Molecular Endocrinology 12 (8): 1120-1132
Copyright © 1998 by The Endocrine Society
Positive and Negative Discrimination of Estrogen Receptor Agonists and Antagonists Using Site-Specific DNA Recombinase Fusion Proteins
Colin Logie1,
Mark Nichols2,
Kathy Myles,
John W. Funder and
A. Francis Stewart
Gene Expression Program European Molecular Biology Laboratory
(C.L., M.N., A.F.S.) 69117 Heidelberg, Germany Baker
Medical Research Institute (K.M., J.W.F.) Prahran, 3181, Victoria,
Australia
 |
ABSTRACT
|
|---|
Activation of the estrogen receptor (ER) by
hormone involves at least two steps. First, hormone binding initially
relieves repression, a property imposed on ER in cis by its
ligand-binding domain (EBD). Subsequently, the derepressed ER binds
specific genomic sites and regulates transcription. In addition to the
natural hormone, ER binds a broad range of ligands that evoke a
spectrum of responses ranging from full ER activation by agonists to
partial activation and inhibition by partial or complete antagonists.
How these different ligands evoke different ER responses remains
unclear. To address this issue, we have developed a nontranscriptional
assay for ER ligand responsiveness based on Flp recombinase/human EBD
protein chimeras. These fusion proteins transduce the transient event
of ligand binding into a permanent DNA change in a human cell line
system. A fusion protein including ER D, E, and F domains was activated
by all the ER ligands tested, demonstrating that both agonists and
antagonists serve to relieve initial repression, and that differences
between them lie downstream in the activation pathway. Mutant variants
of the Flp-ER protein that distinguish between agonists and
antagonists, and a mutant EBD that selectively lost the ability to
respond to 17ß-estradiol but not to other ligands, were also
identified. Thus, agonists and antagonists can be functionally
distinguished in a nontranscriptional assay.
 |
INTRODUCTION
|
|---|
The nuclear receptor family of transcription factors includes
members with transcriptional activities altered by the binding of
small, lipophilic ligands. Ligands that activate the receptors are
termed agonists, and those that bind with high affinity, but do not
induce full transcriptional activity, are termed antagonists. Agonist
binding induces conformational changes in the receptor to alter its
interaction with associated proteins so that it passes from a repressed
state to a transcriptionally active state. Antagonist binding also
induces conformational changes, but some of the subsequent events
required for full transcriptional activity do not take place. The
proteins that are involved in mediating the transcriptional activity of
nuclear receptors have been the subject of many recent studies, with
some found to encode acetylases and associated factors (1, 2, 3, 4). The
protein-protein interactions that characterize the repressed and
antagonist-bound states are more uncertain.
There are two current explanations for repression of nuclear receptor
activity in the absence of bound agonist. The first invokes
interactions of receptor with a ubiquitous complex of heat shock
proteins, termed the Hsp90 complex (5, 6, 7, 8, 9). This situation is thought to
be restricted to vertebrate steroid receptors, a specialized class of
nuclear receptors that homodimerize upon ligand binding (10, 11, 12). The
second arises from recent work on the mechanism of transcriptional
repression mediated by unliganded nuclear receptors, such as thyroid
and retinoic acid receptors, that heterodimerize with the retinoid X
receptor both in the presence or absence of bound ligand. In the
absence of bound ligand these heterodimers appear to interact with
transcriptional corepressors, notably N-CoR (nuclear receptor
corepressor) and SMRT (silencing mediator for retinoid and thyroid
hormone receptors) (13, 14, 15), recently shown to recruit deacetylase
complexes (16, 17). Whereas receptors that heterodimerize are not
believed to interact with the Hsp90 complex (18), the relationship of
steroid receptors with corepressors is yet to be fully established
(19). Similarly, the effect of antagonist binding on interactions with
the Hsp90 complex and corepressors remains unclear (20, 21).
To investigate the relationship between repression, agonists, and
antagonists of the human estrogen receptor (ER), we have developed a
functional approach that does not rely on the transcriptional
consequences of ligand binding. The approach exploits our earlier
observation that the ligand-binding domains (LBDs) of steroid receptors
can regulate the enzyme activity of site-specific recombinases (SSRs)
when expressed as SSR/LBD fusion proteins (22, 23). In the absence of a
bound agonist, we showed that the enzyme activity of an SSR, Flp
recombinase, was repressed when expressed as a fusion protein with
estrogen, androgen, or glucocorticoid LBDs. Binding of cognate agonists
derepressed Flp recombinase activity, permitting site-specific
recombination of recombination reporter substrates. By this means, the
functional consequence of ligand binding is derepression of an
accurately measurable enzyme activity, which does not, theoretically,
rely on the further protein-protein interactions involved in steroid
receptor transcriptional repression, activation, interference, or
cross-talk regulation.
We have thus examined the ability of a selection of estrogen agonists
and antagonists to derepress Flp/ER fusion proteins (Flp/EBDs) in a
mammalian cell line. All the estrogens tested derepress Flp recombinase
activity of Flp/wild-type (wt) and G400V EBD fusion proteins in a
titratable manner reflecting the binding affinities of these two EBDs.
This verifies that the antagonists tested release the EBD from its
initially repressed state. These antagonists must therefore perturb
further downstream events in ER action. We then used the Flp/EBD assay
to examine the phenotypes of EBD mutations chosen from the literature
to selectively impair other EBD functions including ligand specificity.
Thereby Flp/EBD fusion proteins that distinguish between agonists and
antagonists by functional classification were identified. We also
describe a new mutant EBD that responds to all the synthetic ligands
tested but not the natural hormone, estradiol.
 |
RESULTS
|
|---|
Experimental Design
The experiments described used a derivative of 293 human embryonic
kidney cells, 293R10, stably modified to contain a single chromosomal
copy of a Flp recombination substrate as described (Ref. 22 and Fig. 1A
). The parent 293 cells do not express
endogenous ER as determined by both Western blotting and
[3H]estradiol binding (data not shown). Recombination can
be assessed by expression of ß-galactosidase, reflecting deletion of
the neomycin resistance gene and concomitant juxtaposition of the
ß-galactosidase gene to the CMV (cytomegalovirus) promoter, or more
accurately by Southern blotting. Clone 293R10 was electroporated with
various Flp/EBD constructs and random integrants isolated by selection
for hygromycin resistance (Fig. 1A
). Typically, more than 30% of
primary hygromycin-resistant colonies showed induction of
ß-galactosidase expression upon ligand induction (Fig. 1B
).
Isolation, expansion, and characterization of individual colonies also
demonstrated that more than 30% showed ligand inducibility (data not
shown). For each of the different Flp/EBD constructs used, six
independent, hygromycin-resistant, ligand-inducible clones were
characterized for ligand induction. Whereas the kinetics of
recombination mediated by Flp/EBDs varied somewhat within each set of
six, presumably a reflection of differing expression levels from the
different Flp/EBD genomic integration sites, the profile of
responsiveness to the different ligands did not (data not shown). From
each set of six, we chose those clones that showed the most rapid
kinetics of recombination upon ligand induction for further
analysis.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 1. Strategy of Stable Cell Experiments with Flp/EBDs
A, The stable cell line system is depicted showing 1) the unrecombined
state, 2) the recombined state before loss of the excised circle
bearing the neomycin resistance gene, and 3) the recombined state after
loss of the excised circle. In each of the three cell states, the
Flp/EBD fusion protein expression vector is shown above and consists of
a bidirectional promoter that expresses the hygromycin resistance
(hygro) and the Flp/EBD genes. In the uppermost panel,
the recombination substrate is shown below and consists of the
constitutively active SV40 promoter (arrow); the two Flp
recombination targets (FRTs) are indicated by arrowheads
separated by the neomycin resistance gene (neo) followed by the
ß-galactosidase gene (lacZ). Also shown are the two probes used for
Southern analysis (1 2 ) and the BamHI restriction
sites, shown as small open circles, used for the
Southern analyses of Figs. 3 , 4 , 5 , and 7 . Before recombination, a
5.4-kb BamHI fragment is detected by probe 2. Recombination excises the fragment and a BamHI between
the FRTs site to yield a 8.2-kb fragment detected by probe 2. The
excised circle is linearized by BamHI to yield a 1.3-kb
fragment. B, Primary hygromycin-resistant colonies transformed with a
Flp/EBDG400V expression vector were cultured for 10 days in
the presence or in the absence of 100 nM 17ß-estradiol
and stained for ß-galactosidase activity to monitor induced
recombination.
|
|
Flp/EBD D/E/F Fusion Proteins Are Activated by ER Agonists and
Antagonists
Initial time course experiments were performed with Flp/EBD fusion
proteins that included the D, E, and F domains of the ER, corresponding
to human ER amino acids 251595. Two EBDs were used, wt
(Flp/EBDDEF) and the G400V variant
(Flp/EBDG400V), which shows a loss of affinity for ligands
at 37 C (24). (Table 1
contains a
complete listing of Flp/EBD fusion proteins used in this study.) At
saturating concentrations of ligand, both estradiol and the antagonist
ICI 164,384 induced recombination mediated by Flp/EBDG400V
with approximately linear kinetics for the first 5 h until 50%
total recombination was achieved (Fig. 2
, A
and B). As discussed previously (22), the rate of recombination beyond
50% is inherently nonlinear, and therefore we harvested the cells
4 h after ligand administration for Southern analysis to ensure
that percent induced recombination directly reflected ligand-induced
derepression. Short time course experiments with both
Flp/EBDG400V and Flp/EBDDEF using saturating
concentrations of six different ligands also showed that the 4-h time
point was within the linear range for all six ligands (Fig. 2
, C and
D).

View larger version (42K):
[in this window]
[in a new window]
|
Figure 2. Time Courses of Ligand-Induced Flp/EBD
Recombination
A, Southern blots of time courses of recombination mediated by
Flp/EBDG400V after induction with 100 nM
estradiol or 300 nM ICI 164,384 as indicated. Probe 2 shown
on Fig. 1A was used on NdeI-restricted genomic DNA as
previously described (22 ). Before recombination the NdeI
band is 4.9 kb. Recombination reduces this band to 3.6 kb. The
asterisk marks an artifactual band, probably the result
of relaxed cleavage specificity by NdeI. B, Plot showing
PhosphorImager quantification of the Southern analysis shown in panel A
presented as counts in the recombined chromosomal product divided by
the sum of recombined and unrecombined counts. C, Plot showing a short
time course of recombination mediated by Flp/EBDG400V
induced by saturating concentrations (1 µM) of five
different ligands as indicated. D, Plot showing a short time course of
recombination mediated by Flp/EBDDEF induced by saturating
concentrations (1 µM) of six different ligands as
indicated. Note that the time course started from 16% recombination.
The plots of panels B, C, and D were based on PhosphorImager
quantification of Southern blots such as shown in panel A.
|
|
Whereas stable clones expressing Flp/EBDG400V showed no
detectable recombination in the absence of added ligand (Ref. 22 and
Fig. 2A
, lane 1), this was not the case for stable clones expressing
Flp/EBDDEF. In the experiment shown in Fig. 2D
, 16%
recombination was evident before ligand addition, even though the cells
were cultured in phenol red-free, charcoal-stripped FCS medium. We
attribute this background recombination to the residual presence of
estrogens and the accumulation of recombined products during cellular
expansion from the initial stable colonies. Although the recombined
chromosomal product continued to accumulate during further culture of
this cell line, the excised, circular product was lost, or diluted, as
expected (22).
To evaluate how accurately Flp/EBD D/E/F fusion proteins
transduce ligand binding into DNA recombination, titration experiments
with a selection of ER ligands were performed. Figure 3A
presents a composite figure showing
results from five different Southern blots. For brevity, the other
lanes of these blots, corresponding to the different titration points,
have been omitted, and only the 1 µM titration points are
shown. Figure 3B
plots the full data set and shows that all ligands
induce recombination mediated by Flp/EBDG400V in a
titratable manner that closely reflects the known affinities of the
G400V EBD for these ligands. Similarly, titrations with
Flp/EBDDEF also showed the expected dose responses
according to known affinity values for the wt human receptor (data not
shown). EC50 values for these Flp/EBDs, taken as the ligand
concentration required to induce half-maximal recombination, are
summarized in Table 2
.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 3. Ligand Titrations with Cells Expressing
Flp/EBDG400V or Flp/EBD251595 Show that
Flp/EBD D/E/F Proteins Accurately Transduce Ligand Binding to DNA
Recombination
A, Southern blot analyses of ligand titrations of cells expressing
Flp/EBDG400V. BamHI-restricted chromosomal
recombination substrate and product were visualized with probe 2 (Fig. 1A ). Only the 1 µM lanes, taken from five different
Southern blots, plus the no-ligand lane, are shown. B, Plot of
ligand-induced recombination using data from all lanes of the five
titration experiments. Quantification and plotting were as described in
Fig. 2 . The symbols used for the different ligands are denoted and are
the same for Figs. 4 , 5 , and 7 . Solid symbols denote
agonists; open symbols denote antagonists; ,
estradiol; , DES; , hexestrol; , raloxifene; , ICI 182,780;
, 4-hydroxy tamoxifen.
|
|
View this table:
[in this window]
[in a new window]
|
Table 2. Dissociation Constants of Flp/EBDs (determined
by Scatchard Analysis), Compared with the Concentration at which
Half-Maximal Recombination was Induced for the Six Ligands Used
Here.
|
|
To establish that recombination mediated by Flp/EBD
D/E/Fs faithfully reflects ligand binding, extracts of the Flp/EBD
D/E/F stable cell lines were made and assessed for ligand binding in
competition experiments with [3H]estradiol. Table 2
shows
these IC50 data and includes Kd values for the
full-length ER taken from the literature. Ligand binding affinity of
Flp/EBDDEF is very similar to that of full-length ER, and
no significant distortions of affinity are introduced either by
omission of the ER A/B and C domains or by the fusion of Flp
recombinase to the ER D/E/F domains.
The results presented in Figs. 2
and 3
and Table 2
show that all
ligands tested induced recombination regardless of their agonist
[estradiol, diethylstilbestrol (DES), hexestrol], antagonist
(raloxifene, ICI 164,384, ICI 182,780, 4-hydroxytamoxifen), steroidal
(estradiol, ICI 164,384, ICI 182,780), or nonsteroidal (DES, hexestrol,
raloxifene, 4-hydroxytamoxifen) character, in a manner that simply
reflects ligand binding. All these ligands thus serve to release ER
from its initially repressed condition, and differences between these
ER agonists and antagonists must lie later in the pathway of ER
activation. This conclusion, in a mammalian cell model, extends our
previous work based on Flp/EBD experiments in yeast (23) where the
partial exclusion of certain ligands by the yeast cell surface
influenced the dose-response curve.
Although all ligands tested release Flp/EBD D/E/Fs from the initially
repressed condition, the antagonists raloxifene, and to a lesser
extent, ICI 164,384 and ICI 182,780, consistently induced faster rates
of recombination at early time points than did the agonists or
4-hydroxytamoxifen (Figs. 2
and 3
). This may reflect the failure of
these antagonists to allow other protein-protein interactions not
favoring efficient recombination, such as homodimerization or
interactions with transcriptional cofactors.
Mutations That Impair ER Homodimerization Do Not Discriminate
between Agonists and Antagonists
In the ER activation pathway, release from the initially repressed
condition permits ER to dimerize. Since release from initial repression
is promoted by all of the agonists and antagonists used here, we asked
whether agonists and antagonists could be distinguished by their
ability to promote homodimerization. Mutations previously described
that impair homodimerization of mouse ER (25), an interpretation that
has gained recent support from the EBD crystal structure (26), were
introduced into Flp/human EBD D/E/F fusion proteins
(Flp/EBDL507R and Flp/EBDR503A/L507R). Figure 4
shows that all six ligands induce
recombination mediated by these Flp/mutant EBDs, albeit at
substantially higher ligand concentrations. Ligand binding experiments
in extracts (Table 2
) showed that recombination efficacy approximately
reflected ligand binding. The reduction of binding affinity shown by
these dimerization mutants, together with the recent EBD crystal
structure evidence that the dimerization surface is distinct from the
ligand binding pocket (26), suggests that ER dimerization stabilizes
ligand binding. Interactions between ligand binding and dimerization
have been described for other nuclear receptors, notably ecdysone and
retinoid X receptors (27, 28) and the vitamin D receptor (29). As with
both wt and G400V EBDs, raloxifene induced faster rates of initial
recombination for the L507R and R503A,L507R dimerization mutants than
the other ligands. The persistence of this profile suggests that these
agonists and antagonists cannot be differentiated on the basis of
selective effects on homodimerization. These data also indicate that
relief from initial repression is not reliant on dimerization. We also
note that these dimerization mutations do not result in increased
Flp/EBD recombinase enzyme activity, indicating that EBD
homodimerization has little deleterious affect on Flp enzyme
activity.
Flp/EBD Fusion Proteins That Distinguish between Agonists and
Antagonists
The above data show that ligand responsiveness of Flp/EBD fusion
proteins mainly reflects the first step in the ER activation pathway,
relief from initial repression. Those steps after dimerization in the
activation pathway, where agonists and antagonists elicit different
responses, are not reported by this assay. Consequently we employed
known EBD mutations to establish Flp/EBDs that could discriminate
between agonists and antagonists.
The EBD encompasses at least amino acids 305548 (26, 30). The
Flp/EBD fusions used above included amino acids 251595, encompassing
not only the EBD (E domain) but also the D domain (251304) and the F
domain (549595). As we showed previously (23), removal of most of the
D domain (here deletion of amino acids 251303) to create
Flp/EBD
D produced a Flp/EBD that was activatable only by
agonists and not antagonists, but showed less recombinase activity than
other Flp/EBD fusions after 4 h of ligand stimulation (Fig. 5
, A and B). In yeast, we also observed the
exclusive nature of Flp/EBD
D responsiveness to agonists,
as well as the reduced amount of recombinase activity after induction
(23). Competition experiments showed that activation by agonists is
abolished in a dose-dependent fashion by the three ER antagonists (Fig. 5C
). Therefore, as expected given the presence of the complete ER E
domain, Flp/EBD
D has not lost the capacity to bind
antagonist; rather, it fails to be activated by antagonist binding.
This was confirmed by binding experiments (Table 2
). Western analysis
showed that none of the antagonists had a negative effect on the steady
state levels of Flp/EBD
D (data not shown).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 5. Ligand Titration and Competition Experiments with
Cells Expressing Flp/EBD Proteins That Discriminate between Agonists
and Antagonists
A, Southern analysis of recombination induced by 1 µM of
the six indicated ligands in a recombination reporter cell line
expressing Flp/EBD D. BamHI-restricted
chromosomal recombination substrate and product were visualized with
probe 2 (Fig. 1A ). Only the 1 µM lanes, taken from six
different Southern blots, plus the no-ligand lane, are shown. The
asterisk denotes a nonspecific band. B, Plot of ligand-induced
recombination using data from all lanes of the six titration
experiments of panel A. Quantification and plotting were as described
in Fig. 2 . C, Estradiol (3 nM)-induced recombination
mediated by Flp/EBD D is competed by coincubation for
4 h with increasing concentrations of raloxifene,
hydroxytamoxifen, and ICI 182,780 as shown. D, Southern analysis of
recombination induced by 1 µM of the six indicated
ligands in a recombination reporter cell line expressing
Flp/EBDG521R. BamHI-restricted chromosomal
recombination substrate and product were visualised with probe 2 (Fig. 1A ). Only the 1 µM lanes, taken from six different
Southern blots, plus the no-ligand lane, are shown. E, Plot of
ligand-induced recombination using data from all lanes of the six
titration experiments of panel A. Quantification and plotting were as
described in Fig. 2 . F, Failure of 3 mM estradiol, DES, or
hexestrol to compete for Flp/EBDG521R recombination induced
by 300 nM ICI 182,780. See Fig. 3 for ligand symbols.
|
|
A Flp/EBD Fusion Protein That Is Only Activated by ER
Antagonists
The equivalent of a previously described mouse ER point mutation,
glycine 521 to arginine (31), was introduced into the human EBD D/E/F
to create Flp/EBDG521R. Consistent with the mouse ER
results (31), Flp/EBDG521R is not activated by estradiol
but is activated by 4-hydroxytamoxifen (Fig. 5
, D and E).
Interestingly, Flp/EBDG521R is also activatable by the
other two antagonists, ICI 182,780 and raloxifene, but not by two
nonsteroidal agonists, DES and hexestrol. This mutation therefore
appears to discriminate between agonists and antagonists on the basis
of their functional classification as transcriptional activators.
Competition experiments between ICI 182,780 and the three agonists
(Fig. 5F
) and ligand binding studies in extracts indicate that the
G521R mutant has not only lost the ability to bind agonists but also
considerable affinity for antagonists. We note, however, that 1
µM DES does produce a low level of recombination (Fig. 5D
, lane 3), indicating that at high concentrations some binding can
occur. The presence of an arginine at position 521 therefore appears to
be more important for agonist than antagonist binding.
Selective Loss of Estradiol Activation
The experiments described above show that agonists and antagonists
can be differentiated on a functional, nontranscriptional, basis.
Although synthetic estrogens can be broadly categorized as either
agonists or antagonists, several lines of evidence demonstrate that
further subcategories exist (32). We have therefore begun to identify
mutations that would permit further subcategorization of ligands based
on the Flp/EBD assay. Flp/EBD mutants that systematically combined
glycine or valine at amino acid 400 with glycine, valine, or arginine
at amino acid 521 were generated. These Flp/EBD D/E/Fs were tested in a
transient expression assay for qualitative responsiveness to ligand
(Fig. 6
).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 6. Transient Expression of Flp/EBD D/E/F Fusion
Proteins Carrying Mutant Combinations at ER Amino Acids 400 and 521
E25B2/B2 cells were lipofected with either wt (G400/G521), G400V,
G521V, G521R, G400V/G521V, or G400V/G521R Flp/EBDs and treated with 1
µM ligands, or ethanol vehicle, as indicated. E2,
estradiol; HEX, hexestrol; DES, diethylstilbestrol; RAL, raloxifene.
The histograms show number of lacZ-positive cells
counted in 1 cm2 after a 50-h expression period. Note the
different values on the ordinate.
|
|
As expected, the wt, G400V, and G521R EBDs (Flp/EBDDEF,
Flp/EBDG400V, Flp/EBDG521R) showed ligand
inducibility consistent with the data from the stable expression
experiments above. Notably, the wild type fusion protein again showed
more background recombination than the G400V fusion protein. The G521V
mutation displayed some loss of responsiveness to estradiol; however,
when this mutation was combined with G400V (G400V/G521V), selective
loss of responsiveness to estradiol was observed. The G400V/G521R
double mutant was unresponsive to any ligand, probably because both
mutations alone substantially reduce ligand affinity and, when
combined, reduce it further. In other experiments, these fusion
proteins were examined for differential responsiveness to raloxifene,
4-hydroxytamoxifen, and ICI 182,780. No significant differences were
observed (data not shown). None of these EBDs displayed a loss of
initial repression, with the possible exception of the G521V
mutation.
Cells stably expressing the G400V/G521V protein
(Flp/EBDG400V/G521V) were next examined for ligand
inducibility in dose-response experiments (Fig. 7
). Loss of responsiveness to estradiol was
confirmed, and competition experiments showed that estradiol could not
block induction by DES (Fig. 7C
) or raloxifene (data not shown),
demonstrating that the G400V/G521V EBD has lost the ability to bind
estradiol.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 7. A Mutation Selectively Insensitive to Estradiol
A, Southern analysis of ligand titrations with cells expressing
Flp/EBDG400V/G521V. BamHI-restricted
chromosomal recombination substrate and product were visualized with
probe 2 (Fig. 1A ). Only the 1 µM lanes, taken from six
different Southern blots, plus the no-ligand lane, are shown. B, Plot
of ligand-induced recombination using data from all lanes of the six
titration experiments of panel A. Quantification and plotting were as
described in Fig. 2 . C, Excess estradiol (1 µM) does not
inhibit Flp/EBDG400V/G521V recombination induced by a
subsaturating concentration (30 nM) of DES.
|
|
 |
DISCUSSION
|
|---|
Both Agonists and Antagonists Relieve Initial Repression of Flp
Activity Imposed by wt and G400V EBDs
In addition to sharing the property of binding hormones, steroid
receptors display a repressor function that can impart ligand
dependency onto certain other proteins when expressed as fusion
proteins (33). It is believed that the protein cis-repressor
function of the steroid receptors is mediated via complex formation
with chaperone molecules, most notably Hsp90 (5, 6, 7, 8, 9, 18, 34). This dogma
has been challenged in the case of the progesterone receptor on the
basis that it is almost exclusively located in the nucleus even in the
absence of cognate ligands, while Hsp90 is cytoplasmic (35), leaving
the exact mechanism of protein cis-repression open to
question.
To analyze protein cis-repression and ligand specificities
of the human ER, we explored the characteristics of the Flp/EBD fusion
system (22). This receptor assay does not rely on the transcription
activation function of the LBD as it measures site-specific recombinase
activity, making it possible to directly observe the consequence of
ligand binding on the cis-repressor function of the EBD.
In agreement with data generated in a yeast system (23), all the
ligands we tested, including the pure ER antagonist ICI 182,780 (36),
the mixed agonist/antagonists 4-hydroxytamoxifen (37), and raloxifene
(38), induced Flp recombination in this human cell line-based system.
These results imply that all estrogens, regardless of their
agonist/antagonist potential in vivo, induce a structural
conformation that releases the EBD from its initially repressed
condition. Furthermore, our data indicate that the second step in the
ER activation pathway, dimerization, is also not a point of
discrimination between the agonists and antagonists used here.
Therefore, the crucial difference between these agonists and
antagonists lies later in the pathway of ER activation.
In contrast to the near complete reliance on ligand for
Flp/EBDG400V and other mutant EBD forms, we found that the
wt EBD, including the hinge region from residues 251303, does not
repress Flp fully in mammalian cells. Background ER activity has been
repeatedly observed in transcription studies with the wtER in mammalian
cells and is likely due to the presence of trace quantities of
estrogens in phenol red-free, charcoal-stripped, mammalian cell culture
medium, as used here, combined with the high ligand sensitivity of the
wtEBD (Refs. 24, 39 and references therein). In support of this
explanation, the Flp/EBDDEF protein used here shows good
repression in the absence of ligand induction in yeast (23).
Distinction between Agonists and Antagonists by Class
After dimerization, activated ER affects several
transcriptional responses through classic and nonclassic DNA response
elements as well as by cross-talk regulation (for reviews, see Refs. 10, 12). It is probable that different agonists and antagonists elicit
different responses via these various mechanisms (12, 32, 40). Steroid
ligand selectivity is well illustrated by the spectrum of ligand/ER
responses. ER is activated by its cognate agonist, estradiol. The
synthetic nonsteroid estrogen agonist, DES, also elicits agonist
responses, although DES derivatives have been shown to be partial
agonists given their abilities to evoke different subsets of agonist
responses (41). 4-Hydroxytamoxifen has been shown to be a partial
antagonist based on promoter context variability (37) and cross-talk
regulation (42). Interestingly, the partial antagonist raloxifene shows
a different profile of agonism/antagonism to that of 4-hydroxytamoxifen
based on uterine, cholesterol, and bone responses (38, 43, 44). ICI
182,780 is described as a complete ER antagonist because it blocks all
ER agonist activities (36) although ICI 182,780 agonist activity has
been described for ER mutations in the C terminus of the E domain (45, 46). Further evidence for a spectrum of ER responses elicited by
different ligands has been presented (32). The fact that ER responses
are differentially elicited by different ligands suggests that binding
of ligand by ER results in different conformations each reflecting the
particular ligand bound (12, 26, 32, 47).
Given the complexities involved in ER signaling after dimerization, the
use of transcriptional assays to categorize ER ligands into more
refined classes than agonist or antagonist will reflect both the
activity of the ligand and the experimental design of the
transcriptional assays. Since we have shown (
Figs. 24

) that Flp/EBD
responses are largely independent of those steps in the ER activation
pathway at which agonists and antagonists are transcriptionally
discriminated, we reasoned that Flp/mutant EBDs that discriminate
between agonists and antagonists must do so on the basis of inherent
structural properties of ligand binding by the EBD. Appropriate mutant
EBDs were identified and cell lines established that discriminate
between agonists and antagonists by class. To permit further,
nontranscriptional classification of ER ligands, mutant EBDs that
permit subcategorization of ligands were sought and a mutant EBD
(G400V, G521V), that distinguishes between the natural agonist,
estradiol, and synthetic ligands was identified. This demonstrates that
particular ligand specificity mutations can be distinguished in the
Flp/EBD assay. The identification of other ligand specificity mutations
and their use in Flp/EBDs should provide a structural,
nontranscriptional basis for an even more refined categorization of ER
ligands.
Antagonism in the Context of Flp/EBD Fusions
Deletion of amino acids 251303 resulted in a Flp/EBD fusion
protein that was activatable by the three ER agonists, estradiol, DES,
and hexestrol, but only very weakly by the three antagonists tested.
The steroid nature of the ligands was not a determining factor since
two of the agonists, DES and hexestrol, are not steroid ring compounds,
and one of the antagonists, ICI 182,780, has a steroid structure. By
ligand binding experiments in cellular extracts and ligand competition
experiments, we showed that Flp/EBD
D is able to bind
agonists and antagonists; however, only agonists induce Flp
recombination. Lack of recombinase induction by antagonists was not due
to selective protein degradation since Western blot analysis
demonstrated that no ligand had significant effects on expression
levels of any of the Flp/EBD fusion proteins used here (data not
shown). The molecular basis of agonist/antagonist discrimination by
Flp/EBD
D has been addressed elsewhere (47).
Ligand-Selective EBD Mutations
Two Flp/EBD fusions that show ligand binding selectivity are
documented here. Both involve changes at amino acid 521. The first is
the G521R mutation previously described to retain 4-hydroxytamoxifen
but not estradiol binding (31), and the second combines G521V with
G400V. Glycine 521 is located in a region close to bound ligand in the
crystal structures of the liganded human ER, retinoic acid receptor,
and thyroid receptor LBDs (26, 48, 49). Glycine 400 is located at the
start of a ß-turn, which when mutated to valine, causes a general
destabilization of ligand interactions at 37 C (24). Both regions have
been implicated previously in ER and glucocorticoid receptor ligand
binding, functionally and by chemical cross-linking (31, 50, 51, 52, 53).
Our observations with the G521R mutation extend previous work to
establish that this mutation discriminates between agonists and
antagonists by class. This is due to a loss of agonist binding, as
demonstrated by binding and competition experiments, suggesting that
the G521R mutation disrupts a part of the ligand binding pocket that is
essential to bind ER agonists, but not antagonists, with high
affinity.
The G400V/G521V EBD appears to be unable to bind estradiol since high
levels of estradiol did not compete for
Flp/EBDG400V/G521V-mediated recombination elicited by
subsaturating concentrations of DES. Flp/EBDG400V/G521V,
however, responds to all of the other ER ligands we tested, regardless
of their agonist or antagonist activity in terms of the full-length ER.
Thus a glycine at position 521 appears critical to accommodate
estradiol in the ligand binding pocket. However, ICI 182,780 is
identical to estradiol except for the addition of the long side chain
at the seventh carbon of the steroid ring structure. ICI 182,780 is not
excluded from the EBDG400V/G521V, implying that it, like
raloxifene, binds via an extra set of residues in the EBD (26).
The use of SSR/LBD fusions allows direct studies of ligand/LBD
combinations that are transcriptionally inactive. This permits analysis
of the cis-repression activity of LBDs and can provide a new
way to classify steroid receptor ligands as agonists or antagonists.
Further work is required to exploit the ligand discriminatory potential
of Flp/EBD fusions to further distinguish different subclasses of
antagonists (pure vs. tamoxifen-like vs.
raloxifene-like antagonists) and agonists [steroid vs.
nonsteroid and their enantiomers (54, 55)]. Another potentially
fruitful avenue of research may involve the use of SSR/LBDs in the
study of the cis-repressor activities of other members of
the steroid and nuclear receptor superfamily.
 |
MATERIALS AND METHODS
|
|---|
DNA Constructs
Table 1
is a complete list of Flp/EBD fusion proteins used in
this study. The Flp/EBDG400V construct has been described
in pHFE (22). To reintroduce a glycine at position 400 of the cloned
human EBD (24), the NcoI-BglII fragment spanning
this mutation was replaced with the homologous
NcoI-BglII fragment from the mouse ER (25). This
did not result in any further alterations in the amino acid
sequence.
To delete the D domain of the estrogen-binding domain, an intermediate
plasmid, p44HE1 (22), was cut with BamHI and EagI
and a linker with the sequence ggatccaacagcctggccttgtccctgacggccg was
inserted, thus deleting amino acids 251303 of the EBD.
All point mutations were generated by the method of Barettino et
al. (56). The sequence of the 5'-primer was ccaccgagtcctggacaag
and that of the 3'-primer was ccagtagtaggttgaggccgttg. The template for
the first round of amplification cycles using one of the mutagenic
primers and the 3'- primer was p44HE2. The second template, lacking
sequence homology for the 3'-primer, was pHFE1. The products of the
second PCR reactions were digested with StuI and Eco47III to
generate a 499-bp fragment that was inserted into
StuI-Eco47III linearized pHFE2. The sequences of the
mutagenic primers encoding the G521R, G521V, mutations were
gg.cac.atg.agC.aac.aaa.AgA.atg.gag (MaeIII) and
gg.cac.atg.agt.aac.aaa.gTc.atg.gag (not tagged) respectively.
Uppercase nucleotides represent point mutations; the
restriction site that was mutated to tag the mutation is
underlined, and the restriction enzyme is written in between
brackets after each primer sequence.
Cell Lines and Cell Culture Conditions
Cell culture conditions were as previously described
including charcoal stripping of the FCS (22). The Flp recombination
reporter cell line 293R10 was generated by electroporation of linear
pNeoßGal plasmid (23) into 293 cells as previously described. 293R10
cells were transformed with pHFE plasmids bearing the indicated EBD
mutations to generate recombination reporter cell lines as described
(22). All the data points shown on any one graph in the present paper
were collected in the course of a single experiment to allow accurate
comparisons in recombinase activities.
Southern Analysis
Southern analyses were carried out as described (22),
except that 0.86% agarose gels were used. The genomic DNA samples from
P1.4 cells (22) used for Fig. 2A
were digested with NdeI,
which generates 4.9- and 3.6-kb fragments from recombined and
unrecombined pNEOßGAL loci, respectively. DNAs for all the other
Southern blots presented in this study were digested with
BamHI, which gives the following restriction fragments:
unrecombined, 5.4 kb; recombined, 8.2 kb; circle, 1.3 kb.
Transient Expression
The CV1-derived Flp excision recombination reporter cell line
E25B2/B2 (22) was grown on glass coverslips and transfected overnight
with 5 µg Flp/EBD expression vectors by means of lipofectamine
(Boehringer Mannheim, Mannheim, Germany), according to the
manufacturers instructions. Ligand exposure lasted 50 h.
Histochemical detection of ß-galactosidase was performed as before
(22).
 |
ACKNOWLEDGMENTS
|
|---|
We thank P.-O. Angrand, Frank Buchholz, Sophie Chabanis, Hinrich
Gronemeyer, Dino Moras, and Henk Stunnenberg for discussions; V. Kumar,
P. Chambon, and P. Danielian for plasmids; and A. Wakeling (Zeneca
Pharmaceuticals) for providing ICI 164,384 and ICI 182,780.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: A. Francis Stewart, European Molecular Biology Laboratory, Gene Expression Program, Meyerhofstrasse 1, D-69117 Heidelberg, Germany.
This work was supported in part by EU-BIOMED Grant BMH496-0181 (to
A.F.S.).
1 Present address: University of Massachusetts Medical Center, Program
in Molecular Medicine, Worcester, Massachusetts 01604. 
2 Present address: University of Pittsburgh Cancer
Institute, Pittsburgh, Pennsylvania 15213. 
Received for publication February 3, 1998.
Revision received April 27, 1998.
Accepted for publication April 30, 1998.
 |
REFERENCES
|
|---|
-
Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B,
Lin SC, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP
integrator complex mediates transcriptional activation and AP-1
inhibition by nuclear receptors. Cell 85:403414[CrossRef][Medline]
-
Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone
acetyltransferases. Cell 87:953959[CrossRef][Medline]
-
Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L,
Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator
ACTR is a novel histone acetyltransferase and forms a multimeric
activation complex with P/CAF and CBP/p300. Cell 90:569580[CrossRef][Medline]
-
Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen
CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, OMalley BW 1997 Steroid
receptor coactivator-1 is a histone acetyltransferase. Nature 389:194198[CrossRef][Medline]
-
Bohen SP 1995 Hsp90 mutants disrupt glucocorticoid receptor
ligand binding and destabilize aporeceptor complexes. J Biol Chem 270:2943329438[Abstract/Free Full Text]
-
Bohen SP, Yamamoto KR 1993 Isolation of Hsp90 mutants by
screening for decreased steroid receptor function. Proc Natl Acad Sci
USA 90:1142411428[Abstract/Free Full Text]
-
Chang HC, Nathan DF, Lindquist S 1997 In vivo
analysis of the Hsp90 co-chaperone Sti1 (p60). Mol Cell Biol 17:318325[Abstract]
-
Nathan DF, Lindquist S 1995 Mutational analysis of Hsp90
function: interactions with a steroid receptor and a protein kinase.
Mol Cell Biol 15: 39173925
-
Kimura Y, Yahara I, Lindquist S 1995 Role of the protein
chaperone YDJ1 in establishing Hsp90-mediated signal transduction
pathways. Science 268: 13621365
-
Beato M, Herrlich P, Schutz G 1995 Steroid hormone receptors:
many actors in search of a plot. Cell 83:851857[CrossRef][Medline]
-
Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G,
Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The
nuclear receptor superfamily: the second decade. Cell 83:835839[CrossRef][Medline]
-
Stewart AF, Logie C, Nichols M 1996 Regulation of nuclear
receptors by agonists and antagonists. Curr Opin Endocrinol Diabet 3:397402
-
Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa
R, Ryan A, Kamei Y, Soderstrom M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated
by a nuclear receptor co-repressor. Nature 377:397404[CrossRef][Medline]
-
Chen JD, Evans RM 1995 A transcriptional co-repressor that
interacts with nuclear hormone receptors. Nature 377:454457[CrossRef][Medline]
-
Soderstrom M, Vo A, Heinzel T, Lavinsky RM, Yang WM, Seto E,
Peterson DA, Rosenfeld MG, Glass CK 1997 Differential effects of
nuclear receptor corepressor (N-CoR) expression levels on retinoic acid
receptor-mediated repression support the existence of dynamically
regulated corepressor complexes. Mol Endocrinol 11:682692[Abstract/Free Full Text]
-
Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty
CD, Torchia J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN,
Rose DW, Glass CK, Rosenfeld MG 1997 A complex containing N-CoR, mSin3
and histone deacetylase mediates transcriptional repression. Nature 387:4348[CrossRef][Medline]
-
Nagy L, Kao HY, Chakravarti D, Lin RJ, Hassig CA, Ayer DE,
Schreiber SL, Evans RM 1997 Nuclear receptor repression mediated by a
complex containing SMRT, mSin3A, and histone deacetylase. Cell 89:373380[CrossRef][Medline]
-
Dalman FC, Sturzenbecker LJ, Levin AA, Lucas DA, Perdew GH,
Petkovitch M, Chambon P, Grippo JF, Pratt WB 1991 Retinoic acid
receptor belongs to a subclass of nuclear receptors that do not form
"docking" complexes with hsp90. Biochemistry 30:56055608[CrossRef][Medline]
-
Smith CL, Nawaz Z, OMalley BW 1997 Coactivator and
corepressor regulation of the agonist/antagonist activity of the mixed
antiestrogen, 4-hydroxytamoxifen. Mol Endocrinol 11:657666[Abstract/Free Full Text]
-
Jackson TA, Richer JK, Bain DL, Takimoto GS, Tung L, Horwitz
KB 1997 The partial agonist activity of antagonist-occupied steroid
receptors is controlled by a novel hinge domain-binding coactivator
L7/SPA and the corepressors N-CoR or SMRT. Mol Endocrinol 11:693705[Abstract/Free Full Text]
-
Segnitz B, Gehring U 1990 Mechanism of action of a steroidal
antiglucocorticoid in lymphoid cells. J Biol Chem 265:27892796[Abstract/Free Full Text]
-
Logie C, Stewart AF 1995 Ligand-regulated site-specific
recombination. Proc Natl Acad Sci USA 92:940944
-
Nichols M, Rientjes JMJ, Logie C, Stewart AF 1997 FLP
recombinase/estrogen receptor fusion proteins require the receptor D
domain for responsiveness to antagonists, but not agonists. Mol
Endocrinol 11:950961[Abstract/Free Full Text]
-
Tora L, Mullick A, Metzger D, Ponglikitmongkol M, Park I,
Chambon P 1989 The cloned human oestrogen receptor contains a mutation
which alters its hormone binding properties. EMBO J 8:19811986[Medline]
-
Fawell SE, Lees JA, White R, Parker MG 1990 Characterization
and colocalization of steroid binding and dimerization activities in
the mouse estrogen receptor. Cell 60:953962[CrossRef][Medline]
-
Brzozowski AM, Pike ACW, Dauter Z, Hubbard EH, Bonn T,
Engström O, Öhman L, Greene GL, Gustafsson J, Carlquist M 1997 Molecular basis of agonism and antagonism in the estrogen
receptor. Nature 389:753758[CrossRef][Medline]
-
Thomas HE, Stunnenberg HG, Stewart AF 1993 Heterodimerization
of the Drosophila ecdysone receptor with retinoid X receptor and
ultraspiracle. Nature 362:471475[CrossRef][Medline]
-
Yao TP, Forman BM, Jiang Z, Cherbas L, Chen JD, McKeown M,
Cherbas P, Evans RM 1993 Functional ecdysone receptor is the product of
the EcR and ultraspiracle genes. Nature 366:476479[CrossRef][Medline]
-
Cheskis B, Freedman LP 1994 Ligand modulates the conversion of
DNA-bound vitamin D3 receptor (VDR) homodimers into VDR-retinoid X
receptor heterodimers. Mol Cell Biol 14:33293338[Abstract/Free Full Text]
-
Wurtz J-M, Bourguet W, Renaud J-P, Vivat V, Chambon P, Moras
D, Gronemeyer H 1996 A canonical structure for the ligand-binding
domain of nuclear receptors. Nature Struct Biol 3:8794[CrossRef][Medline]
-
Danielian PS, White R, Hoare SA, Fawell SE, Parker MG 1993 Identification of residues in the estrogen receptor that confer
differential sensitivity to estrogen and hydroxytamoxifen. Mol
Endocrinol 7:232240[Abstract]
-
McDonnell DP, Clemm DL, Hermann T, Goldman ME, Pike JW 1995 Analysis of estrogen receptor function in vitro reveals
three distinct classes of antiestrogens. Mol Endocrinol 9:659669[Abstract]
-
Mattioni T, Louvion JF, Picard D 1994 Regulation of protein
activities by fusion to steroid binding domains. Methods Cell Biol 43:335352
-
Scherrer LC, Picard D, Massa E, Harmon JM, Simons Jr SS,
Yamamoto KR, Pratt WB 1993 Evidence that the hormone binding domain of
steroid receptors confers hormonal control on chimeric proteins by
determining their hormone-regulated binding to heat-shock protein 90.
Biochemistry 32:53815386[CrossRef][Medline]
-
Tuohimaa P, Pekki A, Blauer M, Joensuu T, Vilja P, Ylikomi T 1993 Nuclear progesterone receptor is mainly heat shock protein 90-free
in vivo. Proc Natl Acad Sci USA 90:58485852[Abstract/Free Full Text]
-
Wakeling AE, Bowler J 1992 ICI 182,780, a new antioestrogen
with clinical potential. J Steroid Biochem Mol Biol 43:173177[CrossRef][Medline]
-
Berry M, Metzger D, Chambon P 1990 Role of the two activating
domains of the oestrogen receptor in the cell-type and promoter-context
dependent agonistic activity of the anti-oestrogen 4-hydroxytamoxifen.
EMBO J 9:28112818[Medline]
-
Black LJ, Sato M, Rowley ER, Magee DE, Bekele A, Williams DC,
Cullinan GJ, Bendele R, Kauffman RF, Bensch WR, Frolik CA, Termine
JD, Bryant HU 1994 Raloxifene (LY139481 HCI) prevents bone loss and
reduces serum cholesterol without causing uterine hypertrophy in
ovariectomized rats. J Clin Invest 93:6369
-
Mattick S, Glenn K, de Haan G, Shapiro DJ 1997 Analysis of
ligand dependence and hormone response element synergy in transcription
by estrogen receptor. J Steroid Biochem Mol Biol 60:285294[CrossRef][Medline]
-
Katzenellenbogen JA, OMalley BW, Katzenellenbogen BS 1996 Tripartite steroid hormone receptor pharmacology: interaction with
multiple effector sites as a basis for the cell- and promoter-specific
action of these hormones. Mol Endocrinol 10:119131[CrossRef][Medline]
-
Korach KS, Fox-Davies C, Quarmby VE, Swaisgood MH 1985 Diethylstilbestrol metabolites and analogs. Biochemical probes for
differential stimulation of uterine estrogen responses. J Biol
Chem 260:1542015426[Abstract/Free Full Text]
-
Webb P, Lopez GN, Uht RM, Kushner PJ 1995 Tamoxifen activation
of the estrogen receptor/AP-1 pathway: potential origin for the
cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol 9:443456[Abstract]
-
Grese TA, Sluka JP, Bryant HU, Cullinan GJ, Glasebrook AL,
Jones CD, Matsumoto K, Palkowitz AD, Sato M, Termine JD, Winter MA,
Yang NN, Dodge JA 1997 Molecular determinants of tissue selectivity in
estrogen receptor modulators. Proc Natl Acad Sci USA 94:1410514110[Abstract/Free Full Text]
-
Evans G, Bryant HU, Magee D, Sato M, Turner RT 1994 The
effects of raloxifene on tibia histomorphometry in ovariectomized rats.
Endocrinology 134:22832288[Abstract]
-
Mahfoudi A, Roulet E, Dauvois S, Parker MG, Wahli W 1995 Specific mutations in the estrogen receptor change the properties of
antiestrogens to full agonists. Proc Natl Acad Sci USA 92:42064210[Abstract/Free Full Text]
-
Montano MM, Ekena K, Krueger KD, Keller AL, Katzenellenbogen
BS 1996 Human estrogen receptor ligand activity inversion mutants:
receptors that interpret antiestrogens as estrogens and estrogens as
antiestrogens and discriminate among different antiestrogens. Mol
Endocrinol 10:230242[Abstract]
-
Nichols M, Rientjes JMJ, Stewart AF 1998 Different positioning
of the ligand binding domain helix 12 and the F domain of the estrogen
receptor accounts for functional differences between agonists and
antagonists. EMBO J 17:765773[CrossRef][Medline]
-
Renaud JP, Rochel N, Ruff M, Vivat V, Chambon P, Gronemeyer H,
Moras D 1995 Crystal structure of the RAR-gamma ligand-binding domain
bound to all-trans retinoic acid. Nature 378:681689[CrossRef][Medline]
-
Wagner RL, Apriletti JW, McGrath ME, West BL, Baxter JD,
Fletterick RJ 1995 A structural role for hormone in the thyroid hormone
receptor. Nature 378:690697[CrossRef][Medline]
-
Simons Jr SS, Pumphrey JG, Rudikoff S, Eisen HJ 1987 Identification of cysteine 656 as the amino acid of hepatoma tissue
culture cell glucocorticoid receptors that is covalently labeled by
dexamethasone 21-mesylate. J Biol Chem 262:96769680[Abstract/Free Full Text]
-
Harlow KW, Smith DN, Katzenellenbogen JA, Greene GL,
Katzenellenbogen BS 1989 Identification of cysteine 530 as the covalent
attachment site of an affinity-labeling estrogen (ketononestrol
aziridine) and antiestrogen (tamoxifen aziridine) in the human estrogen
receptor. J Biol Chem 264:1747617485[Abstract/Free Full Text]
-
Ekena K, Weis KE, Katzenellenbogen JA, Katzenellenbogen BS 1996 Identification of amino acids in the hormone binding domain of the
human estrogen receptor important in estrogen binding. J Biol Chem 271:2005320059[Abstract/Free Full Text]
-
Ekena K, Weis KE, Katzenellenbogen JA, Katzenellenbogen BS 1997 Different residues of the human estrogen receptor are involved in
the recognition of structurally diverse estrogens and antiestrogens.
J Biol Chem 272:50695075[Abstract/Free Full Text]
-
Chae K, Gibson MK, Korach KS 1991 Estrogen receptor
stereochemistry: ligand binding orientation and influence on biological
activity. Mol Pharmacol 40:806811[Abstract]
-
Bocchinfuso WP, Korach KS 1997 Estrogen receptor residues
required for stereospecific ligand recognition and activation. Mol
Endocrinol 11:587594[Abstract/Free Full Text]
-
Barettino D, Feigenbutz M, Valcarcel R, Stunnenberg HG 1994 Improved method for PCR-mediated site-directed mutagenesis. Nucleic
Acids Res 22:541542[Free Full Text]
-
Katzenellenbogen JA, Hsiung HM, Carlson KE, McGuire WL, Kraay
RJ, Katzenellenbogen BS 1975 Iodohexestrols. II. Characterization of
the binding and estrogenic activity of iodinated hexestrol derivatives,
in vitro and in vivo. Biochemistry 14:17421750[CrossRef][Medline]
-
Jones CD, Jevnikar MG, Pike AJ, Peters MK, Black LJ, Thompson
AR, Falcone JF, Clemens JA 1984 Antiestrogens. 2. Structure-activity
studies in a series of 3-aroyl-2-arylbenzo(b)thiophene derivatives
leading to (6-hydroxy-2-(4-hydroxyphenyl)benzo(b)thien-3-yl)
(4-(2-(1-piperidinyl)ethoxy)-phenyl)methanone hydrochloride
(LY156758), a remarkably effective estrogen antagonist with only
minimal intrinsic estrogenicity. J Med Chem 27:10571066[CrossRef][Medline]
-
Robertson DW, Katzenellenbogen JA, Long DJ, Rorke EA,
Katzenellenbogen BS 1982 Tamoxifen antiestrogens. A comparison of the
activity, pharmacokinetics, and metabolic activation of the cis and
trans isomers of tamoxifen. J Steroid Biochem 16:113[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
R. Paulmurugan, A. Tamrazi, J. A. Katzenellenbogen, B. S. Katzenellenbogen, and S. S. Gambhir
A Human Estrogen Receptor (ER){alpha} Mutation with Differential Responsiveness to Nonsteroidal Ligands: Novel Approaches for Studying Mechanism of ER Action
Mol. Endocrinol.,
July 1, 2008;
22(7):
1552 - 1564.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Paulmurugan and S. S. Gambhir
An intramolecular folding sensor for imaging estrogen receptor-ligand interactions
PNAS,
October 24, 2006;
103(43):
15883 - 15888.
[Abstract]
[Full Text]
[PDF]
|
 |
|