| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Hagedorn Research Institute (L.H.H., B.M., J.H.N., N.B.)
DK-2820 Gentofte, Denmark
Department of Microbiology
(B.T.) Odense University DK-5000 Odense C, Denmark
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
(PPAR) was induced in
preadipocytes during differentiation. In the presence of GH, which
markedly inhibited triglyceride accumulation, no reduction in the
expression level of ADD1 was observed in response to GH, whereas there
was a 50% reduction in the expression of PPAR. The DNA binding
activity of the PPAR/retinoid X receptor-
(RXR) to the ARE7
element from the aP2 gene was also reduced by approximately 50% in
response to GH. GH inhibited the expression of late markers of
adipocyte differentiation, fatty acid synthase, aP2, and
hormone-sensitive lipase by 70–80%. The antiadipogenic effect
of GH was not affected by the mitogen-activated protein (MAP)
kinase/extracellular-regulated protein (ERK) kinase inhibitor
PD 98059, indicating that the mitogen-activated protein kinase pathway
was not involved in GH inhibition of preadipocyte differentiation. The
expression of preadipocyte factor-1/fetal antigen 1 was decreased
during differentiation, and GH treatment prevented this down-regulation
of Pref-1/FA1. A possible role for Pref-1/FA1 in mediating the
antiadipogenic effect of GH was indicated by the observation that FA1
inhibited differentiation as effectively as GH. These data suggest that
GH exerts its inhibitory activity in adipocyte differentiation at a
step after the induction of ADD1 but before the induction of genes
required for terminal differentiation. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The use of various preadipocyte cell lines has been instrumental in
delineating the process of adipocyte differentiation at the molecular
level. Adipocyte determination and differentiation factor 1 (ADD1),
peroxisome proliferator-activated receptor (PPAR),
CCAAT/enhancer binding protein (C/EBP) ,ß,
, adipocyte P2
(aP2), and fatty acid synthase (FAS) have all been found to be
involved in adipocyte differentiation at different stages. ADD1 is a
basic helix-loop-helix protein induced very early during adipogenesis
(10). Transfection studies have shown that forced expression of ADD1 in
fibroblasts will induce differentiation. ADD1 has furthermore been
shown to activate FAS and lipoprotein lipase (LPL) gene expression (11, 12). PPAR is a member of the nuclear receptor superfamily and
exists in two isoforms PPAR1 and PPAR2, which are generated by
alternative splicing (13). PPAR2 is highly expressed in adipose
tissue only whereas low levels of PPAR1 can be found in other
tissues as well (14, 15). PPAR2 is induced very early in adipocyte
differentiation and is able to trigger the differentiation of
fibroblasts into adipocytes (13, 16, 17, 18). Furthermore, PPAR was
found to interact with retinoid X receptor- (RXR) forming the
transcription factor complex ARF6 (16, 19). This PPAR/RXR
heterodimer is able to bind directly to two elements: the ARE6 and ARE7
(13), which are found in the promoters of different adipocyte genes
such as aP2 and phosphoenolpyruvate carboxykinase (19, 20).
On the basis of extensive studies using preadipocyte cell lines such as the 3T3-F442A (21, 22), 3T3-L1 (23), Ob1771, and Ob17UT (24), it has been found that GH promotes their differentiation. In contrast, in primary preadipocytes of murine or human origin, GH exhibits a potent inhibitory activity on preadipocytes induced to differentiate with insulin and T3. Using serum-free chemically defined medium (25, 26), a characterization of the role of GH in the differentiation of primary preadipocytes could be obtained (27, 28, 29), demonstrating that GH markedly prevents triglyceride accumulation in primary rat and human preadipocytes (30).
Other growth factors and cytokines such as platelet-derived growth
factor (PDGF), epidermal growth factor (EGF), fibroblast growth factor
(FGF), tumor necrosis factor-, transforming growth factor-ß, and
interferon- have been shown to inhibit adipocyte differentiation
(31, 32, 33). It was recently demonstrated that PDGF, FGF, and EGF inhibit
adipocyte differentiation through a mitogen-activated protein (MAP)
kinase-dependent pathway (34). Serine phosphorylation of PPAR at
position 112 was observed in response to PDGF, EGF, and FGF, and this
phosphorylation has been found to reduce the transcriptional activity
of the PPAR/RXR complex (34). When this serine residue was
mutated to alanine, no growth factor inhibition of PPAR/RXR-mediated
transcription could be observed.
The differentiation of 3T3-L1 preadipocytes was recently found to be associated with a decrease in the expression of Pref-1, a transmembrane protein with homology to the Drosophila protein delta, which is involved in embryonic cell fate determination. In vivo Pref-1 is processed into a soluble glycoprotein FA1 (35, 36) comprising the extracellular domain of Pref-1. The function of FA1 is not known, but it has recently been shown that a recombinant GST-FA1 fusion protein is able to inhibit the differentiation of 3T3-L1 preadipocytes (37).
Since the mechanism by which GH inhibits the differentiation of primary preadipocytes is not known, the aim of the present study was to determine at which point in the differentiation program GH arrests the differentiating preadipocytes. We have also analyzed the possible mechanism of action of GH in this process.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
). When GH (20
nM) was included in the differentiation medium, a marked
reduction in the number of Oil Red O positive cells was observed (Fig. 1D). A time-dependent increase in triglyceride was observed in cells
cultured in the presence of insulin and T3. This increase
was inhibited by the presence of GH in the differentiation medium after
5 (P 
0.02] and 7 (P 0.05) days
of culture (Fig. 1E).
|
, were induced rapidly during the differentiation process (Fig. 2, A and B). The expression of these
genes before the addition of differentiation medium was low, and
increased 10- to 20-fold after 5–7 days of culture in medium with
insulin and T3. When cells were cultured in the control
serum-free medium, the expression of both PPAR and ADD1 remained at
the level observed at day 0 (data not shown). The expression of both
ADD1 and PPAR was also increased in cells cultured in the presence
of differentiation medium and GH (Fig. 2, A and B). The difference in
induction of ADD1 in differentiation medium with or without GH was not
statistically different (Fig. 2G), indicating that GH inhibits
preadipocyte differentiation at a step distal to the expression of
ADD1. In contrast, a significant 50% reduction in the level of PPAR
expression in response to GH was detected (Fig. 2G). The expression of
late markers of preadipocyte differentiation, FAS, aP2, and
hormone-sensitive lipase (HSL), was also increased during
differentiation. The expression level of these genes in the basal state
(day 0) was very low but increased 35- to 90-fold during
differentiation (Fig. 2, C–E). In the presence of GH, the expression
levels of both FAS, aP2, and HSL were significantly reduced (70–90%)
compared with control differentiating cells (Fig. 2G). Pref-1
expression was high in undifferentiated preadipocytes and decreased to
undetectable levels after 8 days of differentiation (Fig. 2F). In the
presence of GH, however, the expression level of Pref-1 was comparable
to that observed in control preadipocytes (Fig. 2H).
|
RNA by GH, we analyzed whether the reduced RNA expression
resulted in a change in PPAR DNA-binding activity. Nuclear extracts
were isolated from primary rat preadipocytes that had been cultured in
the presence of basal serum-free medium, differentiation medium, or
differentiation medium plus GH. The nuclear extracts were incubated
with radiolabeled ARE7 probe from the aP2 gene. A weak band
corresponding to the PPAR/RXR complex was observed using nuclear
extracts from cells cultured in basal medium (Fig. 3, lane 1), which is in accordance with
the low level of PPAR expression in undifferentiated preadipocytes.
An increased binding activity of PPAR/RXR was observed in cells
cultured in differentiation medium with or without hGH (Fig. 3, lanes 2
and 3). The intensity of the band observed in extracts from GH-treated
cells was reduced approximately 50% compared with that in
differentiating cells. The band was specific, as it could be inhibited
with unlabeled ARE7 (Fig. 3, lane 4), but not with a nonspecific
oligonucleotide CG-cAMP-response element (Fig. 3, lane 5).
Furthermore, the appearance of the PPAR/RXR complex was abolished
when an antibody against RXR was present during incubation (Fig. 3, lane 7), whereas preimmune serum did not affect the electrophoretic
mobility of this complex (Fig. 3, lane 6).
|
). As a control the phorbol ester PDBu
was included in the differentiation medium and was found to inhibit
lipid accumulation as expected. However, in the presence of the
PD98059, PDBu no longer inhibited differentiation. The ability of GH to
activate MAP kinases in preadipocyte cultures was measured by analyzing
the phosphorylation of MAP kinases ERK-1 and 2 in response to GH. Cells
grown in control serum-free medium for 5 days in the absence or
presence of GH did not contain any detectable amount of phosphorylated
ERK1 and 2 (Fig. 5, lanes 1 and 2).
Similarly, no phosphorylated ERK-1 and 2 could be detected in cells
grown in differentiation medium with or without GH for 5 days (Fig. 5, lanes 3 and 8). In contrast, in differentiating cells stimulated for a
short time (10 and 30 min) with GH, phosphorylated MAP kinase could be
detected. This activation was transient as no MAP kinase activation was
seen after 60 min of GH stimulation (Fig. 5 lane 7). These data suggest
that the MAP kinase pathway is not important for GH inhibition of
differentiation and furthermore indicate that GH and EGF utilize
different signaling pathways in inhibiting adipocyte
differentiation.
|
|
) with maximal inhibition observed at 5
µg/ml of FA1. The extent of inhibition at the highest dose was
comparable to that observed using GH. This observation suggests that
the GH-induced expression of Pref-1/FA1 might be involved in the
inhibition of preadipocyte differentiation by GH.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
This effect of GH on primary cells is similar to that of other growth factors (31, 32, 33) but is in contrast to the previously described effects of GH on various preadipocyte cell lines (7, 21, 22, 24, 27). In 3T3-F442A cells, GH was identified as an important factor required for adipose conversion, and GH was able to partially substitute for serum in promoting differentiation. Although the mechanism underlying this difference in response to GH between primary preadipocyte and cell lines is not known, it could be speculated that since differentiation of primary cells occurs in the absence of serum, whereas in 3T3-F442A cells serum is required for differentiation, it may be that this difference in culture conditions affects their response to GH. Furthermore, in contrast to primary cells, the cell lines are immortalized and have unlimited growth potential; therefore, they might respond differently to factors such as GH since growth arrest is generally required for the initiation of differentiation. It is also possible that the primary preadipocyte cell cultures contain other cell types that somehow affect their ability to differentiate and respond to GH. However, in vivo observations confirm an inhibitory effect of GH on adipogenesis. In humans as well as rodents, GH deficiency is often associated with obesity (6), and GH treatment is able to decrease fat cell mass (40). In accordance with this observation, GH overproduction in acromegalics or GH transgenic mice is associated with a decreased adiposity and an increase in lean body mass. An inhibitory effect of GH on human mammary preadipocyte differentiation has also been reported (30). However, under certain conditions, GH can exert insulin-like lipogenic effects on adipose cells as occurs in isolated adipocytes from hypophysectomized animals or in adipocytes deprived of GH in vitro (5).
In preadipocyte cell lines such as 3T3-L1, 3T3-F442A, and Ob17, it has
been demonstrated that the adipocyte-specific genes ADD1, PPAR, FAS,
aP2, and HSL are up-regulated during differentiation in a
time-dependent manner (10, 11, 13, 41, 42, 43, 44, 45, 46). The induction of the basic
helix-loop-helix factor ADD1 is observed early during differentiation
followed by the expression of PPAR and subsequently aP2, FAS, and
HSL. We also found that these genes were up-regulated in
differentiating primary rat preadipocytes, although we could not
confirm the time dependence. This is most likely due to the fact that
the primary cells used in this study are heterogeneous in terms of
their differentiation stage, whereas preadipocyte cell lines are
representative of a more specific developmental stage. When the primary
rat preadipocytes were cultured in differentiation medium supplemented
with GH, we were not able to detect any changes in the expression level
of ADD1 compared with differentiating control cells. In contrast, a
modest reduction in the level of PPAR was observed. This observation
suggests that GH inhibits the differentiation process at a step
downstream of ADD1 expression. The ability of the PPAR/RXR
heterodimer to bind the ARE7 DNA element from the aP2 gene was only
reduced slightly by GH. The expression of FAS, aP2, and HSL, however,
was reduced dramatically by GH. The fact that PPAR mRNA levels as
well as DNA-binding activity were only reduced modestly compared with
the decrease in aP2, FAS, and HSL expression suggest that GH inhibits
PPAR- induced transcription at a step distal to the binding of
PPAR/RXR to DNA or, alternatively, that GH regulates multiple
pathways that converge on PPAR-regulated transcription.
It has recently been shown that the growth factors PDGF and EGF inhibit
the differentiation of preadipocyte cell lines through a MAP
kinase-dependent mechanism (34). Growth factor-stimulated MAP kinase
has been found to phosphorylate PPAR on serine 112; however, this
phosphorylation does not affect the DNA-binding activity of
PPAR/RXR, but significantly inhibits its transactivating activity
(34). In accordance with this model the inhibitory action of EGF could
be reversed by the MEK inhibitor PD98059. In contrast, we did not
detect any effect of PD98059 on the GH-mediated inhibition of primary
preadipocyte differentiation. We could, however, inhibit the
differentiation of primary rat preadipocytes by the addition of the
phorbol ester PDBu, a known MAP kinase activator, and this inhibition
was reversed by PD 98059 (Fig. 4
). In cells cultured long term with GH
we could not detect any activation of MAP kinase. In short-term
stimulation experiments, however, MAP kinase was activated transiently
by GH. Similar transient stimulation of MAP kinase by GH has been
reported to occur in several other cell types (38). The fact that GH
exerts its inhibitory activity on adipocyte differentiation for several
days suggests that the transient induction of MAP kinase activity is
most likely not involved in the inhibitory action of GH. These
observations indicate that GH inhibits differentiation by a mechanism
that is distinct from that used by EGF and other growth factors.
Pref-1/FA1 is a member of the family of proteins having multiple
EGF-like domains and shows homology to the Delta (47) and Notch (48)
gene family. These factors exist in both a membrane-bound or soluble
form. This family of proteins is involved in cell differentiation and
pattern formation. Pref-1 is expressed in four different cell types in
the adult mammalian organism with the highest level of expression in
the adrenal glands (49). Pref-1/FA1 is highly expressed in the
pituitary somatotrophs (50) and in the ß-cells of the pancreas (39).
GH has also been shown to up-regulate Pref-1 in islets of Langerhans
from neonatal rats (39). Finally, expression of Pref-1 has been
observed in preadipocytes (49). In 3T3-L1 preadipocytes, expression of
Pref-1 is high and decreases to nondetectable levels after
differentiation. Forced expression of Pref-1 in 3T3-L1 cells by stable
transfection renders these cells resistant to differentiation,
indicating that down-regulation of Pref-1 during differentiation is
required for differentiation to occur (49). The decrease in Pref-1/FA1
expression is probably an early event in the differentiation process,
as inhibition of differentiation by growth factors such as IL-11, tumor
necrosis factor-, FGF, and transforming growth factor-ß inhibit
the expression of PPAR and adipsin but do not increase the
expression of Pref-1 (51, 52). The ability of GH to maintain high
levels of Pref-1 expression in primary preadipocytes cultured in the
presence of insulin and T3, as shown in this study,
suggests that one possible mechanism by which GH inhibits
differentiation is by inducing the expression of Pref-1. The mechanism
by which Pref-1 exerts its inhibitory actions are not known.
Interestingly, we were able to inhibit preadipocyte differentiation by
adding FA1 to the cultured preadipocytes. FA1 is a naturally occurring
variant of Pref-1 that corresponds to the extracellular domain of
Pref-1 and is believed to be generated by proteolytic cleavage of
Pref-1. The concentration of FA1 is approximately 25 µg/ml and 20
ng/ml in amniotic fluid and plasma, respectively (36). The fact that
FA1 can inhibit preadipocyte differentiation indicates that Pref-1 does
not require its transmembrane or intracellular domains for activity.
However whether Pref-1 acts as a soluble factor or in a
membrane-associated form in vivo to regulate adipocyte
differentiation is not known. Interestingly, we were not able to detect
any FA-1 in the medium of preadipocytes cultured in the presence of GH
while FA-1 could be measured in the medium of cultured islets of
Langerhans (B. Madsen, unpublished observation).
In conclusion, we have shown that GH inhibits the differentiation of
primary rat preadipocytes at a step after the induction of ADD1, but
before the induction of aP2 and FAS. The mechanism by which GH inhibits
the differentiation is not dependent upon MAP kinase-activated serine
phosphorylation of PPAR as has been demonstrated to be the case with
other growth factors. It is suggested that the antiadipogenic effect of
GH is mediated by Pref-1/FA1, which is maintained at a high level of
expression by GH in preadipocytes.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Oil Red O Staining
Oil Red O (Sigma) was dissolved in methanol/acetone. The cells
were rinsed twice in PBS and fixed in 4% glutaraldehyde for 10 min.
After fixation, the cells were washed twice in PBS and incubated with
Oil Red O solution for 10 min. The cells were finally washed twice in
PBS.
Determination of Triglyceride Content
Cells were washed once in PBS and scraped off the dish in 250
µl 50 mM Tris/HCl, pH 7.4, 1 mM EDTA. The
samples were homogenized by sonication, and the triglyceride
concentration was determined using the GPO-Trinder kit from Sigma.
Statistical significance was evaluated using the paired sample
t-test.
Determination of Protein Content
The Bio-Rad protein assay (Bio-Rad Laboratories, Richmond, CA)
was used to determine the protein content of sonicated cell
extracts.
RNA Isolation
Total RNA was isolated by lysing the cells in RNAzol (Cinna
Biotecx, Austin, TX) and purified according to the
manufacturer’s instructions. The RNA was resuspended in diethyl
pyrocarbonate-treated water, and concentration and purity were
determined by measuring A260/A280.
cDNA Synthesis
One microgram of total RNA was mixed with 3 µg of random
hexamer primers (Life Technologies, Inc., Gaithersburg, MD) and heated
for 5 min at 85 C and quickly chilled on ice. The cDNA synthesis was
carried out for 1 h at 37 C in 50 mM Tris/HCl, pH 8.3,
75 mM KCl, 3 mM MgCl2, 10
mM dithiothreitol, 200 U of Moloney murine leukemia virus
reverse transcriptase (Life Technologies, Inc.), 40 U of RNAsin
(Promega, Madison, WI), and 0.9 mM deoxynucleoside
triphosphate (Pharmacia Biotech Inc., Uppsala, Sweden).
After cDNA synthesis the reaction was diluted with 50 µl
H2O, and stored at -20 C until use.
Primers
As an internal control the expression of the rat acidic
ribosomal phosphoprotein P0 (36B4) was measured using the following
primers (53): 5'-oligo: GTACCTGCTCAGAACACCCGG and 3'-oligo:
CCTCTGGGCTGTAGATGCTG, resulting in a 240-bp PCR product. Rat ADD1 (10)
primers: 5'-oligo: CTGCACCCTTGTCCCCTCCA and 3'-oligo:
GGCAGGCTAGATGGCGTCTG, resulting in a 279-bp PCR product. Mouse PPAR
(13) primers: 5'-oligo: GCTGATGCACTGCCTATGAGC and 3'-oligo:
CGCACTTTGGTATTCTTGGAGC, resulting in a 263-bp PCR product. Rat FAS (54)
primers: 5'-oligo: CCCTGAAATCCCAGCACTTC and 3'-oligo:
GGCATGGCTGCTGTAGGGGT, resulting in a 308-bp PCR product. Mouse aP2 (55)
5'-oligo: CCTTTGTGGGAACCTGGAAG and 3'-oligo: TCTTCCTTTGGCTCATGCCC,
resulting in a 380-bp PCR product. Rat Pref-1 primers: 5'-oligo:
TCTGTGAGGCTGACAATGTCTGC and 3'-oligo CCTTGTGCTGGCAGTCCTTTCC, resulting
in a 275-bp PCR product. Rat hormone-sensitive lipase (HSL) primers:
5'-oligo: ACCTGGACACTGAGACACCAGC and 3'-oligo: TCCTGGTCGGTTGATGGTCAGC,
resulting in a 229-bp PCR product. The primer sets were tested on cDNA
from adipose tissue or preadipocytes from the day of isolation to
determine the number of cycles within the linear phase. The number of
PCR cycles within the linear range for each set of primers was
determined as described previously (56). Briefly, cDNA from either
freshly isolated preadipocytes or adipocytes was used. PCR was allowed
to proceed for 16–24 cycles and individual PCR products were analyzed
by PhosphorImage analysis and quantified using the Imagequant program
(Molecular Dynamics, Sunnyvale, CA). The logarithm to the PCR fragment
volume was plotted against cycle number, and linear regression analysis
was used to determine the linear range. The following cycle numbers
were used: 36B4: 18–22 cycles; ADD1: 22 cycles; PPAR: 22 cycles;
FAS: 20 cycles; aP2: 18 cycles; Pref-1: 20–22 cycles; and HSL: 22
cycles.
Multiplex RT-PCR
The PCRs were performed as previously described (56). Briefly,
1.5 µl cDNA and 23.5 µl of PCR mix [50 mM KCl, 10
mM Tris/HCl, pH 9.0, 0.1% Triton X-100, 1.5 mM
MgCl2, 40 mM dATP, dTTP, and dGTPs, 20
mM dCTP, 2.5 U of Taq polymerase (Promega), and
2.5 µCi of 3000 Ci/mmol [-33P]-dCTP (Amersham,
Aylesbury, U.K.)], and 25 µl mineral oil (Sigma) were added
to each tube. The standard thermal cycle profile was used. A single
denaturing step at 95 C for 90 sec was followed by the chosen numbers
of cycles as stated above: 94 C for 30 sec, 55 C for 60 sec, and 72 C
for 60 sec. The reaction products were separated on a 6%
polyacrylamide gel (BRL Life Technologies), which was dried and exposed
to PhosphorImager Storage Screens overnight. The screens were analyzed
using the Molecular Dynamics PhosphorImager series 400, and the band
intensities were calculated using the ImageQuant software by the use of
rectangle mode/local background/volume integration. All quantitations
were normalized to the internal standard 36B4.
Nuclear Extracts
The cells were grown as previously described in 150-mm dishes.
The cells were washed twice in ice-cold PBS on ice and lysed in a
hypotonic buffer [20 mM HEPES, 1 mM EDTA, 1
mM MgCl2, 10 mM KCl, 20% glycerol,
0.5% Triton X-100, 1 mM dithiothreitol, 0.5 mM
4-(2-aminoethyl)-benzenesulfonyl fluoride, 1 mM
Na3VO4, 1 µg/ml leupeptin, 1 µg/ml
aprotinin]. After a 15-min incubation on ice the cells were
centrifuged at 2500 x g for 7 min at 4 C. The pellet
was resuspended in a hypertonic buffer (the hypotonic buffer
supplemented with 400 mM NaCl), and incubated on a rocking
platform for 30 min. The supernatant was collected after centrifugation
at 20,000 x g for 30 min at 4 C.
Electrophoretic Mobility Shift Assay (EMSA)
The EMSA was carried out as previously described (2). Five
micrograms of nuclear extract were incubated for 30 min at 30 C in 20
mM HEPES, 10 mM NaCl, 1 mM
MgCl2, 1 mM EDTA, 10% glycerol, 2.5
mM Na3VO4, 5 mM
dithiothreitol, 2 µg poly- deoxyinosinic-deoxycytidylic
acid·polydeoxyinosinic-deoxycytidylic acid and 20 fmol of
32P-labeled oligonucleotide probe. After addition of 5
x loading buffer, the samples were examined on a 5% native
polyacrylamide gel and exposed to x-ray film. For the supershift
reaction, the samples were preincubated with RXR antibody for 1
h at 4 C. For competition studies the unlabeled oligo was added at
100-fold excess molar concentration at the same time as the
radiolabeled probe. The ARE7 probe used was the
gatcTGTGAACTCTGATCCAGTAAG (13), and the nonspecific competitor was the
-CG promoter probe containing a cAMP response element (CG-CRE)
agctTTTTACCATGAC-GTCAATTTGATC. The ARE7 probe was labeled using T4 PNK
kinase (Promega). Each strand was labeled separately and annealed after
labeling. The annealed probe was purified on a NAP-5 column
(Pharmacia). The RXR antibody was RXR (
N 197) from Santa
Cruz Biothecnology, Inc. (Santa Cruz, CA).
MAP Kinase Assay
The cells were cultured in either 1) basal medium, 2) basal
medium + 20 nM hGH, 3) differentiation medium, or 4)
differentiation medium + 20 nM hGH for 6 days in six-well
plates. The cells that were differentiated for 6 days in
differentiation medium were further stimulated with 20 nM
hGH for 0, 5, 10, 30, or 60 min before harvest. The rest of the cells
were harvested without further stimulation. MAP kinase activation was
investigated using the Phosphoplus MAPK antibody Kit (New England
Biolabs), and the cells were harvested and assayed according to the
manufacturer’s instructions.
Purification of Fetal Antigen 1 (FA1)
Human FA1 was purified from second-trimester amniotic fluid by
immunospecific chromatography as described previously (36, 57). After
dialysis (50 mM Tris/HCl, pH 7.3) the FA-1 containing
fractions were pooled and concentrated using a Resource S matrix
(Pharmacia Biotech) that was eluted with 50 mM Tris/HCl, pH
7.3, containing 1 M NaCl.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
L.H.H. was supported by the Danish Research Academy. B.T. was supported by the Danish Medical Research Council, Direktør, Civilingeniør Aage Louis-Hansens Memorial Foundation, and P.A. Messerschmidt og Hustrus Fond.
Received for publication October 15, 1997. Revision received May 1, 1998. Accepted for publication May 4, 1998.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
2: tissue-specific regulator of an adipocyte enhancer. Genes
Dev 8:1224–1234 (mPPAR) gene: alternative promoter use and different
splicing yield two mPPAR isoforms. Proc Natl Acad Sci USA 92:7921–79251 and 2.
Biochem Biophys Res Commun 224:431–437[CrossRef][Medline]
:
adipose-predominant expression and induction early in adipocyte
differentiation. Endocrinology 135:798–800[Abstract]
2, a lipid-activated
transcription factor. Cell 79:1147–1156[CrossRef][Medline]
and RXR. Nucleic Acids Res 22:5628–56342 regulates adipose expression of the phosphoenolpyruvate
carboxykinase gene. Mol Cell Biol 15:351–357.
Science 274:2100–2105-like protein
in pancreatic islet: molecular cloning and expression pattern during
development and growth of the endocrine pancreas. Endocrinology 138:3940–3948 during the conversion of 3T3
fibroblasts into adipocytes is mediated by C/EBPß, C/EBP, and
glucocorticoids. Mol Cell Biol 16:4128–4136-mediated inhibition and reversal of adipocyte
differentiation is accompanied by suppressed expression of PPAR
without effects on Pref-1 expression. Endocrinology 138:2776–2783This article has been cited by other articles:
 |
|
 |
|
  H. Nakatani, N. Aoki, T. Okajima, D. Nadano, D. Flint, and T. Matsuda Establishment of a Mammary Stromal Fibroblastic Cell Line for In Vitro Studies in Mice of Mammary Adipocyte Differentiation Biol Reprod, January 1, 2010; 82(1): 44 - 53. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. F. Gevers, M. J. Hannah, M. J. Waters, and I. C. A. F. Robinson Regulation of Rapid Signal Transducer and Activator of Transcription-5 Phosphorylation in the Resting Cells of the Growth Plate and in the Liver by Growth Hormone and Feeding Endocrinology, August 1, 2009; 150(8): 3627 - 3636. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. M. J. Jacobs, A. J. A. van der Linden, Y. Wang, L. von Oerthel, H. S. Sul, J. P. H. Burbach, and M. P. Smidt Identification of Dlk1, Ptpru and Klhl1 as novel Nurr1 target genes in meso-diencephalic dopamine neurons Development, July 15, 2009; 136(14): 2363 - 2373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Orr, O. C. Grace, G. Vanpoucke, G. R. Ashley, and A. A. Thomson A Role for Notch Signaling in Stromal Survival and Differentiation during Prostate Development Endocrinology, January 1, 2009; 150(1): 463 - 472. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhou, D. Li, J. Yin, J. Ni, B. Dong, J. Zhang, and M. Du CLA differently regulates adipogenesis in stromal vascular cells from porcine subcutaneous adipose and skeletal muscle J. Lipid Res., August 1, 2007; 48(8): 1701 - 1709. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. M. Abdallah, M. Ding, C. H. Jensen, N. Ditzel, A. Flyvbjerg, T. G. Jensen, F. Dagnaes-Hansen, J. A. Gasser, and M. Kassem Dlk1/FA1 Is a Novel Endocrine Regulator of Bone and Fat Mass and Its Serum Level Is Modulated by Growth Hormone Endocrinology, July 1, 2007; 148(7): 3111 - 3121. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. S. Davies, E. F. Gevers, A. E. Stevenson, K. T. Coschigano, M. M. El-Kasti, M. J. Bull, C. Elford, B. A. J. Evans, J. J. Kopchick, and T. Wells Adiposity profile in the dwarf rat: an unusually lean model of profound growth hormone deficiency Am J Physiol Endocrinol Metab, May 1, 2007; 292(5): E1483 - E1494. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kawai, N. Namba, S. Mushiake, Y. Etani, R. Nishimura, M. Makishima, and K. Ozono Growth hormone stimulates adipogenesis of 3T3-L1 cells through activation of the Stat5A/5B-PPAR{gamma} pathway J. Mol. Endocrinol., January 1, 2007; 38(1): 19 - 34. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wang and H. S. Sul Ectodomain Shedding of Preadipocyte Factor 1 (Pref-1) by Tumor Necrosis Factor Alpha Converting Enzyme (TACE) and Inhibition of Adipocyte Differentiation Mol. Cell. Biol., July 15, 2006; 26(14): 5421 - 5435. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Q. Xu, B. S. Emerald, E. L. K. Goh, N. Kannan, L. D. Miller, P. D. Gluckman, E. T. Liu, and P. E. Lobie Gene Expression Profiling to Identify Oncogenic Determinants of Autocrine Human Growth Hormone in Human Mammary Carcinoma J. Biol. Chem., June 24, 2005; 280(25): 23987 - 24003. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Novakofski Adipogenesis: Usefulness of in vitro and in vivo experimental models J Anim Sci, March 1, 2004; 82(3): 905 - 915. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. M. Thompson, D. A. S. Gill, R. Davies, N. Loveridge, P. A. Houston, I. C. A. F. Robinson, and T. Wells Ghrelin and Des-Octanoyl Ghrelin Promote Adipogenesis Directly in Vivo by a Mechanism Independent of the Type 1a Growth Hormone Secretagogue Receptor Endocrinology, January 1, 2004; 145(1): 234 - 242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. A. Shang and M. J. Waters Constitutively Active Signal Transducer and Activator of Transcription 5 Can Replace the Requirement for Growth Hormone in Adipogenesis of 3T3-F442A Preadipocytes Mol. Endocrinol., December 1, 2003; 17(12): 2494 - 2508. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Shipley and D. J. Waxman Down-Regulation of STAT5b Transcriptional Activity by Ligand-Activated Peroxisome Proliferator-Activated Receptor (PPAR) {alpha} and PPAR{gamma} Mol. Pharmacol., August 1, 2003; 64(2): 355 - 364. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Iwaki, M. Matsuda, N. Maeda, T. Funahashi, Y. Matsuzawa, M. Makishima, and I. Shimomura Induction of Adiponectin, a Fat-Derived Antidiabetic and Antiatherogenic Factor, by Nuclear Receptors Diabetes, July 1, 2003; 52(7): 1655 - 1663. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Zhang, J. Nohr, C. H. Jensen, R. K. Petersen, E. Bachmann, B. Teisner, L. K. Larsen, S. Mandrup, and K. Kristiansen Insulin-like Growth Factor-1/Insulin Bypasses Pref-1/FA1-mediated Inhibition of Adipocyte Differentiation J. Biol. Chem., May 30, 2003; 278(23): 20906 - 20914. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Appiagyei-Dankah, C. D. Tapiador, J. F. Evans, M. Castro-Magana, J. F. Aloia, and J. K. Yeh Influence of growth hormone on bone marrow adipogenesis in hypophysectomized rats Am J Physiol Endocrinol Metab, March 1, 2003; 284(3): E566 - E573. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Frick, D. Linden, C. Ameen, S. Eden, A. Mode, and J. Oscarsson Interaction between growth hormone and insulin in the regulation of lipoprotein metabolism in the rat Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E1023 - E1031. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. F. Gevers, N. Loveridge, and I. C. A. F. Robinson Bone Marrow Adipocytes: A Neglected Target Tissue for Growth Hormone Endocrinology, October 1, 2002; 143(10): 4065 - 4073. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. S. Moon, C. M. Smas, K. Lee, J. A. Villena, K.-H. Kim, E. J. Yun, and H. S. Sul Mice Lacking Paternally Expressed Pref-1/Dlk1 Display Growth Retardation and Accelerated Adiposity Mol. Cell. Biol., August 1, 2002; 22(15): 5585 - 5592. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Graichen, D. Liu, Y. Sun, K.-O. Lee, and P. E. Lobie Autocrine Human Growth Hormone Inhibits Placental Transforming Growth Factor-beta Gene Transcription to Prevent Apoptosis and Allow Cell Cycle Progression of Human Mammary Carcinoma Cells J. Biol. Chem., July 12, 2002; 277(29): 26662 - 26672. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Andersen, C. H. Jensen, R. K. Stoving, J. B. Larsen, H. D. Schroder, B. Teisner, and C. Hagen Fetal Antigen 1 in Healthy Adults and Patients with Pituitary Disease: Relation to Physiological, Pathological, and Pharmacological GH Levels J. Clin. Endocrinol. Metab., November 1, 2001; 86(11): 5465 - 5470. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Le Roith, C. Bondy, S. Yakar, J.-L. Liu, and A. Butler The Somatomedin Hypothesis: 2001 Endocr. Rev., February 1, 2001; 22(1): 53 - 74. [Abstract] [Full Text]
|
|
|
|
|
|
R. Nanbu-Wakao, Y. Fujitani, Y. Masuho, M.-a. Muramatu, and H. Wakao Prolactin Enhances CCAAT Enhancer-Binding Protein-{beta} (C/EBP{beta}) and Peroxisome Proliferator-Activated Receptor {gamma} (PPAR{gamma}) Messenger RNA Expression and Stimulates Adipogenic Conversion of NIH-3T3 Cells Mol. Endocrinol., February 1, 2000; 14(2): 307 - 316. [Abstract] [Full Text]
|
|
|
|
 |
|
 C.H. Jensen, K. Erb, L.G. Westergaard, A. Kliem, and B. Teisner Fetal antigen 1, an EGF multidomain protein in the sex hormone-producing cells of the gonads and the microenvironment of germ cells Mol. Hum. Reprod., October 1, 1999; 5(10): 908 - 913. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Smas, L. Chen, L. Zhao, M.-J. Latasa, and H. S. Sul Transcriptional Repression of pref-1 by Glucocorticoids Promotes 3T3-L1 Adipocyte Differentiation J. Biol. Chem., April 30, 1999; 274(18): 12632 - 12641. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Karlsen, S. G. Ronn, K. Lindberg, J. Johannesen, E. D. Galsgaard, F. Pociot, J. H. Nielsen, T. Mandrup-Poulsen, J. Nerup, and N. Billestrup Suppressor of cytokine signaling 3 (SOCS-3) protects beta -cells against interleukin-1beta - and interferon-gamma -mediated toxicity PNAS, October 9, 2001; 98(21): 12191 - 12196. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
