvers, MA) and stored at -20 C. Antibody was labeled by Cy3 (Amersham) according to the protocol of Southwick et al. (42) and used for immunocytochemical analysis.

Confocal Laser Scanning Microscope Analysis
Immunofluorescence Detection (Fixed Cells)
{alpha}T3 cells stably expressing wild-type {alpha}1bAR and {alpha}1bAR/GFP were seeded at 1 x 105 per well of the eight-well Lab-Tek chamber slide (Nunc, Napervile, IL) in 0.5 ml medium. Fixation was performed in 80% acetone for 5 min. Cells were then incubated with 0.05% Triton X-100 in PBS. Cy3-conjugated, affinity-purified anti-{alpha}1bAR antibody [5 µg/ml, 1B-N1-C, (41)], was brought in PBS containing 10% goat serum and 0.05% Triton X-100, and applied to cells, which were subsequently kept in a humidified chamber for 1 h at room temperature. Cells were then washed twice with PBS, and coverslips were applied using Gel/Mount (Biomeda, Foster City, CA).

Immunofluorescence Detection (Living Cells)
For immunocytochemical staining of living cells, {alpha}T3 cells stably expressing wild-type {alpha}1bAR and {alpha}1bAR/GFP were washed three times with Tyrode solution (135.0 mM NaCl, 5.4 mM KCl, 0.33 mM NaH2PO4, 5.0 mM HEPES, 0.5 mM MgCl2, 5.55 mM glucose, 1.25 mM CaCl2, pH 7.4), and incubated with ice-cold Tyrode solution containing 1 µg/ml of the Cy3-labeled antibody for 30 min at 4 C, after which the cells were washed three times with ice-cold Tyrode solution.

After immunocytochemical staining, cells were examined by using LSM-GB200 laser scanning microscope (Olympus, Tokyo, Japan) with argon-ion laser set at 514 nm for excitation of Cy3.

GFP Detection
{alpha}T3 cells stably expressing wild-type {alpha}1bAR and {alpha}1bAR/GFP were seeded at 1 x 105 per well of the cover glass-bottom culture dish (MatTek Corp., Ashland, MA) in 2.0 ml of medium and examined using LSM-GB200 within 30 min at room temperature.

Labeling of Cells with Cy3-Transferrin
Transferrin was labeled by Cy3 (Amersham) according to manufacturer’s instructions. {alpha}T3 cells stably expressing {alpha}1bAR/GFP in 35-mm dishes were rinsed three times with serum-free DMEM and incubated for 12 h with Cy3-transferrin. At the termination of labeling, the cells were again rinsed three times with warm serum-free DMEM and examined by using LSM-GB200 laser scanning microscope (Olympus) with argon-ion laser set at 514 nm for excitation of Cy3.

Monitoring of [Ca2+]i and Subcellular Distribution of {alpha}1bAR/GFP
Changes in [Ca2+]i as well as the distribution of fluorescent signal were monitored by GB-200 confocal laser scanning microscope (Olympus). The fluorescence intensity change of intracellularly loaded Fura Red was used to estimate the [Ca2+]i change upon stimulation. {alpha}T3 cells stably expressing wild-type {alpha}1bAR and {alpha}1bAR/GFP cultured in a cover glass-bottom culture dish (MatTek Corp.) were incubated with 0.5 µM Fura Red tetrakisacetoxymethyl ester (Fura Red/AM) dissolved in Tyrode solution containing 0.1% BSA for 30 min at 37 C. After the cells were washed twice with Tyrode solution, changes in [Ca2+]i were monitored with a sample interval of 10 sec in Tyrode solution containing yohimbine 100 nM and propranolol 100 nM. The argon laser beam (wavelength 488 nm) was focused with a water-immersion objective lens (Olympus UV ApoLSM 40x). Fluorescent signals were split with a dichroic mirror (550 nm), and change in fluorescence was measured through interference filters of 590-nm highcut filter and 500- to 530-nm bandpass filter for monitoring of [Ca2+]i and subcellular distribution of {alpha}1bAR/GFP, respectively. Three frames before the stimulation were averaged pixel by pixel to obtain resting fluorescence (F0). The resting frame was then divided by each frame in a pixel-by-pixel basis, and the normalized fluorescence intensity value (Ft) was used to estimate the [Ca2+]i change upon stimulation. We did not convert the fluorescence intensity change to absolute values of [Ca2+]i because it was difficult to unambiguously determine the background fluorescence intensity and the resting [Ca2+]i, both of which are required for [Ca2+]i determination using nonratiometric dyes.

Fluorescence Measurements
Confocal images were digitally acquired into two-dimensional arrays of picture elements (pixels). Each pixel is a square with a width of 0.1 µm and assigned an intensity value ranging from 0 (black) to 255 (white). Cellular edges in each image were outlined manually, and the intensity value of each pixel within the outlined area was measured. The sum of the intensity value within the outlined area was considered as the total cellular fluorescence intensity, while the sum of the intensity value within 0.5 µm (5 pixel) depth from the cellular edge was considered as fluorescence signal localized on plasma membrane. Image analysis were performed using IPLab software (Signal Analytics Corp., Vienna, VA). The subcellular distribution of Cy3- or GFP-associated fluorescence was expressed by a cell surface localization ratio: the fluorescent signal localized on plasma membrane divided by the total cellular fluorescence intensity. To quantify the effect that various pharmacological agents have on {alpha}1bAR/GFP redistribution, cells were chosen randomly in each experiment, and one image was obtained from each dish of each individual experiments (Fig. 9Go). Each image contains, on average, three to seven cells, and all cells in the images were analyzed for quantification. At least six independent experiments were performed for each treatment.

Materials
Hamster {alpha}1bAR cDNA was a kind gift of Drs. S. Cotecchia and R. J. Lefkowitz (Duke University Medical Center, Durham, NC) (3). The following drugs were used: [125I]HEAT (specific activity 2,200 Ci/mmol) (New England Nuclear, Boston, MA); KMD-3213 dihydrobromide, ((-)-(R)-1-(3-hydroxypropyl)-5-[2-[2-[2-(2, 2, 2-trifluoroethoxy) phenoxy]ethylamino]propyl] indoline-7-carboxamide dihydrobromide) (Kissei Pharmaceutical Co., Matsumoto, Japan); phentolamine hydrochloride (ClBA-Geigy, Summit, NJ); GnRH (Tanabe, Osaka, Japan); prazosin hydrochloride (Pfizer, Groton, CT); yohimbine HCl (Wako Pure Chemical Industries, Ltd., Osaka, Japan); CEC and 5-methylurapidil (Research Biochemicals, Natick, MA); (-)-norepinephrine bitartrate (Sigma, St. Louis, MO); lipofectin (GIBCO, Life Technologies, Gaithersburg, MD); Fura Red/acetoxymethyl ester (Fura Red/AM) (Molecular Probes, Eugene, OR); Triton X-100 (Wako Pure Chemical Industries, Osaka, Japan); U73,122, 1-[6-[[17ß-3-methoxyestra-1,3,5(10)-trien-17-yl]amino]hexyl]-1H-pyrrole-2,5-dione; U73,343, 1-[6-[[17ß-3-methoxyestra-1,3,5(10)-trien-17-yl]amino]hexyl]-2,5-pyrrolidine-dione; Cy3 (Amersham); transferrin (Sigma). All other chemicals were of reagent grade.

Statistics
ANOVA was performed and when a statistical difference was detected, a Dunnett’s multiple comparison test was used to determine the difference between groups. All data are presented as the mean ± SD, and the statistically significant difference was determined at the P < 0.05 level unless otherwise stated.


    ACKNOWLEDGMENTS
 
We thank Dr. H. Takahashi (Mitsubishi Kasei Institute of Life Sciences) for the kind gift of the cDNA-encoding GFP mutant S65T. We are also grateful to Dr. Susanna Cotecchia (Institute de Pharmacologie et Toxicologie, Lausanne, Switzerland) for the generous gift of the cDNA-encoding hamster {alpha}1bAR and to Dr. Stojilkovic (National Institutes of Health, Bethesda, MD) for mouse {alpha}T3 cells. We also thank Dr. Thomson (International Medical Information Center, Tokyo, Japan) for the language editing.


    FOOTNOTES
 
Address requests for reprints to: Gozoh Tsujimoto, Department of Molecular and Cell Pharmacology, National Children’s Medical Research Center, 3–35-31 Taishido, Setagaya-ku, Tokyo, 154 Japan. E-mail: gtsujimoto{at}nch.go.jp

Received for publication May 1, 1997. Revision received March 6, 1998. Accepted for publication April 20, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Bolton TB 1979 Mechanisms of action of transmitters and other substances on smooth muscle. Physiol Rev 59:606–718[Free Full Text]
  2. Ruffolo Jr RR, Nichols AJ, Stadel JM, Hieble JP 1991 Structure and function of alpha-adrenoceptors. Pharmacol Rev 43:475–505[Medline]
  3. Cotecchia S, Schwinn DA, Randall RR, Lefkowitz RJ, Caron MG, Kobilka BK 1988 Molecular cloning and expression of the cDNA for the hamster alpha 1-adrenergic receptor. Proc Natl Acad Sci USA 85:7159–7163[Abstract/Free Full Text]
  4. Minneman KP, Mumford GK, Abel PW 1988 High efficiency coupling of alpha-1 adrenergic receptors to inositol phospholipid metabolism revealed by denervation of rat vas deferens. J Pharmacol Exp Ther 244:226–230[Abstract/Free Full Text]
  5. Lurie KG, Tsujimoto G, Hoffman BB 1985 Desensitization of alpha-1 adrenergic receptor-mediated vascular smooth muscle contraction. J Pharmacol Exp Ther 234:147–152[Abstract/Free Full Text]
  6. Brown RD, Prendiville P, Cain C 1986 Alpha 1-adrenergic and H1-histamine receptor control of intracellular Ca2+ in a muscle cell line: the influence of prior agonist exposure on receptor responsiveness. Mol Pharmacol 29:531–539[Abstract]
  7. Leeb Lundberg LM, Cotecchia S, DeBlasi A, Caron MG, Lefkowitz RJ 1987 Regulation of adrenergic receptor function by phosphorylation. I. Agonist-promoted desensitization and phosphorylation of alpha 1-adrenergic receptors coupled to inositol phospholipid metabolism in DDT1 MF-2 smooth muscle cells. J Biol Chem 262:3098–3105[Abstract/Free Full Text]
  8. Fratelli M, De Blasi A 1987 Agonist-induced alpha 1-adrenergic receptor changes. Evidence for receptor sequestration. FEBS Lett 212:149–153[CrossRef][Medline]
  9. Cowlen MS, Toews ML 1987 Effects of agonist and phorbol ester on adrenergic receptors of DDT1 MF-2 cells. J Pharmacol Exp Ther 243:527–533[Abstract/Free Full Text]
  10. Wikberg JE, Akers M, Caron MG, Hagen PO 1983 Norepinephrine-induced down regulation of alpha 1 adrenergic receptors in cultured rabbit aorta smooth muscle cells. Life Sci 33:1409–1417[CrossRef][Medline]
  11. Hughes RJ, Insel PA 1986 Agonist-mediated regulation of alpha 1- and beta 2-adrenergic receptor metabolism in a muscle cell line, BC3H-1. Mol Pharmacol 29:521–530[Abstract]
  12. Toews ML 1987 Comparison of agonist-induced changes in beta- and alpha 1-adrenergic receptors of DDT1 MF-2 cells. Mol Pharmacol 31:58–68[Abstract]
  13. Fonseca MI, Aguilar JS, Skorupa AF, Klein WL 1991 Cellular mapping of m2 muscarinic receptors in rat olfactory bulb using an antiserum raised against a cytoplasmic loop peptide. Brain Res 563:163–170[CrossRef][Medline]
  14. Fonseca MI, Button DC, Brown RD 1995 Agonist regulation of alpha 1B-adrenergic receptor subcellular distribution and function. J Biol Chem 270:8902–8909[Abstract/Free Full Text]
  15. Bahouth SW, Wang HY, Malbon CC 1991 Immunological approaches for probing receptor structure and function. Trends Pharmacol Sci 12:338–343[CrossRef][Medline]
  16. Naray Fejes Toth A, Fejes Toth G 1996 Subcellular localization of the type 2 11beta-hydroxysteroid dehydrogenase. A green fluorescent protein study. J Biol Chem 271:15436–15442[Abstract/Free Full Text]
  17. Moores SL, Sabry JH, Spudich JA 1996 Myosin dynamics in live Dictyostelium cells. Proc Natl Acad Sci USA 93:443–446[Abstract/Free Full Text]
  18. Gerisch G, Albrecht R, Heizer C, Hodgkinson S, Maniak M 1995 Chemoattractant-controlled accumulation of coronin at the leading edge of Dictyostelium cells monitored using a green fluorescent protein-coronin fusion protein. Curr Biol 5:1280–1285[CrossRef][Medline]
  19. Kaether C, Gerdes HH 1995 Visualization of protein transport along the secretory pathway using green fluorescent protein. FEBS Lett 369:267–271[CrossRef][Medline]
  20. Heim R, Cubitt AB, Tsien RY 1995 Improved green fluorescence [letter]. Nature 373:663–664[Medline]
  21. Inouye S, Tsuji FI 1994 Aequorea green fluorescent protein. Expression of the gene and fluorescence characteristics of the recombinant protein. FEBS Lett 341:277–280[CrossRef][Medline]
  22. Trowbridge IS, Collawn JF, Hopkins CR 1993 Signal-dependent membrane protein trafficking in the endocytic pathway. Annu Rev Cell Biol 9:129–161[CrossRef]
  23. Daukas G, Zigmond SH 1985 Inhibition of receptor-mediated but not fluid-phase endocytosis in polymorphonuclear leukocytes. J Cell Biol 101:1673–1679[Abstract/Free Full Text]
  24. Ortmann O, Merelli F, Stojilkovic SS, Schulz KD, Emons G, Catt KJ 1994 Modulation of calcium signaling and LH secretion by progesterone in pituitary gonadotrophs and clonal pituitary cells. J Steroid Biochem Mol Biol 48:47–54[CrossRef][Medline]
  25. Prasher DC, Eckenrode VK, Ward WW, Prendergast FG, Cormier MJ 1992 Primary structure of the Aequorea victoria green-fluorescent protein. Gene 111:229–233[CrossRef][Medline]
  26. Probst WC, Snyder LA, Schuster DI, Brosius J, Sealfon SC 1992 Sequence alignment of the G-protein coupled receptor superfamily. DNA Cell Biol 11:1–20[Medline]
  27. Dixon RA, Kobilka BK, Strader DJ, Benovic JL, Dohlman HG, Frielle T, Bolanowski MA, Bennett CD, Rands E, Diehl RE, et al. 1986 Cloning of the gene and cDNA for mammalian beta-adrenergic receptor and homology with rhodopsin. Nature 321:75–79[Medline]
  28. Barak S, Ferguson S, Zhang j, Martenson C, Mayer T, Caron M 1997 Internal trafficking and surface mobility of a functionally intact beta 2-adrenergic receptor-green fluorescent protein conjugate. Mol Pharmacol 51:177–184[Abstract/Free Full Text]
  29. Roettger BF, Rentsch RU, Pinon D, Holicky E, Hadac E, Larkin JM, Miller LJ 1995 Dual pathways of internalization of the cholecystokinin receptor. J Cell Biol 128:1029–1041[Abstract/Free Full Text]
  30. Hirasawa A, Sugawara T, Awaji T, Tsumaya K, Ito H, Tsujimoto G 1997 Subtype-specific differences in subcellilar localization of alpha1-adrenoceptors: chlorethylclonidine preferentially alkylates the accessible cell surface alpha1-adrenoceptors irrespective of the subtype. Mol Pharmacol 52:764–770[Abstract/Free Full Text]
  31. Daunt DA, Hurt C, Hein L, Kallio J, Feng F, Kobilka BK 1997 Subtype-specific intracellular trafficking of alpha2-adrenergic receptors. Mol Pharmacol 51:711–720[Abstract/Free Full Text]
  32. Toews ML 1987 Comparison of agonist-induced changes in beta- and alpha 1-adrenergic receptors of DDT1 MF-2 cells. Mol Pharmacol 31:58–68
  33. Colucci WS, Akers M, Wise GM 1988 Differential effects of norepinephrine and phorbol ester on alpha-1 adrenergic receptor number and surface-accessibility in DDT1 MF-2 cells. Biochem Biophys Res Commun 156:924–930[CrossRef][Medline]
  34. Takebe Y, Seiki M, Fujisawa J, Hoy P, Yokota K, Arai K, Yoshida M, Arai N 1988 SR alpha promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol Cell Biol 8:466–472[Abstract/Free Full Text]
  35. Foglar R, Shibata K, Horie K, Hirasawa A, Tsujimoto G 1995 Use of recombinant alpha 1-adrenoceptors to characterize subtype selectivity of drugs for the treatment of prostatic hypertrophy. Eur J Pharmacol 288:201–207[CrossRef][Medline]
  36. Hirasawa A, Shibata K, Horie K, Takei Y, Obika K, Tanaka T, Muramoto N, Takagaki K, Yano J, Tsujimoto G 1995 Cloning, functional expression and tissue distribution of human alpha 1c-adrenoceptor splice variants. FEBS Lett 363:256–260[CrossRef][Medline]
  37. Lattion AL, Diviani D, Cotecchia S 1994 Truncation of the receptor carboxyl terminus impairs agonist-dependent phosphorylation and desensitization of the alpha 1B-adrenergic receptor. J Biol Chem 269:22887–22893[Abstract/Free Full Text]
  38. Horie K, Hirasawa A, Tsujimoto G 1994 The pharmacological profile of cloned and stably expressed alpha 1b-adrenoceptor in CHO cells. Eur J Pharmacol 268:399–407[CrossRef][Medline]
  39. Shibata K, Hirasawa A, Moriyama N, Kawabe K, Ogawa S, Tsujimoto G 1996 Alpha 1a-adrenoceptor polymorphism: pharmacological characterization and association with benign prostatic hypertrophy. Br J Pharmacol 118:1403–1408[Medline]
  40. Munson PJ, Rodbard D 1980 Ligand: a versatile computerized approach for characterization of ligand-binding systems. Anal Biochem 107:220–239[CrossRef][Medline]
  41. Hirasawa A, Tsumaya K, Awaji T, Shibata K, Homma N, Shinomiya T, Tsujimoto G 1996 Flow cytometry analysis of alpha1-adrenoceptor subtypes. FEBS Lett 386:141–148[CrossRef][Medline]
  42. Southwick PL, Ernst LA, Tauriello EW, Parker SR, Mujumdar RB, Mujumdar SR, Clever HA, Waggoner AS 1990 Cyanine dye labeling reagents–carboxymethylindocyanine succinimidyl esters. Cytometry 11:418–430[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
B. D. Schlag, Z. Lou, M. Fennell, and J. Dunlop
Ligand Dependency of 5-Hydroxytryptamine 2C Receptor Internalization
J. Pharmacol. Exp. Ther., September 1, 2004; 310(3): 865 - 870.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Miyamoto, J. Yamauchi, N. Mizuno, and H. Itoh
The Adaptor Protein Nck1 Mediates Endothelin A Receptor-regulated Cell Migration through the Cdc42-dependent c-Jun N-terminal Kinase Pathway
J. Biol. Chem., August 13, 2004; 279(33): 34336 - 34342.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. Chalothorn, D. F. McCune, S. E. Edelmann, M. L. Garcia-Cazarin, G. Tsujimoto, and M. T. Piascik
Differences in the Cellular Localization and Agonist-Mediated Internalization Properties of the alpha 1-Adrenoceptor Subtypes
Mol. Pharmacol., May 1, 2002; 61(5): 1008 - 1016.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. Wang, L. Wang, J. L. Anderson, N. A. Schulte, and M. L. Toews
Regulatory Properties of alpha 1B-Adrenergic Receptors Defective in Coupling to Phosphoinositide Hydrolysis
J. Pharmacol. Exp. Ther., January 1, 2002; 300(1): 134 - 141.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Miserey-Lenkei, Z. Lenkei, C. Parnot, P. Corvol, and E. Clauser
A Functional Enhanced Green Fluorescent Protein (EGFP)-Tagged Angiotensin II AT1A Receptor Recruits the Endogenous G{{alpha}}q/11 Protein to the Membrane and Induces Its Specific Internalization Independently of Receptor- G Protein Coupling in HEK-293 Cells
Mol. Endocrinol., February 1, 2001; 15(2): 294 - 307.
[Abstract] [Full Text]


Home page
J. Histochem. Cytochem.Home page
Z. Lenkei, A. Beaudet, N. Chartrel, N. De Mota, T. Irinopoulou, B. Braun, H. Vaudry, and C. Llorens-Cortes
A Highly Sensitive Quantitative Cytosensor Technique for the Identification of Receptor Ligands in Tissue Extracts
J. Histochem. Cytochem., November 1, 2000; 48(11): 1553 - 1564.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Chen, Y. V. Mukhin, M. N. Garnovskaya, T. E. Thielen, Y. Iijima, C. Huang, J. R. Raymond, M. E. Ullian, and R. V. Paul
A functional angiotensin II receptor-GFP fusion protein: evidence for agonist-dependent nuclear translocation
Am J Physiol Renal Physiol, September 1, 2000; 279(3): F440 - F448.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
P. A. Stevens, N. Bevan, S. Rees, and G. Milligan
Resolution of Inverse Agonist-Induced Up-Regulation from Constitutive Activity of Mutants of the alpha 1b-Adrenoceptor
Mol. Pharmacol., August 1, 2000; 58(2): 438 - 448.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
D. F. McCune, S. E. Edelmann, J. R. Olges, G. R. Post, B. A. Waldrop, D. J. J. Waugh, D. M. Perez, and M. T. Piascik
Regulation of the Cellular Localization and Signaling Properties of the alpha 1B- and alpha 1D-Adrenoceptors by Agonists and Inverse Agonists
Mol. Pharmacol., April 1, 2000; 57(4): 659 - 666.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
A. J. McLean, N. Bevan, S. Rees, and G. Milligan
Visualizing Differences in Ligand Regulation of Wild-Type and Constitutively Active Mutant beta 2-Adrenoceptor-Green Fluorescent Protein Fusion Proteins
Mol. Pharmacol., December 1, 1999; 56(6): 1182 - 1191.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
S. L. Ferrari, V. Behar, M. Chorev, M. Rosenblatt, and A. Bisello
Endocytosis of Ligand-Human Parathyroid Hormone Receptor 1 Complexes Is Protein Kinase C-dependent and Involves beta -Arrestin2. REAL-TIME MONITORING BY FLUORESCENCE MICROSCOPY
J. Biol. Chem., October 15, 1999; 274(42): 29968 - 29975.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Xu, A. Hirasawa, H. Shinoura, and G. Tsujimoto
Interaction of the alpha 1B-Adrenergic Receptor with gC1q-R, a Multifunctional Protein
J. Biol. Chem., July 23, 1999; 274(30): 21149 - 21154.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Berrada, C. L. Plesnicher, X. Luo, and M. Thibonnier
Dynamic Interaction of Human Vasopressin/Oxytocin Receptor Subtypes with G Protein-coupled Receptor Kinases and Protein Kinase C after Agonist Stimulation
J. Biol. Chem., August 25, 2000; 275(35): 27229 - 27237.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Awaji, T.
Right arrow Articles by Tsujimoto, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Awaji, T.
Right arrow Articles by Tsujimoto, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals