This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Scott, H. S. Articles by Antonarakis, S. E. Search for Related Content PubMed PubMed Citation Articles by Scott, H. S. Articles by Antonarakis, S. E. Pubmed/NCBI databases Gene GEO Profiles HomoloGene OMIM Protein UniGene Genetics Home Reference

Common Mutations in Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy Patients of Different Origins

Laboratory of Human Molecular Genetics (H.S.S., L.M., M.D.L., M-P.P., C.R., S.E.A.) Department of Genetics and Microbiology University of Geneva Medical School and Division of Medical Genetics (S.E.A.) Cantonal Hospital of Geneva 1211 Geneva 4, Switzerland
Institute of Medical Technology and University Hospital (M.H., P.P., P.C., M.S., K.J.E.K.) University of Tampere 33101 Tampere, Finland
Institute of Semeiotica Medica (C.B.) University of Padova 35128 Padova, Italy
Pediatric Endocrinology Unit (A.C.) Laboratorio di Genetica Molecolare (M.S., M.L.) Istituto G. Gaslini University of Genova Medical School (G.R.) Genova, I-16148, Italy
Division of Clinical Sciences (R.M., A.W.) Northern General Hospital University of Sheffield Sheffield SS 7AU, United Kingdom
Department of Molecular Biology (K.N., J.K., N.S.) Keio University School of Medicine 35 Shinanomachi, Shinjuku-ku Tokyo 160, Japan

	ABSTRACT

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED; OMIM *240300, also called APS 1,) is a rare autosomal recessive disorder that is more frequent in certain isolated populations. It is generally characterized by two of the three major clinical symptoms that may be present, Addison’s disease and/or hypoparathyroidism and/or chronic mucocutaneous candidiasis. Patients may also have a number of other clinical symptoms including chronic gastritis, gonadal failure, and rarely, autoimmune thyroid disease and insulin-dependent diabetes mellitus. We and others have recently identified the gene for APECED, which we termed AIRE (for autoimmune regulator). AIRE is expressed in thymus, lymph nodes, and fetal liver and encodes a protein containing motifs suggestive of a transcriptional regulator, including two zinc finger motifs (PHD finger), a proline-rich region, and three LXXLL motifs. Six mutations, including R257X, the predominant Finnish APECED allele, have been defined. R257X was also observed in non-Finnish APECED patients occurring on different chromosomal haplotypes suggesting different mutational origins. Here we present mutation analyses in an extended series of patients, mainly of Northern Italian origin. We have detected 12 polymorphisms, including one amino acid substitution, and two additional mutations, R203X and X546C, in addition to the previously described mutations, R257X, 1096–1097insCCTG, and a 13-bp deletion (1094–1106del). R257X was also the common mutation in the Northern Italian patients (10 of 18 alleles), and 1094–1106del accounted for 5 of 18 Northern Italian alleles. Both R257X and 1094–1106del were both observed in patients of four different geo-ethnic origins, and both were associated with multiple different haplotypes using closely flanking polymorphic markers showing likely multiple mutation events (six and four, respectively). The identification of common AIRE mutations in different APECED patient groups will facilitate its genetic diagnosis. In addition, the polymorphisms presented provide the tools for investigation of the involvement of AIRE in other autoimmune diseases, particularly those affecting the endocrine system.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy, also known as autoimmune polyglandular syndrome type I (APECED; OMIM *240300), is an autosomal recessive disorder (1). It is characterized by a variable combination of destructive autoimmune phenomena, principally directed against the endocrine system, that leads to a failure of the parathyroid glands, adrenal cortex, gonads, pancreatic ß-cells, gastric parietal cells, and thyroid gland. Clinical symptoms outside the endocrine system include chronic mucocutaneous candidiasis, dystrophy of dental enamel and nails, alopecia, vitiligo, and keratopathy (2). The disease usually occurs in childhood, but new tissue-specific symptoms may appear throughout life (2). The incidence of APECED has been estimated to be approximately 1:25,000 and 1:9,000 in Finns and Iranian Jews, respectively (3, 4), and is also relatively common in Sardinians. APECED patients develop autoantibodies against affected organs, including autoantibodies against the steroidogenic enzymes P450scc, P450c17, and P450c21 in patients with adrenocortical failure (Addison’s disease) (5) and/or gonadal failure (6), glutamic acid decarboxylase in patients with insulin-dependent diabetes mellitus (IDDM) (7), and enzymes aromatic L-amino acid decarboxylase (8) and P450 1A2 (9) in patients with hepatitis.

Based on linkage analysis in Finnish families, the locus for APECED was mapped to chromosome 21q22.3 between two markers, D21S49 and D21S171 (3), and linkage disequilibrium studies further defined the critical region for APECED to 500 kb between markers D21S1912 and D21S171. Locus heterogeneity was not revealed by linkage analysis of non-Finnish families (10). We and others have recently cloned the gene for APECED, which encodes a 545-amino acid putative transcription factor (AIRE) with zinc finger (PHD finger) motifs. A common Finnish mutation, R257X, was shown to be responsible for 82% of Finnish APECED alleles. R257X was also detected in patients of different origins on different haplotypes with closely linked polymorphic markers (11, 12).

Here we present mutation analyses in an extended series of patients, mainly of Northern Italian origin. We have detected two common mutations, R257X and a 13-bp deletion (1094–1106del). As shown by haplotype analyses, both R257X and 1094–1106del are likely to have occurred multiple times by independent mutational events. We also report two additional mutations, R203X and a mutation in the stop codon, X546C, and 12 polymorphisms, including one amino acid substitution. As already suspected from the variable phenotypes of APECED sibs, genotype-phenotype correlation is not possible, which indicates that the disease progression is likely to be modified by other genetic and/or environmental factors.

	RESULTS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Mutation Analysis in APECED Patients
The 14 exons of the APECED gene were individually PCR-amplified, purified, and sequenced from each of the 15 patients, including 9 Northern Italians, 2 British, 1 New Zealander, and 3 Finns (see Materials and Methods). Sequence comparison identified 12 polymorphisms and 2 previously undefined mutations (Fig. 1 and Table 1). In addition, by sequence, PCR, and restriction enzyme analyses, R257X in exon 6 and 1094–1106del in exon 8 of the AIRE gene were detected in 10 of 18 and 5 of 18 independent Northern Italian alleles, respectively. R257X was also detected in compound heterozygosity with 1094–1106del in 1 British, 1 New Zealander, and 1 Finn. 1094–1106del was also detected in homozygosity in 2 Italians and 1 British patient (Fig. 1 and Table 2).

View larger version (33K): [in this window] [in a new window]   Figure 1. Electropherograms Showing the Sequence Surrounding the Mutations in the APECED Gene A, Mutation analysis of a Northern Italian APECED family (family A). The two affected siblings are both compound heterozygotes for the R257X (paternal origin) and R203X (maternal origin) mutations. The electropherograms show normal and one patient heterozygous for the C-to-T transition (underlined) resulting in the "Arg" to "Stop" nonsense codon at position 203. B, Mutation analysis of a Northern Italian APECED family (family B). The patients are homozygous for the four-nucleotide insertion, which most likely results from a replication error due to the normally occuring two copies of CCTG (underlined). C, Electropherograms from a normal and homozygous mutant for 1094–1106del (the 13-bp deletion, underlined in black in the normal). The imperfect inverted repeat that may be responsible for the mutations reoccurence is underlined in red. D, Electropherograms from a normal and heterozygote mutant for X546C. The mutated nucleotide is underlined.

A previously described mutation, 1094–1106del, a deletion of 13 nucleotides (12) also in exon 8, was detected in homozygosity in 2 Northern Italians and 1 British patient (Fig. 1C) and was also found in heterozygosity in a British, a New Zealand, and a Finnish patient. The insertion presumably results in a frameshift at C322, and premature truncation of a 372-amino acid protein with 50 C-terminal amino acids unrelated to the normal AIRE protein.

Analysis of two Finnish patients heterozygous for R257X, including VP (11) revealed a mutation in the stop codon of AIRE, TGATGT (X546C) resulting in the addition of 60 C-terminal amino acids before termination at an in-frame stop codon in the 3'-untranslated region of AIRE (Fig. 1D).

Haplotype Analysis in APECED Families
R257X has previously been described as the common Finnish APECED allele but the mutation was also observed in APECED patients of various origins (11, 12). This mutation is a CT transition of the C residue of a CpG dinucleotide, and haplotype analysis with the polymorphic markers D21S1912, and PFKL confirmed that the R257X mutation is associated with different haplotypes in the non-Finnish patients. R257X was detected in 10 of 18 Northern Italian APECED alleles in this study. Due to limited availability of samples from parents of patients (NIT-A to I, Table 2), haplotype construction was performed assuming a founder affect for R257X in the Northern Italian patients and, therefore, haplotypes were deduced to minimize ancient implied recombinations. We are uncertain of the haplotypes only in NIT-C, as the patient is heterozygous for both markers studied here; however, in all possible allelic combinations, R257X is associated with a unique haplotype in this patient. In the patient from family A, where haplotype construction was possible with immediate family members, and the four homozygotes for R257X, the mutation is associated with five different haplotypes in Northern Italians (order, D21S1912, AIRE, PFKL). D21S1912 is located approximately 130 kb from the 5'-end of AIRE (11, 12), and thus this additional association of D21S1912 alleles with R257X could result from an ancient recombination event or mutation of this dinucleotide marker after the original mutational or founder effect in Northern Italy. However, the CA repeat polymorphic marker of PFKL is in the promoter region of the PFKL gene, which is located approximately only 1.5 kb distal to the stop codon of AIRE. R257X is associated with three different PFKL alleles (Tables 2 and 3). Thus, although possible, it is unlikely that different haplotypes of R257X and PFKL are the result of ancient recombination events. Combination of these results with those previously reported (11, 12) shows R257X to be associated with nine different haplotypes (Table 3). Data available from the intragenic polymorphisms in AIRE in our patient series are uninformative. There are potentially three to five implied independent mutational or migrational events that result in the presence of R257X in Northern Italy. Assuming migrational events could have mixed Swiss or Finnish R257X alleles in Northern Italy, looking only at the association of R257X with PFKL alleles, there have been a minimum of three mutational events.

	DISCUSSION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
The recent cloning of the gene for APECED has allowed the investigation into the molecular basis of the disease in a number of patients. These studies are pursued to provide clues to the function of the AIRE protein in autoimmunity and the endocrine system. Six mutations, including R257X, have previously been reported (11, 12). Here we report an additional two mutations, one nonsense mutation and one stop codon mutation. We have shown that R257X is also the common cause of APECED in Northern Italian patients. Haplotype analyses indicate a minimum of five independent mutational events worldwide for this mutation, but the more likely scenario is that there have been a minimum of nine independent occurrences of R257X. This is not unprecedented as recurring CT transition mutations in CpG dinucleotides, particularly those in arginine codons, are commonly described mutation events (13, 14, 15). R257X has only been observed with one haplotype in Finnish patients, and the success of linkage disequilibrium studies in Finnish families (10) and the frequency of the disease in Finland point to a single mutational event for the Finnish R257X.

1094–1106del is also observed in patients of diverse geo-ethnic origin and is associated with multiple haplotypes. It is also likely to be a recurring mutation, perhaps by the formation of hairpin structures from the imperfect inverted repeat near the ends of the mutation site (GGCCTGCCTGTCCCCTCCGCTCCGG, the deletion is in bold and the imperfect inverted repeat is underlined) as indicated in Fig. 1C. This is also a known mutational mechanism (14). We describe the first occurrence of 1094–1106del in a Finnish patient and another mutation, X546C, in two Finnish patients. X546C is associated with the same haplotype. The fact that 1094–1106del is recurrent and X546C is seen in two patients may imply that these mutations will account for the remaining undescribed Finnish APECED alleles with varying haplotypes (10).

A total of eight mutations have now been defined for APECED. It is notable that all but K83E, and possibly X546C, are null mutations that would produce no functional protein. Both the 4-bp insertion and 13-bp deletion described here cause frameshifts in the first of the two PHD zinc finger domains of AIRE. R257X and R203X are both situated before the first zinc finger motif. We have also detected 12 polymorphisms, 6 in the coding region, but only one of which causes a conservative amino acid substitution of a serine at position 278 to an arginine (found in homozygosity and heterozygosity in control cell lines). S278R is N-terminal to the zinc finger motifs in the AIRE protein and outside all recognizable motifs (11, 12).

The 4-bp insertion and 13-bp deletion are in exon 8 of AIRE and are thus also present in the alternative transcripts we previously named AIRE2 and AIRE3 (11). However, it is possible that these transcripts are experimental artifact and not functionally significant as many mutations fall outside these transcripts and AIRE2 and AIRE3 are not detectable by Northern blot using specific probes (11).

As expected, due to the slowly developing nature of many of the symptoms of APECED, the observed differences between Finnish patients, many of which where known to be homozygous by haplotype analyses, and variation in phenotypes between APECED siblings (2, 4, 10), genotype-phenotype correlations do not seem to be possible in APECED. X546C may be expected to produce functional protein, but both patients had a typical APECED phenotype indistinguishable from that of R257X homozygotes. This is emphasized by the different disease progression in the siblings presented in our two Northern Italian families. In family A, the siblings had a similar disease progression except that one sibling lacked one of the three major characteristics of APECED, hypoparathyroidism. In the twins in family B, autoimmune thyroid disease developed in one patient at 3 yr of age and not until 16 in the other. Genotype-phenotype correlations may only be possible after long-term follow-up of a large group of patients with division into subgroups such as human leukocyte antigen (HLA) genotypes. However, as may be expected from mouse models of autoimmune and endocrine diseases, environment and genetic background play an important role as in the mice with rheumatoid arthritis resulting from crossing a T cell receptor (TCR) transgenic line with the nonobese diabetic (NOD) strain (16).

The fact that most described APECED mutations in the AIRE gene are presumably null mutations from many apparently nonrelated APECED patients may be interpreted in several ways. We may be investigating a rare disease with founder effects and/or that only null mutations cause disease and/or the gene contains certain hypermutable sites accounting for the reoccurrence of R257X and the 13-bp deletion in patients of several different geo-ethnic origins. Presumably AIRE is also responsible for a variant of APECED that presents mainly as hypoparathyroidism in Iranian Jews, with some of the other clinical symptoms such as candidiasis and kerathopathy present at much lower frequencies than in Finnish patients (2, 9). With the partially penetrant nature of many of the symptoms of APECED, the lack of phenotype-genotype correlation and the fact that mutations in the AIRE can cause a different clinical course, other mutations in AIRE may result in other distinct genetic diseases or be contributory to other polygenic diseases. Different mutations in different domains in the same gene have been shown to be responsible for disorders with distinctive phenotypes (e.g. Refs 17, 18, 19, 20). Due to AIRE’s pattern of gene expression (thymus, lymph nodes, and fetal liver), AIRE may be involved in other autoimmune/endocrine diseases such as autoimmune polyendocrinopathy syndrome type 2, isolated Addison’s disease, or idiopathic hypoparathyroidism (21).

In summary, we have identified two previously undescribed mutations and 12 polymorphisms in the putative transcription factor gene, AIRE, responsible for APECED. Two of these mutations, R257X and the 13-bp deletion, occur in patients of different geo-ethnic origin and on different chromosomal haplotypes, implying the reoccurrence of these mutations by independent mutational events. These results should facilitate the genetic diagnosis of APECED and the investigation of the role of AIRE in other autoimmune-endocrine disorders.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Patient Selection and DNA Isolation
A total of 15 apparently unrelated patients were studied. Nine were of North-Italian origin, 2 were from Britain, 1 was from New Zealand, and 3 were of Finnish origin. No consanguinity was documented in any of the families. The patients were referred to Tampere University Central Hospital (Tampere, Finland) or at Department of Pediatrics, University of Padova (Padova, Italy) or the Pediatric Department, Gaslini Institute (Genova, Italy) and blood samples were obtained after informed consent and after approval of the research projects by the Hospital Ethics Committees. The diagnosis was based on typical clinical findings and, in some cases, the presence of autoantibodies against steroidogenic enzymes P450c17 and/or P450scc. Peripheral blood lymphocytes isolated from patient blood or lymphoblastoid cell lines from APECED patients were used for extraction of DNA using standard protocols.

Mutation Analyses
All 14 exons of the AIRE gene (GenBank accession no. AB006684) were PCR amplified using the PCR primers and conditions shown in Table 4. In general, PCR amplification was carried out in a 30-cycle PCR, in which the initial 5-min denaturation of template DNA at 94 C was followed by a "touch-down" program for 10 cycles: 94 C/20 sec, 65 C/20 sec (-1 C/cycle), 72 C/1 min, and then 20 cycles: 94 C/20 sec, 55 C/20 sec, 72 C/1 min, in a volume of 20 µl containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 0.2 mM of each deoxynucleoside triphosphate (dNTP), 1.5 mM MgCl₂, 0.5 µM of each primer, 10% dimethysulfoxide, and 0.5 U of Taq polymerase. For some exons, presumably due to their GC-rich nature, the use of Pfu polymerase, and/or 50% deaza-GTP in place of dGTP and a special buffer (16.6 mM NH₄SO₄, 67 mM Tris-HCl, pH 8.8, 6.7 mM MgCl₂, 10 mM ß-mercaptoethanol, 1.25 mM of each dNTP) aided in successful amplification (Table 4). Exon 9 gave the best results with the QIAGEN (Chatsworth, CA) Kit Taq Polymerase with Q-solution and 5% dimethylsulfoxide. PCR products were purified using Qiaquick PCR purification columns according to manufacturer’s instructions, and their nucleotide sequences were determined in both orientations using all the primers listed with standard dye-terminator protocols for the ABI377 automated sequencer (ABI Advanced Biotechnologies, Columbia, MD). The R257X mutation was also analyzed by TaqI restriction digestions as described (11). Haplotype analysis for the markers D21S1912 and PFKL was performed as described (10).

	ACKNOWLEDGMENTS

 
We thank the families with APECED for their collaboration and donation of samples.

	FOOTNOTES

 
Address requests for reprints to: Hamish S. Scott, Laboratory of Human Molecular Genetics, Department of Genetics and Microbiology, University of Geneva Medical School, 1 rue Michel Servet, 1211 Geneva 4, Switzerland. E-mail: Hamish.Scott{at}medecine.unige.ch

The laboratory of S.E.A. is supported by grants from the Swiss FNRS 31.33965.92 and 31–40500.94 and the European Union (EU)/Office Fédéral de l’Education et de la Science (OFES) CT93–0015, funds from the University and Cantonal Hospital of Geneva, and the Associazione Malattie Rare "Mauro Baschirotto." M.D.L. is a trainee of the Graduate Program of Molecular and Cellular Biology of the University of Geneva Medical School. The laboratory of K.J.E.K. was supported by EU Biomed2 program CA grant (BNH4-CT95–0729) and by grants from Tampere University Hospital Medical Research Fund. The laboratory of N.S. was supported by Funds for Human Genome Sequencing Project from the Japan Science and Technology Corporation (JST); Grants in Aid for Scientific Research on Priority Areas and Scientific Research from the Ministry of Education, Science, Sports and Culture of Japan; and Fund for "Research for the Future" Program from the Japan Society for the Promotion of Science (JSPS).

Received for publication December 19, 1997. Revision received April 6, 1998. Accepted for publication April 10, 1998.

	REFERENCES

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 

1. Ahonen P 1985 Autoimmune polyendocrinopathy-candidosis-ectodermal dystrophy (APECED): autosomal recessive inheritance. Clin Genet 27:535–542[Medline]
2. Ahonen P, Myllärniemi S, Sipilä I, Perheentupa J 1990 Clinical variation of autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) in a series of 68 patients. N Engl J Med 322:1829–1836[Abstract]
3. Aaltonen J, Björses P, Sandkuijl L, Perheentupa J, Peltonen L 1994 An autosomal locus causing autoimmune disease: autoimmune polyglandular disease type I assigned to chromosome 21. Nat Genet 8:83–87[CrossRef][Medline]
4. Zlotogora J, Shapiro MS 1992 Polyglandular autoimmune syndrome type I among Iranian Jews. J Med Genet 29:824–826[Abstract/Free Full Text]
5. Uibo R, Aavik E, Peterson P, Perheentupa J, Aranko S, Pelkonen R, Krohn K 1994 Autoantibodies to cytochrome P450scc, P450c17 and P450c21 in autoimmune polyglandular disease types I and II and in isolated Addison’s disease. J Clin Endocrinol Metab 78:323–328[Abstract]
6. Krohn K, Uibo R, Aavik E, Peterson P, Savilahti K 1992 Identification by molecular cloning of an autoantigen associated with Addison’s disease as steroid 17 alpha-hydroxylase. Lancet 339:770–773[CrossRef][Medline]
7. Tuomi T, Bjorses P, Falorni A, Partanen J, Perheentupa J, Lernmark A, Miettinen A 1996 Antibodies to glutamic acid decarboxylase and insulin-dependent diabetes in patients with APS1. J Clin Endocrinol Metab. 81:1488–1493
8. Husebye ES, Gebre-Medhin G, Tuomi T, Perheentupa J, Landin-Olsson M, Gustafsson J, Rorsman F, Kampe O 1997 Autoantibodies against aromatic L-amino acid decarboxylase in autoimmune polyendocrine syndrome type I. J Clin Endocrinol Metab 82:147–150[Abstract/Free Full Text]
9. Clemente MG, Obermayer-Straub P, Meloni A, Strassburg CP, Arangino V, Tukey RH, de Virgiliis S, Manns MP 1997 Cytochrome P450 1A2 is a hepatic autoantigen in autoimmune polyglandular syndrome type 1. J Clin Endocrinol Metab 82:1353–1361[Abstract/Free Full Text]
10. Björses P, Aaltonen J, Vikman A, Perheentupa J, Ben-Zion G, Chiumello G, Dahl N, Heideman P, Hoorweg-Nijman JJ, Mathivon L, Mullis PE, Pohl M, Ritzen M, Romeo G, Shapiro MS, Smith CS, Solyom J, Zlotogora J, Peltonen L 1996 Genetic homogeneity of autoimmune polyglandular disease type I. Am J Hum Genet 59:879–886[Medline]
11. Nagamine K, Peterson P, Scott HS, Kudoh J, Minoshima S, Heino M, Krohn K, Lalioti MD, Mullis PE, Antonarakis SE, Kawasaki K, Asakawa S, Ito F, Shimizu N 1997 Positional cloning of the APECED gene. Nat Genet 17:393–398[CrossRef][Medline]
12. Finnish-German APECED Consortium 1997 An autoimmune disease, APECED, caused by mutations in a novel gene featuring two PHD-type zinc-finger domains. Nat Genet 17:399–403[CrossRef][Medline]
13. Youssoufian H, Kazazian Jr HH, Phillips DG, Aronis S, Tsiftis G, Brown VA, Antonarakis SE 1986 Recurrent mutations in haemophilia A give evidence for CpG mutation hotspots. Nature 324:380–382[CrossRef][Medline]
14. Scott HS, Litjens T, Hopwood JJ, Morris CP 1992 A common mutation for mucopolysaccharidosis type I associated with a severe Hurler syndrome phenotype. Hum Mutat 1:103–108[CrossRef][Medline]
15. Cooper DN, Krawczak M, Antonarakis SE 1995 The nature and mechanisms of human gene mutation. In: Scriver CR, Beaudet AL, Sly WS, Valle D (eds) The Metabolic and Molecular Basis of Inherited Disease, ed 7. McGraw Hill, New York, pp 259–291
16. Kouskoff V, Korganow AS, Duchatelle V, Degott C, Benoist C, Mathis D 1996 Organ-specific disease provoked by systemic autoimmunity. Cell 87:811–822[CrossRef][Medline]
17. Romeo G, McKusick VA 1994 Phenotypic diversity, allelic series and modifier genes. Nat Genet 7:451–453[CrossRef][Medline]
18. Radhakrishna U, Wild A, Grzeschik KH, Antonarakis SE 1997 Mutation in GLI3 in postaxial polydactyly type A. Nat Genet 17:269–271[CrossRef][Medline]
19. Biesecker LG 1997 Strike three for GLI3. Nat Genet 17:259–260[CrossRef][Medline]
20. Horton WA 1997 Fibroblast growth factor receptor 3 and the human chondrodysplasias. Curr Opin Pediatr 9:437–442[Medline]
21. Aubourg P 1997 The expanding world of primary adrenal insufficiencies. Eur J Endocrinol 137:10–12[CrossRef][Medline]

This article has been cited by other articles:

				F.-X. Hubert, S. A. Kinkel, P. E. Crewther, P. Z. F. Cannon, K. E. Webster, M. Link, R. Uibo, M. K. O'Bryan, A. Meager, S. P. Forehan, et al. Aire-Deficient C57BL/6 Mice Mimicking the Common Human 13-Base Pair Deletion Mutation Present with Only a Mild Autoimmune Phenotype J. Immunol., March 15, 2009; 182(6): 3902 - 3918. [Abstract] [Full Text] [PDF]

				M. Dittmar, M. Ide, M. Wurm, and G. J Kahaly Early onset of polyglandular failure is associated with HLA-DRB1*03. Eur. J. Endocrinol., July 1, 2008; 159(1): 55 - 60. [Abstract] [Full Text] [PDF]

				A. Maret, C. Ding, S. L. Kornfield, and M. A. Levine Analysis of the GCM2 Gene in Isolated Hypoparathyroidism: A Molecular and Biochemical Study J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1426 - 1432. [Abstract] [Full Text] [PDF]

				T. Lambe, J. C. H. Leung, T. Bouriez-Jones, K. Silver, K. Makinen, T. L. Crockford, H. Ferry, J. V. Forrester, and R. J. Cornall CD4 T Cell-Dependent Autoimmunity against a Melanocyte Neoantigen Induces Spontaneous Vitiligo and Depends upon Fas-Fas Ligand Interactions. J. Immunol., September 1, 2006; 177(5): 3055 - 3062. [Abstract] [Full Text] [PDF]

				K. Trebusak Podkrajsek, N. Bratanic, C. Krzisnik, and T. Battelino Autoimmune Regulator-1 Messenger Ribonucleic Acid Analysis in a Novel Intronic Mutation and Two Additional Novel AIRE Gene Mutations in a Cohort of Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy Patients J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4930 - 4935. [Abstract] [Full Text] [PDF]

				C. Cocco, A. Meloni, F. Boi, G. Pinna, R. Possenti, S. Mariotti, and G.-L. Ferri Median Eminence Dopaminergic Nerve Terminals: A Novel Target in Autoimmune Polyendocrine Syndrome? J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4108 - 4111. [Abstract] [Full Text] [PDF]

				R Bergholdt, J Nerup, and F Pociot Fine mapping of a region on chromosome 21q21.11-q22.3 showing linkage to type 1 diabetes J. Med. Genet., January 1, 2005; 42(1): 17 - 25. [Abstract] [Full Text] [PDF]

				G. S. Eisenbarth and P. A. Gottlieb Autoimmune Polyendocrine Syndromes N. Engl. J. Med., May 13, 2004; 350(20): 2068 - 2079. [Full Text] [PDF]

				F. Buzi, R. Badolato, C. Mazza, S. Giliani, L. D. Notarangelo, G. Radetti, A. Plebani, and L. D. Notarangelo Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy Syndrome: Time to Review Diagnostic Criteria? J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3146 - 3148. [Abstract] [Full Text] [PDF]

				C. Betterle, C. Dal Pra, F. Mantero, and R. Zanchetta Autoimmune Adrenal Insufficiency and Autoimmune Polyendocrine Syndromes: Autoantibodies, Autoantigens, and Their Applicability in Diagnosis and Disease Prediction Endocr. Rev., June 1, 2002; 23(3): 327 - 364. [Abstract] [Full Text] [PDF]

				A. Meloni, R. Perniola, V. Faa, E. Corvaglia, A. Cao, and M. C. Rosatelli Delineation of the Molecular Defects in the AIRE Gene in Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy Patients from Southern Italy J. Clin. Endocrinol. Metab., February 1, 2002; 87(2): 841 - 846. [Abstract] [Full Text] [PDF]

				F. Cetani, G. Barbesino, S. Borsari, E. Pardi, L. Cianferotti, A. Pinchera, and C. Marcocci A Novel Mutation of the Autoimmune Regulator Gene in an Italian Kindred with Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy, Acting in a Dominant Fashion and Strongly Cosegregating with Hypothyroid Autoimmune Thyroiditis J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 4747 - 4752. [Abstract] [Full Text] [PDF]

				M. Halonen, M. Pelto–Huikko, P. Eskelin, L. Peltonen, I. Ulmanen, and M. Kolmer Subcellular Location and Expression Pattern of Autoimmune Regulator (Aire), the Mouse Orthologue for Human Gene Defective in Autoimmune Polyendocrinopathy Candidiasis Ectodermal Dystrophy (APECED) J. Histochem. Cytochem., February 1, 2001; 49(2): 197 - 208. [Abstract] [Full Text]

				T. Halbach, N. Scheer, and W. Werr Transcriptional activation by the PHD finger is inhibited through an adjacent leucine zipper that binds 14-3-3 proteins Nucleic Acids Res., September 15, 2000; 28(18): 3542 - 3550. [Abstract] [Full Text] [PDF]

				T. Ishii, Y. Suzuki, N. Ando, N. Matsuo, and T. Ogata Novel Mutations of the Autoimmune Regulator Gene in Two Siblings with Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy J. Clin. Endocrinol. Metab., August 1, 2000; 85(8): 2922 - 2926. [Abstract] [Full Text]

				B. Vaidya, H. Imrie, D. R. Geatch, P. Perros, S. G. Ball, P. H. Baylis, D. Carr, S. J. Hurel, R. A. James, W. F. Kelly, et al. Association Analysis of the Cytotoxic T Lymphocyte Antigen-4 (CTLA-4) and Autoimmune Regulator-1 (AIRE-1) Genes in Sporadic Autoimmune Addison's Disease J. Clin. Endocrinol. Metab., February 1, 2000; 85(2): 688 - 691. [Abstract] [Full Text]

				L. Ward, J. Paquette, E. Seidman, C. Huot, F. Alvarez, P. Crock, E. Delvin, O. Kämpe, and C. Deal Severe Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy in an Adolescent Girl with a Novel AIRE Mutation: Response to Immunosuppressive Therapy J. Clin. Endocrinol. Metab., March 1, 1999; 84(3): 844 - 852. [Abstract] [Full Text]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Scott, H. S. Articles by Antonarakis, S. E. Search for Related Content PubMed PubMed Citation Articles by Scott, H. S. Articles by Antonarakis, S. E. Pubmed/NCBI databases Gene GEO Profiles HomoloGene OMIM Protein UniGene Genetics Home Reference