help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hansen, L. H.
Right arrow Articles by Billestrup, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hansen, L. H.
Right arrow Articles by Billestrup, N.
Molecular Endocrinology 12 (8): 1140-1149
Copyright © 1998 by The Endocrine Society

Characterization of the Inhibitory Effect of Growth Hormone on Primary Preadipocyte Differentiation

Lone Hoedt Hansen, Birgitte Madsen, Børge Teisner, Jens Høiriis Nielsen and Nils Billestrup

Hagedorn Research Institute (L.H.H., B.M., J.H.N., N.B.) DK-2820 Gentofte, Denmark
Department of Microbiology (B.T.) Odense University DK-5000 Odense C, Denmark


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
GH exerts adipogenic activity in several preadipocyte cell lines, whereas in primary rat preadipocytes, GH has an antiadipogenic activity. To better understand the molecular mechanism involved in adipocyte differentiation, the expression of adipocyte-specific genes was analyzed in differentiating preadipocytes in response to GH. We found that the expression of both adipocyte determination and differentiation factor 1 (ADD1) and peroxisome proliferator activated receptor {gamma} (PPAR{gamma}) was induced in preadipocytes during differentiation. In the presence of GH, which markedly inhibited triglyceride accumulation, no reduction in the expression level of ADD1 was observed in response to GH, whereas there was a 50% reduction in the expression of PPAR{gamma}. The DNA binding activity of the PPAR{gamma}/retinoid X receptor-{alpha} (RXR{alpha}) to the ARE7 element from the aP2 gene was also reduced by approximately 50% in response to GH. GH inhibited the expression of late markers of adipocyte differentiation, fatty acid synthase, aP2, and hormone-sensitive lipase by 70–80%. The antiadipogenic effect of GH was not affected by the mitogen-activated protein (MAP) kinase/extracellular-regulated protein (ERK) kinase inhibitor PD 98059, indicating that the mitogen-activated protein kinase pathway was not involved in GH inhibition of preadipocyte differentiation. The expression of preadipocyte factor-1/fetal antigen 1 was decreased during differentiation, and GH treatment prevented this down-regulation of Pref-1/FA1. A possible role for Pref-1/FA1 in mediating the antiadipogenic effect of GH was indicated by the observation that FA1 inhibited differentiation as effectively as GH. These data suggest that GH exerts its inhibitory activity in adipocyte differentiation at a step after the induction of ADD1 but before the induction of genes required for terminal differentiation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
GH exerts a variety of effects on bone growth (1), gene expression (2), mitogenesis (3, 4), and metabolism (5). GH has opposing effects on glucose and lipid metabolism in adipose tissue (6): insulin-like and insulin antagonizing, depending on the time frame. The insulin-like effect is an acute antilipolytic and lipogenic effect, whereas the long-term insulin-antagonizing effect inhibits lipogenesis and glucose transport and increases lipolysis (7, 8). Several clinical observations indicate that the adipose tissue is a major target tissue for GH. In GH-deficient individuals, obesity is often observed, and this condition can be reversed by GH treatment. In many animal studies GH deficiency also leads to increases in fat cell mass, and GH treatment results in a decrease in adipose mass and an accompanying increase in lean body mass (for review see Ref. 9).

The use of various preadipocyte cell lines has been instrumental in delineating the process of adipocyte differentiation at the molecular level. Adipocyte determination and differentiation factor 1 (ADD1), peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}), CCAAT/enhancer binding protein (C/EBP) {alpha},ß,{delta}, adipocyte P2 (aP2), and fatty acid synthase (FAS) have all been found to be involved in adipocyte differentiation at different stages. ADD1 is a basic helix-loop-helix protein induced very early during adipogenesis (10). Transfection studies have shown that forced expression of ADD1 in fibroblasts will induce differentiation. ADD1 has furthermore been shown to activate FAS and lipoprotein lipase (LPL) gene expression (11, 12). PPAR{gamma} is a member of the nuclear receptor superfamily and exists in two isoforms PPAR{gamma}1 and PPAR{gamma}2, which are generated by alternative splicing (13). PPAR{gamma}2 is highly expressed in adipose tissue only whereas low levels of PPAR{gamma}1 can be found in other tissues as well (14, 15). PPAR{gamma}2 is induced very early in adipocyte differentiation and is able to trigger the differentiation of fibroblasts into adipocytes (13, 16, 17, 18). Furthermore, PPAR{gamma} was found to interact with retinoid X receptor-{alpha} (RXR{alpha}) forming the transcription factor complex ARF6 (16, 19). This PPAR{gamma}/RXR heterodimer is able to bind directly to two elements: the ARE6 and ARE7 (13), which are found in the promoters of different adipocyte genes such as aP2 and phosphoenolpyruvate carboxykinase (19, 20).

On the basis of extensive studies using preadipocyte cell lines such as the 3T3-F442A (21, 22), 3T3-L1 (23), Ob1771, and Ob17UT (24), it has been found that GH promotes their differentiation. In contrast, in primary preadipocytes of murine or human origin, GH exhibits a potent inhibitory activity on preadipocytes induced to differentiate with insulin and T3. Using serum-free chemically defined medium (25, 26), a characterization of the role of GH in the differentiation of primary preadipocytes could be obtained (27, 28, 29), demonstrating that GH markedly prevents triglyceride accumulation in primary rat and human preadipocytes (30).

Other growth factors and cytokines such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), fibroblast growth factor (FGF), tumor necrosis factor-{alpha}, transforming growth factor-ß, and interferon-{gamma} have been shown to inhibit adipocyte differentiation (31, 32, 33). It was recently demonstrated that PDGF, FGF, and EGF inhibit adipocyte differentiation through a mitogen-activated protein (MAP) kinase-dependent pathway (34). Serine phosphorylation of PPAR{gamma} at position 112 was observed in response to PDGF, EGF, and FGF, and this phosphorylation has been found to reduce the transcriptional activity of the PPAR{gamma}/RXR complex (34). When this serine residue was mutated to alanine, no growth factor inhibition of PPAR{gamma}/RXR-mediated transcription could be observed.

The differentiation of 3T3-L1 preadipocytes was recently found to be associated with a decrease in the expression of Pref-1, a transmembrane protein with homology to the Drosophila protein delta, which is involved in embryonic cell fate determination. In vivo Pref-1 is processed into a soluble glycoprotein FA1 (35, 36) comprising the extracellular domain of Pref-1. The function of FA1 is not known, but it has recently been shown that a recombinant GST-FA1 fusion protein is able to inhibit the differentiation of 3T3-L1 preadipocytes (37).

Since the mechanism by which GH inhibits the differentiation of primary preadipocytes is not known, the aim of the present study was to determine at which point in the differentiation program GH arrests the differentiating preadipocytes. We have also analyzed the possible mechanism of action of GH in this process.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
When primary epididymal preadipocytes were cultured in serum-free medium supplemented with insulin and T3, marked differentiation occurred during the first 7 days. The cells acquired a round shape, and lipid droplets became visible in the cytoplasm after 3 days of insulin and T3 treatment. Based on positive Oil Red O staining, more than 80% of the cells in these cultures differentiated. In contrast, cells grown in the serum-free medium alone did not differentiate, and they maintained their fibroblast-like morphology (Fig. 1AGo). When GH (20 nM) was included in the differentiation medium, a marked reduction in the number of Oil Red O positive cells was observed (Fig. 1DGo). A time-dependent increase in triglyceride was observed in cells cultured in the presence of insulin and T3. This increase was inhibited by the presence of GH in the differentiation medium after 5 (P <= 0.02] and 7 (P <= 0.05) days of culture (Fig. 1EGo).



View larger version (89K):
[in this window]
[in a new window]
 
Figure 1. Inhibition of Preadipocyte Differentiation by GH

Primary rat preadipocytes were cultured in basal medium (A), basal medium supplemented with 20 nM GH (B), differentiation medium (C), and differentiation medium supplemented with 20 nM GH (D). The cells were cultured for 4 days and stained for lipid using Oil Red O (A–D). Total cellular triglyceride was measured in cell extracts from cells cultured in differentiation medium (solid bars) or in differentiation medium supplemented with GH (open bars) for the indicated time. The mean + SD for three experiments are shown (E).

 
In an effort to characterize the mechanism by which GH exerts it antiadipogenic action, we measured the expression levels of several genes known to be activated during preadipocyte differentiation. Using total RNA isolated from cells cultured in differentiation medium in the absence or presence of GH (20 nM), multiplex RT-PCR was performed to quantify the level of gene expression. The expression levels of two genes expressed early during differentiation, ADD1 and PPAR{gamma}, were induced rapidly during the differentiation process (Fig. 2Go, A and B). The expression of these genes before the addition of differentiation medium was low, and increased 10- to 20-fold after 5–7 days of culture in medium with insulin and T3. When cells were cultured in the control serum-free medium, the expression of both PPAR{gamma} and ADD1 remained at the level observed at day 0 (data not shown). The expression of both ADD1 and PPAR{gamma} was also increased in cells cultured in the presence of differentiation medium and GH (Fig. 2Go, A and B). The difference in induction of ADD1 in differentiation medium with or without GH was not statistically different (Fig. 2GGo), indicating that GH inhibits preadipocyte differentiation at a step distal to the expression of ADD1. In contrast, a significant 50% reduction in the level of PPAR{gamma} expression in response to GH was detected (Fig. 2GGo). The expression of late markers of preadipocyte differentiation, FAS, aP2, and hormone-sensitive lipase (HSL), was also increased during differentiation. The expression level of these genes in the basal state (day 0) was very low but increased 35- to 90-fold during differentiation (Fig. 2Go, C–E). In the presence of GH, the expression levels of both FAS, aP2, and HSL were significantly reduced (70–90%) compared with control differentiating cells (Fig. 2GGo). Pref-1 expression was high in undifferentiated preadipocytes and decreased to undetectable levels after 8 days of differentiation (Fig. 2FGo). In the presence of GH, however, the expression level of Pref-1 was comparable to that observed in control preadipocytes (Fig. 2HGo).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 2. Effect of GH on Gene Expression during Adipocyte Differentiation

The level of gene expression in preadipocytes cultured in differentiation medium with (open bars) or without (hatched bars) 20 nM GH for the indicated time was determined by multiplex RT-PCR and quantified as described in Materials and Methods. The figure shows one representative experiment measuring the mRNA level of ADD1 (A), PPAR{gamma} (B), FAS (C), aP2 (D), HSL (E), and Pref-1 (F). Data are expressed as fold induction over nondifferentiated cells (day 0). In panel G the inhibitory effect of GH on the expression of adipocyte marker genes is shown. The expression of marker genes after 5 days of differentiation ± GH is shown. Results are shown as mean + SD for three to five experiments. In panel H the effect of GH on the expression of Pref-1 is shown. The expression of Pref-1 after 8 days of differentiation ± GH was normalized to the expression at day 0. Results are shown as mean ± SD for three experiments.

 
Since we observed a modest 50% decrease in the expression level of PPAR{gamma} RNA by GH, we analyzed whether the reduced RNA expression resulted in a change in PPAR{gamma} DNA-binding activity. Nuclear extracts were isolated from primary rat preadipocytes that had been cultured in the presence of basal serum-free medium, differentiation medium, or differentiation medium plus GH. The nuclear extracts were incubated with radiolabeled ARE7 probe from the aP2 gene. A weak band corresponding to the PPAR{gamma}/RXR{alpha} complex was observed using nuclear extracts from cells cultured in basal medium (Fig. 3Go, lane 1), which is in accordance with the low level of PPAR{gamma} expression in undifferentiated preadipocytes. An increased binding activity of PPAR{gamma}/RXR{alpha} was observed in cells cultured in differentiation medium with or without hGH (Fig. 3Go, lanes 2 and 3). The intensity of the band observed in extracts from GH-treated cells was reduced approximately 50% compared with that in differentiating cells. The band was specific, as it could be inhibited with unlabeled ARE7 (Fig. 3Go, lane 4), but not with a nonspecific oligonucleotide {alpha}CG-cAMP-response element (Fig. 3Go, lane 5). Furthermore, the appearance of the PPAR{gamma}/RXR{alpha} complex was abolished when an antibody against RXR{alpha} was present during incubation (Fig. 3Go, lane 7), whereas preimmune serum did not affect the electrophoretic mobility of this complex (Fig. 3Go, lane 6).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Effect of Differentiation and GH on PPAR{gamma} DNA-Binding Activity

EMSAs were performed using nuclear extracts prepared from primary rat preadipocytes cultured in basal medium (lane 1), differentiation medium (lane 2), and differentiation medium + GH (lane 3) and incubated with a radiolabeled ARE7 probe. Unlabeled ARE7 (100-fold molar excess) (lane 4), or nonspecific cold oligo (100-fold molar excess) (lane 5) were included in the binding reaction. Control or anti-RXR{alpha} antibody was included in lanes 6 and 7, respectively.

 
It has recently been reported that growth factors such as EGF inhibit adipocyte differentiation through a MAP kinase-dependent pathway and that the inhibition of differentiation by EGF can be blocked by the mitogen-activated protein (MAP) kinase/extracellular-regulated protein kinase (ERK) kinase inhibitor PD 98059 (34). Since it has previously been shown that GH activates the MAP kinase pathway in several cell types (38), we analyzed the effect of PD 98059 on GH-induced inhibition of differentiation. The effect of PD 98059 on the total triglyceride content of cells cultured in differentiation medium with or without GH was measured. In differentiating cells, PD 98059 increased the lipid content by 50%; however, in the presence of PD 98059, GH was still able to inhibit differentiation (Fig. 4Go). As a control the phorbol ester PDBu was included in the differentiation medium and was found to inhibit lipid accumulation as expected. However, in the presence of the PD98059, PDBu no longer inhibited differentiation. The ability of GH to activate MAP kinases in preadipocyte cultures was measured by analyzing the phosphorylation of MAP kinases ERK-1 and 2 in response to GH. Cells grown in control serum-free medium for 5 days in the absence or presence of GH did not contain any detectable amount of phosphorylated ERK1 and 2 (Fig. 5Go, lanes 1 and 2). Similarly, no phosphorylated ERK-1 and 2 could be detected in cells grown in differentiation medium with or without GH for 5 days (Fig. 5Go, lanes 3 and 8). In contrast, in differentiating cells stimulated for a short time (10 and 30 min) with GH, phosphorylated MAP kinase could be detected. This activation was transient as no MAP kinase activation was seen after 60 min of GH stimulation (Fig. 5Go lane 7). These data suggest that the MAP kinase pathway is not important for GH inhibition of differentiation and furthermore indicate that GH and EGF utilize different signaling pathways in inhibiting adipocyte differentiation.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. The Effect of MEK 1 Inhibitor PD98059 on GH Inhibition of Preadipocyte Differentiation

The MEK 1 inhibitor PD98059 was added to primary rat preadipocytes during differentiation with (open bars) or without (hatched bars) 20 nM GH. The phorbol ester PDBu (100 nM) was added either alone or in combination with PD 98059 in differentiation medium in the absence or presence of 20 nM GH. The cells were harvested at day 5 and triglyceride content was measured and normalized to total cellular protein. Data are expressed as the mean ± SD of three experiments.

 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 5. MAP Kinase Activation in Primary Rat Preadipocytes Differentiated with or without 20 nM GH

Extracts from primary rat preadipocytes were immunoprecipitated with an antibody against p44/42 MAP kinase, and Western blot analysis was performed using a phosphor-specific MAPK antibody. The cells were grown in basal medium (lane 1), basal medium + GH (lane 2), differentiation medium (lane 3), or differentiation medium + GH (lane 8). The cells grown in differentiation medium were further stimulated with 20 nM GH for 0, 5, 10, 30, or 60 min (lanes 3–7). The figure shows a representative experiment.

 
As GH has been shown to induce Pref-1/FA1 gene expression in pancreatic ß-cells (39) and preadipocyte cell lines, and, furthermore, since it has been suggested to be involved in cell differentiation (37), we investigated the effect of FA1 on differentiation. FA1 inhibited adipose differentiation in a dose-dependent manner (Fig. 6Go) with maximal inhibition observed at 5 µg/ml of FA1. The extent of inhibition at the highest dose was comparable to that observed using GH. This observation suggests that the GH-induced expression of Pref-1/FA1 might be involved in the inhibition of preadipocyte differentiation by GH.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 6. The Effect of FA1 on Primary Rat Preadipocyte Differentiation

Primary rat preadipocytes were cultured in differentiation medium containing 0, 1.25, 2.5, or 5 µg/ml purified FA1 for 5 days. Total cellular triglyceride content was measured in cell extracts as described in Materials and Methods. Triglyceride content was normalized to that observed in differentiated cells. For comparison, primary rat preadipocytes were cultured in differentiation medium with 20 nM GH. Data are expressed as the mean ± SD of three experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this study we have demonstrated that GH inhibits the differentiation of primary rat preadipocytes at a step preceding the induction of the late adipocyte markers, aP2, FAS and HSL. The inhibitory action of GH was not mediated by a MAP kinase-dependent pathway since the MEK inhibitor PD98059 did not affect the inhibitory activity of GH. Finally, the expression of Pref-1/FA1, which is normally down-regulated during adipocyte differentiation, was maintained at preadipocyte levels by GH, and recombinant FA1 added to the preadipocytes prevented differentiation.

This effect of GH on primary cells is similar to that of other growth factors (31, 32, 33) but is in contrast to the previously described effects of GH on various preadipocyte cell lines (7, 21, 22, 24, 27). In 3T3-F442A cells, GH was identified as an important factor required for adipose conversion, and GH was able to partially substitute for serum in promoting differentiation. Although the mechanism underlying this difference in response to GH between primary preadipocyte and cell lines is not known, it could be speculated that since differentiation of primary cells occurs in the absence of serum, whereas in 3T3-F442A cells serum is required for differentiation, it may be that this difference in culture conditions affects their response to GH. Furthermore, in contrast to primary cells, the cell lines are immortalized and have unlimited growth potential; therefore, they might respond differently to factors such as GH since growth arrest is generally required for the initiation of differentiation. It is also possible that the primary preadipocyte cell cultures contain other cell types that somehow affect their ability to differentiate and respond to GH. However, in vivo observations confirm an inhibitory effect of GH on adipogenesis. In humans as well as rodents, GH deficiency is often associated with obesity (6), and GH treatment is able to decrease fat cell mass (40). In accordance with this observation, GH overproduction in acromegalics or GH transgenic mice is associated with a decreased adiposity and an increase in lean body mass. An inhibitory effect of GH on human mammary preadipocyte differentiation has also been reported (30). However, under certain conditions, GH can exert insulin-like lipogenic effects on adipose cells as occurs in isolated adipocytes from hypophysectomized animals or in adipocytes deprived of GH in vitro (5).

In preadipocyte cell lines such as 3T3-L1, 3T3-F442A, and Ob17, it has been demonstrated that the adipocyte-specific genes ADD1, PPAR{gamma}, FAS, aP2, and HSL are up-regulated during differentiation in a time-dependent manner (10, 11, 13, 41, 42, 43, 44, 45, 46). The induction of the basic helix-loop-helix factor ADD1 is observed early during differentiation followed by the expression of PPAR{gamma} and subsequently aP2, FAS, and HSL. We also found that these genes were up-regulated in differentiating primary rat preadipocytes, although we could not confirm the time dependence. This is most likely due to the fact that the primary cells used in this study are heterogeneous in terms of their differentiation stage, whereas preadipocyte cell lines are representative of a more specific developmental stage. When the primary rat preadipocytes were cultured in differentiation medium supplemented with GH, we were not able to detect any changes in the expression level of ADD1 compared with differentiating control cells. In contrast, a modest reduction in the level of PPAR{gamma} was observed. This observation suggests that GH inhibits the differentiation process at a step downstream of ADD1 expression. The ability of the PPAR{gamma}/RXR{alpha} heterodimer to bind the ARE7 DNA element from the aP2 gene was only reduced slightly by GH. The expression of FAS, aP2, and HSL, however, was reduced dramatically by GH. The fact that PPAR{gamma} mRNA levels as well as DNA-binding activity were only reduced modestly compared with the decrease in aP2, FAS, and HSL expression suggest that GH inhibits PPAR{gamma}- induced transcription at a step distal to the binding of PPAR{gamma}/RXR{alpha} to DNA or, alternatively, that GH regulates multiple pathways that converge on PPAR{gamma}-regulated transcription.

It has recently been shown that the growth factors PDGF and EGF inhibit the differentiation of preadipocyte cell lines through a MAP kinase-dependent mechanism (34). Growth factor-stimulated MAP kinase has been found to phosphorylate PPAR{gamma} on serine 112; however, this phosphorylation does not affect the DNA-binding activity of PPAR{gamma}/RXR{alpha}, but significantly inhibits its transactivating activity (34). In accordance with this model the inhibitory action of EGF could be reversed by the MEK inhibitor PD98059. In contrast, we did not detect any effect of PD98059 on the GH-mediated inhibition of primary preadipocyte differentiation. We could, however, inhibit the differentiation of primary rat preadipocytes by the addition of the phorbol ester PDBu, a known MAP kinase activator, and this inhibition was reversed by PD 98059 (Fig. 4Go). In cells cultured long term with GH we could not detect any activation of MAP kinase. In short-term stimulation experiments, however, MAP kinase was activated transiently by GH. Similar transient stimulation of MAP kinase by GH has been reported to occur in several other cell types (38). The fact that GH exerts its inhibitory activity on adipocyte differentiation for several days suggests that the transient induction of MAP kinase activity is most likely not involved in the inhibitory action of GH. These observations indicate that GH inhibits differentiation by a mechanism that is distinct from that used by EGF and other growth factors.

Pref-1/FA1 is a member of the family of proteins having multiple EGF-like domains and shows homology to the Delta (47) and Notch (48) gene family. These factors exist in both a membrane-bound or soluble form. This family of proteins is involved in cell differentiation and pattern formation. Pref-1 is expressed in four different cell types in the adult mammalian organism with the highest level of expression in the adrenal glands (49). Pref-1/FA1 is highly expressed in the pituitary somatotrophs (50) and in the ß-cells of the pancreas (39). GH has also been shown to up-regulate Pref-1 in islets of Langerhans from neonatal rats (39). Finally, expression of Pref-1 has been observed in preadipocytes (49). In 3T3-L1 preadipocytes, expression of Pref-1 is high and decreases to nondetectable levels after differentiation. Forced expression of Pref-1 in 3T3-L1 cells by stable transfection renders these cells resistant to differentiation, indicating that down-regulation of Pref-1 during differentiation is required for differentiation to occur (49). The decrease in Pref-1/FA1 expression is probably an early event in the differentiation process, as inhibition of differentiation by growth factors such as IL-11, tumor necrosis factor-{alpha}, FGF, and transforming growth factor-ß inhibit the expression of PPAR{gamma} and adipsin but do not increase the expression of Pref-1 (51, 52). The ability of GH to maintain high levels of Pref-1 expression in primary preadipocytes cultured in the presence of insulin and T3, as shown in this study, suggests that one possible mechanism by which GH inhibits differentiation is by inducing the expression of Pref-1. The mechanism by which Pref-1 exerts its inhibitory actions are not known. Interestingly, we were able to inhibit preadipocyte differentiation by adding FA1 to the cultured preadipocytes. FA1 is a naturally occurring variant of Pref-1 that corresponds to the extracellular domain of Pref-1 and is believed to be generated by proteolytic cleavage of Pref-1. The concentration of FA1 is approximately 25 µg/ml and 20 ng/ml in amniotic fluid and plasma, respectively (36). The fact that FA1 can inhibit preadipocyte differentiation indicates that Pref-1 does not require its transmembrane or intracellular domains for activity. However whether Pref-1 acts as a soluble factor or in a membrane-associated form in vivo to regulate adipocyte differentiation is not known. Interestingly, we were not able to detect any FA-1 in the medium of preadipocytes cultured in the presence of GH while FA-1 could be measured in the medium of cultured islets of Langerhans (B. Madsen, unpublished observation).

In conclusion, we have shown that GH inhibits the differentiation of primary rat preadipocytes at a step after the induction of ADD1, but before the induction of aP2 and FAS. The mechanism by which GH inhibits the differentiation is not dependent upon MAP kinase-activated serine phosphorylation of PPAR{gamma} as has been demonstrated to be the case with other growth factors. It is suggested that the antiadipogenic effect of GH is mediated by Pref-1/FA1, which is maintained at a high level of expression by GH in preadipocytes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture
Primary rat preadipocytes were isolated as previously described (30). Briefly, epididymal fat pads from Sprague Dawley male rats approximately 120 g (Møllegaard, Ll. Skensved, Denmark) were excised and separated from blood vessels and connective tissue. The fat pads were incubated for 45–60 min in 1 mg/ml collagenase in Krebs-Ringer-HEPES (KRH) buffer, pH 7.4, supplemented with 2.0 mM glucose and 3.5% BSA (KRH wash buffer) until less than 1% of the starting material remained. The collagenase digest was filtered through two layers of gauze and washed twice in KRH wash buffer and centrifuged at 500 x g for 2 min. The pellet containing the preadipocytes was washed once in DMEM containing 10% FCS, 100 U of penicillin/ml, and 100 µg of streptomycin/ml (GIBCO BRL, Gaithersburg, MD), resuspended in erythrocyte lysis buffer (154 mM NH4Cl, 10 mM KHCO3, 0.1 mM EDTA), and filtered through a 70-µm Falcon nylon cell strainer and subsequently through a 30-µm filter (Sefar AG, Thal, Switzerland). After filtration the cells was centrifuged at 500 x g for 10 min at room temperature. The cells was counted and plated in DMEM containing 10% FCS at a density of 2 x 105 cells per dish (11.3 cm2). After 2 days of culture the medium was changed to 1) basal serum-free medium (DMEM/Ham’s F12 (1:1 vol/vol) supplemented with 15 mM NaHCO3, 15 mM HEPES, 33 µM Biotin (Sigma Chemical Co., St. Louis, MO), 17 µM panthotenate (Sigma), 100 U/ml penicillin and 100 µg of streptomycin/ml, and 10 µg/ml transferrin (Sigma); 2) basal medium supplemented with 20 nM hGH (Novo Nordisk, Bagsvard, Denmark); 3) basal medium supplemented with 1 µM insulin (Novo Nordisk) and 200 pM T3 (Sigma) (differentiation medium); or 4) differentiation medium supplemented with 20 nM hGH. The day of induction of differentiation is referred to as day 0. For the experiments using the MEK 1 inhibitor PD98059 (New England Biolabs, Beverly, MA), primary rat preadipocytes were cultured in the presence of 10 µM MEK 1 inhibitor PD98059 (in DMSO), DMSO, or 100 nM PDBu for 5 days and harvested for triglyceride measurement.

Oil Red O Staining
Oil Red O (Sigma) was dissolved in methanol/acetone. The cells were rinsed twice in PBS and fixed in 4% glutaraldehyde for 10 min. After fixation, the cells were washed twice in PBS and incubated with Oil Red O solution for 10 min. The cells were finally washed twice in PBS.

Determination of Triglyceride Content
Cells were washed once in PBS and scraped off the dish in 250 µl 50 mM Tris/HCl, pH 7.4, 1 mM EDTA. The samples were homogenized by sonication, and the triglyceride concentration was determined using the GPO-Trinder kit from Sigma. Statistical significance was evaluated using the paired sample t-test.

Determination of Protein Content
The Bio-Rad protein assay (Bio-Rad Laboratories, Richmond, CA) was used to determine the protein content of sonicated cell extracts.

RNA Isolation
Total RNA was isolated by lysing the cells in RNAzol (Cinna Biotecx, Austin, TX) and purified according to the manufacturer’s instructions. The RNA was resuspended in diethyl pyrocarbonate-treated water, and concentration and purity were determined by measuring A260/A280.

cDNA Synthesis
One microgram of total RNA was mixed with 3 µg of random hexamer primers (Life Technologies, Inc., Gaithersburg, MD) and heated for 5 min at 85 C and quickly chilled on ice. The cDNA synthesis was carried out for 1 h at 37 C in 50 mM Tris/HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 200 U of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.), 40 U of RNAsin (Promega, Madison, WI), and 0.9 mM deoxynucleoside triphosphate (Pharmacia Biotech Inc., Uppsala, Sweden). After cDNA synthesis the reaction was diluted with 50 µl H2O, and stored at -20 C until use.

Primers
As an internal control the expression of the rat acidic ribosomal phosphoprotein P0 (36B4) was measured using the following primers (53): 5'-oligo: GTACCTGCTCAGAACACCCGG and 3'-oligo: CCTCTGGGCTGTAGATGCTG, resulting in a 240-bp PCR product. Rat ADD1 (10) primers: 5'-oligo: CTGCACCCTTGTCCCCTCCA and 3'-oligo: GGCAGGCTAGATGGCGTCTG, resulting in a 279-bp PCR product. Mouse PPAR{gamma} (13) primers: 5'-oligo: GCTGATGCACTGCCTATGAGC and 3'-oligo: CGCACTTTGGTATTCTTGGAGC, resulting in a 263-bp PCR product. Rat FAS (54) primers: 5'-oligo: CCCTGAAATCCCAGCACTTC and 3'-oligo: GGCATGGCTGCTGTAGGGGT, resulting in a 308-bp PCR product. Mouse aP2 (55) 5'-oligo: CCTTTGTGGGAACCTGGAAG and 3'-oligo: TCTTCCTTTGGCTCATGCCC, resulting in a 380-bp PCR product. Rat Pref-1 primers: 5'-oligo: TCTGTGAGGCTGACAATGTCTGC and 3'-oligo CCTTGTGCTGGCAGTCCTTTCC, resulting in a 275-bp PCR product. Rat hormone-sensitive lipase (HSL) primers: 5'-oligo: ACCTGGACACTGAGACACCAGC and 3'-oligo: TCCTGGTCGGTTGATGGTCAGC, resulting in a 229-bp PCR product. The primer sets were tested on cDNA from adipose tissue or preadipocytes from the day of isolation to determine the number of cycles within the linear phase. The number of PCR cycles within the linear range for each set of primers was determined as described previously (56). Briefly, cDNA from either freshly isolated preadipocytes or adipocytes was used. PCR was allowed to proceed for 16–24 cycles and individual PCR products were analyzed by PhosphorImage analysis and quantified using the Imagequant program (Molecular Dynamics, Sunnyvale, CA). The logarithm to the PCR fragment volume was plotted against cycle number, and linear regression analysis was used to determine the linear range. The following cycle numbers were used: 36B4: 18–22 cycles; ADD1: 22 cycles; PPAR{gamma}: 22 cycles; FAS: 20 cycles; aP2: 18 cycles; Pref-1: 20–22 cycles; and HSL: 22 cycles.

Multiplex RT-PCR
The PCRs were performed as previously described (56). Briefly, 1.5 µl cDNA and 23.5 µl of PCR mix [50 mM KCl, 10 mM Tris/HCl, pH 9.0, 0.1% Triton X-100, 1.5 mM MgCl2, 40 mM dATP, dTTP, and dGTPs, 20 mM dCTP, 2.5 U of Taq polymerase (Promega), and 2.5 µCi of 3000 Ci/mmol [{alpha}-33P]-dCTP (Amersham, Aylesbury, U.K.)], and 25 µl mineral oil (Sigma) were added to each tube. The standard thermal cycle profile was used. A single denaturing step at 95 C for 90 sec was followed by the chosen numbers of cycles as stated above: 94 C for 30 sec, 55 C for 60 sec, and 72 C for 60 sec. The reaction products were separated on a 6% polyacrylamide gel (BRL Life Technologies), which was dried and exposed to PhosphorImager Storage Screens overnight. The screens were analyzed using the Molecular Dynamics PhosphorImager series 400, and the band intensities were calculated using the ImageQuant software by the use of rectangle mode/local background/volume integration. All quantitations were normalized to the internal standard 36B4.

Nuclear Extracts
The cells were grown as previously described in 150-mm dishes. The cells were washed twice in ice-cold PBS on ice and lysed in a hypotonic buffer [20 mM HEPES, 1 mM EDTA, 1 mM MgCl2, 10 mM KCl, 20% glycerol, 0.5% Triton X-100, 1 mM dithiothreitol, 0.5 mM 4-(2-aminoethyl)-benzenesulfonyl fluoride, 1 mM Na3VO4, 1 µg/ml leupeptin, 1 µg/ml aprotinin]. After a 15-min incubation on ice the cells were centrifuged at 2500 x g for 7 min at 4 C. The pellet was resuspended in a hypertonic buffer (the hypotonic buffer supplemented with 400 mM NaCl), and incubated on a rocking platform for 30 min. The supernatant was collected after centrifugation at 20,000 x g for 30 min at 4 C.

Electrophoretic Mobility Shift Assay (EMSA)
The EMSA was carried out as previously described (2). Five micrograms of nuclear extract were incubated for 30 min at 30 C in 20 mM HEPES, 10 mM NaCl, 1 mM MgCl2, 1 mM EDTA, 10% glycerol, 2.5 mM Na3VO4, 5 mM dithiothreitol, 2 µg poly- deoxyinosinic-deoxycytidylic acid·polydeoxyinosinic-deoxycytidylic acid and 20 fmol of 32P-labeled oligonucleotide probe. After addition of 5 x loading buffer, the samples were examined on a 5% native polyacrylamide gel and exposed to x-ray film. For the supershift reaction, the samples were preincubated with RXR{alpha} antibody for 1 h at 4 C. For competition studies the unlabeled oligo was added at 100-fold excess molar concentration at the same time as the radiolabeled probe. The ARE7 probe used was the gatcTGTGAACTCTGATCCAGTAAG (13), and the nonspecific competitor was the {alpha}-CG promoter probe containing a cAMP response element ({alpha}CG-CRE) agctTTTTACCATGAC-GTCAATTTGATC. The ARE7 probe was labeled using T4 PNK kinase (Promega). Each strand was labeled separately and annealed after labeling. The annealed probe was purified on a NAP-5 column (Pharmacia). The RXR{alpha} antibody was {alpha}RXR{alpha} ({Delta}N 197) from Santa Cruz Biothecnology, Inc. (Santa Cruz, CA).

MAP Kinase Assay
The cells were cultured in either 1) basal medium, 2) basal medium + 20 nM hGH, 3) differentiation medium, or 4) differentiation medium + 20 nM hGH for 6 days in six-well plates. The cells that were differentiated for 6 days in differentiation medium were further stimulated with 20 nM hGH for 0, 5, 10, 30, or 60 min before harvest. The rest of the cells were harvested without further stimulation. MAP kinase activation was investigated using the Phosphoplus MAPK antibody Kit (New England Biolabs), and the cells were harvested and assayed according to the manufacturer’s instructions.

Purification of Fetal Antigen 1 (FA1)
Human FA1 was purified from second-trimester amniotic fluid by immunospecific chromatography as described previously (36, 57). After dialysis (50 mM Tris/HCl, pH 7.3) the FA-1 containing fractions were pooled and concentrated using a Resource S matrix (Pharmacia Biotech) that was eluted with 50 mM Tris/HCl, pH 7.3, containing 1 M NaCl.


    ACKNOWLEDGMENTS
 
We thank Dr. Erica Nishimura for helpful discussion and critical review of the manuscript. We also thank Linda Larsø and Jannie Rosendahl Christensen for expert technical assistance.


    FOOTNOTES
 
Address requests for reprints to: Nils Billestrup, Hagedorn Research Institute, Niels Steensensvej 6, DK-2820 Gentofte, Denmark. E-mail: nbil{at}hagedorn.dk

L.H.H. was supported by the Danish Research Academy. B.T. was supported by the Danish Medical Research Council, Direktør, Civilingeniør Aage Louis-Hansens Memorial Foundation, and P.A. Messerschmidt og Hustrus Fond.

