help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clemens, J. W.
Right arrow Articles by Richards, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clemens, J. W.
Right arrow Articles by Richards, J. S.
Molecular Endocrinology 12 (8): 1201-1214
Copyright © 1998 by The Endocrine Society

Hormone Induction of Progesterone Receptor (PR) Messenger Ribonucleic Acid and Activation of PR Promoter Regions in Ovarian Granulosa Cells: Evidence for a Role of Cyclic Adenosine 3',5'-Monophosphate but Not Estradiol

Jeffrey W. Clemens1, Rebecca L. Robker, W. Lee Kraus2, Benita S. Katzenellenbogen and JoAnne S. Richards

Department of Cell Biology (J.W.C., R.L.R., J.S.R.) Baylor College of Medicine Houston, Texas 77030
Department of Molecular and Integrative Physiology (W.L.K., B.S.K.) University of Illinois Urbana, Illinois 61801


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Expression of progesterone receptor (PR) mRNA in granulosa cells of ovarian preovulatory follicles is induced by LH (1, 2) and is essential for ovulation (3). Although 17ß-estradiol (E) can induce PR mRNA and activate PR promoter-reporter constructs in other cell types, the effects of E in granulosa cells appear to be indirect. We show herein that E alone does not induce the expression of PR mRNA in preovulatory granulosa cells. Rather, induction of PR mRNA depends on the differentiation of granulosa cells in response to E and a physiological amount of FSH followed by exposure to agonists (elevated levels of LH, FSH, and forskolin) that markedly increase cAMP. Induction of PR mRNA by forskolin is blocked by the A-kinase inhibitor H89 and cycloheximide but not by the E antagonist, ICI 164,384. These results indicate that phosphorylation and synthesis of some regulatory factor(s) other than or in addition to the estrogen receptor (ER) are essential for transactivation of the PR gene. When distal and proximal PR promoter-reporter constructs that are responsive to E in other cell types were transiently transfected into differentiated granulosa cells, forskolin, but not E, induced activity. Likewise, when a vector containing the consensus vitellogenin B1 gene estrogen response element (ERE) was transfected into differentiated granulosa cells, forskolin, but not E, induced activity. Using electrophoretic mobility shift assays, the consensus ERE was shown to bind ERß, the predominant subtype present in rat granulosa cells, and ER{alpha}, the predominant subtype present in luteal cells, whereas the putative ERE-like region (ERE3) of the proximal PR promoter did not bind either ER subtype. Although the identity of the specific factors binding to the ERE3 site remain to be determined, mutation of this region abolished forskolin-induced activity of ERE3-PR-CAT constructs. The GC-rich region of the distal PR promoter bound Sp1 and Sp3 but not C/EBP{alpha}/ß, indicating that factors binding to ERE3 interact synergistically with Sp1/Sp3 to confer increased responsiveness of the distal promoter to forskolin. Taken together, these results indicate that activation of the A-kinase pathway leads to the phosphorylation of some transcription factor(s) other than or in addition to ER that is (are) critical for the transactivation of the PR gene and that this mechanism is selectively activated in differentiated granulosa cells possessing a preovulatory phenotype.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The surge of LH is the physiological trigger that stimulates ovulation, a process by which preovulatory follicles rupture and release a fertilizable oocyte. Recent studies have shown that the LH surge induces in granulosa cells of these preovulatory follicles the rapid and transient expression of specific genes critical for the ovulation process (4). One of these genes encodes the progesterone receptor [PR (1, 2, 3, 4, 5)] which is a member of the nuclear receptor superfamily of transcription factors.

PR mRNA is selectively induced in granulosa cells of preovulatory follicles within 5–7 h of the LH surge (1, 2, 6) and is localized to nuclei of preovulatory granulosa cells exposed to ovulatory concentrations of LH in culture (2). PR mRNAs expressed in granulosa cells encode both the short (PRA) and long (PRB) forms of the receptor (2), which are derived from two internal ATG translational start sites within the first exon (7, 8, 9, 10). Because these two receptor proteins differ in the N-terminal transactivation domain, their relative functional activities in various target cells may differ (11, 12). In target tissues such as the uterus, mammary gland, and hypothalamic-pituitary cells, progesterone activation of its receptor leads to the transcription of numerous genes (13). In the ovary, target genes for PR action have not yet been identified. However, targeted deletion of the PR gene in mice causes a mouse phenotype with numerous reproductive abnormalities (3). One of the defects in PR-/- mice is the failure to ovulate even when exogenous gonadotropins are administered (3). The anovulatory phenotype of these PR-/- mice confirms many earlier studies that indicated a key role for progesterone (Refs. 2, 14, 15 for review) and the increase in PR (1, 2) in the LH-induced process of ovulation.

The regulated expression of the PR gene in different tissues, including the ovary, is complex and appears to depend, in part, on the structure of the PR gene. The rat and mouse PR cDNAs (7, 16) and the rat, human, and rabbit PR genes (7, 8, 9, 10) have been cloned. Within the 5'-flanking region, two putative functional promoters have been described. The distal promoter (P) resides at -131/+65 bp in the rat 5'-flanking sequence, and the proximal promoter (P') resides at +461/+675 bp within the 5'-untranslated region (7). The distal and proximal promoters have putative binding sites for the estrogen receptor (ER), designated estrogen response element (ERE)-like regions (7, 10). The proximal promoter also contains an ERE1/2 site (7, 10). Functional studies of these two promoters in different nonovarian cell types indicate that the proximal promoter responds to 17ß-estradiol (E), whereas the distal promoter does not unless two or more copies of the PR promoter ERE-like sequences or a consensus ERE (17) are ligated to it (7, 10). Furthermore, the inducibility of these promoters by E differs in different cell types, presumably due to different levels of endogenous ER, the subtype of ER (ER{alpha} vs. ERß) or specific coactivators present in the different cells (7, 10).

In addition to ligand-dependent activation of ER, it is becoming increasing clear that phosphorylation can enhance receptor activation in the presence of ligand or even activate the receptor in the absence of ligand (18, 19). Different kinase cascades also activate ER at different positions in the molecule; epidermal growth factor through the N-terminal AF1 region and A-kinase through the C-terminal AF2 region (20). With regard to the induction of PR, cAMP stimulation of the A-kinase pathway has been documented to enhance the effects of E in other tissues (Ref. 7 and references therein) and to directly activate the distal promoter activity in ovarian cells (21). However, the precise mechanisms by which E and cAMP coordinately regulate the expression of PR in different tissues remains unclear. They may either lead to the induction and phosphorylation of ER, or other factors that bind selectively to the distal promoter (21), or specific coregulatory molecules (22, 23). In the ovary, there is an additional enigma. Granulosa cells of preantral and preovulatory follicles express nuclear E-binding proteins (24). Based on in situ hybridization, these are now known to be comprised predominantly of ERß with lesser amounts of ER{alpha} (25, 26). E is synthesized at high levels in granulosa cells of preovulatory follicles before the LH surge. However, PR mRNA and protein are only expressed in preovulatory granulosa cells that have been exposed to the LH surge. Thus, it is critical to determine the mechanisms by which ER and activation of the A-kinase pathway lead to transactivation of the PR gene in granulosa cells.

Based on precise temporal induction of PR mRNA and protein by the LH surge and the obligatory role of PR in ovulation, we have sought to determine whether E is necessary for LH induction of PR in the preovulatory follicle and if it directly mediates transactivation of the PR promoter. For this we have analyzed 1) the temporal requirement of E, FSH, and LH for induction of PR mRNA, 2) regions of the PR promoter that are required for activation by ER and/or the A-kinase pathway, and 3) factors that bind to putative regulatory regions of the distal and proximal promoters of the PR gene.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
E Alone Does Not Induce PR mRNA in Granulosa Cells
The temporal effects of E, FSH, and LH on the induction of PR mRNA were analyzed in primary rat granulosa cell cultures. Granulosa cells were harvested from immature rats (27, 28), plated in serum-coated dishes, and cultured in chemically defined medium with either E (10 ng/ml) or testosterone (T; 10 ng/ml) alone for 48 h. Additional cells were cultured for 48 h with T and FSH (50 ng/ml), a treatment known to stimulate the differentiation of these cells to a preovulatory phenotype (4, 27, 28). Forskolin (10 µM), a direct activator of adenylyl cyclase, was added to the cultures at 48 h to stimulate the acute increase in cAMP (Fig. 1AGo). Neither T nor E alone increased PR mRNA. When forskolin was added to the cells cultured with E or T alone, this cAMP-stimulatory agonist was unable to induce the rapid appearance of PR mRNA. However, in the differentiated, FSH/T-treated granulosa cells, forskolin induced a marked increase in PR mRNA within 5 h (48–53 h) (P < 0.001; Fig. 1AGo). These results confirm earlier studies in cycling rats (1) and in granulosa cell cultures (2), showing that FSH is critical for granulosa cell differentiation and subsequent responses to cAMP, and provide the additional, novel information that neither E nor T alone induces PR mRNA in granulosa cells or permits the acute induction of PR mRNA by forskolin.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. Induction of PR by Forskolin Requires Granulosa Cell Differentiation

A, Neither E nor T alone can induce PR in granulosa cells. Granulosa cells were isolated from untreated, immature rats and cultured in serum-free medium for 48 h in the presence of either T (10 ng/ml), E (10 ng/ml) or T and FSH (50 ng/ml) (FSH/T). Forskolin (10 µM) was added to the cultures and RNA isolated 5 h later (48–53 h). PR mRNA was analyzed in this and subsequent figures by RT-PCR as described in Materials and Methods and expressed relative to mRNA for the ribosomal protein L19. B, The E antagonist ICI 164,384 does not block the acute induction of PR mRNA by forskolin. Granulosa cells from untreated, immature rats were cultured for 48 h in the presence of FSH and T (10 ng/ml) or with FSH, T, and ICI 164,384 (500-fold molar excess relative to T). At 48 h, cells in each group were either processed immediately for RNA or exposed to forskolin (10 µM) for an additional 5 h (48–53 h). Additional cells were cultured with FSH/T for 48 h, exposed to both forskolin and ICI for 5 h, and RNA was prepared. PR mRNA was analyzed by RT-PCR.

 
To determine whether the effects of E and its receptor are mediated indirectly at some earlier stage of granulosa cell differentiation, the ER antagonist ICI 164,384 (ICI) was added at two different times during cell culture. The effects of E during granulosa cell differentiation were analyzed by adding ICI simultaneously with FSH and T at the initiation of the culture. The effects of E and ER on the acute induction of PR mRNA by forskolin were determined by adding ICI to the FSH/T-treated cells at the same time as the addition of forskolin (i.e. at 48 h of culture). As shown in Fig. 1BGo, administration of ICI at the initiation of culture severely reduced (by 60%; P < 0.001) the subsequent induction of PR by forskolin. In contrast, when ICI was added to the differentiated cells together with forskolin (at 48 h), ICI failed to block the induction of PR mRNA by the A-kinase activator. These results indicate that E and ER mediate specific effects on granulosa cell differentiation but are not obligatory for the rapid induction of PR by cAMP and A-kinase. To determine more precisely when addition of E to the granulosa cell cultures is needed to facilitate the induction of PR mRNA by forskolin, granulosa cells were cultured in the continuous presence of FSH with E added at selected time intervals. As controls, T and E were added at the initiation of culture (Fig. 2Go; t = 0, left and right panels, respectively). E was also added after 6 (t = 6), 12 (t = 12), or 24 (t = 24) h of culture (Fig. 2Go; right panels). The induction of PR mRNA by forskolin (P < 0.001; solid bars) was similar in all cultures. These results show that when granulosa cells are cultured with E, the steroid acts synergistically with FSH even when added as late as 24–48 h of culture.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Induction of PR by Forskolin Requires FSH and a Time-Dependent Exposure of Cells to E

Granulosa cells of untreated, immature rats were cultured in the presence of FSH for 48 h with T or with E added at the initiation of culture (t = 0) or at 6, 12, and 24 h after plating. At 48 h, cells were left untreated (open bars) or exposed to forskolin (10 µM; solid bars). RNA was isolated from all cells 5 h later.

 
Induction of PR mRNA Is Dependent on Granulosa Cell Differentiation
We next determined the time and dose-dependent effects of FSH for induction of PR mRNA by forskolin. Granulosa cells were either cultured for 48 h in the absence of hormones or in the presence of T (10 ng/ml) and a physiological level of FSH (50/ng/ml). T and the physiological dose of FSH are known to induce a preovulatory phenotype in which granulosa cells express aromatase (28) and LH receptor (29) and respond to LH with induction of specific genes such as PGS-2 (30) and C/EBPß (31). When granulosa cells were cultured for 48 h in the absence of hormones, neither ovulatory concentrations of FSH [500 ng/ml (30)], GnRH [1 µM (31)] or high levels of forskolin [10 µM (4)] induced PR mRNA (Fig. 3AGo). When cells were cultured with T and a low level of FSH (10 ng/ml), a progressive 5-fold increase in PR mRNA occurred in response to increasing concentrations of LH (Fig. 3BGo). In contrast, cells cultured with T and a physiological concentration of FSH (50 ng/ml) responded vigorously to increasing concentrations of LH. Levels of PR mRNA in these cells were 8-fold higher than in the cells cultured with low levels of FSH and T at 5.0 ng/ml LH (Fig. 3BGo, left panel). Furthermore, the maximal response observed in these differentiated cells cultured with physiological amounts of FSH occurred in response to as little as 2.5 ng/ml LH, a dose 200 times less than that used previously (Fig. 3Go, A and B, and Ref. 2). These preovulatory granulosa cells also exhibited a marked response to FSH and GnRH, as well as to the phorbol ester PMA (phorbol myristate) (Fig. 3AGo). These results indicate that the differentiated cells exhibit an enhanced response to the A-kinase activators (FSH/LH) and C-kinase activators (GnRH/PMA).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 3. Induction of PR by Various Agonists Is Dependent on Steroid and a Physiological Dose of FSH

A, Granulosa cells were isolated from E-primed, immature rats and cultured for 48 h in medium alone or in the presence of FSH (50 ng/ml) and T (10 ng/ml). At 48 h, ovulatory doses of FSH (500 ng/ml) and LH (500 ng/ml) or high concentrations of forskolin (10 µM), GnRH (1 µM), or PMA (100 ng/ml) were added to the cultures for 5 h. RNA was isolated 5 h later; PR mRNA was quantified by RT-PCR. B, Granulosa cells were cultured as above with either low levels of FSH (10 ng/ml) or physiological amounts of FSH (50 ng/ml). At 48 h, increasing concentrations of LH were added, RNA was isolated 5 h later, and PR mRNA was analyzed by RT-PCR.

 
To determine whether A-kinase and C-kinase pathways were being selectively activated by LH, the A-kinase and C-kinase inhibitors, H89 and Calphostin C, respectively, were used. For these experiments granulosa cells were cultured for 48 h in the presence of FSH (50 ng/ml) and T (10 ng/ml). At 48 h of culture, the cells were challenged with forskolin without or with the addition of H89 (added 1 h before [t = -1] or at the same time [t = 0] as forskolin) or Calphostin C. H89 at either time completely inhibited (P < 0.001) the induction of PR mRNA, whereas addition of Calphostin C had much less of an effect (P < 0.02; Fig. 4Go). The induction of PR mRNA by the A-kinase pathway appears to involve de novo protein synthesis since the addition of cycloheximide also abolished the induction by forskolin (P < 0.001; Fig. 4Go). From these data we conclude that activation of the C-kinase pathway can induce expression of PR. However, activation of the A-kinase (not C-kinase) pathway and de novo protein synthesis are essential for LH-mediated induction of PR mRNA.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 4. Induction of PR by Forskolin Depends on Activation of the A-Kinase Pathway and a Cycloheximide-Sensitive Factor

Granulosa cells were harvested from E-primed, immature rats and cultured 48 h with FSH/T as described in Fig. 3AGo. The A-kinase inhibitor, H89 (10 µM), and the protein synthesis blocker, cycloheximide (CHX; 10 µg/ml), were added either 1 h before (t = -1) or at the same time as forskolin. The C-kinase kinase inhibitor, Calphostin C (Cal-C; 1 µM), was added at the same time as forskolin. RNA was isolated 5 h later and PR mRNA was analyzed by RT-PCR.

 
E Does Not Directly Activate the Proximal or Distal Promoters of the PR Gene in Granulosa Cells
As a complementary approach and more direct way to assess the specific effects of E, FSH, and LH on transactivation of the PR gene, we analyzed hormone-induced transactivation of various PR promoter-reporter constructs. The promoter-reporter constructs used in this study have been reported to be inducible by E alone and enhanced by A-kinase activators in other cell types (7, 10) and are shown schematically in Fig. 5AGo. They include the distal (P) and proximal (P') promoters ligated to the chloramphenicol acetyltransferase (CAT) reporter gene, as well as concatamers of an ERE-like region (ERE3) of the proximal promoter or a consensus ERE from the vitellogenin B1 gene ligated to the distal promoter (10). As a control, a vector containing two copies of a consensus ERE ligated to a minimal promoter E1b-CAT construct (ERE-E1b CAT) was used (32). To verify the function of the ERE3 and ERE regions, vectors containing either a mutation of ERE3 (ERE3m) or the minimal E1b-promoter were used. All vectors were transfected into granulosa cells that had been cultured for 48 h with FSH/T (i.e. those in which the endogenous PR gene is induced by forskolin). After 4 h the DNA was removed, and the cells were stimulated with various agonists and antagonists.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 5. Activation of PR Promoter Constructs by Forskolin

A, Schematic of the rat PR promoter and the PR promoter-reporter constructs used in transfection assays. The distal promoter (P; -131 to +65) is GC-rich whereas the putative proximal promoter (P'), which lies within coding region (+461 to +675), contains an ERE half-site and an ERE-like region, previously designated ERE3 (7 10 ). The transcriptional start site (+1) as well as the two translational start sites for PRB and PRA forms of the receptor are indicated. Distal and proximal promoters were each ligated to the CAT reporter construct. In addition, concatamers of the ERE3 region (AGCTTCTCGGGTCGTCATGACTGAGCT) as well as a mutant ERE3 (ERE3m; AGCTTCTCGGGTttTCATGACTGAGCT) have been ligated to the distal promoter. These vectors have previously been shown to respond to E in specific cell lines (7 10 ). The ERE-E1b-CAT vector (kindly provided by Dr. John Cidlowski, NIEHS, Research Triangle Park, NC) was used as a control for the effects of E and its receptors in these cells. B, Forskolin inducibility of PR promoter-reporter constructs in granulosa cells. The constructs described in Fig. 5AGo were transiently transfected (see Materials and Methods) into granulosa cells cultured for 48 h in the presence of FSH (50 ng/ml) and T (10 ng/ml). After transfection, the cells were either cultured in medium alone or stimulated with forskolin alone or forskolin in the presence of ICI (as in Fig. 1BGo) for 5 h. At that time the cells were lysed and the lysates analyzed for CAT activity. Each point represents the mean± SEM using results obtained in two independent experiments. C, Forskolin but not E activates the (ERE3)3-P-CAT and ERE-E1b-CAT promoter-reporter constructs. Granulosa cells were cultured and transfected as above with either (ERE3)3-P-CAT, mutant (ERE3m)3-P-CAT, ERE-E1b-CAT, or the minimal E1b-CAT vectors. Cells were then cultured for 5 h in medium alone or in the presence of E (10 ng/ml), forskolin (FSK; 10 µM), or E and forskolin with or without ICI 164,384 (500-fold excess). CAT activity was analyzed in the cell lysates. Similar results were obtained in three separate experiments.

 
The distal promoter-reporter construct exhibited a small but significant (P < 0.05) increase in CAT activity in response to forskolin (Fig. 5BGo). When three copies of ERE3 [(ERE3)3] were placed upstream of the distal (P) promoter, forskolin-stimulated activity was markedly increased (P < 0.001), and mutation of the ERE3 abolished this response (P < 0.001), indicating that the ERE3 region was essential for mediating enhanced activation of the distal promoter by cAMP. When a single copy of the consensus ERE was placed upstream of the distal promoter, a significant response to forskolin was also observed (P < 0.05). The proximal promoter-reporter construct containing the ERE3 site showed a response to forskolin (P < 0.05), whereas the control construct ERE-E1b-CAT containing two copies of the consensus ER-binding site exhibited a vigorous response to forskolin (P < 0.001). The addition of the ER antagonist ICI did not block forskolin-induced activity of the vectors containing consensus EREs. Although in this experiment ICI did decrease the forskolin-induced activity of the (ERE3)3-P-CAT, this was not observed consistently in later experiments (Fig. 5CGo) and is presumed to be a nonspecific effect.

These same constructs were then transfected to analyze their response to either E or forskolin alone or in combination (Fig. 5CGo). E alone failed to increase the activity of any construct, including the ERE-E1b-CAT vector. As above, forskolin alone markedly increased (P < 0.001) the activities of the ERE3-P-CAT and the ERE-E1b-CAT constructs. The addition of E did not enhance the effects of forskolin. However, mutation of ERE3 or deletion of the ERE abolished (P < 0.001) the responses to forskolin in each vector, indicating that these regions are critical for mediating the forskolin-induced responses. Lastly, cells were transfected to determine whether the ER antagonist ICI could block the effect of forskolin in the presence of E. As shown, the effects of forskolin or forskolin plus E on the activity of the (ERE3)3-P-CAT and ERE-E1b-CAT vectors were not inhibited by ICI. Collectively, these results indicate that an ERE-like region (ERE3) in the PR promoter and the consensus ERE of the vitellogenin B1 gene are not inducible by exogenous E alone in granulosa cells. Furthermore, the functional activation of these regions by cAMP was not reduced by the E antagonist ICI.

An ERE Consensus DNA but Not the ERE-Like Region (ERE3) within the Promoter of the PR Gene Binds ER Present in Granulosa Cell Nuclear Extracts
Based on the lack of a functional response to E when the ERE3- and ERE-containing vectors were transfected into preovulatory granulosa cells, we next sought to determine the relative amount and subtype of ER present in the preovulatory granulosa cells. For this, electrophoretic mobility shift assays (EMSAs) were done using a consensus ERE oligonucleotide as the labeled DNA probe, specific ER{alpha} and ERß antibodies for supershift analyses, and nuclear extracts prepared from granulosa cells isolated from ovaries of hormonally primed hypophysectomized (H) rats (33, 34). Different stages of follicular development were stimulated by treatment with E (HE; preantral), E and FSH (HEF; preovulatory), and hCG (HEF/hCG; ovulatory) (4). Whole cell extracts were also prepared from corpora lutea isolated from ovaries of HEF/hCG-treated rats as well as pregnant rats (35).

When the ERE consensus oligonucleotide was used as the labeled probe and nuclear extracts from preovulatory granulosa cells (HEF) were used as the source of protein, one major, diffuse protein/DNA complex and one minor, closely associated complex were formed (Fig. 6AGo). The major, diffuse band was competed with a 100-fold excess of cold competitor DNA, whereas the smaller band was not. When antibody to ER{alpha} was added to the reactions, only a small amount of the major complex was supershifted. However, when an antibody to ERß was added, most of the major complex was supershifted (Fig. 6AGo). Neither antibody altered the migration of the minor band. This observation, combined with the lack of competition with unlabeled DNA, indicates that this band is nonspecific.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. Consensus ERE but Not ERE3 Binds ER{alpha} and ERß Subtypes Present in Ovarian Cells

EMSAs were done using ERE and ERE3 oligonucleotides as described in Materials and Methods. Nuclear extracts of granulosa cells from H rats before and after treatment with E (HE), E and FSH (HEF), and hCG (HEF + hCG) as well as whole cell extracts from corpora lutea of pregnant rats at day 7 or 16 of gestation were used as indicated. Antibodies to ER{alpha}, ERß, SF1, C/EBP{alpha}, and C/EBPß were used (1 µl) to identify proteins binding to the DNA. Cold competitor DNA (100-fold molar excess) was also added to determine specificity of the binding reactions. A, Incubation of labeled ERE with HEF nuclear extracts resulted in a single band comprised primarily of ERß with only small amounts of ER{alpha} as indicated by the supershifts. B, ERß was equally present in H, HE, and HEF extracts but decreased in response to hCG. In contrast, ER{alpha}, but not ERß, was present in whole cell extracts of corpora lutea (CL). C, Proteins binding to labeled ERE3 probe are not ERß or ER{alpha} (not shown), SF1, or C/EBP{alpha}/ß.

 
To determine whether the amount of ERß in granulosa cells changed during follicular development, additional EMSAs were done. A protein/DNA complex of similar mobility and intensity was observed when nuclear extracts from granulosa cells of H, HE, and HEF rats were used in the assays (Fig. 6BGo, lanes 2–4). However, when extracts prepared from HEF-hCG-treated rats were used, the amount of the major protein/DNA complex decreased markedly within 4 h and was undetectable in luteal cell extracts prepared 48 h after hCG (Fig. 6BGo, lanes 5 and 6). When whole cell extracts of corpora lutea isolated on days 7 and 16 of pregnancy were used in the assay, a protein/DNA complex of similar mobility was formed (Fig. 6BGo; lanes 7 and 8). When antibodies to ERß and ER{alpha} were included in the reactions, the ERß antibody supershifted the complex formed by nuclear extracts of HE granulosa cells (Fig. 6BGo, lane 10) but not the complex formed using extracts from luteal cells (Fig. 6BGo, lane 12). Conversely, the ER{alpha} antibody supershifted the entire complex present in luteal tissue but had only a minor effect in extracts of granulosa cells (Fig. 6BGo, lanes 11 and 9, respectively). Immunofluorescent analyses of granulosa cells using the same ER antibodies verified high levels of ERß (but no detectable ER{alpha}) in nuclei of granulosa cells cultured overnight in serum-free medium (data not shown). An antibody specific for steroidogenic factor-1 (SF1) had no effect on the protein/DNA complex (data not shown). These results provide the first evidence that ERß and ER{alpha} proteins are present in ovarian cells and that the relative amount of each receptor subtype changes during differentiation. Granulosa cells contain an abundance of ERß that is capable of binding to the ERE consensus, whereas luteal cells contain ER{alpha}.

When a single-copy ERE3 oligonucleotide was used as the labeled probe, four specific protein/DNA complexes were observed using nuclear extracts of HEF granulosa cells. These complexes were competed with a 100-fold excess of cold competitor ERE3 DNA (Fig. 6CGo). However, neither the ERß antibody nor the ER{alpha} antibody (not shown) shifted the complexes. This same oligonucleotide also competed very poorly for the binding of ER to the ERE consensus DNA (10). Antibodies to SF1, which is capable of binding to an ERE half-site (CAAGGTCA), and antibodies to the CAAT enhancer-binding proteins (C/EBPß and C/EBP{alpha}; used here for nonspecific binding) also failed to shift the protein/DNA complexes. Although the ERE3 site has homology to an AP1/CRE binding site (containing CGTCA), a consensus AP1 oligonucleotide did not compete, specific antibodies to CREB (c-Jun, Jun B, and Jun D) failed to supershift the complexes, and purified CREB failed to bind the ERE3 oligonucleotide (data not shown). Mutation of the ERE3 oligonucletoide at sites that prevented forskolin inducibility of the (ERE3m)3-P-CAT vector also prevented protein/DNA complex formation (data not shown), indicating that the nucleotides critical for the protein/DNA interactions involve those that comprise the putative ERE-like site. Collectively, these data indicate that proteins other than ER are interacting with ERE3 to confer forskolin inducibility of the promoter-reporter constructs. However, the identity of these factors remains to be determined.

To characterize the proteins binding to the functional region of the distal PR promoter (21), an oligonucleotide to the GC-rich region containing putative Sp1 and C/EBP binding sites was synthesized, labeled, and used as the probe in EMSAs. Using granulosa cell nuclear extracts, several complexes were observed (Fig. 7Go). When antibodies to Sp1, C/EBP{alpha}, and C/EBPß were added to the reactions, only the Sp1 antibody caused a shift (Fig. 7AGo). When additional EMSAs were run using antibodies to either Sp1, Sp3, or the combination, Sp1 and Sp3 antibodies caused two of the complexes (denoted by arrows) to shift (denoted by small arrowheads) indicating that not only Sp1 but also Sp3 is present in granulosa cells and binds to this region of the PR promoter (Fig. 7BGo). Furthermore, recombinant Sp1 bound to this region and was shifted with the Sp1 but not an Sp3 antibody, indicating the specificity of the antibodies and their binding activities. Oligonucleotides containing mutant Sp1 sites did not compete for binding. Thus, this functional region of the distal PR promoter (Ref. 21 and data herein) binds members of the Sp1 family but does not bind C/EBP{alpha} or C/EBPß that are present in granulosa cell nuclear extracts (31).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 7. The GC-Rich Region of the Distal Promoter Binds Sp1 and Sp3 but Not C/EBP{alpha}

HEF nuclear extracts were incubated with labeled oligonucleotide spanning the functional GC-rich region of the distal promoter (21 ). A, Antibodies to Sp1, but not C/EBP{alpha} and C/EBPß, recognize proteins in the complex. B, Specific complexes are shifted by the Sp1 and Sp3 antibodies. Purified Sp1 also binds the labeled distal probe and is shifted with Sp1, but not Sp3, antibodies. Arrowheads indicate the specific supershifted bands.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Ovarian granulosa cells have been known for some time to contain nuclear E-binding proteins (24) and to require E for differentiation (4). In situ hybridization studies have recently shown that ERß is the most abundant subtype in these cells (25, 26). The bandshift assays and immunofluorescent analyses provided herein document that ERß protein is also selectively expressed in granulosa cells, whereas levels of ER{alpha} protein were much lower. The presence of these receptors combined with the fact that preovulatory follicles are the major source of E provide evidence consistent with the notion that E has a role in the induction of PR in granulosa cells as it does in other cells (13). Although this hypothesis is attractive, the effects of E on PR expression in the ovary remain elusive. The studies conducted herein reinforce the notion that the regulation of PR in granulosa cells may not be exclusively dependent on the activation of ER by its ligand. Of note, the induction of PR by LH is temporally restricted to preovulatory follicles that are already producing E but in which the LH surge rapidly terminates expression of aromatase (36, 37), biosynthesis of E (38, 39), and levels of ERß protein (figures herein). Thus, the induction of PR mRNA is occurring in follicles at a time when follicular levels of E and its receptor are being markedly reduced. Furthermore, E and specific E antagonists, such as ICI, exhibit specific temporal effects on PR induction at stages of granulosa cell differentiation that are distinct from those when PR is induced by A-kinase activators. Furthermore, vectors containing rat PR promoters, as well as vectors containing consensus ERE-regulatory regions, exhibit nonconventional responses to E and A-kinase activators when transfected into preovulatory granulosa cells. Based on these and subsequent considerations, we conclude that induction of PR by the LH surge in preovulatory granulosa cells is complex and that E (and ER) likely act via an indirect mechanism(s) rather than by a direct mechanism to activate the PR gene in granulosa cells.

The temporal expression of ERs and the biosynthesis of E provide evidence favoring an indirect mechanism for E activation of the PR gene. First, ERß mRNA has been shown to be expressed in follicles of immature rats (25, 26). Furthermore, we show herein by DNA binding studies using a consensus ERE oligonucleotide that ERß protein is present in granulosa cells of H rats before and after treatment with E and FSH. By immunofluorescent analyses, we show that ERß is localized to nuclei of granulosa cells before exposure to FSH or E. Thus, if E could directly activate the PR gene via an ERE-like sequence present in the PR promoter, E alone would be expected to induce expression of PR mRNA when added to undifferentiated granulosa cells as well as in differentiated granulosa cells. However, as shown herein, neither the addition of E to immature granulosa cells nor the addition of T to cells expressing aromatase and thereby capable of converting this androgen to E (28) was effective in inducing PR mRNA in these cells. Likewise, E alone does not induce PR in granulosa cells of small preantral follicles in H rats (our unpublished data). Taken together, these results suggest that neither the presence of ERß nor the binding of ligand to ERß is sufficient for induction of PR in granulosa cells. This is not due to a lack of response of these cells to E. E markedly increases granulosa cell proliferation (38) as well as an increase in the cell cycle regulator, cyclin D2, in granulosa cells in vivo (39). E also increases cyclin D2 mRNA in granulosa cells cultured in serum-free medium (39).

The hypothesis that E acts via an indirect mechanism to facilitate LH induction of PR is further supported by the temporal effects of E. First, T and E are important for enhancing FSH-mediated attainment of a preovulatory phenotype (4, 28, 29, 30). E can be added as late as 24 h of culture and still enhance FSH-mediated granulosa cell differentiation with subsequent induction of PR mRNA by forskolin. Second, although the antiestrogen ICI was completely ineffective in blocking the rapid (within 5 h) induction of PR mRNA by forskolin in differentiated granulosa cells, it markedly blunted the response to forskolin if present throughout the 48 h of hormone-dependent differentiation. These observations are consistent with the notion that the ability of E (and ER) to alter granulosa cell function is temporal, specific, and critically dependent on FSH and LH activation of the A-kinase pathway (4). There is no doubt that E can directly activate ER function and the expression of some genes in these cells. However, the acute induction of PR is dependent on more complex interactions involving a diverse set of putative regulatory elements present in the promoter of the PR gene. These include a CG-rich distal promoter and several ERE-like regions present in the distal and proximal promoters.

The transcriptional activation of various PR promoter-reporter constructs in granulosa cells also appears to favor an indirect effect of E and ER on PR induction by LH. Vectors shown to be induced by E in other cell types (7, 10) showed no response to E alone when transfected into granulosa cells. Specifically, when E alone was added to granulosa cells transfected with distal (P) or proximal (P') PR-CAT vectors, no induction of activity was observed. Ligation of a concatamer of an ERE-like element (ERE3; Ref. 10) to the distal promoter, (ERE3)3-P-CAT, also failed to exhibit a response to E in granulosa cells. This is in marked contrast to the inducibility of (ERE3)3-P-CAT by E alone in MCF7 cells (10). Conversely, in the absence of E, forskolin induced CAT activity in the (ERE3)3-P-CAT vector, and this activation was lost when the ERE3 site was mutated. Furthermore, the E antagonist ICI did not block forskolin-induced activation of the ERE3-P-CAT. These results indicate that the mechanism by which forskolin induces activation of these PR promoter constructs occurs independently of E in granulosa cells.

This evidence indicating that E does not regulate expression of PR directly is tempered by the unexpected but interesting observation that E alone fails to activate the ERE-E1b-CAT vector when transfected into differentiated granulosa cells. Rather this vector was induced by forskolin alone, and the forskolin-induced activity was not blocked by addition of ICI. We have shown that the consensus ERE contained within this construct binds an abundance of ERß present in granulosa cell extracts as well as ER{alpha} present in luteal cells. Thus, the ERE is a functional DNA-binding site for both ER subtypes in granulosa cells. These observations indicate that the endogenous ERß may already be occupied by small amounts of endogenous E and that activation of ligand-occupied ER in granulosa cells is dependent on a phosphorylation event. That phosphorylation of some factor within these cells is critical is highly interesting and supported by the evidence that activators of A-kinase (LH, forskolin) can induce PR in differentiated granulosa cells and that the effects of A-kinase are blocked by the A-kinase inhibitor, H89. Because cycloheximide also blocked induction of PR, we believe that de novo synthesis of some factor is also obligatory. The inducible factors remain unknown. They are unlikely to be the ER subtypes since ERß mRNA (25, 26) and protein (figures herein) are present in preovulatory granulosa cells and decrease after exposure to ovulatory levels of LH/hCG. Although we shown herein that Sp1 and Sp3 bind to the distal promoter, these factors are not hormonally regulated in granulosa cells (40). Rather, they are expressed at elevated levels during follicular development and in corpora lutea (40). Although C/EBPß was a likely candidate to be the LH-inducible factor (31), we could not detect binding of C/EBPß to the GC-rich region of the distal PR promoter that has been shown herein and elsewhere to be regulated by cAMP (21). Furthermore, the distal region by itself gave only a marginal response to LH. Therefore, it would appear that factors binding to the distal region (Sp1/Sp3) must interact with factors binding to the ERE3 site to confer maximal activity.

Activators of A-kinase may lead to the phosphorylation of a specific coactivator or another transcription factor obligatory for the induction of PR. CBP and SRC-1 both are capable of being phosphorylated by A-kinase (41, 42). Therefore, the function of ER bound to an ERE site or another site may be dependent on the phosphorylation of these or related coactivators. In addition, we show herein that Sp1/Sp3 is present in granulosa cell extracts and bind to the GC-rich region of the distal promoter of the PR gene. Sp1/Sp3 have recently been shown to be expressed at high levels in granulosa cells and to confer cAMP inducibility to a number of genes expressed in ovarian cells (40). These include the serum and glucocorticoid-inducible kinase, Sgk (40); cholesterol side-chain cleavage cytochrome P450, P450scc (43); and the cell cycle-inhibitory protein, p21CIP (44). Because a single copy of the consensus ERE and three copies of ERE3 enhanced expression of the distal promoter, it is attractive to postulate that the Sp1/Sp3-binding site in the distal promoter needs to interact with additional, adjacent regulatory mechanisms to confer cAMP inducibility to the promoter. Most recently, ER has been shown to bind to Sp1 and increase its DNA and transactivation potential in the absence of an ER DNA-binding site (45). Thus, one explanation that combines a role for ER and A-kinase on the PR promoter would be that ER binds Sp1 and that A-kinase phosphorylates either one of these factors or an additional coactivator or coregulator (CBP?) to enhance transcription.

These observations raise an intriguing question: Of what physiological significance is the obligatory requirement of A-kinase (phosphorylation?) for activation of putative ER-regulated genes in ovarian cells? The absence of a direct effect of E on genes, such as PR, in granulosa cells may have evolved to ensure that PR is not induced prematurely in the E-producing, estrogen-enriched milieu of the preovulatory follicle. Rather, induction of PR may only occur when E coming from the preovulatory follicle elicits the LH surge. If the ERE-like regions in the PR promoter bind AP1-related factors, this may be particularly relevant. Recent studies have shown that in the presence of E or diethylstilbestrol, the ERß subtype is a negative regulator of ER action via AP1-responsive elements (46). Conversely, antiestrogens are positive regulators in these same vectors (46). Thus, in the developing follicle, ERß may inhibit ER action in promoters with AP1 response elements while favoring activation of promoters with EREs. A secondary level of control may involve the level and sites of phosphorylation of ER. The effect of the LH surge may also be to shift the balance from the predominantly ERß granulosa cell to the ER{alpha}-containing luteal cell. ER{alpha}, unlike ERß, can enhance activity on the AP1 regions in the presence of E or antiestrogens (46). Alternatively, recent studies have shown that ER can facilitate the functional activity of Sp1 (45). Thus, phosphorylation of Sp1 or ER may be required for their interactions, and this may occur independently of E. ERß may exert specific and critical functions in tissues that express aromatase and have high endogenous levels of E. Collectively, the results of this study indicate that activation of the A-kinase pathway leads to the phosphorylation of some transcription factor(s) other than, or in addition to, ER that is (are) essential for transactivation of the PR gene and that this mechanism is selectively activated in granulosa cells of preovulatory follicles.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reagents
Media and cell culture reagents and materials were purchased from GIBCO (Grand Island, NY), Sigma (St. Louis, MO), Research Organics (Cleveland, OH), Fisher Scientific (Fairlawn, NJ) Corning (Corning, NY) and Hyclone (Logan UT). Trypsin, soybean trypsin inhibitor, deoxyribonuclease (DNAse), PMA, E, propylene glycol, and mineral oil were all purchased from Sigma. Ovine FSH (oFSH-16) and LH (oLH-23) were gifts of the National Hormone and Pituitary Program (Rockville, MD). Human CG (hCG) was from Organon Special Chemicals (West Orange, NJ). GnRH, Calphostin C, and Nonidet-40 (NP-40) were obtained from Calbiochem (La Jolla, CA). ICI 164,384 was provided by Dr. Alan Wakeling (Zeneca Pharmaceuticals, Macclesfield, UK). Cycloheximide was purchased form Nutritional Biochemicals (Cleveland, OH); H89 was acquired from Seigagaku America (Rockville, MD); T and E for tissue culture were purchased from Steraloids (Keene, NH). Bryostatin was provided by Dr. Alan Fields (Case Western Reserve University, Cleveland, OH). Electrophoresis and molecular biology grade reagents were purchased from Sigma, Bio-Rad (Richmond, CA), and Boehringer Mannheim Biochemicals (Indianapolis, IN). Oligonucleotides were purchased from Genosys (The Woodlands, TX). All RT-PCR reagents were from Promega (Madison, WI) except for deoxyribonucleotides (dNTPs; Boehringer Mannheim). {alpha}-32P[dCTP] was from ICN Radiochemicals (Costa Mesa, CA). Hyperfilm was purchased from Amersham (Arlington Heights, IL). [C14]chloramphenicol was purchased from Amersham, and acetyl coenzyme A was obtained from Pharmacia (Piscataway, NJ).

Animals
Intact and hypophysectomized immature (day 25 of age) Holtzman Sprague-Dawley female rats (Harlan, Indianapolis, IN) were housed under a 16-h light, 8-h dark schedule in the Center for Comparative Medicine at Baylor College of Medicine (Houston, TX) and provided food and water ad libitum. Animals were treated in accordance with the NIH Guide for the Care and Use of Laboratory Animals, as approved by the Animal Care and Use Committee at Baylor College of Medicine.

Granulosa Cell Cultures
Granulosa cells were harvested from untreated immature rats or from E-primed rats as previously described (27, 28) and as indicated in Results and figure legends. Cells were cultured at a density of 1 x 106 cells per 3 ml serum free medium (DMEM:F12 containing penicillin and streptomycin) in multiwell (35-mm) dishes that were serum coated. Hormones, agonists, antagonists, and inhibitors were added as indicated in the figure legends.

RNA Isolation and RT-PCR Assays
Cytoplasmic RNA was isolated from cultured cells with a buffer containing 1% NP-40 (28). Each RNA sample was pooled from three replicate wells. The RNA was purified by sequential phenol, phenol-chloroform, and chloroform extraction, followed by ethanol precipitation. The RNA was resuspended in 0.1% diethylpyrocarbamate-treated water, and its concentration was determined by absorbance at 260 nm.

RT-PCR reactions were performed as previously described (47) using specific primer pairs for rat PR (forward, 5'-CCCACAGGAGTTTGTCAAGCT-3' and reverse 5'-TAACTTCAGACATCATTCCGG-3') (1, 6) and the ribosomal protein L19 (1, 6). The amplified cDNA products were resolved by acrylamide gel electrophoresis, and radioactivity/PCR product band was quantified on a Betascope 603 Blot Analyzer (Betagen Corp., Mountain View, CA). Data are presented as the ratio of radioactivity in the PR and L19 bands.

Transfections
The rat PR promoter-CAT reporter constructs analyzed in these studies have been used previously in other cell types (7, 10) and are shown in Fig. 6Go. For transfections, granulosa cells were harvested from E-primed immature rats and cultured in the presence of FSH (50 ng/ml) and T (10 ng/ml) for 48 h, conditions that permit transactivation of the endogenous PR gene by hormones and forskolin (2, 4). The cells were transiently transfected using 4.78 pmol plasmid/well and the calcium phosphate precipitation method (33, 34). Four hours later, the DNA was removed, and the cells were washed and cultured in the presence or absence of 7.5 µM forskolin for 5 h. At that time, the cells were lysed by freeze-thaw procedure, and cytosolic protein concentrations were determined by the mini-Bradford assay (Bio-Rad). CAT activity in the extracts was analyzed using 30 µg protein and an 18-h incubation according to a standard protocol (33, 34). The amount of radioactivity in the substrate and acetylated products after chromatographic separation was determined by the Betascope 603 Blot Analyzer. Transfections of each plasmid were done in triplicate, and at least three replicate experiments were performed. Data are expressed as the mean ± SEM.

EMSAs
Oligonucleotides to specific regions of the PR promoter were synthesized, annealed, and labeled according to routine procedures (33, 34). The double-stranded oligonucleotides included:

1. The GC-rich region of the distal promoter (Distal: 5'-AGGTCTAGCCAGTGATTGGCTAGGGAGGGGCTTTGGGCGGGCCTTCCTAGAGC and reverse AGGGCTCTAGGAAGGCCCGCCCAAAGCCCTCCCTAGCCAATCACTGGCTAGA);

2. The ERE3 region of the proximal promoter (ERE3: 5'-AGGTCTCGGGTCGTCATGACTGAGCT and reverse AGGAGCTCAGTCATGACGACCCGAGA as well as

3. An ERE consensus from the vitellogenin B1 gene (EREcon: 5'-AGGCAAAGTCAGGTCACAGTGACCTGATCAAAGA and reverse AGGTCTTTGATCAGGTCACTGTGACCTGACTTTG.

Oligonucleotides were incubated with nuclear extracts or whole cell extracts prepared from granulosa cells of hypophysectomized (H) rats treated sequentially with E (HE), FSH (HEF), and hCG (HEF + hCG) as previously described (33, 34, 35). Extracts were also prepared from corpora lutea isolated from the ovaries of pregant rats on days 7 and 16 of gestation. After 20 min at room temperature, the binding reactions were subjected to nondenaturing electrophoresis (0.5% Tris-borate-EDTA) at 150 V. Where indicated, specific antibodies against nuclear proteins were added to the reactions for 30 min on ice before the addition of labeled DNA. The antibodies used were specific for ER{alpha} (Santa Cruz Biotechnology, Santa Cruz, CA) and ERß (Affinity Bioreagents, Golden, CO), c-fos (Oncogene Science Inc, Manhasset, NY), pan-Jun (Oncogene), SF1 (Dr. Ken Morohashi, National Institute for Basic Biology, Okazaki, Japan), CAAT enhancer binding proteins, C/EBP{alpha} and C/EBPß (Dr. Valerie Poli, Instituto di Ricerche, Rome, Italy), and stimulatory proteins, Sp1 and Sp3 (Promega, Madison, WI).

Immunocytochemistry
Granulosa cells from E-primed immature rats were cultured as above on glass coverslips for varying times in the presence or absence of FSH or forskolin. Cells were processed for immunocytochemistry as described previously (33). Briefly, cells were fixed in fresh 4% paraformaldehyde (Electron Microscopy Sciences, Fort Washington, PA) in PBS for 30 min at room temperature, washed in 10 mM glycine in PBS and PBS. The fixed cells were either stored at 4 C. The cells were permeabilized with 0.5% NP-40 in PBS for 10 min and then blocked with 4% BSA in PBS for 1 h at room temperature. The cells were incubated at 4 C for 18 h with specific antibodies diluted 1:500 in 4% BSA in PBS. After several PBS washes, cells were incubated with flourescein-labeled goat anti-rabbit IgG (1:20, Pierce, Rockford, IL) in 4% BSA in PBS for 1 h at room temperature. ERß and ER{alpha} were visualized on a Zeiss Axiophot microscope (Carl Zeiss, Thornwood, NY).

Statistical Analyses
RT-PCR and transfection data were analyzed by ANOVA. Values represent the mean ± SEM for at least three experiments and were considered significantly different if P < 0.05.


    FOOTNOTES
 
Address requests for reprints to: JoAnne S. Richards, Department of Cell Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030. E-mail: joanner{at}bcm.tmc.edu

Supported in part by NIH Grants HD-16229 (J.S.R.) and CA-18119 and US Army Grant DAMD-17-J-4205 (B.S.K.).

1 Current address: Department of Biological Sciences, Duquesne University, Pittsburg, Pennsylvania 15282. Back

2 Current address: Department of Biology, University of California San Diego, La Jolla, California 92093. Back

Received for publication February 18, 1998. Revision received April 15, 1998. Accepted for publication April 30, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Park O-K, Mayo K 1991 Transient expression of progesterone receptor messenger RNA in ovarian granulosa cells after the preovulatory luteinizing hormone surge. Mol Endocrinol 5:967–978[Abstract/Free Full Text]
  2. Natraj U, Richards JS 1993 Hormonal regulation, localization and functional activity of the progesterone receptor in granulosa cells of rat preovulatory follicles. Endocrinology 133:761–769[Abstract/Free Full Text]
  3. Lydon JP, De Mayo F, Funk CR, Mani SK, Hughes AR, Montgomery CA, Shyamala G, Conneely OM, O’Malley BW 1995 Mice lacking progesterone receptor exhibit reproductive abnormalities. Genes Dev 9:2266–2278[Abstract/Free Full Text]
  4. Richards JS 1994 Hormonal control of gene expression in the ovary. Endocr Rev 15:725–751[Abstract/Free Full Text]
  5. Schrader WT, O’Malley BW 1972 Progesterone-binding components of chick oviduct. IV. Characterization of purified subunits. J Biol Chem 247:51–59[Abstract/Free Full Text]
  6. Park-Sarge O-K, Parmer TG, Gibori G 1995 Does the rat corpus luteum express the progesterone receptor gene? Endocrinology 136:1537–1543[Abstract]
  7. Kraus WL, Montano MM, Katzenellenbogen BS 1993 Cloning of the rat progesterone receptor gene 5'-region and identification of two functionally distinct promoters. Mol Endocrinol 7:1603–1616[Abstract/Free Full Text]
  8. Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P 1990 Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B EMBO J 9:1603–1614[Medline]
  9. Misrahi M, Loosfelt H, Atger M, Meriel C, Zerah V, Dessen P Milgrom E 1988 Organization of the entire rabbit progesterone receptor mRNA and of the promoter and 5' flanking region of the gene. Nucleic Acids Res 16:5459–5472[Abstract/Free Full Text]
  10. Kraus WL, Montano MM, Katzenellenbogen BS 1994 Identification of multiple, widely spaced estrogen-responsive regions in the rat progesterone receptor gene. Mol Endocrinol 8:952–969[Abstract/Free Full Text]
  11. Tung L, Mohamed MK, Hoeffler JP, Takimoto GS, Horwitz KB 1993 Antagonist-occupied human progesterone B-receptors activate transcription without binding to progesterone response elements and are dominantly inhibited by A-receptors. Mol Endocrinol 7:1256–1265[Abstract/Free Full Text]
  12. Vegeto E, Shahbaz MM, Wen DX, Goldman ME, O’Malley BW, McDonnell DP 1993 Human progesterone receptor A form is cell and promoter-specific repressor of human progesterone receptor B function. Mol Endocrinol 7:1244–1255[Abstract/Free Full Text]
  13. Clark JH, Mani SK 1994 Actions of ovarian steroid hormones, In: Knobil E, Neill JD (eds) The Physiology of Reproduction. Raven Press, New York, pp 1011–1059
  14. Espey LL, Lipner H 1994 Ovulation. In: Knobil E, Neill JD (eds) The Physiology of Reproduction, ed. 2. Raven Press, New York, pp 725–780
  15. Espey LL 1980 Ovulation as an inflammatory reaction— a hypothesis. Biol Reprod 22:73–106[CrossRef][Medline]
  16. Schott DR, Shyamala G, Schneider W, Parry G 1991 Molecular cloning, sequence analysis and expression of complementary DNA encoding murine progesterone receptor. Biochemistry 30:7014–7020[CrossRef][Medline]
  17. Chang T-C, Nardulli AM, Lew D, Shapiro DJ 1992 the role of estrogen response elements in expression of the Xenopus laevis vitellogenin B1 gene. Mol Endocrinol 6:346–354[Abstract/Free Full Text]
  18. Ince BA, Montano MM, Katzenellenbogen BS 1994 Activation of transcriptionally inactive human estrogen receptors by cyclic adenosine 3',5'-monophosphate and ligands including anitestrogens. Mol Endocrinol 8:1397–1406[Abstract/Free Full Text]
  19. Kato S, Endoh H, Masuhiro Y, Kitamoto T, Uchiyama S, Sasaki H, Masushige S, Gotoh Y, Nishida E, Kawashima H, Metzger D, Chambon P 1995 Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science 270:1491–1494[Abstract/Free Full Text]
  20. El-Tanani MKK, Green CD 1997 Two separate mechanisms for ligand-independent activation of the estrogen receptor. Mol Endocrinol 11:928–937[Abstract/Free Full Text]
  21. Park-Sarge O-K, Sarge KD 1995 Cis-regulatory elements conferring cyclic 3',5'-adenosine monophosphate responsiveness of the progesterone receptor in transfected rat granulosa cells. Endocrinology 136:5430–5437[Abstract]
  22. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin S-C, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414[CrossRef][Medline]
  23. Smith CL, Onate SA, Tsai M-J, O’Malley BW 1996 CREB binding protein act synergistically with steroid receptor coactivator-1 to enhance steroid receptor-dependent transcription. Proc Natl Acad Sci USA 93:8884–8888[Abstract/Free Full Text]
  24. Richards JS 1975 Estradiol receptor content in rat granulosa cells during follicular development:modification by estradiol and gonadotropins. Endocrinology 97:1174–1184[Abstract/Free Full Text]
  25. Kuiper GGM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson J-A 1996 Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  26. Byers M, Kuiper GGJM, Gustafsson J-A, Park-Sarge O-K 1997 Estrogen receptor-ß mRNA expression in rat ovary:down regulation by gonadotropins. Mol Endocrinol 11:172–182[Abstract/Free Full Text]
  27. Ratoosh SL, Lifka J, Hedin L, Jahnsen T, Richards JS (1987) Hormonal regulation of the synthesis and m RNA content of the regulatory subunit of cyclic AMP-dependent protein kinase type II in cultured granulosa cells. J Biol Chem 262:7306–7313
  28. Fitzpatrick SL, Richards JS (1991) Regulation of cytochrome P 450 aromatase messenger ribonucleic acid and activity by steroids and gonadotropins in rat granulosa cells. Endocrinology 129:1452–1462
  29. Segaloff DL, Wang H, Richards JS 1990 Hormonal regulation of LH/CG receptor mRNA in rat ovarian cells during follicular development and luteinization. Mol Endocrinol 4:1856–1865[Abstract/Free Full Text]
  30. Sirois J, Simmons DL, Richards JS 1992 Hormonal regulation of messenger ribonucleic acid encoding a novel isoform of prostaglandin endoperoxide H synthase in rat preovulatory follicles. J Biol Chem 267:11586–11592[Abstract/Free Full Text]
  31. Sirois J, Levy LO, Simmons DL, Richards JS 1993 Characterization and hormonal regulation of the promoter of the rat prostaglandin endoperoxide synthase 2 gene in granulosa cells. J Biol Chem 286:12199–1220
  32. Smith CL, Onate SA, Tsai M-J, O’Malley BW 1996 CREB binding protein acts synergistically with steroid receptor coactivator-1 to enhance steroid receptor-dependent transcription. Proc Natl Acad Sci USA 93:8884–8888
  33. Carlone DL, Richards JS 1997 Functional interactions, phosphorylation and levels of 3',5'-cyclic adenosine monophosphate-regulatory element binding protein and steroidogenic factor-1 mediate hormone-regulated and constitutive expression of aromatase in gonadal cells. Mol Endocrinol 11:292–304[Abstract/Free Full Text]
  34. Fitzpatrick SL, Richards JS 1994 Identification of a cyclic adenosine 3',5'-monophosphate response element in the rat aromatase promoter that is required for transcriptional activation in rat granulosa cells and R2C Leydig cells. Mol Endocrinol 8:1309–1319[Abstract/Free Full Text]
  35. Russell DL, Norman RL, Dajee M, Liu X, Henninghausen L, Richards JS 1996 Prolactin-induced activation and binding of Stat proteins to the IL-6RE of the {alpha}2-macroglobulin ({alpha}2M) promoter in the rat ovary. Biol Reprod 55:1029–1038[Abstract]
  36. Hickey GJ, Chen S, Besman MJ, Shively JE, Hall PF, Gaddy-Kurten D, Richards JS 1988 Hormonal regulation, tissue distribution and content of aromatase cytochrome P 450 messenger ribonucleic acid and enzyme activity in rat ovarian follicles and corpora lutea: relationship to estradiol biosynthesis. Endocrinology 122:1426–1436[Abstract/Free Full Text]
  37. Fitzpatrick SL, Carlone DL, Robker RL, Richards JS 1997 Expression of aromatase in the ovary:down-regulation of mRNA by the ovulatory luteinizing hormone surge. Steroids 62:197–206[CrossRef][Medline]
  38. Rao MC, Midgley Jr AR, Richards JS 1978 Hormonal regulation of ovarian cellular proliferation. Cell 14:71–78[CrossRef][Medline]
  39. Robker RL, Richards JS 1998 Hormone-induced proliferation and differentiation of granulosa cells: a coordinated balance of the cell cycle regulators cyclin D2 and p27KIP1. Mol Endocrinol 12:924–940[Abstract/Free Full Text]
  40. Alliston T, Richards JS 1997 Hormonal regulation of serum and glucocorticoid regulated kinase, Sgk, in rat granulosa cells: role of Sp1 in FSH action. Mol Endocrinol 11:1934–1949[Abstract/Free Full Text]
  41. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin S-C, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414
  42. Rowan BG, Weigel NL, O’Malley BW, Phosphorylation of chicken progesterone receptor and steroid receptor coactivator-1 during ligand-independent activation by 8-bromo-cAMP. Program of the 79th Annual Meeting of The Endocrine Society, Minneapolis MN, 1997 (Abstract OR23–5)
  43. Liu A, Simpson ER 1997 Steroidogenic factor 1 and Sp1 are required for regulation of bovine CYP11A gene expression in bovine luteal cells and adrenal Y1 cells. Mol Endocrinol 11:127–137[Abstract/Free Full Text]
  44. Prowse DM, Bolgan L, Molnar, Dotto GP 1997 Involvement of the Sp3 transcription factor in induction of p21CIP1/KIP1 in keratinocyte differentiation. J Biol Chem 272:1308–1314[Abstract/Free Full Text]
  45. Porter W, Saville B, Hoivik D, Safe S 1997 Functional synergy between the transcription factor Sp1 and the estrogen receptor. Mol Endocrinol 11:1569–1580[Abstract/Free Full Text]
  46. Paech K, Webb P, Kuiper GGJM, Nilsson S, Gustafsson J-A, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  47. Orly J, Rei Z, Greenberg N, Richards JS 1994 Tyrosine kinase inhibitor AG18 arrests follicle-stimulating hormone-induced granulosa cell differentiation: use of reverse transcriptase-polymerase chain reaction assay for multiple messenger ribonucleic acids. Endocrinology 134:2336–2346[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
B. J. Deroo, K. F. Rodriguez, J. F. Couse, K. J. Hamilton, J. B. Collins, S. F. Grissom, and K. S. Korach
Estrogen Receptor {beta} Is Required for Optimal cAMP Production in Mouse Granulosa Cells
Mol. Endocrinol., July 1, 2009; 23(7): 955 - 965.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Kim, I. C. Bagchi, and M. K. Bagchi
Signaling by Hypoxia-Inducible Factors Is Critical for Ovulation In Mice
Endocrinology, July 1, 2009; 150(7): 3392 - 3400.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
P. de Cremoux, D. Rosenberg, J. Goussard, C. Bremont-Weil, F. Tissier, C. Tran-Perennou, L. Groussin, X. Bertagna, J. Bertherat, and M.-L. Raffin-Sanson
Expression of progesterone and estradiol receptors in normal adrenal cortex, adrenocortical tumors, and primary pigmented nodular adrenocortical disease
Endocr. Relat. Cancer, June 1, 2008; 15(2): 465 - 474.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Kim, M. Sato, Q. Li, J. P. Lydon, F. J. DeMayo, I. C. Bagchi, and M. K. Bagchi
Peroxisome Proliferator-Activated Receptor {gamma} Is a Target of Progesterone Regulation in the Preovulatory Follicles and Controls Ovulation in Mice
Mol. Cell. Biol., March 1, 2008; 28(5): 1770 - 1782.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
D. L. Russell and R. L. Robker
Molecular mechanisms of ovulation: co-ordination through the cumulus complex
Hum. Reprod. Update, May 1, 2007; 13(3): 289 - 312.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. M. Bryant, M. A. Gibson, and M. A. Shupnik
Stimulation of the Novel Estrogen Receptor-{alpha} Intronic TERP-1 Promoter by Estrogens, Androgen, Pituitary Adenylate Cyclase-Activating Peptide, and Forskolin, and Autoregulation by TERP-1 Protein
Endocrinology, January 1, 2006; 147(1): 543 - 551.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. F. Couse, M. M. Yates, B. J. Deroo, and K. S. Korach
Estrogen Receptor-{beta} Is Critical to Granulosa Cell Differentiation and the Ovulatory Response to Gonadotropins
Endocrinology, August 1, 2005; 146(8): 3247 - 3262.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. Gava, C. L. Clarke, K. Byth, R. L. Arnett-Mansfield, and A. deFazio
Expression of Progesterone Receptors A and B in the Mouse Ovary during the Estrous Cycle
Endocrinology, July 1, 2004; 145(7): 3487 - 3494.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. Sriraman and J. S. Richards
Cathepsin L Gene Expression and Promoter Activation in Rodent Granulosa Cells
Endocrinology, February 1, 2004; 145(2): 582 - 591.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J.-Y. Park, F. Richard, S.-Y. Chun, J.-H. Park, E. Law, K. Horner, S-L C. Jin, and M. Conti
Phosphodiesterase Regulation Is Critical for the Differentiation and Pattern of Gene Expression in Granulosa Cells of the Ovarian Follicle
Mol. Endocrinol., June 1, 2003; 17(6): 1117 - 1130.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
V. Sriraman, S. C. Sharma, and J. S. Richards
Transactivation of the Progesterone Receptor Gene in Granulosa Cells: Evidence that Sp1/Sp3 Binding Sites in the Proximal Promoter Play a Key Role in Luteinizing Hormone Inducibility
Mol. Endocrinol., March 1, 2003; 17(3): 436 - 449.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H. Schwarzenbach, P. R. Manna, D. M. Stocco, G. Chakrabarti, and A. K. Mukhopadhyay
Stimulatory Effect of Progesterone on the Expression of Steroidogenic Acute Regulatory Protein in MA-10 Leydig Cells
Biol Reprod, March 1, 2003; 68(3): 1054 - 1063.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. J. Phillips, J. Bailey, S. C. Robson, and G. N. Europe-Finner
Differential Expression of the Adenylyl Cyclase-Stimulatory Guanosine Triphosphate-Binding Protein Gs{alpha} in the Human Myometrium during Pregnancy and Labor Involves Transcriptional Regulation by Cyclic Adenosine 3',5'-Monophosphate and Binding of Phosphorylated Nuclear Proteins to Multiple GC Boxes within the Promoter
J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5675 - 5685.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Sathya, M. S. Jansen, S. C. Nagel, C. E. Cook, and D. P. MCDonnell
Identification and Characterization of Novel Estrogen Receptor-{beta}-Sparing Antiprogestins
Endocrinology, August 1, 2002; 143(8): 3071 - 3082.
[Abstract] [Full Text] [PDF]


Home page
Recent Prog Horm ResHome page
J. S. Richards, D. L. Russell, S. Ochsner, M. Hsieh, K. H. Doyle, A. E. Falender, Y. K. Lo, and S. C. Sharma
Novel Signaling Pathways That Control Ovarian Follicular Development, Ovulation, and Luteinization
Recent Prog. Horm. Res., January 1, 2002; 57(1): 195 - 220.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
K. M. Waters, S. Safe, and K. W. Gaido
Differential Gene Expression in Response to Methoxychlor and Estradiol through ER{alpha}, ER{beta}, and AR in Reproductive Tissues of Female Mice
Toxicol. Sci., September 1, 2001; 63(1): 47 - 56.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Guo, L. Savage, K. D. Sarge, and O.-K. Park-Sarge
Gonadotropins Decrease Estrogen Receptor-{beta} Messenger Ribonucleic Acid Stability in Rat Granulosa Cells
Endocrinology, June 1, 2001; 142(6): 2230 - 2237.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. S. Richards
New Signaling Pathways for Hormones and Cyclic Adenosine 3',5'-Monophosphate Action in Endocrine Cells
Mol. Endocrinol., February 1, 2001; 15(2): 209 - 218.
[Abstract] [Full Text]


Home page
Mol Hum ReprodHome page
J.-I. Park, W.-J. Kim, L. Wang, H.-J. Park, J. Lee, J.-H. Park, H.-B. Kwon, A. Tsafriri, and S.-Y. Chun
Involvement of progesterone in gonadotrophin-induced pituitary adenylate cyclase-activating polypeptide gene expression in pre-ovulatory follicles of rat ovary
Mol. Hum. Reprod., March 1, 2000; 6(3): 238 - 245.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. L. O’Brien, K. Park, Y. In, and O.-K. Park-Sarge
Characterization of Estrogen Receptor-{beta} (ER{beta}) Messenger Ribonucleic Acid and Protein Expression in Rat Granulosa Cells
Endocrinology, October 1, 1999; 140(10): 4530 - 4541.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
C. L. Chaffin, R. L. Stouffer, and D. M. Duffy
Gonadotropin and Steroid Regulation of Steroid Receptor and Aryl Hydrocarbon Receptor Messenger Ribonucleic Acid in Macaque Granulosa Cells during the Periovulatory Interval
Endocrinology, October 1, 1999; 140(10): 4753 - 4760.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
J. J. Brosens, N. Hayashi, and J. O. White
Progesterone Receptor Regulates Decidual Prolactin Expression in Differentiating Human Endometrial Stromal Cells
Endocrinology, October 1, 1999; 140(10): 4809 - 4820.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
S. C. Sharma, J. W. Clemens, M. D. Pisarska, and J. S. Richards
Expression and Function of Estrogen Receptor Subtypes in Granulosa Cells: Regulation by Estradiol and Forskolin
Endocrinology, September 1, 1999; 140(9): 4320 - 4334.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
I. J. Gonzalez-Robayna, T. N. Alliston, P. Buse, G. L. Firestone, and J. S. Richards
Functional and Subcellular Changes in the A-Kinase-Signaling Pathway: Relation to Aromatase and Sgk Expression during the Transition of Granulosa Cells to Luteal Cells
Mol. Endocrinol., August 1, 1999; 13(8): 1318 - 1337.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
S. L. Fitzpatrick, J. M. Funkhouser, D. M. Sindoni, P. E. Stevis, D. C. Deecher, A. R. Bapat, I. Merchenthaler, and D. E. Frail
Expression of Estrogen Receptor-{beta} Protein in Rodent Ovary
Endocrinology, June 1, 1999; 140(6): 2581 - 2591.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
D. W. Schomberg, J. F. Couse, A. Mukherjee, D. B. Lubahn, M. Sar, K. E. Mayo, and K. S. Korach
Targeted Disruption of the Estrogen Receptor-{alpha} Gene in Female Mice: Characterization of Ovarian Responses and Phenotype in the Adult
Endocrinology, June 1, 1999; 140(6): 2733 - 2744.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. L. Robker, D. L. Russell, L. L. Espey, J. P. Lydon, B. W. O'Malley, and J. S. Richards
Progesterone-regulated genes in the ovulation process: ADAMTS-1 and cathepsin L proteases
PNAS, April 25, 2000; 97(9): 4689 - 4694.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clemens, J. W.
Right arrow Articles by Richards, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clemens, J. W.
Right arrow Articles by Richards, J. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals