| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Cell Biology (J.W.C., R.L.R., J.S.R.) Baylor
College of Medicine Houston, Texas 77030
Department of
Molecular and Integrative Physiology (W.L.K., B.S.K.) University of
Illinois Urbana, Illinois 61801
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
, the predominant
subtype present in luteal cells, whereas the putative ERE-like region
(ERE3) of the proximal PR promoter did not bind either ER subtype.
Although the identity of the specific factors binding to the ERE3 site
remain to be determined, mutation of this region abolished
forskolin-induced activity of ERE3-PR-CAT constructs. The GC-rich
region of the distal PR promoter bound Sp1 and Sp3 but not
C/EBP/ß, indicating that factors binding to ERE3 interact
synergistically with Sp1/Sp3 to confer increased responsiveness of the
distal promoter to forskolin. Taken together, these results indicate
that activation of the A-kinase pathway leads to the
phosphorylation of some transcription factor(s) other than or in
addition to ER that is (are) critical for the transactivation of the PR
gene and that this mechanism is selectively activated in differentiated
granulosa cells possessing a preovulatory phenotype. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
PR mRNA is selectively induced in granulosa cells of preovulatory follicles within 5–7 h of the LH surge (1, 2, 6) and is localized to nuclei of preovulatory granulosa cells exposed to ovulatory concentrations of LH in culture (2). PR mRNAs expressed in granulosa cells encode both the short (PRA) and long (PRB) forms of the receptor (2), which are derived from two internal ATG translational start sites within the first exon (7, 8, 9, 10). Because these two receptor proteins differ in the N-terminal transactivation domain, their relative functional activities in various target cells may differ (11, 12). In target tissues such as the uterus, mammary gland, and hypothalamic-pituitary cells, progesterone activation of its receptor leads to the transcription of numerous genes (13). In the ovary, target genes for PR action have not yet been identified. However, targeted deletion of the PR gene in mice causes a mouse phenotype with numerous reproductive abnormalities (3). One of the defects in PR-/- mice is the failure to ovulate even when exogenous gonadotropins are administered (3). The anovulatory phenotype of these PR-/- mice confirms many earlier studies that indicated a key role for progesterone (Refs. 2, 14, 15 for review) and the increase in PR (1, 2) in the LH-induced process of ovulation.
The regulated expression of the PR gene in different tissues, including
the ovary, is complex and appears to depend, in part, on the structure
of the PR gene. The rat and mouse PR cDNAs (7, 16) and the rat, human,
and rabbit PR genes (7, 8, 9, 10) have been cloned. Within the 5'-flanking
region, two putative functional promoters have been described. The
distal promoter (P) resides at -131/+65 bp in the rat 5'-flanking
sequence, and the proximal promoter (P') resides at +461/+675 bp within
the 5'-untranslated region (7). The distal and proximal promoters have
putative binding sites for the estrogen receptor (ER), designated
estrogen response element (ERE)-like regions (7, 10). The
proximal promoter also contains an ERE1/2 site (7, 10). Functional
studies of these two promoters in different nonovarian cell types
indicate that the proximal promoter responds to 17ß-estradiol (E),
whereas the distal promoter does not unless two or more copies of the
PR promoter ERE-like sequences or a consensus ERE (17) are ligated to
it (7, 10). Furthermore, the inducibility of these promoters by E
differs in different cell types, presumably due to different levels of
endogenous ER, the subtype of ER (ER vs. ERß) or
specific coactivators present in the different cells (7, 10).
In addition to ligand-dependent activation of ER, it is becoming
increasing clear that phosphorylation can enhance receptor activation
in the presence of ligand or even activate the receptor in the absence
of ligand (18, 19). Different kinase cascades also activate ER at
different positions in the molecule; epidermal growth factor through
the N-terminal AF1 region and A-kinase through the C-terminal AF2
region (20). With regard to the induction of PR, cAMP stimulation of
the A-kinase pathway has been documented to enhance the effects of E in
other tissues (Ref. 7 and references therein) and to directly activate
the distal promoter activity in ovarian cells (21). However, the
precise mechanisms by which E and cAMP coordinately regulate the
expression of PR in different tissues remains unclear. They may either
lead to the induction and phosphorylation of ER, or other factors that
bind selectively to the distal promoter (21), or specific coregulatory
molecules (22, 23). In the ovary, there is an additional enigma.
Granulosa cells of preantral and preovulatory follicles express
nuclear E-binding proteins (24). Based on in situ
hybridization, these are now known to be comprised predominantly of
ERß with lesser amounts of ER (25, 26). E is synthesized at high
levels in granulosa cells of preovulatory follicles before the LH
surge. However, PR mRNA and protein are only expressed in preovulatory
granulosa cells that have been exposed to the LH surge. Thus, it is
critical to determine the mechanisms by which ER and activation of the
A-kinase pathway lead to transactivation of the PR gene in granulosa
cells.
Based on precise temporal induction of PR mRNA and protein by the LH surge and the obligatory role of PR in ovulation, we have sought to determine whether E is necessary for LH induction of PR in the preovulatory follicle and if it directly mediates transactivation of the PR promoter. For this we have analyzed 1) the temporal requirement of E, FSH, and LH for induction of PR mRNA, 2) regions of the PR promoter that are required for activation by ER and/or the A-kinase pathway, and 3) factors that bind to putative regulatory regions of the distal and proximal promoters of the PR gene.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
). Neither T nor E alone increased PR
mRNA. When forskolin was added to the cells cultured with E or T alone,
this cAMP-stimulatory agonist was unable to induce the rapid
appearance of PR mRNA. However, in the differentiated, FSH/T-treated
granulosa cells, forskolin induced a marked increase in PR mRNA within
5 h (48–53 h) (P < 0.001; Fig. 1A). These
results confirm earlier studies in cycling rats (1) and in granulosa
cell cultures (2), showing that FSH is critical for granulosa cell
differentiation and subsequent responses to cAMP, and provide the
additional, novel information that neither E nor T alone induces PR
mRNA in granulosa cells or permits the acute induction of PR mRNA by
forskolin.
|
, administration of ICI at the initiation of culture severely reduced (by
60%; P < 0.001) the subsequent induction of PR by
forskolin. In contrast, when ICI was added to the differentiated cells
together with forskolin (at 48 h), ICI failed to block the
induction of PR mRNA by the A-kinase activator. These results indicate
that E and ER mediate specific effects on granulosa cell
differentiation but are not obligatory for the rapid induction of PR by
cAMP and A-kinase. To determine more precisely when addition of E to
the granulosa cell cultures is needed to facilitate the
induction of PR mRNA by forskolin, granulosa cells were cultured in the
continuous presence of FSH with E added at selected time intervals. As
controls, T and E were added at the initiation of culture (Fig. 2; t = 0, left and
right panels, respectively). E was also added after 6
(t = 6), 12 (t = 12), or 24 (t = 24) h of culture (Fig. 2; right panels). The induction of PR mRNA by forskolin
(P < 0.001; solid bars) was similar in all
cultures. These results show that when granulosa cells are cultured
with E, the steroid acts synergistically with FSH even when added as
late as 24–48 h of culture.
|
). When cells were cultured with T and
a low level of FSH (10 ng/ml), a progressive 5-fold increase in PR mRNA
occurred in response to increasing concentrations of LH (Fig. 3B). In
contrast, cells cultured with T and a physiological concentration of
FSH (50 ng/ml) responded vigorously to increasing concentrations of LH.
Levels of PR mRNA in these cells were 8-fold higher than in the cells
cultured with low levels of FSH and T at 5.0 ng/ml LH (Fig. 3B, left panel). Furthermore, the maximal response observed in
these differentiated cells cultured with physiological amounts of FSH
occurred in response to as little as 2.5 ng/ml LH, a dose 200 times
less than that used previously (Fig. 3, A and B, and Ref. 2). These
preovulatory granulosa cells also exhibited a marked response to FSH
and GnRH, as well as to the phorbol ester PMA (phorbol myristate) (Fig. 3A). These results indicate that the differentiated cells exhibit an
enhanced response to the A-kinase activators (FSH/LH) and C-kinase
activators (GnRH/PMA).
|
). The induction of PR
mRNA by the A-kinase pathway appears to involve de novo
protein synthesis since the addition of cycloheximide also
abolished the induction by forskolin (P < 0.001; Fig. 4). From these data we conclude that activation of the C-kinase pathway
can induce expression of PR. However, activation of the A-kinase (not
C-kinase) pathway and de novo protein synthesis are
essential for LH-mediated induction of PR mRNA.
|
. They include
the distal (P) and proximal (P') promoters ligated to the
chloramphenicol acetyltransferase (CAT) reporter gene, as well as
concatamers of an ERE-like region (ERE3) of the proximal promoter or a
consensus ERE from the vitellogenin B1 gene ligated to the distal
promoter (10). As a control, a vector containing two copies of a
consensus ERE ligated to a minimal promoter E1b-CAT construct (ERE-E1b
CAT) was used (32). To verify the function of the ERE3 and ERE regions,
vectors containing either a mutation of ERE3 (ERE3m) or the
minimal E1b-promoter were used. All vectors were transfected into
granulosa cells that had been cultured for 48 h with FSH/T
(i.e. those in which the endogenous PR gene is induced by
forskolin). After 4 h the DNA was removed, and the cells were
stimulated with various agonists and antagonists.
|
). When three copies of ERE3 [(ERE3)3]
were placed upstream of the distal (P) promoter, forskolin-stimulated
activity was markedly increased (P < 0.001), and
mutation of the ERE3 abolished this response (P <
0.001), indicating that the ERE3 region was essential for mediating
enhanced activation of the distal promoter by cAMP. When a single copy
of the consensus ERE was placed upstream of the distal promoter, a
significant response to forskolin was also observed (P
< 0.05). The proximal promoter-reporter construct containing the ERE3
site showed a response to forskolin (P < 0.05),
whereas the control construct ERE-E1b-CAT containing two copies of the
consensus ER-binding site exhibited a vigorous response to forskolin
(P < 0.001). The addition of the ER antagonist ICI did
not block forskolin-induced activity of the vectors containing
consensus EREs. Although in this experiment ICI did decrease the
forskolin-induced activity of the (ERE3)3-P-CAT, this was not observed
consistently in later experiments (Fig. 5C) and is presumed to be a
nonspecific effect.
These same constructs were then transfected to analyze their response
to either E or forskolin alone or in combination (Fig. 5C). E alone
failed to increase the activity of any construct, including the
ERE-E1b-CAT vector. As above, forskolin alone markedly increased
(P < 0.001) the activities of the ERE3-P-CAT and the
ERE-E1b-CAT constructs. The addition of E did not enhance the effects
of forskolin. However, mutation of ERE3 or deletion of the ERE
abolished (P < 0.001) the responses to forskolin in
each vector, indicating that these regions are critical for mediating
the forskolin-induced responses. Lastly, cells were transfected to
determine whether the ER antagonist ICI could block the effect of
forskolin in the presence of E. As shown, the effects of forskolin or
forskolin plus E on the activity of the (ERE3)3-P-CAT and ERE-E1b-CAT
vectors were not inhibited by ICI. Collectively, these results indicate
that an ERE-like region (ERE3) in the PR promoter and the consensus ERE
of the vitellogenin B1 gene are not inducible by exogenous E alone in
granulosa cells. Furthermore, the functional activation of these
regions by cAMP was not reduced by the E antagonist ICI.
An ERE Consensus DNA but Not the ERE-Like Region (ERE3) within the
Promoter of the PR Gene Binds ER Present in Granulosa Cell Nuclear
Extracts
Based on the lack of a functional response to E when the
ERE3- and ERE-containing vectors were transfected into preovulatory
granulosa cells, we next sought to determine the relative amount and
subtype of ER present in the preovulatory granulosa cells. For this,
electrophoretic mobility shift assays (EMSAs) were done using a
consensus ERE oligonucleotide as the labeled DNA probe, specific ER
and ERß antibodies for supershift analyses, and nuclear extracts
prepared from granulosa cells isolated from ovaries of hormonally
primed hypophysectomized (H) rats (33, 34). Different stages of
follicular development were stimulated by treatment with E (HE;
preantral), E and FSH (HEF; preovulatory), and hCG (HEF/hCG; ovulatory)
(4). Whole cell extracts were also prepared from corpora lutea isolated
from ovaries of HEF/hCG-treated rats as well as pregnant rats (35).
When the ERE consensus oligonucleotide was used as the labeled probe
and nuclear extracts from preovulatory granulosa cells (HEF) were
used as the source of protein, one major, diffuse protein/DNA complex
and one minor, closely associated complex were formed (Fig. 6A). The major, diffuse band was competed
with a 100-fold excess of cold competitor DNA, whereas the smaller band
was not. When antibody to ER was added to the reactions, only a
small amount of the major complex was supershifted. However, when an
antibody to ERß was added, most of the major complex was supershifted
(Fig. 6A). Neither antibody altered the migration of the minor band.
This observation, combined with the lack of competition with unlabeled
DNA, indicates that this band is nonspecific.
|
, lanes 2–4). However, when extracts prepared
from HEF-hCG-treated rats were used, the amount of the major
protein/DNA complex decreased markedly within 4 h and was
undetectable in luteal cell extracts prepared 48 h after hCG (Fig. 6B, lanes 5 and 6). When whole cell extracts of corpora lutea isolated
on days 7 and 16 of pregnancy were used in the assay, a protein/DNA
complex of similar mobility was formed (Fig. 6B; lanes 7 and 8). When
antibodies to ERß and ER were included in the reactions, the ERß
antibody supershifted the complex formed by nuclear extracts of HE
granulosa cells (Fig. 6B, lane 10) but not the complex formed using
extracts from luteal cells (Fig. 6B, lane 12). Conversely, the ER
antibody supershifted the entire complex present in luteal tissue but
had only a minor effect in extracts of granulosa
cells (Fig. 6B, lanes 11 and 9, respectively). Immunofluorescent
analyses of granulosa cells using the same ER antibodies verified high
levels of ERß (but no detectable ER) in nuclei of granulosa cells
cultured overnight in serum-free medium (data not shown). An antibody
specific for steroidogenic factor-1 (SF1) had no effect on the
protein/DNA complex (data not shown). These results provide the first
evidence that ERß and ER proteins are present in ovarian cells and
that the relative amount of each receptor subtype changes during
differentiation. Granulosa cells contain an abundance of ERß that is
capable of binding to the ERE consensus, whereas luteal cells contain
ER.
When a single-copy ERE3 oligonucleotide was used as the labeled
probe, four specific protein/DNA complexes were observed using nuclear
extracts of HEF granulosa cells. These complexes were competed with a
100-fold excess of cold competitor ERE3 DNA (Fig. 6C). However, neither
the ERß antibody nor the ER antibody (not shown) shifted the
complexes. This same oligonucleotide also competed very poorly for the
binding of ER to the ERE consensus DNA (10). Antibodies to SF1, which
is capable of binding to an ERE half-site (CAAGGTCA), and antibodies to
the CAAT enhancer-binding proteins (C/EBPß and C/EBP; used here
for nonspecific binding) also failed to shift the protein/DNA
complexes. Although the ERE3 site has homology to an AP1/CRE binding
site (containing CGTCA), a consensus AP1 oligonucleotide did not
compete, specific antibodies to CREB (c-Jun, Jun B, and Jun D) failed
to supershift the complexes, and purified CREB failed to bind the ERE3
oligonucleotide (data not shown). Mutation of the ERE3 oligonucletoide
at sites that prevented forskolin inducibility of the (ERE3m)3-P-CAT
vector also prevented protein/DNA complex formation (data not shown),
indicating that the nucleotides critical for the protein/DNA
interactions involve those that comprise the putative ERE-like site.
Collectively, these data indicate that proteins other than ER are
interacting with ERE3 to confer forskolin inducibility of the
promoter-reporter constructs. However, the identity of these factors
remains to be determined.
To characterize the proteins binding to the functional region of
the distal PR promoter (21), an oligonucleotide to the GC-rich region
containing putative Sp1 and C/EBP binding sites was synthesized,
labeled, and used as the probe in EMSAs. Using granulosa cell nuclear
extracts, several complexes were observed (Fig. 7). When antibodies to Sp1, C/EBP, and
C/EBPß were added to the reactions, only the Sp1 antibody caused a
shift (Fig. 7A). When additional EMSAs were run using antibodies to
either Sp1, Sp3, or the combination, Sp1 and Sp3 antibodies caused two
of the complexes (denoted by arrows) to shift (denoted by
small arrowheads) indicating that not only Sp1 but also Sp3
is present in granulosa cells and binds to this region of the PR
promoter (Fig. 7B). Furthermore, recombinant Sp1 bound to this region
and was shifted with the Sp1 but not an Sp3 antibody, indicating the
specificity of the antibodies and their binding activities.
Oligonucleotides containing mutant Sp1 sites did not compete for
binding. Thus, this functional region of the distal PR promoter (Ref.
21 and data herein) binds members of the Sp1 family but does not
bind C/EBP or C/EBPß that are present in granulosa cell
nuclear extracts (31).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
protein were much lower. The presence of
these receptors combined with the fact that preovulatory follicles are
the major source of E provide evidence consistent with the notion that
E has a role in the induction of PR in granulosa cells as it does in
other cells (13). Although this hypothesis is attractive, the effects
of E on PR expression in the ovary remain elusive. The studies
conducted herein reinforce the notion that the regulation of PR in
granulosa cells may not be exclusively dependent on the activation of
ER by its ligand. Of note, the induction of PR by LH is temporally
restricted to preovulatory follicles that are already producing E but
in which the LH surge rapidly terminates expression of aromatase (36, 37), biosynthesis of E (38, 39), and levels of ERß protein (figures
herein). Thus, the induction of PR mRNA is occurring in follicles at a
time when follicular levels of E and its receptor are being markedly
reduced. Furthermore, E and specific E antagonists, such as ICI,
exhibit specific temporal effects on PR induction at stages of
granulosa cell differentiation that are distinct from those when PR is
induced by A-kinase activators. Furthermore, vectors containing rat PR
promoters, as well as vectors containing consensus ERE-regulatory
regions, exhibit nonconventional responses to E and A-kinase activators
when transfected into preovulatory granulosa cells. Based on these and
subsequent considerations, we conclude that induction of PR by the LH
surge in preovulatory granulosa cells is complex and that E (and ER)
likely act via an indirect mechanism(s) rather than by a direct
mechanism to activate the PR gene in granulosa cells. The temporal expression of ERs and the biosynthesis of E provide evidence favoring an indirect mechanism for E activation of the PR gene. First, ERß mRNA has been shown to be expressed in follicles of immature rats (25, 26). Furthermore, we show herein by DNA binding studies using a consensus ERE oligonucleotide that ERß protein is present in granulosa cells of H rats before and after treatment with E and FSH. By immunofluorescent analyses, we show that ERß is localized to nuclei of granulosa cells before exposure to FSH or E. Thus, if E could directly activate the PR gene via an ERE-like sequence present in the PR promoter, E alone would be expected to induce expression of PR mRNA when added to undifferentiated granulosa cells as well as in differentiated granulosa cells. However, as shown herein, neither the addition of E to immature granulosa cells nor the addition of T to cells expressing aromatase and thereby capable of converting this androgen to E (28) was effective in inducing PR mRNA in these cells. Likewise, E alone does not induce PR in granulosa cells of small preantral follicles in H rats (our unpublished data). Taken together, these results suggest that neither the presence of ERß nor the binding of ligand to ERß is sufficient for induction of PR in granulosa cells. This is not due to a lack of response of these cells to E. E markedly increases granulosa cell proliferation (38) as well as an increase in the cell cycle regulator, cyclin D2, in granulosa cells in vivo (39). E also increases cyclin D2 mRNA in granulosa cells cultured in serum-free medium (39).
The hypothesis that E acts via an indirect mechanism to facilitate LH induction of PR is further supported by the temporal effects of E. First, T and E are important for enhancing FSH-mediated attainment of a preovulatory phenotype (4, 28, 29, 30). E can be added as late as 24 h of culture and still enhance FSH-mediated granulosa cell differentiation with subsequent induction of PR mRNA by forskolin. Second, although the antiestrogen ICI was completely ineffective in blocking the rapid (within 5 h) induction of PR mRNA by forskolin in differentiated granulosa cells, it markedly blunted the response to forskolin if present throughout the 48 h of hormone-dependent differentiation. These observations are consistent with the notion that the ability of E (and ER) to alter granulosa cell function is temporal, specific, and critically dependent on FSH and LH activation of the A-kinase pathway (4). There is no doubt that E can directly activate ER function and the expression of some genes in these cells. However, the acute induction of PR is dependent on more complex interactions involving a diverse set of putative regulatory elements present in the promoter of the PR gene. These include a CG-rich distal promoter and several ERE-like regions present in the distal and proximal promoters.
The transcriptional activation of various PR promoter-reporter constructs in granulosa cells also appears to favor an indirect effect of E and ER on PR induction by LH. Vectors shown to be induced by E in other cell types (7, 10) showed no response to E alone when transfected into granulosa cells. Specifically, when E alone was added to granulosa cells transfected with distal (P) or proximal (P') PR-CAT vectors, no induction of activity was observed. Ligation of a concatamer of an ERE-like element (ERE3; Ref. 10) to the distal promoter, (ERE3)3-P-CAT, also failed to exhibit a response to E in granulosa cells. This is in marked contrast to the inducibility of (ERE3)3-P-CAT by E alone in MCF7 cells (10). Conversely, in the absence of E, forskolin induced CAT activity in the (ERE3)3-P-CAT vector, and this activation was lost when the ERE3 site was mutated. Furthermore, the E antagonist ICI did not block forskolin-induced activation of the ERE3-P-CAT. These results indicate that the mechanism by which forskolin induces activation of these PR promoter constructs occurs independently of E in granulosa cells.
This evidence indicating that E does not regulate expression of PR
directly is tempered by the unexpected but interesting observation that
E alone fails to activate the ERE-E1b-CAT vector when transfected into
differentiated granulosa cells. Rather this vector was induced by
forskolin alone, and the forskolin-induced activity was not blocked by
addition of ICI. We have shown that the consensus ERE contained within
this construct binds an abundance of ERß present in granulosa cell
extracts as well as ER present in luteal cells. Thus, the ERE is a
functional DNA-binding site for both ER subtypes in granulosa cells.
These observations indicate that the endogenous ERß may already be
occupied by small amounts of endogenous E and that activation of
ligand-occupied ER in granulosa cells is dependent on a phosphorylation
event. That phosphorylation of some factor within these cells is
critical is highly interesting and supported by the evidence that
activators of A-kinase (LH, forskolin) can induce PR in differentiated
granulosa cells and that the effects of A-kinase are blocked by the
A-kinase inhibitor, H89. Because cycloheximide also blocked induction
of PR, we believe that de novo synthesis of some factor is
also obligatory. The inducible factors remain unknown. They are
unlikely to be the ER subtypes since ERß mRNA (25, 26) and protein
(figures herein) are present in preovulatory granulosa cells and
decrease after exposure to ovulatory levels of LH/hCG. Although we
shown herein that Sp1 and Sp3 bind to the distal promoter, these
factors are not hormonally regulated in granulosa cells (40). Rather,
they are expressed at elevated levels during follicular
development and in corpora lutea (40). Although C/EBPß was a likely
candidate to be the LH-inducible factor (31), we could not detect
binding of C/EBPß to the GC-rich region of the distal PR promoter
that has been shown herein and elsewhere to be regulated by cAMP (21).
Furthermore, the distal region by itself gave only a marginal response
to LH. Therefore, it would appear that factors binding to the distal
region (Sp1/Sp3) must interact with factors binding to the ERE3 site to
confer maximal activity.
Activators of A-kinase may lead to the phosphorylation of a specific coactivator or another transcription factor obligatory for the induction of PR. CBP and SRC-1 both are capable of being phosphorylated by A-kinase (41, 42). Therefore, the function of ER bound to an ERE site or another site may be dependent on the phosphorylation of these or related coactivators. In addition, we show herein that Sp1/Sp3 is present in granulosa cell extracts and bind to the GC-rich region of the distal promoter of the PR gene. Sp1/Sp3 have recently been shown to be expressed at high levels in granulosa cells and to confer cAMP inducibility to a number of genes expressed in ovarian cells (40). These include the serum and glucocorticoid-inducible kinase, Sgk (40); cholesterol side-chain cleavage cytochrome P450, P450scc (43); and the cell cycle-inhibitory protein, p21CIP (44). Because a single copy of the consensus ERE and three copies of ERE3 enhanced expression of the distal promoter, it is attractive to postulate that the Sp1/Sp3-binding site in the distal promoter needs to interact with additional, adjacent regulatory mechanisms to confer cAMP inducibility to the promoter. Most recently, ER has been shown to bind to Sp1 and increase its DNA and transactivation potential in the absence of an ER DNA-binding site (45). Thus, one explanation that combines a role for ER and A-kinase on the PR promoter would be that ER binds Sp1 and that A-kinase phosphorylates either one of these factors or an additional coactivator or coregulator (CBP?) to enhance transcription.
These observations raise an intriguing question: Of what physiological
significance is the obligatory requirement of A-kinase
(phosphorylation?) for activation of putative ER-regulated genes in
ovarian cells? The absence of a direct effect of E on genes, such as
PR, in granulosa cells may have evolved to ensure that PR is not
induced prematurely in the E-producing, estrogen-enriched milieu of the
preovulatory follicle. Rather, induction of PR may only occur when E
coming from the preovulatory follicle elicits the LH surge. If the
ERE-like regions in the PR promoter bind AP1-related factors, this may
be particularly relevant. Recent studies have shown that in the
presence of E or diethylstilbestrol, the ERß subtype is a
negative regulator of ER action via AP1-responsive elements (46).
Conversely, antiestrogens are positive regulators in these same vectors
(46). Thus, in the developing follicle, ERß may inhibit ER action in
promoters with AP1 response elements while favoring activation of
promoters with EREs. A secondary level of control may involve the level
and sites of phosphorylation of ER. The effect of the LH surge may also
be to shift the balance from the predominantly ERß granulosa cell to
the ER-containing luteal cell. ER, unlike ERß, can enhance
activity on the AP1 regions in the presence of E or antiestrogens (46).
Alternatively, recent studies have shown that ER can facilitate the
functional activity of Sp1 (45). Thus, phosphorylation of Sp1 or ER may
be required for their interactions, and this may occur independently of
E. ERß may exert specific and critical functions in tissues that
express aromatase and have high endogenous levels of E. Collectively,
the results of this study indicate that activation of the A-kinase
pathway leads to the phosphorylation of some transcription factor(s)
other than, or in addition to, ER that is (are) essential for
transactivation of the PR gene and that this mechanism is selectively
activated in granulosa cells of preovulatory follicles.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
-32P[dCTP] was from ICN
Radiochemicals (Costa Mesa, CA). Hyperfilm was purchased from Amersham
(Arlington Heights, IL). [C14]chloramphenicol was
purchased from Amersham, and acetyl coenzyme A was obtained from
Pharmacia (Piscataway, NJ).
Animals
Intact and hypophysectomized immature (day 25 of age) Holtzman
Sprague-Dawley female rats (Harlan, Indianapolis, IN) were housed under
a 16-h light, 8-h dark schedule in the Center for Comparative Medicine
at Baylor College of Medicine (Houston, TX) and provided food and water
ad libitum. Animals were treated in accordance with the NIH
Guide for the Care and Use of Laboratory Animals, as approved by the
Animal Care and Use Committee at Baylor College of Medicine.
Granulosa Cell Cultures
Granulosa cells were harvested from untreated immature rats or
from E-primed rats as previously described (27, 28) and as indicated in
Results and figure legends. Cells were cultured at a density
of 1 x 106 cells per 3 ml serum free medium (DMEM:F12
containing penicillin and streptomycin) in multiwell (35-mm) dishes
that were serum coated. Hormones, agonists, antagonists, and inhibitors
were added as indicated in the figure legends.
RNA Isolation and RT-PCR Assays
Cytoplasmic RNA was isolated from cultured cells with a buffer
containing 1% NP-40 (28). Each RNA sample was pooled from three
replicate wells. The RNA was purified by sequential phenol,
phenol-chloroform, and chloroform extraction, followed by ethanol
precipitation. The RNA was resuspended in 0.1%
diethylpyrocarbamate-treated water, and its concentration was
determined by absorbance at 260 nm.
RT-PCR reactions were performed as previously described (47) using specific primer pairs for rat PR (forward, 5'-CCCACAGGAGTTTGTCAAGCT-3' and reverse 5'-TAACTTCAGACATCATTCCGG-3') (1, 6) and the ribosomal protein L19 (1, 6). The amplified cDNA products were resolved by acrylamide gel electrophoresis, and radioactivity/PCR product band was quantified on a Betascope 603 Blot Analyzer (Betagen Corp., Mountain View, CA). Data are presented as the ratio of radioactivity in the PR and L19 bands.
Transfections
The rat PR promoter-CAT reporter constructs analyzed in these
studies have been used previously in other cell types (7, 10) and are
shown in Fig. 6. For transfections, granulosa cells were harvested from
E-primed immature rats and cultured in the presence of FSH (50 ng/ml)
and T (10 ng/ml) for 48 h, conditions that permit transactivation
of the endogenous PR gene by hormones and forskolin (2, 4). The cells
were transiently transfected using 4.78 pmol plasmid/well and the
calcium phosphate precipitation method (33, 34). Four hours later, the
DNA was removed, and the cells were washed and cultured in the presence
or absence of 7.5 µM forskolin for 5 h. At that
time, the cells were lysed by freeze-thaw procedure, and cytosolic
protein concentrations were determined by the mini-Bradford assay
(Bio-Rad). CAT activity in the extracts was analyzed using 30 µg
protein and an 18-h incubation according to a standard protocol (33, 34). The amount of radioactivity in the substrate and acetylated
products after chromatographic separation was determined by the
Betascope 603 Blot Analyzer. Transfections of each plasmid were done in
triplicate, and at least three replicate experiments were
performed. Data are expressed as the mean ± SEM.
EMSAs
Oligonucleotides to specific regions of the PR promoter were
synthesized, annealed, and labeled according to routine procedures (33, 34). The double-stranded oligonucleotides included:
1. The GC-rich region of the distal promoter (Distal: 5'-AGGTCTAGCCAGTGATTGGCTAGGGAGGGGCTTTGGGCGGGCCTTCCTAGAGC and reverse AGGGCTCTAGGAAGGCCCGCCCAAAGCCCTCCCTAGCCAATCACTGGCTAGA);
2. The ERE3 region of the proximal promoter (ERE3: 5'-AGGTCTCGGGTCGTCATGACTGAGCT and reverse AGGAGCTCAGTCATGACGACCCGAGA as well as
3. An ERE consensus from the vitellogenin B1 gene (EREcon: 5'-AGGCAAAGTCAGGTCACAGTGACCTGATCAAAGA and reverse AGGTCTTTGATCAGGTCACTGTGACCTGACTTTG.
Oligonucleotides were incubated with nuclear extracts or whole cell
extracts prepared from granulosa cells of hypophysectomized (H) rats
treated sequentially with E (HE), FSH (HEF), and hCG (HEF + hCG) as
previously described (33, 34, 35). Extracts were also prepared from corpora
lutea isolated from the ovaries of pregant rats on days 7 and 16 of
gestation. After 20 min at room temperature, the binding reactions were
subjected to nondenaturing electrophoresis (0.5% Tris-borate-EDTA) at
150 V. Where indicated, specific antibodies against nuclear proteins
were added to the reactions for 30 min on ice before the addition of
labeled DNA. The antibodies used were specific for ER (Santa Cruz
Biotechnology, Santa Cruz, CA) and ERß (Affinity Bioreagents, Golden,
CO), c-fos (Oncogene Science Inc, Manhasset, NY),
pan-Jun (Oncogene), SF1 (Dr. Ken Morohashi, National Institute for
Basic Biology, Okazaki, Japan), CAAT enhancer binding proteins,
C/EBP and C/EBPß (Dr. Valerie Poli, Instituto di Ricerche, Rome,
Italy), and stimulatory proteins, Sp1 and Sp3 (Promega, Madison,
WI).
Immunocytochemistry
Granulosa cells from E-primed immature rats were cultured as
above on glass coverslips for varying times in the presence or absence
of FSH or forskolin. Cells were processed for immunocytochemistry as
described previously (33). Briefly, cells were fixed in fresh 4%
paraformaldehyde (Electron Microscopy Sciences, Fort Washington, PA) in
PBS for 30 min at room temperature, washed in 10 mM glycine
in PBS and PBS. The fixed cells were either stored at 4 C. The
cells were permeabilized with 0.5% NP-40 in PBS for 10 min and then
blocked with 4% BSA in PBS for 1 h at room temperature. The cells
were incubated at 4 C for 18 h with specific antibodies diluted
1:500 in 4% BSA in PBS. After several PBS washes, cells were incubated
with flourescein-labeled goat anti-rabbit IgG (1:20, Pierce, Rockford,
IL) in 4% BSA in PBS for 1 h at room temperature. ERß and ER
were visualized on a Zeiss Axiophot microscope (Carl Zeiss, Thornwood,
NY).
Statistical Analyses
RT-PCR and transfection data were analyzed by ANOVA. Values
represent the mean ± SEM for at least three
experiments and were considered significantly different if
P < 0.05.
|
FOOTNOTES |
|---|
Supported in part by NIH Grants HD-16229 (J.S.R.) and CA-18119 and US Army Grant DAMD-17-J-4205 (B.S.K.).
1 Current address: Department of Biological Sciences, Duquesne
University, Pittsburg, Pennsylvania 15282. 
2 Current address: Department of Biology, University of California San
Diego, La Jolla, California 92093.
Received for publication February 18, 1998. Revision received April 15, 1998. Accepted for publication April 30, 1998.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
2-macroglobulin (2M) promoter in
the rat ovary. Biol Reprod 55:1029–1038[Abstract]
and ERß at AP1 sites. Science 277:1508–1510This article has been cited by other articles:
 |
|
 |
|
  B. J. Deroo, K. F. Rodriguez, J. F. Couse, K. J. Hamilton, J. B. Collins, S. F. Grissom, and K. S. Korach Estrogen Receptor {beta} Is Required for Optimal cAMP Production in Mouse Granulosa Cells Mol. Endocrinol., July 1, 2009; 23(7): 955 - 965. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Kim, I. C. Bagchi, and M. K. Bagchi Signaling by Hypoxia-Inducible Factors Is Critical for Ovulation In Mice Endocrinology, July 1, 2009; 150(7): 3392 - 3400. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. de Cremoux, D. Rosenberg, J. Goussard, C. Bremont-Weil, F. Tissier, C. Tran-Perennou, L. Groussin, X. Bertagna, J. Bertherat, and M.-L. Raffin-Sanson Expression of progesterone and estradiol receptors in normal adrenal cortex, adrenocortical tumors, and primary pigmented nodular adrenocortical disease Endocr. Relat. Cancer, June 1, 2008; 15(2): 465 - 474. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Kim, M. Sato, Q. Li, J. P. Lydon, F. J. DeMayo, I. C. Bagchi, and M. K. Bagchi Peroxisome Proliferator-Activated Receptor {gamma} Is a Target of Progesterone Regulation in the Preovulatory Follicles and Controls Ovulation in Mice Mol. Cell. Biol., March 1, 2008; 28(5): 1770 - 1782. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. L. Russell and R. L. Robker Molecular mechanisms of ovulation: co-ordination through the cumulus complex Hum. Reprod. Update, May 1, 2007; 13(3): 289 - 312. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. M. Bryant, M. A. Gibson, and M. A. Shupnik Stimulation of the Novel Estrogen Receptor-{alpha} Intronic TERP-1 Promoter by Estrogens, Androgen, Pituitary Adenylate Cyclase-Activating Peptide, and Forskolin, and Autoregulation by TERP-1 Protein Endocrinology, January 1, 2006; 147(1): 543 - 551. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. Couse, M. M. Yates, B. J. Deroo, and K. S. Korach Estrogen Receptor-{beta} Is Critical to Granulosa Cell Differentiation and the Ovulatory Response to Gonadotropins Endocrinology, August 1, 2005; 146(8): 3247 - 3262. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Gava, C. L. Clarke, K. Byth, R. L. Arnett-Mansfield, and A. deFazio Expression of Progesterone Receptors A and B in the Mouse Ovary during the Estrous Cycle Endocrinology, July 1, 2004; 145(7): 3487 - 3494. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Sriraman and J. S. Richards Cathepsin L Gene Expression and Promoter Activation in Rodent Granulosa Cells Endocrinology, February 1, 2004; 145(2): 582 - 591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-Y. Park, F. Richard, S.-Y. Chun, J.-H. Park, E. Law, K. Horner, S-L C. Jin, and M. Conti Phosphodiesterase Regulation Is Critical for the Differentiation and Pattern of Gene Expression in Granulosa Cells of the Ovarian Follicle Mol. Endocrinol., June 1, 2003; 17(6): 1117 - 1130. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Sriraman, S. C. Sharma, and J. S. Richards Transactivation of the Progesterone Receptor Gene in Granulosa Cells: Evidence that Sp1/Sp3 Binding Sites in the Proximal Promoter Play a Key Role in Luteinizing Hormone Inducibility Mol. Endocrinol., March 1, 2003; 17(3): 436 - 449. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Schwarzenbach, P. R. Manna, D. M. Stocco, G. Chakrabarti, and A. K. Mukhopadhyay Stimulatory Effect of Progesterone on the Expression of Steroidogenic Acute Regulatory Protein in MA-10 Leydig Cells Biol Reprod, March 1, 2003; 68(3): 1054 - 1063. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Phillips, J. Bailey, S. C. Robson, and G. N. Europe-Finner Differential Expression of the Adenylyl Cyclase-Stimulatory Guanosine Triphosphate-Binding Protein Gs{alpha} in the Human Myometrium during Pregnancy and Labor Involves Transcriptional Regulation by Cyclic Adenosine 3',5'-Monophosphate and Binding of Phosphorylated Nuclear Proteins to Multiple GC Boxes within the Promoter J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5675 - 5685. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Sathya, M. S. Jansen, S. C. Nagel, C. E. Cook, and D. P. MCDonnell Identification and Characterization of Novel Estrogen Receptor-{beta}-Sparing Antiprogestins Endocrinology, August 1, 2002; 143(8): 3071 - 3082. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. S. Richards, D. L. Russell, S. Ochsner, M. Hsieh, K. H. Doyle, A. E. Falender, Y. K. Lo, and S. C. Sharma Novel Signaling Pathways That Control Ovarian Follicular Development, Ovulation, and Luteinization Recent Prog. Horm. Res., January 1, 2002; 57(1): 195 - 220. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Waters, S. Safe, and K. W. Gaido Differential Gene Expression in Response to Methoxychlor and Estradiol through ER{alpha}, ER{beta}, and AR in Reproductive Tissues of Female Mice Toxicol. Sci., September 1, 2001; 63(1): 47 - 56. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Guo, L. Savage, K. D. Sarge, and O.-K. Park-Sarge Gonadotropins Decrease Estrogen Receptor-{beta} Messenger Ribonucleic Acid Stability in Rat Granulosa Cells Endocrinology, June 1, 2001; 142(6): 2230 - 2237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Richards New Signaling Pathways for Hormones and Cyclic Adenosine 3',5'-Monophosphate Action in Endocrine Cells Mol. Endocrinol., February 1, 2001; 15(2): 209 - 218. [Abstract] [Full Text]
|
|
|
|
 |
|
 J.-I. Park, W.-J. Kim, L. Wang, H.-J. Park, J. Lee, J.-H. Park, H.-B. Kwon, A. Tsafriri, and S.-Y. Chun Involvement of progesterone in gonadotrophin-induced pituitary adenylate cyclase-activating polypeptide gene expression in pre-ovulatory follicles of rat ovary Mol. Hum. Reprod., March 1, 2000; 6(3): 238 - 245. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. O’Brien, K. Park, Y. In, and O.-K. Park-Sarge Characterization of Estrogen Receptor-{beta} (ER{beta}) Messenger Ribonucleic Acid and Protein Expression in Rat Granulosa Cells Endocrinology, October 1, 1999; 140(10): 4530 - 4541. [Abstract] [Full Text]
|
|
|
|
|
|
C. L. Chaffin, R. L. Stouffer, and D. M. Duffy Gonadotropin and Steroid Regulation of Steroid Receptor and Aryl Hydrocarbon Receptor Messenger Ribonucleic Acid in Macaque Granulosa Cells during the Periovulatory Interval Endocrinology, October 1, 1999; 140(10): 4753 - 4760. [Abstract] [Full Text]
|
|
|
|
|
|
J. J. Brosens, N. Hayashi, and J. O. White Progesterone Receptor Regulates Decidual Prolactin Expression in Differentiating Human Endometrial Stromal Cells Endocrinology, October 1, 1999; 140(10): 4809 - 4820. [Abstract] [Full Text]
|
|
|
|
|
|
S. C. Sharma, J. W. Clemens, M. D. Pisarska, and J. S. Richards Expression and Function of Estrogen Receptor Subtypes in Granulosa Cells: Regulation by Estradiol and Forskolin Endocrinology, September 1, 1999; 140(9): 4320 - 4334. [Abstract] [Full Text]
|
|
|
|
|
|
I. J. Gonzalez-Robayna, T. N. Alliston, P. Buse, G. L. Firestone, and J. S. Richards Functional and Subcellular Changes in the A-Kinase-Signaling Pathway: Relation to Aromatase and Sgk Expression during the Transition of Granulosa Cells to Luteal Cells Mol. Endocrinol., August 1, 1999; 13(8): 1318 - 1337. [Abstract] [Full Text]
|
|
|
|
|
|
S. L. Fitzpatrick, J. M. Funkhouser, D. M. Sindoni, P. E. Stevis, D. C. Deecher, A. R. Bapat, I. Merchenthaler, and D. E. Frail Expression of Estrogen Receptor-{beta} Protein in Rodent Ovary Endocrinology, June 1, 1999; 140(6): 2581 - 2591. [Abstract] [Full Text]
|
|
|
|
|
|
D. W. Schomberg, J. F. Couse, A. Mukherjee, D. B. Lubahn, M. Sar, K. E. Mayo, and K. S. Korach Targeted Disruption of the Estrogen Receptor-{alpha} Gene in Female Mice: Characterization of Ovarian Responses and Phenotype in the Adult Endocrinology, June 1, 1999; 140(6): 2733 - 2744. [Abstract] [Full Text]
|
|
|
|
 |
|
 R. L. Robker, D. L. Russell, L. L. Espey, J. P. Lydon, B. W. O'Malley, and J. S. Richards Progesterone-regulated genes in the ovulation process: ADAMTS-1 and cathepsin L proteases PNAS, April 25, 2000; 97(9): 4689 - 4694. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