Received for publication October 15, 1997. Revision received May 1, 1998. Accepted for publication May 4, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Isaksson OGP, Edén S, Jansson JO 1985 Mode of action of pituitary growth hormone on target cells. Annu Rev Physiol 47:483–499[CrossRef][Medline]
  2. Hansen LH, Wang X, Kopchick JJ, Bouchelouche P, Nielsen JH, Galsgaard ED, Billestrup N 1996 Identification of tyrosine residues in the intracellular domain of the growth hormone receptor required for transcriptional signaling and Stat5 activation. J Biol Chem 271:12669–12673[Abstract/Free Full Text]
  3. Billestrup N, Nielsen JH 1991 The stimulatory effect of growth hormone, prolactin, and placental lactogen of beta cell proliferation is not mediated by insulin-like growth factor-I. Endocrinology 129:883–888[Abstract/Free Full Text]
  4. Schindler C, Darnell Jr JE 1995 Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu Rev Biochem 64:621–651[Medline]
  5. Goodman HM 1981 Separation of early and late responses of adipose tissue to growth hormone. Endocrinology 109:120–129[Abstract/Free Full Text]
  6. Davidson MB 1987 Effects of growth hormone on carbohydrate and lipid metabolism. Endocr Rev 8:115–123[Abstract/Free Full Text]
  7. Dietz J, Schwartz J 1991 Growth hormone alters lipolysis and hormone-sensitive lipase activity in 3T3–F442A adipocytes. Metabolism 40:800–806[CrossRef][Medline]
  8. Doglio A, Dani C, Grimaldi P, Ailhaud G 1989 Growth hormone stimulates c-fos gene expression by means of protein kinase C without increasing inositol lipid turnover. Proc Natl Acad Sci USA 86:1148–1152[Abstract/Free Full Text]
  9. Wabitsch M, Hauner H, Heinze E, Teller WM 1995 The role of growth hormone/insulin-like growth factors in adipocyte differentiation. Metabolism 44[Suppl 4]:45–49
  10. Tontonoz P, Kim JB, Graves RA, Spiegelman BM 1993 ADD1: a novel helix-loop-helix transcription factor associated with adipocyte determination and differentiation. Mol Cell Biol 13:4753–4759[Abstract/Free Full Text]
  11. Kim JB, Spiegelman BM 1996 ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism. Genes Dev 10:1096–1107[Abstract/Free Full Text]
  12. Magaña MM, Osborne TF 1996 Two tandem binding sites for sterol regulatory element binding proteins are required for sterol regulation of fatty acid synthase promoter. J Biol Chem 271:32689–32694[Abstract/Free Full Text]
  13. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM 1994 mPPAR{gamma}2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8:1224–1234[Abstract/Free Full Text]
  14. Zhu Y, Qi C, Korenberg JR, Chen XN, Noya D, Rao MS, Reddy JK 1995 Structural organization of mouse peroxisome proliferator-activated receptor {gamma} (mPPAR{gamma}) gene: alternative promoter use and different splicing yield two mPPAR{gamma} isoforms. Proc Natl Acad Sci USA 92:7921–7925[Abstract/Free Full Text]
  15. Elbrecht A, Chen Y, Cullinan CA, Hayes N, Leibowitz MD, Moller DE, Berger J 1996 Molecular cloning, expression and characterization of human peroxisome proliferator activated receptors {gamma}1 and {gamma}2. Biochem Biophys Res Commun 224:431–437[CrossRef][Medline]
  16. Chawla A, Schwarz EJ, Dimaculangan DD, Lazar MA 1994 Peroxisome proliferator-activated receptor (PPAR) {gamma}: adipose-predominant expression and induction early in adipocyte differentiation. Endocrinology 135:798–800[Abstract]
  17. Tontonoz P, Hu E, Spiegelman BM 1994 Stimulation of adipogenesis in fibroblasts by PPAR{gamma}2, a lipid-activated transcription factor. Cell 79:1147–1156[CrossRef][Medline]
  18. Schoonjans K, Staels B, Auwerx J 1996 The peroxisome proliferator activated receptors (PPARS) and their effects on lipid metabolism and adipocyte differentiation. Biochim Biophys Acta 1302:93–109[Medline]
  19. Tontonoz P, Graves RA, Budavari AI, Erdjument Bromage H, Lui M, Hu E, Tempst P, Spiegelman BM 1994 Adipocyte-specific transcription factor ARF6 is a heterodimeric complex of two nuclear hormone receptors, PPAR{gamma} and RXR{alpha}. Nucleic Acids Res 22:5628–5634[Abstract/Free Full Text]
  20. Tontonoz P, Hu E, Devine J, Beale EG, Spiegelman BM 1995 PPAR{gamma}2 regulates adipose expression of the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 15:351–357[Abstract]
  21. Morikawa M, Nixon T, Green H 1982 Growth hormone and the adipose conversion of 3T3 cells. Cell 29:783–789[CrossRef][Medline]
  22. Nixon T, Green H 1984 Contribution of growth hormone to the adipogenic activity of serum. Endocrinology 114:527–532[Abstract/Free Full Text]
  23. Hauner H, Loffler G 1986 Adipogenic factors in human serum promote the adipose conversion of 3T3–L1 fibroblasts. Int J Obes 10:323–330[Medline]
  24. Doglio A, Dani C, Grimaldi P 1986 Growth hormone regulation of the expression of differentiation dependent genes in preadipocyte Ob1771 cells. Biochem J 238:123–129[Medline]
  25. Deslex S, Negrel R, Ailhaud G 1987 Development of a chemically defined serum-free medium for differentiation of rat adipose precursor cells. Exp Cell Res 168:15–30[CrossRef][Medline]
  26. Vassaux G, Negrel R, Ailhaud G, Gaillard D 1994 Proliferation and differentiation of rat adipose precursor cells in chemically defined medium: differential action of anti-adipogenic agents. J Cell Physiol 161:249–256[CrossRef][Medline]
  27. Loffler G, Hauner H 1987 Adipose tissue development: the role of precursor cells and adipogenic factors. Part II: The regulation of the adipogenic conversion by hormones and serum factors. Klin Wochenschr 65:812–817[CrossRef][Medline]
  28. Hauner H, Loffler G 1987 Adipose tissue development: the role of precursor cells and adipogenic factors. Part I: Adipose tissue development and the role of precursor cells. Klin Wochenschr 65:803–811[CrossRef][Medline]
  29. Ailhaud G, Grimaldi P, Negrel R 1992 Cellular and molecular aspects of adipose tissue development. Annu Rev Nutr 12:207–233[CrossRef][Medline]
  30. Wabitsch M, Heinze E, Hauner H, Shymko RM, Teller WM, De Meyts P, Ilondo MM 1996 Biological effects of human growth hormone in rat adipocyte precursor cells and newly differentiated adipocytes in primary culture. Metabolism 45:34–42[CrossRef][Medline]
  31. Hauner H, Rohrig K, Petruschke T 1995 Effects of epidermal growth factor (EGF), platelet-derived growth factor (PDGF) and fibroblast growth factor (FGF) on human adipocyte development and function. Eur J Clin Invest 25:90–96[Medline]
  32. Serrero G, Mills D 1991 Physiological role of epidermal growth factor on adipose tissue development in vivo. Proc Natl Acad Sci USA 88:3912–3916[Abstract/Free Full Text]
  33. Navre M, Ringold GM 1989 Differential effects of fibroblast growth factor and tumor promoters on the initiation and maintenance of adipocyte differentiation. J Cell Biol 109:1857–1863[Abstract/Free Full Text]
  34. Hu E, Kim JB, Sarraf P, Spiegelman BM 1996 Inhibition of adipogenesis through MAP kinase-mediated phosphorylation of PPAR{gamma}. Science 274:2100–2105[Abstract/Free Full Text]
  35. Fay TN, Jacobs I, Teisner B, Poulsen O, Chapman MG, Stabile I, Bohn H, Westergaard JG, Grudzinskas JG 1988 Two fetal antigens (FA-1 and FA-2) and endometrial proteins (PP12 and PP14) isolated from amniotic fluid: preliminary observations in fetal and maternal tissues. Eur J Obstet Gynecol Reprod Biol 29:73–85[CrossRef][Medline]
  36. Jensen CH, Teisner B, Højrup P, Rasmussen HB, Madsen OD, Nielsen B, Skjødt K 1993 Studies of the isolation, structural analysis and tissue localization of fetal antigen 1 and its relation to a human adrenal specific cDNA, pG2. Hum Reprod 8:635–641[Abstract/Free Full Text]
  37. Smas CM, Chen L, Sul HS 1997 Cleavage of membrane associated pref-1 generates a soluble inhibitor of adipocyte differentiation. Mol Cell Biol 17:977–988[Abstract]
  38. Carter-Su C, Schwartz J, Smit LS 1996 Molecular mechanism of growth hormone action. Annu Rev Physiol 58:187–207[CrossRef][Medline]
  39. Carlsson C, Tornehave D, Lindberg K, Galante P, Billestrup N, Michelsen B, Larsson LI, Nielsen JH 1997 Growth hormone and prolactin stimulate the expression of rat preadipocyte factor-1/{Delta}-like protein in pancreatic islet: molecular cloning and expression pattern during development and growth of the endocrine pancreas. Endocrinology 138:3940–3948[Abstract/Free Full Text]
  40. Salomon F, Cuneo RC, Hesp R, Sönksen PH 1989 The effect of treatment with recombinant human growth hormone on body composition and metabolism in adults with growth hormone deficiency. N Engl J Med 321:1797–1803[Abstract]
  41. Shalev A, Meier CA 1996 Peroxisome proliferator-activated receptors: a nuclear hormone receptor involved in adipocyte differentiation and lipid homeostasis. Eur J Endocrinol 134:541–542[Abstract/Free Full Text]
  42. Wu Z, Bucher NL, Farmer SR 1996 Induction of peroxisome proliferator-activated receptor {gamma} during the conversion of 3T3 fibroblasts into adipocytes is mediated by C/EBPß, C/EBP{delta}, and glucocorticoids. Mol Cell Biol 16:4128–4136[Abstract]
  43. Brun RP, Tontonoz P, Forman BM, Ellis R, Chen J, Evans RM, Spiegelman BM 1996 Differential activation of adipogenesis by multiple PPAR isoforms. Genes Dev 10:974–984[Abstract/Free Full Text]
  44. Moustaid N, Sakamoto K, Clarke S, Beyer RS, Sul HS 1993 Regulation of fatty acid synthase gene transcription. Sequences that confer a positive insulin effect and differentiation-dependent expression in 3T3–L1 preadipocytes are present in the 332 bp promoter. Biochem J 292:767–772
  45. Moustaid N, Sul HS 1991 Regulation of expression of the fatty acid synthase gene in 3T3–L1 cells by differentiation and triiodothyronine. J Biol Chem 266:18550–18554[Abstract/Free Full Text]
  46. Distel RJ, Robinson GS, Spiegelman BM 1992 Fatty acid regulation of gene expression. Transcriptional and post-transcriptional mechanisms. J Biol Chem 267:5937–5941[Abstract/Free Full Text]
  47. Kopczynski CC, Alton AK, Fechtel K, Kooh PJ, Muskavitch MA 1988 Delta, a Drosophila neurogenic gene, is transcriptionally complex and encodes a protein related to blood coagulation factors and epidermal growth factor of vertebrates. Genes Dev 2:1723–1735[Abstract/Free Full Text]
  48. Wharton KA, Johansen KM, Xu T, Artavanis-Tsakonas S 1985 Nucleotide sequence from the neurogenic locus notch implies a gene product that shares homology with proteins containing EGF-like repeats. Cell 43:567–581[CrossRef][Medline]
  49. Smas CM, Sul HS 1993 Pref-1, a protein containing EGF-like repeats, inhibits adipocyte differentiation. Cell 73:725–734[CrossRef][Medline]
  50. Larsen JB, Jensen CH, Schrøder HD, Teisner B, Bjerre B, Hagen C 1996 Fetal antigen-1 and growth hormone in pituitary somatotroph cells. Lancet 347:191[CrossRef]
  51. Boney CM, Fiedorek FT, Paul SR, Gruppuso PA 1996 Regulation of preadipocyte factor-1 gene expression during 3T3–L1 cell differentiation. Endocrinology 137:2923–2928[Abstract]
  52. Xing H, Northrop JP, Grove JR, Kilpatrick KE, Su J, Ringold GM 1997 TNF{alpha}-mediated inhibition and reversal of adipocyte differentiation is accompanied by suppressed expression of PPAR{gamma} without effects on Pref-1 expression. Endocrinology 138:2776–2783[Abstract/Free Full Text]
  53. Wool IG, Chan YL, Gluck A, Suzuki K 1991 The primary structure of rat ribosomal proteins P0, P1, and P2 and a proposal for a uniform nomenclature for mammalian and yeast ribosomal proteins. Biochimie 73:861–870[Medline]
  54. Amy CM, Witkowski A, Naggert J, Williams B, Randhawa Z, Smith S 1989 Molecular cloning and sequencing of cDNAs encoding the entire rat fatty acid synthase. Proc Natl Acad Sci USA 86:3114–3118[Abstract/Free Full Text]
  55. Hunt CR, Ro HS, Dobson DE, Min HY, Spiegelman BM 1986 adipocyte P2 gene: developmental expression and homology of 5'-flanking sequences among fat cell-specific genes. Proc Natl Acad Sci USA 83:3786–3790[Abstract/Free Full Text]
  56. Jensen J, Serup P, Karlsen C, Nielsen TF, Madsen OD 1996 mRNA profiling of rat islet tumors reveals nkx 6.1 as a beta-cell-specific homeodomain transcription factor. J Biol Chem 271:18749–18758[Abstract/Free Full Text]
  57. Jensen CH, Krogh TN, Højrup P, Clausen PP, Skjødt K, Larsson LI, Enghild JJ, Teisner B 1994 Protein structure of fetal antigen 1 (FA-1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene product of dlk and pG2. Eur J Biochem 225:83–92[Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
E. F. Gevers, M. J. Hannah, M. J. Waters, and I. C. A. F. Robinson
Regulation of Rapid Signal Transducer and Activator of Transcription-5 Phosphorylation in the Resting Cells of the Growth Plate and in the Liver by Growth Hormone and Feeding
Endocrinology, August 1, 2009; 150(8): 3627 - 3636.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
F. M. J. Jacobs, A. J. A. van der Linden, Y. Wang, L. von Oerthel, H. S. Sul, J. P. H. Burbach, and M. P. Smidt
Identification of Dlk1, Ptpru and Klhl1 as novel Nurr1 target genes in meso-diencephalic dopamine neurons
Development, July 15, 2009; 136(14): 2363 - 2373.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. Orr, O. C. Grace, G. Vanpoucke, G. R. Ashley, and A. A. Thomson
A Role for Notch Signaling in Stromal Survival and Differentiation during Prostate Development
Endocrinology, January 1, 2009; 150(1): 463 - 472.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
X. Zhou, D. Li, J. Yin, J. Ni, B. Dong, J. Zhang, and M. Du
CLA differently regulates adipogenesis in stromal vascular cells from porcine subcutaneous adipose and skeletal muscle
J. Lipid Res., August 1, 2007; 48(8): 1701 - 1709.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. M. Abdallah, M. Ding, C. H. Jensen, N. Ditzel, A. Flyvbjerg, T. G. Jensen, F. Dagnaes-Hansen, J. A. Gasser, and M. Kassem
Dlk1/FA1 Is a Novel Endocrine Regulator of Bone and Fat Mass and Its Serum Level Is Modulated by Growth Hormone
Endocrinology, July 1, 2007; 148(7): 3111 - 3121.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. S. Davies, E. F. Gevers, A. E. Stevenson, K. T. Coschigano, M. M. El-Kasti, M. J. Bull, C. Elford, B. A. J. Evans, J. J. Kopchick, and T. Wells
Adiposity profile in the dwarf rat: an unusually lean model of profound growth hormone deficiency
Am J Physiol Endocrinol Metab, May 1, 2007; 292(5): E1483 - E1494.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
M. Kawai, N. Namba, S. Mushiake, Y. Etani, R. Nishimura, M. Makishima, and K. Ozono
Growth hormone stimulates adipogenesis of 3T3-L1 cells through activation of the Stat5A/5B-PPAR{gamma} pathway
J. Mol. Endocrinol., January 1, 2007; 38(1): 19 - 34.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Wang and H. S. Sul
Ectodomain Shedding of Preadipocyte Factor 1 (Pref-1) by Tumor Necrosis Factor Alpha Converting Enzyme (TACE) and Inhibition of Adipocyte Differentiation.
Mol. Cell. Biol., July 1, 2006; 26(14): 5421 - 5435.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Q. Xu, B. S. Emerald, E. L. K. Goh, N. Kannan, L. D. Miller, P. D. Gluckman, E. T. Liu, and P. E. Lobie
Gene Expression Profiling to Identify Oncogenic Determinants of Autocrine Human Growth Hormone in Human Mammary Carcinoma
J. Biol. Chem., June 24, 2005; 280(25): 23987 - 24003.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
J. Novakofski
Adipogenesis: Usefulness of in vitro and in vivo experimental models
J Anim Sci, March 1, 2004; 82(3): 905 - 915.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. M. Thompson, D. A. S. Gill, R. Davies, N. Loveridge, P. A. Houston, I. C. A. F. Robinson, and T. Wells
Ghrelin and Des-Octanoyl Ghrelin Promote Adipogenesis Directly in Vivo by a Mechanism Independent of the Type 1a Growth Hormone Secretagogue Receptor
Endocrinology, January 1, 2004; 145(1): 234 - 242.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. A. Shang and M. J. Waters
Constitutively Active Signal Transducer and Activator of Transcription 5 Can Replace the Requirement for Growth Hormone in Adipogenesis of 3T3-F442A Preadipocytes
Mol. Endocrinol., December 1, 2003; 17(12): 2494 - 2508.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. M. Shipley and D. J. Waxman
Down-Regulation of STAT5b Transcriptional Activity by Ligand-Activated Peroxisome Proliferator-Activated Receptor (PPAR) {alpha} and PPAR{gamma}
Mol. Pharmacol., August 1, 2003; 64(2): 355 - 364.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Iwaki, M. Matsuda, N. Maeda, T. Funahashi, Y. Matsuzawa, M. Makishima, and I. Shimomura
Induction of Adiponectin, a Fat-Derived Antidiabetic and Antiatherogenic Factor, by Nuclear Receptors
Diabetes, July 1, 2003; 52(7): 1655 - 1663.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Zhang, J. Nohr, C. H. Jensen, R. K. Petersen, E. Bachmann, B. Teisner, L. K. Larsen, S. Mandrup, and K. Kristiansen
Insulin-like Growth Factor-1/Insulin Bypasses Pref-1/FA1-mediated Inhibition of Adipocyte Differentiation
J. Biol. Chem., May 30, 2003; 278(23): 20906 - 20914.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Y. Appiagyei-Dankah, C. D. Tapiador, J. F. Evans, M. Castro-Magana, J. F. Aloia, and J. K. Yeh
Influence of growth hormone on bone marrow adipogenesis in hypophysectomized rats
Am J Physiol Endocrinol Metab, March 1, 2003; 284(3): E566 - E573.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
F. Frick, D. Linden, C. Ameen, S. Eden, A. Mode, and J. Oscarsson
Interaction between growth hormone and insulin in the regulation of lipoprotein metabolism in the rat
Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E1023 - E1031.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. F. Gevers, N. Loveridge, and I. C. A. F. Robinson
Bone Marrow Adipocytes: A Neglected Target Tissue for Growth Hormone
Endocrinology, October 1, 2002; 143(10): 4065 - 4073.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. S. Moon, C. M. Smas, K. Lee, J. A. Villena, K.-H. Kim, E. J. Yun, and H. S. Sul
Mice Lacking Paternally Expressed Pref-1/Dlk1 Display Growth Retardation and Accelerated Adiposity
Mol. Cell. Biol., August 1, 2002; 22(15): 5585 - 5592.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Graichen, D. Liu, Y. Sun, K.-O. Lee, and P. E. Lobie
Autocrine Human Growth Hormone Inhibits Placental Transforming Growth Factor-beta Gene Transcription to Prevent Apoptosis and Allow Cell Cycle Progression of Human Mammary Carcinoma Cells
J. Biol. Chem., July 12, 2002; 277(29): 26662 - 26672.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Andersen, C. H. Jensen, R. K. Stoving, J. B. Larsen, H. D. Schroder, B. Teisner, and C. Hagen
Fetal Antigen 1 in Healthy Adults and Patients with Pituitary Disease: Relation to Physiological, Pathological, and Pharmacological GH Levels
J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5465 - 5470.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. E. Karlsen, S. G. Ronn, K. Lindberg, J. Johannesen, E. D. Galsgaard, F. Pociot, J. H. Nielsen, T. Mandrup-Poulsen, J. Nerup, and N. Billestrup
Suppressor of cytokine signaling 3 (SOCS-3) protects beta -cells against interleukin-1beta - and interferon-gamma -mediated toxicity
PNAS, September 26, 2001; (2001) 211445998.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
D. Le Roith, C. Bondy, S. Yakar, J.-L. Liu, and A. Butler
The Somatomedin Hypothesis: 2001
Endocr. Rev., February 1, 2001; 22(1): 53 - 74.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
R. Nanbu-Wakao, Y. Fujitani, Y. Masuho, M.-a. Muramatu, and H. Wakao
Prolactin Enhances CCAAT Enhancer-Binding Protein-{beta} (C/EBP{beta}) and Peroxisome Proliferator-Activated Receptor {gamma} (PPAR{gamma}) Messenger RNA Expression and Stimulates Adipogenic Conversion of NIH-3T3 Cells
Mol. Endocrinol., February 1, 2000; 14(2): 307 - 316.
[Abstract] [Full Text]


Home page
Mol Hum ReprodHome page
C.H. Jensen, K. Erb, L.G. Westergaard, A. Kliem, and B. Teisner
Fetal antigen 1, an EGF multidomain protein in the sex hormone-producing cells of the gonads and the microenvironment of germ cells
Mol. Hum. Reprod., October 1, 1999; 5(10): 908 - 913.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. M. Smas, L. Chen, L. Zhao, M.-J. Latasa, and H. S. Sul
Transcriptional Repression of pref-1 by Glucocorticoids Promotes 3T3-L1 Adipocyte Differentiation
J. Biol. Chem., April 30, 1999; 274(18): 12632 - 12641.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. E. Karlsen, S. G. Ronn, K. Lindberg, J. Johannesen, E. D. Galsgaard, F. Pociot, J. H. Nielsen, T. Mandrup-Poulsen, J. Nerup, and N. Billestrup
Suppressor of cytokine signaling 3 (SOCS-3) protects beta -cells against interleukin-1beta - and interferon-gamma -mediated toxicity
PNAS, October 9, 2001; 98(21): 12191 - 12196.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hansen, L. H.
Right arrow Articles by Billestrup, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hansen, L. H.
Right arrow Articles by Billestrup, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals