help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Logie, C.
Right arrow Articles by Stewart, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Logie, C.
Right arrow Articles by Stewart, A. F.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*DIETHYLSTILBESTROL
*ESTRADIOL
*HEXESTROL
*TAMOXIFEN
Molecular Endocrinology 12 (8): 1120-1132
Copyright © 1998 by The Endocrine Society

Positive and Negative Discrimination of Estrogen Receptor Agonists and Antagonists Using Site-Specific DNA Recombinase Fusion Proteins

Colin Logie1, Mark Nichols2, Kathy Myles, John W. Funder and A. Francis Stewart

Gene Expression Program European Molecular Biology Laboratory (C.L., M.N., A.F.S.) 69117 Heidelberg, Germany Baker Medical Research Institute (K.M., J.W.F.) Prahran, 3181, Victoria, Australia


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Activation of the estrogen receptor (ER) by hormone involves at least two steps. First, hormone binding initially relieves repression, a property imposed on ER in cis by its ligand-binding domain (EBD). Subsequently, the derepressed ER binds specific genomic sites and regulates transcription. In addition to the natural hormone, ER binds a broad range of ligands that evoke a spectrum of responses ranging from full ER activation by agonists to partial activation and inhibition by partial or complete antagonists. How these different ligands evoke different ER responses remains unclear. To address this issue, we have developed a nontranscriptional assay for ER ligand responsiveness based on Flp recombinase/human EBD protein chimeras. These fusion proteins transduce the transient event of ligand binding into a permanent DNA change in a human cell line system. A fusion protein including ER D, E, and F domains was activated by all the ER ligands tested, demonstrating that both agonists and antagonists serve to relieve initial repression, and that differences between them lie downstream in the activation pathway. Mutant variants of the Flp-ER protein that distinguish between agonists and antagonists, and a mutant EBD that selectively lost the ability to respond to 17ß-estradiol but not to other ligands, were also identified. Thus, agonists and antagonists can be functionally distinguished in a nontranscriptional assay.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The nuclear receptor family of transcription factors includes members with transcriptional activities altered by the binding of small, lipophilic ligands. Ligands that activate the receptors are termed agonists, and those that bind with high affinity, but do not induce full transcriptional activity, are termed antagonists. Agonist binding induces conformational changes in the receptor to alter its interaction with associated proteins so that it passes from a repressed state to a transcriptionally active state. Antagonist binding also induces conformational changes, but some of the subsequent events required for full transcriptional activity do not take place. The proteins that are involved in mediating the transcriptional activity of nuclear receptors have been the subject of many recent studies, with some found to encode acetylases and associated factors (1, 2, 3, 4). The protein-protein interactions that characterize the repressed and antagonist-bound states are more uncertain.

There are two current explanations for repression of nuclear receptor activity in the absence of bound agonist. The first invokes interactions of receptor with a ubiquitous complex of heat shock proteins, termed the Hsp90 complex (5, 6, 7, 8, 9). This situation is thought to be restricted to vertebrate steroid receptors, a specialized class of nuclear receptors that homodimerize upon ligand binding (10, 11, 12). The second arises from recent work on the mechanism of transcriptional repression mediated by unliganded nuclear receptors, such as thyroid and retinoic acid receptors, that heterodimerize with the retinoid X receptor both in the presence or absence of bound ligand. In the absence of bound ligand these heterodimers appear to interact with transcriptional corepressors, notably N-CoR (nuclear receptor corepressor) and SMRT (silencing mediator for retinoid and thyroid hormone receptors) (13, 14, 15), recently shown to recruit deacetylase complexes (16, 17). Whereas receptors that heterodimerize are not believed to interact with the Hsp90 complex (18), the relationship of steroid receptors with corepressors is yet to be fully established (19). Similarly, the effect of antagonist binding on interactions with the Hsp90 complex and corepressors remains unclear (20, 21).

To investigate the relationship between repression, agonists, and antagonists of the human estrogen receptor (ER), we have developed a functional approach that does not rely on the transcriptional consequences of ligand binding. The approach exploits our earlier observation that the ligand-binding domains (LBDs) of steroid receptors can regulate the enzyme activity of site-specific recombinases (SSRs) when expressed as SSR/LBD fusion proteins (22, 23). In the absence of a bound agonist, we showed that the enzyme activity of an SSR, Flp recombinase, was repressed when expressed as a fusion protein with estrogen, androgen, or glucocorticoid LBDs. Binding of cognate agonists derepressed Flp recombinase activity, permitting site-specific recombination of recombination reporter substrates. By this means, the functional consequence of ligand binding is derepression of an accurately measurable enzyme activity, which does not, theoretically, rely on the further protein-protein interactions involved in steroid receptor transcriptional repression, activation, interference, or cross-talk regulation.

We have thus examined the ability of a selection of estrogen agonists and antagonists to derepress Flp/ER fusion proteins (Flp/EBDs) in a mammalian cell line. All the estrogens tested derepress Flp recombinase activity of Flp/wild-type (wt) and G400V EBD fusion proteins in a titratable manner reflecting the binding affinities of these two EBDs. This verifies that the antagonists tested release the EBD from its initially repressed state. These antagonists must therefore perturb further downstream events in ER action. We then used the Flp/EBD assay to examine the phenotypes of EBD mutations chosen from the literature to selectively impair other EBD functions including ligand specificity. Thereby Flp/EBD fusion proteins that distinguish between agonists and antagonists by functional classification were identified. We also describe a new mutant EBD that responds to all the synthetic ligands tested but not the natural hormone, estradiol.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Experimental Design
The experiments described used a derivative of 293 human embryonic kidney cells, 293R10, stably modified to contain a single chromosomal copy of a Flp recombination substrate as described (Ref. 22 and Fig. 1AGo). The parent 293 cells do not express endogenous ER as determined by both Western blotting and [3H]estradiol binding (data not shown). Recombination can be assessed by expression of ß-galactosidase, reflecting deletion of the neomycin resistance gene and concomitant juxtaposition of the ß-galactosidase gene to the CMV (cytomegalovirus) promoter, or more accurately by Southern blotting. Clone 293R10 was electroporated with various Flp/EBD constructs and random integrants isolated by selection for hygromycin resistance (Fig. 1AGo). Typically, more than 30% of primary hygromycin-resistant colonies showed induction of ß-galactosidase expression upon ligand induction (Fig. 1BGo). Isolation, expansion, and characterization of individual colonies also demonstrated that more than 30% showed ligand inducibility (data not shown). For each of the different Flp/EBD constructs used, six independent, hygromycin-resistant, ligand-inducible clones were characterized for ligand induction. Whereas the kinetics of recombination mediated by Flp/EBDs varied somewhat within each set of six, presumably a reflection of differing expression levels from the different Flp/EBD genomic integration sites, the profile of responsiveness to the different ligands did not (data not shown). From each set of six, we chose those clones that showed the most rapid kinetics of recombination upon ligand induction for further analysis.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. Strategy of Stable Cell Experiments with Flp/EBDs

A, The stable cell line system is depicted showing 1) the unrecombined state, 2) the recombined state before loss of the excised circle bearing the neomycin resistance gene, and 3) the recombined state after loss of the excised circle. In each of the three cell states, the Flp/EBD fusion protein expression vector is shown above and consists of a bidirectional promoter that expresses the hygromycin resistance (hygro) and the Flp/EBD genes. In the uppermost panel, the recombination substrate is shown below and consists of the constitutively active SV40 promoter (arrow); the two Flp recombination targets (FRTs) are indicated by arrowheads separated by the neomycin resistance gene (neo) followed by the ß-galactosidase gene (lacZ). Also shown are the two probes used for Southern analysis (1 2 ) and the BamHI restriction sites, shown as small open circles, used for the Southern analyses of Figs. 3Go, 4Go, 5Go, and 7Go. Before recombination, a 5.4-kb BamHI fragment is detected by probe 2. Recombination excises the fragment and a BamHI between the FRTs site to yield a 8.2-kb fragment detected by probe 2. The excised circle is linearized by BamHI to yield a 1.3-kb fragment. B, Primary hygromycin-resistant colonies transformed with a Flp/EBDG400V expression vector were cultured for 10 days in the presence or in the absence of 100 nM 17ß-estradiol and stained for ß-galactosidase activity to monitor induced recombination.

 
Flp/EBD D/E/F Fusion Proteins Are Activated by ER Agonists and Antagonists
Initial time course experiments were performed with Flp/EBD fusion proteins that included the D, E, and F domains of the ER, corresponding to human ER amino acids 251–595. Two EBDs were used, wt (Flp/EBDDEF) and the G400V variant (Flp/EBDG400V), which shows a loss of affinity for ligands at 37 C (24). (Table 1Go contains a complete listing of Flp/EBD fusion proteins used in this study.) At saturating concentrations of ligand, both estradiol and the antagonist ICI 164,384 induced recombination mediated by Flp/EBDG400V with approximately linear kinetics for the first 5 h until 50% total recombination was achieved (Fig. 2Go, A and B). As discussed previously (22), the rate of recombination beyond 50% is inherently nonlinear, and therefore we harvested the cells 4 h after ligand administration for Southern analysis to ensure that percent induced recombination directly reflected ligand-induced derepression. Short time course experiments with both Flp/EBDG400V and Flp/EBDDEF using saturating concentrations of six different ligands also showed that the 4-h time point was within the linear range for all six ligands (Fig. 2Go, C and D).


View this table:
[in this window]
[in a new window]
 
Table 1. Names and Description of Flp/EBD Fusion Proteins Used

 


View larger version (42K):
[in this window]
[in a new window]
 
Figure 2. Time Courses of Ligand-Induced Flp/EBD Recombination

A, Southern blots of time courses of recombination mediated by Flp/EBDG400V after induction with 100 nM estradiol or 300 nM ICI 164,384 as indicated. Probe 2 shown on Fig. 1AGo was used on NdeI-restricted genomic DNA as previously described (22 ). Before recombination the NdeI band is 4.9 kb. Recombination reduces this band to 3.6 kb. The asterisk marks an artifactual band, probably the result of relaxed cleavage specificity by NdeI. B, Plot showing PhosphorImager quantification of the Southern analysis shown in panel A presented as counts in the recombined chromosomal product divided by the sum of recombined and unrecombined counts. C, Plot showing a short time course of recombination mediated by Flp/EBDG400V induced by saturating concentrations (1 µM) of five different ligands as indicated. D, Plot showing a short time course of recombination mediated by Flp/EBDDEF induced by saturating concentrations (1 µM) of six different ligands as indicated. Note that the time course started from 16% recombination. The plots of panels B, C, and D were based on PhosphorImager quantification of Southern blots such as shown in panel A.

 
Whereas stable clones expressing Flp/EBDG400V showed no detectable recombination in the absence of added ligand (Ref. 22 and Fig. 2AGo, lane 1), this was not the case for stable clones expressing Flp/EBDDEF. In the experiment shown in Fig. 2DGo, 16% recombination was evident before ligand addition, even though the cells were cultured in phenol red-free, charcoal-stripped FCS medium. We attribute this background recombination to the residual presence of estrogens and the accumulation of recombined products during cellular expansion from the initial stable colonies. Although the recombined chromosomal product continued to accumulate during further culture of this cell line, the excised, circular product was lost, or diluted, as expected (22).

To evaluate how accurately Flp/EBD D/E/F fusion proteins transduce ligand binding into DNA recombination, titration experiments with a selection of ER ligands were performed. Figure 3AGo presents a composite figure showing results from five different Southern blots. For brevity, the other lanes of these blots, corresponding to the different titration points, have been omitted, and only the 1 µM titration points are shown. Figure 3BGo plots the full data set and shows that all ligands induce recombination mediated by Flp/EBDG400V in a titratable manner that closely reflects the known affinities of the G400V EBD for these ligands. Similarly, titrations with Flp/EBDDEF also showed the expected dose responses according to known affinity values for the wt human receptor (data not shown). EC50 values for these Flp/EBDs, taken as the ligand concentration required to induce half-maximal recombination, are summarized in Table 2Go.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Ligand Titrations with Cells Expressing Flp/EBDG400V or Flp/EBD251–595 Show that Flp/EBD D/E/F Proteins Accurately Transduce Ligand Binding to DNA Recombination

A, Southern blot analyses of ligand titrations of cells expressing Flp/EBDG400V. BamHI-restricted chromosomal recombination substrate and product were visualized with probe 2 (Fig. 1AGo). Only the 1 µM lanes, taken from five different Southern blots, plus the no-ligand lane, are shown. B, Plot of ligand-induced recombination using data from all lanes of the five titration experiments. Quantification and plotting were as described in Fig. 2Go. The symbols used for the different ligands are denoted and are the same for Figs. 4Go, 5Go, and 7Go. Solid symbols denote agonists; open symbols denote antagonists; •, estradiol; {blacksquare}, DES; {blacktriangleup}, hexestrol; {circ}, raloxifene; {square}, ICI 182,780; {triangleup}, 4-hydroxy tamoxifen.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Dissociation Constants of Flp/EBDs (determined by Scatchard Analysis), Compared with the Concentration at which Half-Maximal Recombination was Induced for the Six Ligands Used Here.

 
To establish that recombination mediated by Flp/EBD D/E/Fs faithfully reflects ligand binding, extracts of the Flp/EBD D/E/F stable cell lines were made and assessed for ligand binding in competition experiments with [3H]estradiol. Table 2Go shows these IC50 data and includes Kd values for the full-length ER taken from the literature. Ligand binding affinity of Flp/EBDDEF is very similar to that of full-length ER, and no significant distortions of affinity are introduced either by omission of the ER A/B and C domains or by the fusion of Flp recombinase to the ER D/E/F domains.

The results presented in Figs. 2Go and 3Go and Table 2Go show that all ligands tested induced recombination regardless of their agonist [estradiol, diethylstilbestrol (DES), hexestrol], antagonist (raloxifene, ICI 164,384, ICI 182,780, 4-hydroxytamoxifen), steroidal (estradiol, ICI 164,384, ICI 182,780), or nonsteroidal (DES, hexestrol, raloxifene, 4-hydroxytamoxifen) character, in a manner that simply reflects ligand binding. All these ligands thus serve to release ER from its initially repressed condition, and differences between these ER agonists and antagonists must lie later in the pathway of ER activation. This conclusion, in a mammalian cell model, extends our previous work based on Flp/EBD experiments in yeast (23) where the partial exclusion of certain ligands by the yeast cell surface influenced the dose-response curve.

Although all ligands tested release Flp/EBD D/E/Fs from the initially repressed condition, the antagonists raloxifene, and to a lesser extent, ICI 164,384 and ICI 182,780, consistently induced faster rates of recombination at early time points than did the agonists or 4-hydroxytamoxifen (Figs. 2Go and 3Go). This may reflect the failure of these antagonists to allow other protein-protein interactions not favoring efficient recombination, such as homodimerization or interactions with transcriptional cofactors.

Mutations That Impair ER Homodimerization Do Not Discriminate between Agonists and Antagonists
In the ER activation pathway, release from the initially repressed condition permits ER to dimerize. Since release from initial repression is promoted by all of the agonists and antagonists used here, we asked whether agonists and antagonists could be distinguished by their ability to promote homodimerization. Mutations previously described that impair homodimerization of mouse ER (25), an interpretation that has gained recent support from the EBD crystal structure (26), were introduced into Flp/human EBD D/E/F fusion proteins (Flp/EBDL507R and Flp/EBDR503A/L507R). Figure 4Go shows that all six ligands induce recombination mediated by these Flp/mutant EBDs, albeit at substantially higher ligand concentrations. Ligand binding experiments in extracts (Table 2Go) showed that recombination efficacy approximately reflected ligand binding. The reduction of binding affinity shown by these dimerization mutants, together with the recent EBD crystal structure evidence that the dimerization surface is distinct from the ligand binding pocket (26), suggests that ER dimerization stabilizes ligand binding. Interactions between ligand binding and dimerization have been described for other nuclear receptors, notably ecdysone and retinoid X receptors (27, 28) and the vitamin D receptor (29). As with both wt and G400V EBDs, raloxifene induced faster rates of initial recombination for the L507R and R503A,L507R dimerization mutants than the other ligands. The persistence of this profile suggests that these agonists and antagonists cannot be differentiated on the basis of selective effects on homodimerization. These data also indicate that relief from initial repression is not reliant on dimerization. We also note that these dimerization mutations do not result in increased Flp/EBD recombinase enzyme activity, indicating that EBD homodimerization has little deleterious affect on Flp enzyme activity.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 4. Mutations that Impair Dimerization Do Not Discriminate between Agonists and Antagonists

A, Southern blot analyses of ligand titrations of cells expressing Flp/EBDL507R. BamHI-restricted chromosomal recombination substrate and product were visualized with probe 2 (Fig. 1AGo). Only the 1 µM lanes, taken from six different Southern blots, plus the no-ligand lane, are shown. B, Plot of ligand-induced recombination using data from all lanes of the six titration experiments of panel A. Quantification and plotting were as described in Fig. 2Go. C, Southern blot analyses of ligand titrations of cells expressing Flp/EBDR503A/L507R as described in panel A. D, Plot of ligand-induced recombination using data from all lanes of the six titration experiments of panel C. See Fig. 3Go for ligand symbols.

 
Flp/EBD Fusion Proteins That Distinguish between Agonists and Antagonists
The above data show that ligand responsiveness of Flp/EBD fusion proteins mainly reflects the first step in the ER activation pathway, relief from initial repression. Those steps after dimerization in the activation pathway, where agonists and antagonists elicit different responses, are not reported by this assay. Consequently we employed known EBD mutations to establish Flp/EBDs that could discriminate between agonists and antagonists.

The EBD encompasses at least amino acids 305–548 (26, 30). The Flp/EBD fusions used above included amino acids 251–595, encompassing not only the EBD (E domain) but also the D domain (251–304) and the F domain (549–595). As we showed previously (23), removal of most of the D domain (here deletion of amino acids 251–303) to create Flp/EBD{Delta}D produced a Flp/EBD that was activatable only by agonists and not antagonists, but showed less recombinase activity than other Flp/EBD fusions after 4 h of ligand stimulation (Fig. 5Go, A and B). In yeast, we also observed the exclusive nature of Flp/EBD{Delta}D responsiveness to agonists, as well as the reduced amount of recombinase activity after induction (23). Competition experiments showed that activation by agonists is abolished in a dose-dependent fashion by the three ER antagonists (Fig. 5CGo). Therefore, as expected given the presence of the complete ER E domain, Flp/EBD{Delta}D has not lost the capacity to bind antagonist; rather, it fails to be activated by antagonist binding. This was confirmed by binding experiments (Table 2Go). Western analysis showed that none of the antagonists had a negative effect on the steady state levels of Flp/EBD{Delta}D (data not shown).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 5. Ligand Titration and Competition Experiments with Cells Expressing Flp/EBD Proteins That Discriminate between Agonists and Antagonists

A, Southern analysis of recombination induced by 1 µM of the six indicated ligands in a recombination reporter cell line expressing Flp/EBD{Delta}D. BamHI-restricted chromosomal recombination substrate and product were visualized with probe 2 (Fig. 1AGo). Only the 1 µM lanes, taken from six different Southern blots, plus the no-ligand lane, are shown. The asterisk denotes a nonspecific band. B, Plot of ligand-induced recombination using data from all lanes of the six titration experiments of panel A. Quantification and plotting were as described in Fig. 2Go. C, Estradiol (3 nM)-induced recombination mediated by Flp/EBD{Delta}D is competed by coincubation for 4 h with increasing concentrations of raloxifene, hydroxytamoxifen, and ICI 182,780 as shown. D, Southern analysis of recombination induced by 1 µM of the six indicated ligands in a recombination reporter cell line expressing Flp/EBDG521R. BamHI-restricted chromosomal recombination substrate and product were visualised with probe 2 (Fig. 1AGo). Only the 1 µM lanes, taken from six different Southern blots, plus the no-ligand lane, are shown. E, Plot of ligand-induced recombination using data from all lanes of the six titration experiments of panel A. Quantification and plotting were as described in Fig. 2Go. F, Failure of 3 mM estradiol, DES, or hexestrol to compete for Flp/EBDG521R recombination induced by 300 nM ICI 182,780. See Fig. 3Go for ligand symbols.

 
A Flp/EBD Fusion Protein That Is Only Activated by ER Antagonists
The equivalent of a previously described mouse ER point mutation, glycine 521 to arginine (31), was introduced into the human EBD D/E/F to create Flp/EBDG521R. Consistent with the mouse ER results (31), Flp/EBDG521R is not activated by estradiol but is activated by 4-hydroxytamoxifen (Fig. 5Go, D and E). Interestingly, Flp/EBDG521R is also activatable by the other two antagonists, ICI 182,780 and raloxifene, but not by two nonsteroidal agonists, DES and hexestrol. This mutation therefore appears to discriminate between agonists and antagonists on the basis of their functional classification as transcriptional activators. Competition experiments between ICI 182,780 and the three agonists (Fig. 5FGo) and ligand binding studies in extracts indicate that the G521R mutant has not only lost the ability to bind agonists but also considerable affinity for antagonists. We note, however, that 1 µM DES does produce a low level of recombination (Fig. 5DGo, lane 3), indicating that at high concentrations some binding can occur. The presence of an arginine at position 521 therefore appears to be more important for agonist than antagonist binding.

Selective Loss of Estradiol Activation
The experiments described above show that agonists and antagonists can be differentiated on a functional, nontranscriptional, basis. Although synthetic estrogens can be broadly categorized as either agonists or antagonists, several lines of evidence demonstrate that further subcategories exist (32). We have therefore begun to identify mutations that would permit further subcategorization of ligands based on the Flp/EBD assay. Flp/EBD mutants that systematically combined glycine or valine at amino acid 400 with glycine, valine, or arginine at amino acid 521 were generated. These Flp/EBD D/E/Fs were tested in a transient expression assay for qualitative responsiveness to ligand (Fig. 6Go).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 6. Transient Expression of Flp/EBD D/E/F Fusion Proteins Carrying Mutant Combinations at ER Amino Acids 400 and 521

E25B2/B2 cells were lipofected with either wt (G400/G521), G400V, G521V, G521R, G400V/G521V, or G400V/G521R Flp/EBDs and treated with 1 µM ligands, or ethanol vehicle, as indicated. E2, estradiol; HEX, hexestrol; DES, diethylstilbestrol; RAL, raloxifene. The histograms show number of lacZ-positive cells counted in 1 cm2 after a 50-h expression period. Note the different values on the ordinate.

 
As expected, the wt, G400V, and G521R EBDs (Flp/EBDDEF, Flp/EBDG400V, Flp/EBDG521R) showed ligand inducibility consistent with the data from the stable expression experiments above. Notably, the wild type fusion protein again showed more background recombination than the G400V fusion protein. The G521V mutation displayed some loss of responsiveness to estradiol; however, when this mutation was combined with G400V (G400V/G521V), selective loss of responsiveness to estradiol was observed. The G400V/G521R double mutant was unresponsive to any ligand, probably because both mutations alone substantially reduce ligand affinity and, when combined, reduce it further. In other experiments, these fusion proteins were examined for differential responsiveness to raloxifene, 4-hydroxytamoxifen, and ICI 182,780. No significant differences were observed (data not shown). None of these EBDs displayed a loss of initial repression, with the possible exception of the G521V mutation.

Cells stably expressing the G400V/G521V protein (Flp/EBDG400V/G521V) were next examined for ligand inducibility in dose-response experiments (Fig. 7Go). Loss of responsiveness to estradiol was confirmed, and competition experiments showed that estradiol could not block induction by DES (Fig. 7CGo) or raloxifene (data not shown), demonstrating that the G400V/G521V EBD has lost the ability to bind estradiol.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 7. A Mutation Selectively Insensitive to Estradiol

A, Southern analysis of ligand titrations with cells expressing Flp/EBDG400V/G521V. BamHI-restricted chromosomal recombination substrate and product were visualized with probe 2 (Fig. 1AGo). Only the 1 µM lanes, taken from six different Southern blots, plus the no-ligand lane, are shown. B, Plot of ligand-induced recombination using data from all lanes of the six titration experiments of panel A. Quantification and plotting were as described in Fig. 2Go. C, Excess estradiol (1 µM) does not inhibit Flp/EBDG400V/G521V recombination induced by a subsaturating concentration (30 nM) of DES.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Both Agonists and Antagonists Relieve Initial Repression of Flp Activity Imposed by wt and G400V EBDs
In addition to sharing the property of binding hormones, steroid receptors display a repressor function that can impart ligand dependency onto certain other proteins when expressed as fusion proteins (33). It is believed that the protein cis-repressor function of the steroid receptors is mediated via complex formation with chaperone molecules, most notably Hsp90 (5, 6, 7, 8, 9, 18, 34). This dogma has been challenged in the case of the progesterone receptor on the basis that it is almost exclusively located in the nucleus even in the absence of cognate ligands, while Hsp90 is cytoplasmic (35), leaving the exact mechanism of protein cis-repression open to question.

To analyze protein cis-repression and ligand specificities of the human ER, we explored the characteristics of the Flp/EBD fusion system (22). This receptor assay does not rely on the transcription activation function of the LBD as it measures site-specific recombinase activity, making it possible to directly observe the consequence of ligand binding on the cis-repressor function of the EBD.

In agreement with data generated in a yeast system (23), all the ligands we tested, including the pure ER antagonist ICI 182,780 (36), the mixed agonist/antagonists 4-hydroxytamoxifen (37), and raloxifene (38), induced Flp recombination in this human cell line-based system. These results imply that all estrogens, regardless of their agonist/antagonist potential in vivo, induce a structural conformation that releases the EBD from its initially repressed condition. Furthermore, our data indicate that the second step in the ER activation pathway, dimerization, is also not a point of discrimination between the agonists and antagonists used here. Therefore, the crucial difference between these agonists and antagonists lies later in the pathway of ER activation.

In contrast to the near complete reliance on ligand for Flp/EBDG400V and other mutant EBD forms, we found that the wt EBD, including the hinge region from residues 251–303, does not repress Flp fully in mammalian cells. Background ER activity has been repeatedly observed in transcription studies with the wtER in mammalian cells and is likely due to the presence of trace quantities of estrogens in phenol red-free, charcoal-stripped, mammalian cell culture medium, as used here, combined with the high ligand sensitivity of the wtEBD (Refs. 24, 39 and references therein). In support of this explanation, the Flp/EBDDEF protein used here shows good repression in the absence of ligand induction in yeast (23).

Distinction between Agonists and Antagonists by Class
After dimerization, activated ER affects several transcriptional responses through classic and nonclassic DNA response elements as well as by cross-talk regulation (for reviews, see Refs. 10, 12). It is probable that different agonists and antagonists elicit different responses via these various mechanisms (12, 32, 40). Steroid ligand selectivity is well illustrated by the spectrum of ligand/ER responses. ER is activated by its cognate agonist, estradiol. The synthetic nonsteroid estrogen agonist, DES, also elicits agonist responses, although DES derivatives have been shown to be partial agonists given their abilities to evoke different subsets of agonist responses (41). 4-Hydroxytamoxifen has been shown to be a partial antagonist based on promoter context variability (37) and cross-talk regulation (42). Interestingly, the partial antagonist raloxifene shows a different profile of agonism/antagonism to that of 4-hydroxytamoxifen based on uterine, cholesterol, and bone responses (38, 43, 44). ICI 182,780 is described as a complete ER antagonist because it blocks all ER agonist activities (36) although ICI 182,780 agonist activity has been described for ER mutations in the C terminus of the E domain (45, 46). Further evidence for a spectrum of ER responses elicited by different ligands has been presented (32). The fact that ER responses are differentially elicited by different ligands suggests that binding of ligand by ER results in different conformations each reflecting the particular ligand bound (12, 26, 32, 47).

Given the complexities involved in ER signaling after dimerization, the use of transcriptional assays to categorize ER ligands into more refined classes than agonist or antagonist will reflect both the activity of the ligand and the experimental design of the transcriptional assays. Since we have shown ( Figs. 2–4GoGoGo) that Flp/EBD responses are largely independent of those steps in the ER activation pathway at which agonists and antagonists are transcriptionally discriminated, we reasoned that Flp/mutant EBDs that discriminate between agonists and antagonists must do so on the basis of inherent structural properties of ligand binding by the EBD. Appropriate mutant EBDs were identified and cell lines established that discriminate between agonists and antagonists by class. To permit further, nontranscriptional classification of ER ligands, mutant EBDs that permit subcategorization of ligands were sought and a mutant EBD (G400V, G521V), that distinguishes between the natural agonist, estradiol, and synthetic ligands was identified. This demonstrates that particular ligand specificity mutations can be distinguished in the Flp/EBD assay. The identification of other ligand specificity mutations and their use in Flp/EBDs should provide a structural, nontranscriptional basis for an even more refined categorization of ER ligands.

Antagonism in the Context of Flp/EBD Fusions
Deletion of amino acids 251–303 resulted in a Flp/EBD fusion protein that was activatable by the three ER agonists, estradiol, DES, and hexestrol, but only very weakly by the three antagonists tested. The steroid nature of the ligands was not a determining factor since two of the agonists, DES and hexestrol, are not steroid ring compounds, and one of the antagonists, ICI 182,780, has a steroid structure. By ligand binding experiments in cellular extracts and ligand competition experiments, we showed that Flp/EBD{Delta}D is able to bind agonists and antagonists; however, only agonists induce Flp recombination. Lack of recombinase induction by antagonists was not due to selective protein degradation since Western blot analysis demonstrated that no ligand had significant effects on expression levels of any of the Flp/EBD fusion proteins used here (data not shown). The molecular basis of agonist/antagonist discrimination by Flp/EBD{Delta}D has been addressed elsewhere (47).

Ligand-Selective EBD Mutations
Two Flp/EBD fusions that show ligand binding selectivity are documented here. Both involve changes at amino acid 521. The first is the G521R mutation previously described to retain 4-hydroxytamoxifen but not estradiol binding (31), and the second combines G521V with G400V. Glycine 521 is located in a region close to bound ligand in the crystal structures of the liganded human ER, retinoic acid receptor, and thyroid receptor LBDs (26, 48, 49). Glycine 400 is located at the start of a ß-turn, which when mutated to valine, causes a general destabilization of ligand interactions at 37 C (24). Both regions have been implicated previously in ER and glucocorticoid receptor ligand binding, functionally and by chemical cross-linking (31, 50, 51, 52, 53).

Our observations with the G521R mutation extend previous work to establish that this mutation discriminates between agonists and antagonists by class. This is due to a loss of agonist binding, as demonstrated by binding and competition experiments, suggesting that the G521R mutation disrupts a part of the ligand binding pocket that is essential to bind ER agonists, but not antagonists, with high affinity.

The G400V/G521V EBD appears to be unable to bind estradiol since high levels of estradiol did not compete for Flp/EBDG400V/G521V-mediated recombination elicited by subsaturating concentrations of DES. Flp/EBDG400V/G521V, however, responds to all of the other ER ligands we tested, regardless of their agonist or antagonist activity in terms of the full-length ER. Thus a glycine at position 521 appears critical to accommodate estradiol in the ligand binding pocket. However, ICI 182,780 is identical to estradiol except for the addition of the long side chain at the seventh carbon of the steroid ring structure. ICI 182,780 is not excluded from the EBDG400V/G521V, implying that it, like raloxifene, binds via an extra set of residues in the EBD (26).

The use of SSR/LBD fusions allows direct studies of ligand/LBD combinations that are transcriptionally inactive. This permits analysis of the cis-repression activity of LBDs and can provide a new way to classify steroid receptor ligands as agonists or antagonists. Further work is required to exploit the ligand discriminatory potential of Flp/EBD fusions to further distinguish different subclasses of antagonists (pure vs. tamoxifen-like vs. raloxifene-like antagonists) and agonists [steroid vs. nonsteroid and their enantiomers (54, 55)]. Another potentially fruitful avenue of research may involve the use of SSR/LBDs in the study of the cis-repressor activities of other members of the steroid and nuclear receptor superfamily.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
DNA Constructs
Table 1Go is a complete list of Flp/EBD fusion proteins used in this study. The Flp/EBDG400V construct has been described in pHFE (22). To reintroduce a glycine at position 400 of the cloned human EBD (24), the NcoI-BglII fragment spanning this mutation was replaced with the homologous NcoI-BglII fragment from the mouse ER (25). This did not result in any further alterations in the amino acid sequence.

To delete the D domain of the estrogen-binding domain, an intermediate plasmid, p44HE1 (22), was cut with BamHI and EagI and a linker with the sequence ggatccaacagcctggccttgtccctgacggccg was inserted, thus deleting amino acids 251–303 of the EBD.

All point mutations were generated by the method of Barettino et al. (56). The sequence of the 5'-primer was ccaccgagtcctggacaag and that of the 3'-primer was ccagtagtaggttgaggccgttg. The template for the first round of amplification cycles using one of the mutagenic primers and the 3'- primer was p44HE2. The second template, lacking sequence homology for the 3'-primer, was pHFE1. The products of the second PCR reactions were digested with StuI and Eco47III to generate a 499-bp fragment that was inserted into StuI-Eco47III linearized pHFE2. The sequences of the mutagenic primers encoding the G521R, G521V, mutations were gg.cac.atg.agC.aac.aaa.AgA.atg.gag (MaeIII) and gg.cac.atg.agt.aac.aaa.gTc.atg.gag (not tagged) respectively. Uppercase nucleotides represent point mutations; the restriction site that was mutated to tag the mutation is underlined, and the restriction enzyme is written in between brackets after each primer sequence.

Cell Lines and Cell Culture Conditions
Cell culture conditions were as previously described including charcoal stripping of the FCS (22). The Flp recombination reporter cell line 293R10 was generated by electroporation of linear pNeoßGal plasmid (23) into 293 cells as previously described. 293R10 cells were transformed with pHFE plasmids bearing the indicated EBD mutations to generate recombination reporter cell lines as described (22). All the data points shown on any one graph in the present paper were collected in the course of a single experiment to allow accurate comparisons in recombinase activities.

Southern Analysis
Southern analyses were carried out as described (22), except that 0.86% agarose gels were used. The genomic DNA samples from P1.4 cells (22) used for Fig. 2AGo were digested with NdeI, which generates 4.9- and 3.6-kb fragments from recombined and unrecombined pNEOßGAL loci, respectively. DNAs for all the other Southern blots presented in this study were digested with BamHI, which gives the following restriction fragments: unrecombined, 5.4 kb; recombined, 8.2 kb; circle, 1.3 kb.

Transient Expression
The CV1-derived Flp excision recombination reporter cell line E25B2/B2 (22) was grown on glass coverslips and transfected overnight with 5 µg Flp/EBD expression vectors by means of lipofectamine (Boehringer Mannheim, Mannheim, Germany), according to the manufacturer’s instructions. Ligand exposure lasted 50 h. Histochemical detection of ß-galactosidase was performed as before (22).


    ACKNOWLEDGMENTS
 
We thank P.-O. Angrand, Frank Buchholz, Sophie Chabanis, Hinrich Gronemeyer, Dino Moras, and Henk Stunnenberg for discussions; V. Kumar, P. Chambon, and P. Danielian for plasmids; and A. Wakeling (Zeneca Pharmaceuticals) for providing ICI 164,384 and ICI 182,780.


    FOOTNOTES
 
Address requests for reprints to: A. Francis Stewart, European Molecular Biology Laboratory, Gene Expression Program, Meyerhofstrasse 1, D-69117 Heidelberg, Germany.

This work was supported in part by EU-BIOMED Grant BMH4–96-0181 (to A.F.S.).

1 Present address: University of Massachusetts Medical Center, Program in Molecular Medicine, Worcester, Massachusetts 01604. Back

2 Present address: University of Pittsburgh Cancer Institute, Pittsburgh, Pennsylvania 15213. Back

Received for publication February 3, 1998. Revision received April 27, 1998. Accepted for publication April 30, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414[CrossRef][Medline]
  2. Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953–959[CrossRef][Medline]
  3. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580[CrossRef][Medline]
  4. Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194–198[CrossRef][Medline]
  5. Bohen SP 1995 Hsp90 mutants disrupt glucocorticoid receptor ligand binding and destabilize aporeceptor complexes. J Biol Chem 270:29433–29438[Abstract/Free Full Text]
  6. Bohen SP, Yamamoto KR 1993 Isolation of Hsp90 mutants by screening for decreased steroid receptor function. Proc Natl Acad Sci USA 90:11424–11428[Abstract/Free Full Text]
  7. Chang HC, Nathan DF, Lindquist S 1997 In vivo analysis of the Hsp90 co-chaperone Sti1 (p60). Mol Cell Biol 17:318–325[Abstract]
  8. Nathan DF, Lindquist S 1995 Mutational analysis of Hsp90 function: interactions with a steroid receptor and a protein kinase. Mol Cell Biol 15: 3917–3925
  9. Kimura Y, Yahara I, Lindquist S 1995 Role of the protein chaperone YDJ1 in establishing Hsp90-mediated signal transduction pathways. Science 268: 1362–1365
  10. Beato M, Herrlich P, Schutz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83:851–857[CrossRef][Medline]
  11. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  12. Stewart AF, Logie C, Nichols M 1996 Regulation of nuclear receptors by agonists and antagonists. Curr Opin Endocrinol Diabet 3:397–402
  13. Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Soderstrom M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–404[CrossRef][Medline]
  14. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]
  15. Soderstrom M, Vo A, Heinzel T, Lavinsky RM, Yang WM, Seto E, Peterson DA, Rosenfeld MG, Glass CK 1997 Differential effects of nuclear receptor corepressor (N-CoR) expression levels on retinoic acid receptor-mediated repression support the existence of dynamically regulated corepressor complexes. Mol Endocrinol 11:682–692[Abstract/Free Full Text]
  16. Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty CD, Torchia J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK, Rosenfeld MG 1997 A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387:43–48[CrossRef][Medline]
  17. Nagy L, Kao HY, Chakravarti D, Lin RJ, Hassig CA, Ayer DE, Schreiber SL, Evans RM 1997 Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell 89:373–380[CrossRef][Medline]
  18. Dalman FC, Sturzenbecker LJ, Levin AA, Lucas DA, Perdew GH, Petkovitch M, Chambon P, Grippo JF, Pratt WB 1991 Retinoic acid receptor belongs to a subclass of nuclear receptors that do not form "docking" complexes with hsp90. Biochemistry 30:5605–5608[CrossRef][Medline]
  19. Smith CL, Nawaz Z, O’Malley BW 1997 Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol Endocrinol 11:657–666[Abstract/Free Full Text]
  20. Jackson TA, Richer JK, Bain DL, Takimoto GS, Tung L, Horwitz KB 1997 The partial agonist activity of antagonist-occupied steroid receptors is controlled by a novel hinge domain-binding coactivator L7/SPA and the corepressors N-CoR or SMRT. Mol Endocrinol 11:693–705[Abstract/Free Full Text]
  21. Segnitz B, Gehring U 1990 Mechanism of action of a steroidal antiglucocorticoid in lymphoid cells. J Biol Chem 265:2789–2796[Abstract/Free Full Text]
  22. Logie C, Stewart AF 1995 Ligand-regulated site-specific recombination. Proc Natl Acad Sci USA 92:940–944
  23. Nichols M, Rientjes JMJ, Logie C, Stewart AF 1997 FLP recombinase/estrogen receptor fusion proteins require the receptor D domain for responsiveness to antagonists, but not agonists. Mol Endocrinol 11:950–961[Abstract/Free Full Text]
  24. Tora L, Mullick A, Metzger D, Ponglikitmongkol M, Park I, Chambon P 1989 The cloned human oestrogen receptor contains a mutation which alters its hormone binding properties. EMBO J 8:1981–1986[Medline]
  25. Fawell SE, Lees JA, White R, Parker MG 1990 Characterization and colocalization of steroid binding and dimerization activities in the mouse estrogen receptor. Cell 60:953–962[CrossRef][Medline]
  26. Brzozowski AM, Pike ACW, Dauter Z, Hubbard EH, Bonn T, Engström O, Öhman L, Greene GL, Gustafsson J, Carlquist M 1997 Molecular basis of agonism and antagonism in the estrogen receptor. Nature 389:753–758[CrossRef][Medline]
  27. Thomas HE, Stunnenberg HG, Stewart AF 1993 Heterodimerization of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle. Nature 362:471–475[CrossRef][Medline]
  28. Yao TP, Forman BM, Jiang Z, Cherbas L, Chen JD, McKeown M, Cherbas P, Evans RM 1993 Functional ecdysone receptor is the product of the EcR and ultraspiracle genes. Nature 366:476–479[CrossRef][Medline]
  29. Cheskis B, Freedman LP 1994 Ligand modulates the conversion of DNA-bound vitamin D3 receptor (VDR) homodimers into VDR-retinoid X receptor heterodimers. Mol Cell Biol 14:3329–3338[Abstract/Free Full Text]
  30. Wurtz J-M, Bourguet W, Renaud J-P, Vivat V, Chambon P, Moras D, Gronemeyer H 1996 A canonical structure for the ligand-binding domain of nuclear receptors. Nature Struct Biol 3:87–94[CrossRef][Medline]
  31. Danielian PS, White R, Hoare SA, Fawell SE, Parker MG 1993 Identification of residues in the estrogen receptor that confer differential sensitivity to estrogen and hydroxytamoxifen. Mol Endocrinol 7:232–240[Abstract]
  32. McDonnell DP, Clemm DL, Hermann T, Goldman ME, Pike JW 1995 Analysis of estrogen receptor function in vitro reveals three distinct classes of antiestrogens. Mol Endocrinol 9:659–669[Abstract]
  33. Mattioni T, Louvion JF, Picard D 1994 Regulation of protein activities by fusion to steroid binding domains. Methods Cell Biol 43:335–352
  34. Scherrer LC, Picard D, Massa E, Harmon JM, Simons Jr SS, Yamamoto KR, Pratt WB 1993 Evidence that the hormone binding domain of steroid receptors confers hormonal control on chimeric proteins by determining their hormone-regulated binding to heat-shock protein 90. Biochemistry 32:5381–5386[CrossRef][Medline]
  35. Tuohimaa P, Pekki A, Blauer M, Joensuu T, Vilja P, Ylikomi T 1993 Nuclear progesterone receptor is mainly heat shock protein 90-free in vivo. Proc Natl Acad Sci USA 90:5848–5852[Abstract/Free Full Text]
  36. Wakeling AE, Bowler J 1992 ICI 182,780, a new antioestrogen with clinical potential. J Steroid Biochem Mol Biol 43:173–177[CrossRef][Medline]
  37. Berry M, Metzger D, Chambon P 1990 Role of the two activating domains of the oestrogen receptor in the cell-type and promoter-context dependent agonistic activity of the anti-oestrogen 4-hydroxytamoxifen. EMBO J 9:2811–2818[Medline]
  38. Black LJ, Sato M, Rowley ER, Magee DE, Bekele A, Williams DC, Cullinan GJ, Bendele R, Kauffman RF, Bensch WR, Frolik CA, Termine JD, Bryant HU 1994 Raloxifene (LY139481 HCI) prevents bone loss and reduces serum cholesterol without causing uterine hypertrophy in ovariectomized rats. J Clin Invest 93:63–69
  39. Mattick S, Glenn K, de Haan G, Shapiro DJ 1997 Analysis of ligand dependence and hormone response element synergy in transcription by estrogen receptor. J Steroid Biochem Mol Biol 60:285–294[CrossRef][Medline]
  40. Katzenellenbogen JA, O’Malley BW, Katzenellenbogen BS 1996 Tripartite steroid hormone receptor pharmacology: interaction with multiple effector sites as a basis for the cell- and promoter-specific action of these hormones. Mol Endocrinol 10:119–131[CrossRef][Medline]
  41. Korach KS, Fox-Davies C, Quarmby VE, Swaisgood MH 1985 Diethylstilbestrol metabolites and analogs. Biochemical probes for differential stimulation of uterine estrogen responses. J Biol Chem 260:15420–15426[Abstract/Free Full Text]
  42. Webb P, Lopez GN, Uht RM, Kushner PJ 1995 Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol 9:443–456[Abstract]
  43. Grese TA, Sluka JP, Bryant HU, Cullinan GJ, Glasebrook AL, Jones CD, Matsumoto K, Palkowitz AD, Sato M, Termine JD, Winter MA, Yang NN, Dodge JA 1997 Molecular determinants of tissue selectivity in estrogen receptor modulators. Proc Natl Acad Sci USA 94:14105–14110[Abstract/Free Full Text]
  44. Evans G, Bryant HU, Magee D, Sato M, Turner RT 1994 The effects of raloxifene on tibia histomorphometry in ovariectomized rats. Endocrinology 134:2283–2288[Abstract]
  45. Mahfoudi A, Roulet E, Dauvois S, Parker MG, Wahli W 1995 Specific mutations in the estrogen receptor change the properties of antiestrogens to full agonists. Proc Natl Acad Sci USA 92:4206–4210[Abstract/Free Full Text]
  46. Montano MM, Ekena K, Krueger KD, Keller AL, Katzenellenbogen BS 1996 Human estrogen receptor ligand activity inversion mutants: receptors that interpret antiestrogens as estrogens and estrogens as antiestrogens and discriminate among different antiestrogens. Mol Endocrinol 10:230–242[Abstract]
  47. Nichols M, Rientjes JMJ, Stewart AF 1998 Different positioning of the ligand binding domain helix 12 and the F domain of the estrogen receptor accounts for functional differences between agonists and antagonists. EMBO J 17:765–773[CrossRef][Medline]
  48. Renaud JP, Rochel N, Ruff M, Vivat V, Chambon P, Gronemeyer H, Moras D 1995 Crystal structure of the RAR-gamma ligand-binding domain bound to all-trans retinoic acid. Nature 378:681–689[CrossRef][Medline]
  49. Wagner RL, Apriletti JW, McGrath ME, West BL, Baxter JD, Fletterick RJ 1995 A structural role for hormone in the thyroid hormone receptor. Nature 378:690–697[CrossRef][Medline]
  50. Simons Jr SS, Pumphrey JG, Rudikoff S, Eisen HJ 1987 Identification of cysteine 656 as the amino acid of hepatoma tissue culture cell glucocorticoid receptors that is covalently labeled by dexamethasone 21-mesylate. J Biol Chem 262:9676–9680[Abstract/Free Full Text]
  51. Harlow KW, Smith DN, Katzenellenbogen JA, Greene GL, Katzenellenbogen BS 1989 Identification of cysteine 530 as the covalent attachment site of an affinity-labeling estrogen (ketononestrol aziridine) and antiestrogen (tamoxifen aziridine) in the human estrogen receptor. J Biol Chem 264:17476–17485[Abstract/Free Full Text]
  52. Ekena K, Weis KE, Katzenellenbogen JA, Katzenellenbogen BS 1996 Identification of amino acids in the hormone binding domain of the human estrogen receptor important in estrogen binding. J Biol Chem 271:20053–20059[Abstract/Free Full Text]
  53. Ekena K, Weis KE, Katzenellenbogen JA, Katzenellenbogen BS 1997 Different residues of the human estrogen receptor are involved in the recognition of structurally diverse estrogens and antiestrogens. J Biol Chem 272:5069–5075[Abstract/Free Full Text]
  54. Chae K, Gibson MK, Korach KS 1991 Estrogen receptor stereochemistry: ligand binding orientation and influence on biological activity. Mol Pharmacol 40:806–811[Abstract]
  55. Bocchinfuso WP, Korach KS 1997 Estrogen receptor residues required for stereospecific ligand recognition and activation. Mol Endocrinol 11:587–594[Abstract/Free Full Text]
  56. Barettino D, Feigenbutz M, Valcarcel R, Stunnenberg HG 1994 Improved method for PCR-mediated site-directed mutagenesis. Nucleic Acids Res 22:541–542[Free Full Text]
  57. Katzenellenbogen JA, Hsiung HM, Carlson KE, McGuire WL, Kraay RJ, Katzenellenbogen BS 1975 Iodohexestrols. II. Characterization of the binding and estrogenic activity of iodinated hexestrol derivatives, in vitro and in vivo. Biochemistry 14:1742–1750[CrossRef][Medline]
  58. Jones CD, Jevnikar MG, Pike AJ, Peters MK, Black LJ, Thompson AR, Falcone JF, Clemens JA 1984 Antiestrogens. 2. Structure-activity studies in a series of 3-aroyl-2-arylbenzo(b)thiophene derivatives leading to (6-hydroxy-2-(4-hydroxyphenyl)benzo(b)thien-3-yl) (4-(2-(1-piperidinyl)ethoxy)-phenyl)methanone hydrochloride (LY156758), a remarkably effective estrogen antagonist with only minimal intrinsic estrogenicity. J Med Chem 27:1057–1066[CrossRef][Medline]
  59. Robertson DW, Katzenellenbogen JA, Long DJ, Rorke EA, Katzenellenbogen BS 1982 Tamoxifen antiestrogens. A comparison of the activity, pharmacokinetics, and metabolic activation of the cis and trans isomers of tamoxifen. J Steroid Biochem 16:1–13[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
R. Paulmurugan, A. Tamrazi, J. A. Katzenellenbogen, B. S. Katzenellenbogen, and S. S. Gambhir
A Human Estrogen Receptor (ER){alpha} Mutation with Differential Responsiveness to Nonsteroidal Ligands: Novel Approaches for Studying Mechanism of ER Action
Mol. Endocrinol., July 1, 2008; 22(7): 1552 - 1564.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Paulmurugan and S. S. Gambhir
An intramolecular folding sensor for imaging estrogen receptor-ligand interactions
PNAS, October 24, 2006; 103(43): 15883 - 15888.
[Abstract] [Full Text] [PDF]


<
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles