Molecular Endocrinology 12 (9): 1334-1342
Copyright © 1998 by The Endocrine Society
Definition of a Negative Modulation Domain in the Human Progesterone Receptor
Barbara Huse,
Stefano Brenz Verca,
Patricia Matthey and
Sandro Rusconi
Biochemistry Institute Université de Fribourg,
Pérolles CH-1700 Fribourg, Switzerland
 |
ABSTRACT
|
|---|
The progesterone receptor (PR) occurs in two
major forms, the full-length PRB and the amino-truncated PRA, which
lacks 164 amino-terminal residues. PRB functions as a strong
transcriptional activator of progesterone-responsive genes, whereas PRA
is inactive in several cell types where it may even act as a
trans-dominant repressor of PRB and other steroid
receptors, like the glucocorticoid receptor or, reportedly, the
estrogen receptor. We initially observed that a PR deleted of its
entire amino domain (PR538-C) is incapable of
trans-repressing PRB or glucocorticoid receptor,
suggesting that a negative modulation domain must be contained in the
region between position 165 and 538. After testing progressive deletion
mutants and chimeras, we demonstrate that this negative modulating
domain is confined within 120 residues in the amino-terminal region and
that it contains a subdomain of 40 residues that is crucial for
intermolecular transrepression. Duplication, deletion, and
transplantation of the negative modulation domain show that the
negative modulation domain has only a limited functional autonomy. In
our hands, transrepression of estrogen receptor could not be
substantiated, and, under our conditions, at least an equimolar
concentration of PRA expression plasmid is required for
transrepression. Our deletion studies reveal domains that correlate
with strong homology patches between the amino-terminal domains of
mammalian and avian PR.
 |
INTRODUCTION
|
|---|
The progesterone receptor (PR) is a member of the nuclear receptor
family, which is activated by diverse ligands such as steroids, thyroid
hormones, and retinoids (Ref. 1 and references therein). These
receptors act as transcriptional factors that regulate gene expression
positively or negatively by interacting with cognate DNA sequences.
Like all nuclear receptors, the PR can be subdivided in several
functional regions such as the domains responsible for DNA binding
[DNA-binding domain (DBD) and hormone-binding domain (HBD) (1, 2)].
Several distinct transactivating regions (AF) have been identified in
the PR (Fig. 1A
, top). The principal ones are the AF1 located at the
N-terminal domain and the AF2 within the HBD (3, 4). More recent works
pointed to a third domain (referred to as AF3 in Fig. 1A
, top) that has been positioned within the first 164
N-terminal amino acids of the PRB form (6) and to a weaker activation
domain overlapping the DBD [that we indicated as AF? (5)].

View larger version (22K):
[in this window]
[in a new window]
|
Figure 1. Effector and Reporter Constructs
A, Progressive deletion mutants. The full-length PR is 933 aa long.
AF1, AF2, AF?, and AF3 are transcription activation domains (see text);
DBD, hatched box; HBD, black box with white
dots. The numbers in the different clone names
indicate the position of the first intact PR residue, while C indicates
that the cDNA extends to encode the natural carboxy terminus. PRB and
PRA ( PRA165-C) are the naturally occurring PR forms. B, Internal
duplication and deletion mutants. In PR2xP a segment of 157 aa
encompassing the P element (positive modulation domain) is
duplicated; in PR2xN the N element (negative modulation domain), within
aa 307 and 427, is duplicated; in PR N the N element is deleted. C,
PR/GR chimeras. The chimeras have the N-terminal domain from the PR and
the HBD from the GR (black rectangle). GRAF1, GRAF2, and
GRAF3 indicate the position of the established transcriptional
activator domains of the GR. D, Reporter plasmids. The MMTV-OVEC
contains the MMTV-long terminal repeat segments at promoter position
(28 ). In EREa-OVEC (line 21) we inserted two copies of a vitellogenin
estrogen response element (17 ) in the promoter region; this reporter
also possessed an SV40 enhancer located downstream
(SV40). The EREb-OVEC contains four tandem copies of the
ER-binding side described by Wen et al. (10 ) (see
Materials and Methods). CMV-ref (line 23) has been used
to standardize transfection and assays conditions and gives a shorter
S1-protected signal (see Materials and Methods and Ref.
16). The construct G4-HTH-OVEC (nr 24) was used to test the in
vivo DNA-binding capacity of relevant PR constructs. Symbols
for G4-HTH-OVEC: G4, four tandem GAL4-binding elements (solid
rectangles); HTH, TATA-box (rectangle marked
T) flanked by adjacent HREs (double solid triangles)
of the consensus sequence AGAACAnnnTGTTCT. Docking of an HRE-binding
factor disturbs correct transcriptional initiation in these promoters.
For further details, see text, Materials and Methods,
and legend of Fig. 4 .
|
|
PR naturally occurs in two distinct forms, the full-length PRB and the
amino-truncated PRA (called PRA165-C, Fig. 1A
, line 4), which is
missing 164 amino-terminal amino acids (aas). Two distinct
estrogen-regulated promoters are responsible for the synthesis of
isoform A and isoform B, and it has been shown that the two isoforms
differently activate transcription from target gene promoters (7, 8).
When tested on transiently transfected PR-responsive reporters, the
shorter isoform, PRA, is not an efficient transactivator in many cell
lines, as for example in HeLa cells. In cell lines where it does not
transactivate, PRA blocks induction by the larger isoform PRB (9, 10, 11, 12)
as well as other steroid receptors such as glucocorticoid receptor (GR)
or, reportedly, even the estrogen receptor (ER) (10, 13). Given our
recent work on the mechanism of trans-dominant repression by
natural or mutated steroid receptors (14, 15), we were particularly
intrigued by the reported properties of PRA, and we decided to compare
it with other repressors in our laboratory. To this end we dissected
the amino terminus of the PR and analyzed the transacting properties of
progressive deletions and duplications. Our results have allowed a
clear identification of a positive (P) and a negative (N) modulation
domain. Both the P and the N domains exhibit a marked cell
type-dependent function, implicating the involvement of cellular
factors in their action mechanism. We could narrow down the crucial
regions for the P and the N domain to about 44 and 40 residues,
respectively. These regions correspond to conserved homology patches
between chick and mammalian PR.
 |
RESULTS
|
|---|
Figure 1
illustrates the DNA constructs used for this work. We
assembled expression vectors encoding progressive deletion mutants to
characterize the different modules that may be contained in the
N-terminal domain of PR (Fig. 1A
, constructs 29). As described below,
these deletion mutants allowed the identification of a positive
modulation domain (P) within the first 164 aas [coinciding with AF3
(6)] and a negative modulation domain (N) spanning aa 307427. We
investigated the effects of the relative stoichiometry of the N and P
domains by constructing internal deletions (Fig. 1B
, construct 13) as
well as duplications (constructs 11 and 12). We also assembled PR/GR
chimeric cDNAs to verify whether the N domain can be transplanted to
another context (Fig. 1C
). Other details of the expression plasmids
encoding the effector genes and of the cognate reporter vectors (Fig. 1D
) are given in Materials and Methods.
A transfection cocktail consisting of reference gene (CMV-ref, see Fig. 1D
and Materials and Methods), reporter constructs
(MMTV.OVEC or ERE-OVECse, Fig. 1D
and Materials and
Methods), and the different transactivators was transfected in
HeLa or CV-1 cells by calcium phosphate coprecipitation. The reporter
globin RNA was analyzed by a nuclease protection protocol that produces
two radiographic signals (a test and a reference signal), which
quantitatively represent bona fide transcriptional
initiation of the reporter and reference globin transcripts (16).
Figure 2
gives qualitative examples of
relevant results, and Fig. 3
reports the quantitative evaluation of similar
autoradiograms in which further combinations of
transactivators/repressors were tested. Negative controls that give
very low (basal) expression of the reporter are shown in Fig. 2A
, lanes
12 (presence of hormone but absence of GR or PR), and in Fig. 3
, AC, bar 1 (coexpressed GR and PRB but absence of hormone).

View larger version (61K):
[in this window]
[in a new window]
|
Figure 2. Qualitative Examples of Transactivation and
Transrepression by GR and PR
The cells were transfected by calcium phosphate precipitation, rinsed,
and incubated for 48 h. The RNA was extracted and analyzed by
nuclease protection essentially as described previously (16 ). The
positions of the test signal (MMTV-OVEC, Fig. 1D , line 20) and
reference signal (CMV-ref, Fig. 1D , line 23) are indicated by
sig and ref, respectively. The amount of
transfected transactivating PR DNA constructs was 1 µg and of the
GR.wt plasmid 0.3 µg (in lanes indicated by +); the amounts of
reference globin and carrier DNA are described in Materials and
Methods. Hormones were added after rinsing of the
CaPO4 cocktail, according to the scheme shown at top (+ and
-). Hormones (see Materials and Methods for
concentrations) were: D, dexamethasone; P, progesterone; R, R5020 (used
in panel B). These concentrations were chosen to give appropriate
activation according to the corresponding dose-response curves (not
shown). A, Activation and repression functions in HeLa cells. The first
two lanes are negative controls; lane 3 is a positive control with GR.
Lanes 411 show transactivation by PRB, PR24-C, PRA165-C, PR217-C,
PR307-C, PR427-C (clones a and b), and PR538-C. Lanes 1220 show
transrepression of GR upon coexpression of the same constructs of lanes
411. B, Comparison of PR activity in CV-1 and HeLa cells. The assays
were conducted as in Fig. 1A . The transfectability of CV-1 cells (lanes
111) is about 5 times lower than that of HeLa cells (lanes 1223).
Note that PRA and PR307-C exhibit a significant transactivation in CV-1
cells (ratio signal/reference in lanes 3 and 4) while they are
essentially silent in HeLa cells (lanes 15 and 16).
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Figure 3. Quantitative Analysis of Transactivation and
Transrepression Activity of Relevant PR Mutants
The histograms summarize the relative transcription
levels measured by nuclease protection assays analogous to those exemplified in Fig. 2 . Relative
transcription is defined as signal divided by reference where the
transcription levels obtained upon expression of 0.3 µg GR.wt are
declared as 100%. All the results in Fig. 3 are obtained from
transient transfection in HeLa cells. The signals were quantified by
densitometric scanning (Materials and Methods).
SD is indicated by T-bars, whenever the data were collected
from more than three independent transfections. Whenever required, the
appropriate hormones were used at the concentrations cited in
Materials and Methods. Bar 1 (basal) represents the
reporter expression level of samples in which either a mix of GR and PR
(0.3 µg GRwt + 1 µg PRB; panels AC) or ER (0.3 µg, panel
D) expressing vectors were cotransfected but no cognate hormone was
added.A. Transactivation and transrepression of MMTV-OVEC by PRB and
PRA. Left column, Transfected effectors and their
quantity (micrograms of transfected expression plasmid are given in
parentheses); shaded bars, activation of
MMTV-OVEC; solid bars, transrepression of GR upon
coexpression of the indicated PR constructs. B, Transactivation and
transrepression by progressive PR deletion mutants. Symbols and
conditions as in panel A. C, Transactivation and transrepression by
internal deletion/duplication mutants and by PR/GR chimeras. Symbols
and conditions as in panel A. D, Effect of PR forms on ER-mediated
transactivation. The reporter gene was 4xEREb-OVEC (Fig. 1D , line 22).
Symbols: shaded bars (1 2 3 4 ), effect of different amounts
of ER encoding plasmid [HEO (20 )] on the reporter gene; solid
bars, relative transcription of 4xEREb-OVEC in the presence of
0.1 µg HEO and 1 µg of expression plasmid encoding respectively GR,
PRB, or PRA. The hormone concentrations are explained in
Materials and Methods.
|
|
As anticipated, we observed that PRB is a strong activator of mouse
mammary tumor virus (MMTV) promoter (Fig. 2A
, lane 4, or Fig. 3A
, bars 35) and could confirm that in HeLa cells PRA is essentially
inactive, as seen in Fig. 2A
(lane 6), Fig. 2B
(lane 15), and in the
histogram of Fig. 3A
(shaded bar 6). The PRA construct is
indeed able to repress PRB activity (data not shown) and GR activity
[Fig. 2A
(lane 15) and Fig. 2B
(lane 20); Fig. 3A
(bars 811)]. We
call this inhibition transrepression independently of the
underlying mechanism. In CV-1 cells, the transfection efficiency was
generally lower than in HeLa cells (compare Fig. 2B
, lanes 111 with
lanes 1223), and the different PR constructs exerted a relatively
higher transactivation level. Thus, no convincing repression by PRA or
analogous constructs could be monitored in this cell line. The
transrepression capacity of the various constructs was therefore
primarily tested in HeLa cells and in combination with a fixed amount
of GR, since in this case the activity of the various components can be
easily distinguished by appropriate hormone combinations. Under our
conditions, we needed to cotransfect at least equimolar amounts of PRA
plasmid (which roughly results in equal amounts of protein as will be
shown in Fig. 4A
), to obtain significant
repression of GR activity (i.e. down to roughly 30% of
mock-interfered control, Fig. 3A
, bars 811). This is in contrast to
data reported by others (9), where a 1:25 molar ratio of PRA-encoding
plasmid was sufficient to obtain half-repression of PRB or GR activity.
In our hands the strength of transrepression by PRA is roughly
comparable to the inhibitor activity of a previously described GR
mutant, the GR(Ala) (15) construct (Fig. 3A
, bars 7 and 12). GR(Ala)
contains a poly-alanine stretch in the N-terminal domain, has
essentially lost its transactivation capacity, and behaves as a
competitive inhibitor of the wild-type GR (15). Because of the similar
behavior we initially inferred that PRA mainly inhibits by a
competitive (passive) mode of repression. However, we were convinced
that an intermolecular (active) effect must exist, given the behavior
of further deletion mutants by which we could separate transrepression
from the mere inability to transactivate (see below).

View larger version (48K):
[in this window]
[in a new window]
|
Figure 4. Immunoblot and DNA Binding of Transiently Expressed
PR Mutants
A, The blotted hemagglutinin-tagged proteins were visualized by
enhanced chemiluminescence as described in Materials and
Methods. The following major bands corresponding to the
expected molecular mass (in parentheses in the following
list) can be detected: GR.wt (91 kDa), PRB (114 kDa), PR24-C (112 kDa);
PR68-C (107 kDa); PRA (96 kDa); PR217-C (90 kDa); PR307-C (80 kDa);
PR347-C (76 kDa); PR387-C (72 kDa); PR427-C (68 kDa) and PR538-C (55
kDa). Signals of lower molecular mass are seen throughout and are
likely derived from proteolytic degradation. When we used anti-PR
polyclonal antibodies (data not shown) to probe similar blots, we
detected in lanes 2, 3, and 4 (extracts from cells expressing PRB,
PR24-C, and PR68-C) substantial signals with size perfectly matching
PRA, suggesting that PRA is cosynthesized from mRNA encoding larger
polypeptides. Intensity of bands of the immunoblot was used to
normalize the DNA-binding assay. B, In vivo DNA binding
was measured by transient transfection of G4-HTH-OVEC as described in
text and Materials and Methods. The positions of the
test signal (G4-HTH-OVEC, Fig. 1D , line 24) and reference signal
(CMV-ref, Fig. 1D , line 23) are indicated by sig and
ref, respectively. The transfection cocktails contained
the reference gene (0.1 µg); the reporter gene G4-HTH-OVEC (1 µg);
carrier DNA (up to 20 µg), and the additional effector plasmids
encoding the factors as shown at bottom: Gal4VP16 (1 µg vector in
lanes marked with +); GRwt or PR mutants (10 µg vector).
Shaded bars, No hormone added; solid
bars, appropriate hormone (dexamethasone or R5020) added during
incubation.
|
|
After analyzing the properties of naturally occurring PR forms, we
studied the progressive deletion mutants described in Fig. 1A
, whose
cotransfection gave the results shown in Figs. 2
and 3
. The deletion of
the first 23 aas (PR24-C) does not disturb the properties of the
wild-type PRB (Fig. 3B
, shaded bar 4). The deletion mutant
PR68-C is less active and cannot fully repress GR activity, probably
owing to its residual transactivation potential (Fig. 3B
, shaded
and solid bar 5). The three deletion mutants, PRA165-C (synonymous
to PRA), PR217-C, and PR307-C are not transactivating and are all able
to strongly inhibit the GR activity (Fig. 3B
, bars 68). The two
further deletions, PR347-C and PR387-C, are themselves not active (Fig. 3B
, shaded bars 9 and 10) but have lost the ability to
transinhibit the GR function (Fig. 3B
, solid bars 9 and 10).
In those mutants the inability of transactivating has been clearly
separated from the transrepressing function. PR427-C is almost as
active as PRB or PR24-C and is additive to cotransfected GR (compare
bars 3 and 4 with bar 11 in Fig. 3B
). The deletion PR538-C that lacks
the AF-1 domain is essentially inactive but is incapable of repressing
the activity of GR (Fig. 3B
, shaded and solid bar 12).
We tested the autonomy of the identified N domain by constructing PR/GR
chimeras in which different N-terminal PR domains were fused to the
hormone- binding domain of GR (see Fig. 1C
). Transfection of these
constructs shows that all PR/GR chimeras remain active, although the
PRB/GR chimera is more active than the PRA/GR chimera (Fig. 3C
). The
PRA/GR chimera is consequently unable to repress GR activity (Fig. 3C
, solid bars in lines 811). This observation indicates that
the N domain exerts its intermolecular inhibition only when embedded in
the PR context. This is consistent with Giangrande et al.
(13) who showed that the human PR (hPR) N domain maintains its
repressive function when transplanted to the chick PR (cPR), but it
does not maintain this property when moved to unrelated chimeric
transcription factors.
We finally verified whether PRA is able to repress ER activity as
proposed by others (10). We tested two estrogen response
elements (ERE) reporters. We could not detect any sign of
transrepression of ER either with the vitellogenin ERE (17) or with an
ERE reconstructed from the work of Wen et al. (10) (see Fig. 3D
and legend). Bars 24 of Fig. 3D
show that increasing amounts of
cotransfected ER plasmid give progressively "squelched" (18, 19)
signals. Cotransfection of ER with GR or PRB intensifies the squelching
effect (Fig. 3D
, bars 8 and 9), whereas PRA (bar 7) does not squelch ER
activity. Under all the tested conditions [with wild-type ER, mutated
ER (HEO, Ref. 20) and under various ER and PR expression levels] we
consistently observed that in HeLa cells GR and PRB efficiently compete
(squelch) ER activity, whereas PRA does not affect or even
increases ER activity.
Since the mutants PR347-C and PR387-C were incapable of both
transactivation and transrepression, we questioned the stability and
DNA- binding properties of all the relevant PR constructs. As shown in
Fig. 4
, we verified the protein levels by immunoblot and DNA-binding
function with an in vivo interference assay. The immunoblot
(Fig. 4A
) demonstrates that, except for PRB, PR24-C, and PR538-C (lanes
2, 3, 8, and 13 showing about half-intensity signals), all deletion
mutants give comparable levels of proteins. Those data were confirmed
by in situ immunofluorescence of similarly transfected cells
(data not shown). Additional polypeptides deriving most likely from
proteolytic degradation are detected in the Western blot.
To verify the relative DNA-binding properties we designed an in
vivo assay in which we test the capacity of PR mutants to
interfere with transcription initiation when binding to sites flanking
the TATA box of a reporter construct. As reporter we used G4-HTH-OVEC
(Fig. 1D
, construct 24), which gives high transcription level upon
coexpression of GAL4-VP16. In this construct the TATA box is flanked by
two hormone response elements (HREs) (for details see
Materials and Methods), and docking of a high-affinity
HRE-binding factor strongly interferes with correct transcriptional
initiation (compare lane 2 with lane 3 in Fig. 4B
). The relative
transcription level of the G4-HTH-OVEC was quantitated and normalized
(see histogram in Fig. 4B
) to the relative protein levels detected in
the immunoblot. For our purpose, the in vivo DNA binding
assay is superior to the in vitro DNA binding assay because
it verifies at the same time nuclear localization, hormone binding,
protein stability, and DNA binding capacity. In this assay all PR
mutants were able to repress the transcription from G4-HTH-OVEC (see
Fig. 4B
, lanes 414). The immunoblot and the in vivo DNA
binding assays indicate that the failed transrepression by the mutants,
PR68-C, PR347-C, and PR387-C, is not due to their intrinsic instability
or incapacity to bind target DNA in vivo, whereas the lack
of transrepression of PR538-C may be partly explained by a lower
steady-state level.
The loss of transactivation upon deletion of the first 165
residues confirms that this portion contains a positive modulation
domain (AF3; Ref. 6). The properties of our mutants, PR24-C and PR68-C,
suggest that essential aas for AF3 can be narrowed down to a segment
between aa 24 and 68. Operationally, we call the entire region 1164
the P domain (positive modulation). Analogously, we define the region
307427 as the N domain (negative modulation). As discussed below,
this region can be subdivided into Na and Nb. The progressive deletion
data suggested that the P and the N domains might antagonize each
other, and we reasoned that changes in their stoichiometric ratio could
reveal their relative importance. Therefore, we tested PR mutants in
which these domains are duplicated or deleted (see Fig. 1B
, constructs
1113 for structures). We observed that PR2xP (where the P-domain
is duplicated) is a spectacular activator. This mutant activates the
MMTV-OVEC 300-fold stronger than the PRB and is obviously not able to
repress the cotransfected GR activity (Fig. 3C
, bar 4). In
contrast, the mutant PR2xN (bearing an N domain duplication but
maintaining the P domain) is no longer active and can partially
transrepress (Fig. 3C
, shaded and solid bar 6). Full
repression could not be expected as this mutant still contains the
intact P domain. Finally, PR
N (deletion of the N domain) gives a
2-fold higher activation compared with PRB (Fig. 3C
, shaded
bar 7) and is additive to cotransfected GR (Fig. 3C
, solid
bar 7).
 |
DISCUSSION
|
|---|
In this work we confirm that in HeLa cells, hPRA is a very poor
activator and that it is able to repress PRB- and GR-mediated
activation. To obtain transrepression with PRA, equimolar or even
higher amounts of the expression plasmid are required in our system.
This is in conflict with the report of Vegeto et al. (9) who
described that cotransfection with only 1/25 the amount of PRA
expression vector leads to repression. A second conflict is the
different response in the two involved cell types: HeLa and CV-1. We
found that PRA produces higher activation in CV-1 than in HeLa, whereas
others (9, 10) have reported the reverse. While this work was in
progress, yet another group confirmed our observed low activity of PRA
in HeLa cells (13). A third discrepancy relates to the supposed
interference of PRA with the action of ER. At least in HeLa cells, we
detect no interference, while others (9, 10, 13) seem to have detected
it in this same cell line. The reasons for these discrepancies
are difficult to explain, although experimental conditions are slightly
different. We used an internally controlled transfection assay, whereas
in the other reports the transfection control was conducted in a
separate test. Another difference is that we directly measured
transcription initiation while others measured reporter enzymes that
could arise from incorrectly initiated transcripts, thereby giving
misleading results. In any case, our results indicate that the
transrepression at submolar ratios, the cell type specificity, and the
ER interference observed by others cannot be recapitulated under all
circumstances and that these phenomena cannot be considered as general
properties of PRA.
From our deletions and duplications we can distinguish three classes of
mutant PR (Fig. 5A
).
The first class (Fig. 5A
, left; we call it "B" from its
prototype PRB) comprises all PR mutants that are able to transactivate.
In Fig. 5A
we illustrate class B as fully capable of intermolecular
(shaded arrows marked by +) synergistic activation with the
transactivation by the GR (double line arrow). The class B
members (PRB, PR24-C, PR427-C, PR2xP, and PR
N) are obviously not
able to repress, and their coexpression with GR leads to the addition
or multiplication of both activities when tested on a GRE reporter
promoter. The second class of phenotypes (which we call "A" from
their prototype PRA, see Fig. 5A
, middle) encompasses
receptors containing the segment from aa 165 to 307, such as PRA165-C
(synonymous to PRA), PR217-C, and PR307-C. These are inactive when
tested alone (bottom drawing) and are able to transrepress
(dashed inhibition lines marked with a minus sign) the
action of GR or PRB. The receptors of class A seem therefore to contain
domains that act both intra- and intermolecularly (solid and
shaded inhibition lines, respectively, in Fig. 5A
, middle). The third class contains the dispersed PR mutants,
PR68-C, PR347-C, PR387-C, and PR538-C (class X, Fig. 5A
), which seem to
have lost intermolecular interference (no shaded inhibition lines)
while maintaining the intramolecular one (solid inhibition
lines). These latter are themselves inactive when tested alone
(Fig. 5A
, bottom drawing at right) but are poor GR
transrepressors (Fig. 5A
, top drawing at right) since they
seem to lack the intermolecular inhibiting capacity
(shaded arrow followed by ?). For PR68-C we attribute this
lack of transrepression to possible residual aas belonging to the AF3
region (see below). The lack of transrepression by the mutant PR538-C
could be likely explained by the lower steady-state levels of the
corresponding polypeptide (Fig. 4A
). For the mutants PR347-C and
PR387-C, the loss of function could not be explained by lower
expression, spurious mutations, or incapacity of in vivo DNA
binding since Western blot and TATA-box interference assay (Fig. 4
)
demonstrated levels of expression and DNA binding to be comparable with
class A mutants.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 5. Three Classes of hPR Phenotypes and Human
vs. Chicken PR Homology
A, Intermolecular and intramolecular action. Top, The
scheme shows three classes of situations for equimolar binding of GR
(ovals) and PR (elongated octagons)
homodimers at two adjacent palindromic response elements (dotted
bars) in the ratio 1:1 (PR:GR, top).
Bottom, Situation in which only PR is expressed. The Na
domain is represented by solid belt in the PR symbols.
The thickness of the broken arrow symbolizes the level
of transcription in the various combinations. The dotted
arrows represent the synergistic activation; the double
dotted-arrow indicates the transactivation by GR; the
dotted inhibition lines represent the intermolecular and the
solid inhibition lines the intramolecular negative
action. The signs - and + refer to intermolecular activation and
repression functions, respectively; ? indicates the absence of either
intermolecular activation or repression. The names of the constructs
corresponding to a class are listed at the bottom. The
mutants PR68-C and PR538-C are given in parentheses
since they are operationally listed under class X although their lack
of transrepression may be due to residual transactivating residues and
lower expression levels, respectively (see text). B, Homology matrix of
human vs. chicken PR amino-terminal sequences. The amino
terminus of human PR (X-axis, 550 residues) and the chicken PR (Y axis,
410 residues) were compared in a homology matrix (stringency 6/13;
program DNA Strider from Christian Marck, Gif-sur-Yvette, CEDEX,
France). The major colinear homology starts around position 500
of hPR (corresponding to AF1, followed by the Zn finger region). The
patches of homology in the more upstream regions are coincident with
some of the phenotypes displayed by the various deletion mutants
(N-terminal border of relevant mutants is indicated by dotted
lines, and names are indicated at the top). C,
The region of highest homology between hPR and cPR amino termini roughly
corresponds to the Na domain. The two relevant regions (249350
for hPR, top sequence; and 163270 for cPR,
bottom sequence) are shown by maximum alignment.
Vertical bars indicate identity, double
dots indicate similarity. The region of most intense
conservation lies between 300 and 331 of the hPR.
|
|
We also noted that some functional elements revealed by our deletion
analysis coincide with homology patches between chick and human PR
(Fig. 5
, B and C). The significance of such homology is still unclear,
especially because the chick PR does have distinct properties (Ref. 13
and references therein) but it is intriguing to note that the strongest
homology stretches overlap with borders of functions defined in our
deletion studies. A significant cluster of conserved aas is observed in
the region between position 40 and 70, which overlaps the segment
2468, whose removal causes a dramatic drop of transactivation in the
PR. The properties of PR347-C and PR387-C suggest that the N domain can
be subdivided in Na and Nb, where the Na subdomain seems to be
necessary for intermolecular inhibition (see above). Our deletion
analysis has narrowed this region to 40 residues (region 307347), and
the hPR/cPR homology (see Fig. 5C
) covers the relevant portion along
about 30 residues (segment 300331). The Nb domain seems to be
necessary only for intramolecular down-regulation as demonstrated by
mutants PR347-C and PR387-C. Since we show that these two mutants are
fully competent for DNA binding, we must conclude that a weak activator
is not necessarily a good transrepressor. The Nb region (347427) is
characterized only by weak patches of homology between cPR and hPR (see
homology matrix Fig. 5B
). Further duplication and deletion mutants will
be necessary to test whether or not the subdomains Na and Nb work in an
interdependent manner.
Given the observed partial autonomy of the P and N domains, we raised
the question of their relative stoichiometric importance (Fig. 3C
).
Analysis of the duplication and internal deletion mutants suggested
that the stoichiometric ratio of the P and N modules strongly
influences the transactivation and transrepression ability. Duplication
of the P domain shows that this domain has a powerful (multiplicative)
activation function. The internal deletion of the N domain leads to a
receptor that is twice as active as the wild-type PRB. Thus, we
conclude that one copy of the N domain provides an approximately 2-fold
inhibition in the natural PRB. The addition of a second N domain (in
PR2xN) nearly destroys the activation capacity of the PR. This suggests
that the repressing activity of the N domain is also multiplicative
with itself.
The transdominant repression of PRA is reminiscent of the one exerted
by the GR(Ala) mutant previously obtained in our laboratory (14, 15).
It is conceivable that PRA, like GR(Ala), is unable to activate the
prototype MMTV promoter but fully capable of inducing other complex,
natural promoters. We have recently initiated this type of functional
genomics with our GR(Ala) expressed from recombinant adenoviral
vectors, and we have indeed observed several chromosomal genes that are
unexpectedly activated by GR(Ala) (S.B. Verca and S. Rusconi, in
preparation). Similar experiments will be done with recombinant
adenoviruses expressing PRB and PRA forms (H. Ghanbari and B. Huse,
unpublished), and we are confident that they will reveal a set of
resident promoters behaving differently than the prototype MMTV. Our
work, together with the observations of other groups, makes us conclude
that one cannot consider the PRA as generally incapable of
transactivation since: 1) there are some cell types in which PRA is
significantly transactivating, such as CV-1 cells (this work) or HepG2
cells (13); 2) only a few promoter combinations have been tested (see
Ref. 9 and this work); 3) all the data have so far been collected from
transient cotransfection experiments in which the order of addition of
chromatin components does not necessarily reflect the situation for
chromosomal genes. The cell type-preferential activation and repression
by PRA suggests that additional cofactors may play a role in this
mechanism. It seems logical that some cofactors will
specifically interact with the N domain of the PR. One of our principal
interests will be, indeed, the identification of such cofactors.
PRA and PRB seem to build a regulatory mechanism that possibly applies
also to androgen receptor (21) and other factors (Ref. 22 and
references therein), and we envisage new approaches to better
understand their relative importance for the regulation of resident
genes. To this aim we believe that our "functional genomics"
analysis may reveal novel properties of the natural and artificial PR
forms and may further clarify their physiological role in cell
homeostasis.
 |
MATERIALS AND METHODS
|
|---|
Plasmids
Reporter Constructs
All reporter constructs are based on the OVEC vector (16). This vector
contains a modified ß-globin gene from -1221 to +3325 cloned in
pUC 18, which allows quantitative measurement of rabbit expressed
ß-globin RNA levels with nuclease protection assays (16). The
ß-globin promoter region from -435 to -37 has been replaced by a
synthetic linker containing a SacI and SalI site.
These sites allow insertion of synthetic promoter elements directly
upstream of the ß-globin TATA-box. In MMTV-OVEC the MMTV-long
terminal repeat segment from -600 to -20 was inserted. This
element contains Octamer sites at -20, an NF-1 site at -70, and
strong HREs at -120 and -180. In ERE-OVEC, the promoters are
artificial estrogen response elements (ERE): a double Vitellogenin ERE
sequence (17) in EREa-OVEC and four tandem copies of the ER-binding
side 5'-AAT TCA AAG TCA GGT CA C AGT GAC CTG ATC AAA-3' described by
Wen et al. (10) in the EREb-OVEC. The EREa-OVEC further
contains an SV40 enhancer downstream of the ß-globin gene. The
reporter construct for testing the DNA binding (G4-HTH-OVEC, Fig. 1D
)
is based on an OVEC vector that consists of four GAL4-binding sites
(italics, in parentheses) and two GREs
(uppercase letters in parentheses) flanking the TATA-box
(underlined) in the following arrangement:
(gaggtctcctgactccggaggactgtcctccgtgaccagtcttcgtc)4xgac-(AGAACAgctTGTTCT)gaactccttgggCATAAA(AGAACAgctTG-TTCT)gctgctgctt(
mRNA
start). CMV-ref is similarly based on the OVEC vector, but it contains
a 5'-truncated ß-globin gene (16) that gives a distinct signal that
can be used to standardize transfection.
Eukaryotic Expression Vector
The cDNAs of all the transactivator mutants are based on the expression
vector pSTC (23, 24, 25, 26). This vector contains the cytomegalovirus
promoter/enhancer from -522 to +72 linked to the thymidine kinase
leader sequence from +55 to +104 including the start codon and two
additional amino acids followed in most constructs by the hemagglutinin
tag. The vector includes a splicing and polyadenylation sites derived
from the rabbit ß-globin gene and an SV40 origin of replication. The
cDNAs of the various PR mutants were cloned in frame to the start codon
of the thymidine kinase leader. Deletion and duplication mutants were
cloned by amplifying the corresponding cDNA portions by PCR using
primers bearing convenient restriction sites. The PR/GR chimeras were
constructed by exploiting a common SphI site that is at a
homologous position in the DNA-binding domain of both receptors.
Constructions were done according to standard techniques (27), and
relevant regions were verified by custom sequencing (Microsynth,
Balgach, Switzerland).
Cell Cultures, Transfections, and Transcript Analysis
Cells were routinely grown in DMEM supplemented with 2.5% each
of newborn calf serum and FCS (both sera from GIBCO, Grand
Island, NY). After transfection the cells were cultured in DMEM
supplemented with 3% FCS to avoid hormone agonists that are present in
newborn calf serum. The transfection method was calcium phosphate
coprecipitation (16). A typical transfection cocktail contained 10 µg
reporter plasmid, 0.2 µg reference plasmid, and various amounts of
expression vector for transactivation/transrepression and were adjusted
to 25 µg with calf thymus DNA and cytomegalovirus (CMV)
mock-expression vector to compensate for different plasmid
combinations. Whenever required, corresponding hormones were added at
the following final molar concentrations: dexamethasone, 5 x
10-7 M; R5020 (Dupont NEN, Boston, MA;
progestin agonist), 5 x 10-8 M;
progesterone, 5 x 10-7 M;
17ß-estradiol (Milan Biotech Inc., New York, NY), 5 x
10-7 M. Hormone was present during the entire
incubation time (48 h). After this incubation, RNA was isolated and
subjected to S1-nuclease protection analysis (16). The signals were
quantified by densitometric scanning (Bio-Rad GS-760, Bio-Rad
Laboratories, Richmond, CA) or by Phosphoimager analysis (Bio-Rad
GS525). The relative transcription is defined as the ratio
signal/reference.
Western Blot and in Vivo DNA Binding Assay
For Western blot and immunostaining, HeLa cells were transfected
with 5 µg plasmid encoding the corresponding hemagglutinin-tagged PR
and GR construct. Total cell extracts were electrophoresed by SDS-PAGE,
and the blots were probed with an antihemagglutinin antibody.
Visualization of signals was obtained with an antirabbit antibody
allowing detection by enhanced chemiluminescence (Pierce Chemical Co.,
Rockford, IL).
For in vivo DNA binding assay we used conditions analogous
to those for the Western blot, and the transfection cocktail was spiked
with 1 µg G4-HTH-OVEC reporter plasmid, 0.1 µg reference plasmid
(CMV-ovec), and 1 µg Gal4VP16. Appropriate hormones were given in the
same concentrations as described above. Reporter RNA was measured by
RNA protection assay, and quantitation of the signals was performed on
a Phosphoimager (GS525, Bio-Rad).
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful to Dr. D. Wen (Ligand Pharmaceuticals) for
sending useful control plasmids encoding PRA and PRB and for sharing
information on ERE reporter plasmids. We thank our colleagues at the
Biochemistry Institute for critical review.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Sandro Rusconi, Biochemistry Institute, Universite de Fribourg, Perolles, CH-1700 Fribourg, Switzerland. E-mail: sandro.rusconi{at}unifr.ch
This work was supported by the Kanton Fribourg and by the
Schweizerischer Nationalfonds, Grants 3132486.91 and 3149572.96 to
S.R.
Received for publication July 22, 1997.
Revision received May 12, 1998.
Accepted for publication May 14, 1998.
 |
REFERENCES
|
|---|
-
Mangelsdorf DJ, Thummel C, Beato M, Herrlich P,
Umesono K, Blumberg B, Kastner P, Mark M, Chambon P 1995 The nuclear receptor superfamily: the second decade.
Cell 83:835839[CrossRef][Medline]
-
Beato M 1989 Gene regulation by steroid hormones. Cell 56:335344[CrossRef][Medline]
-
Gronemeyer H, Meyer M, Bocquel M, Kastner P, Turcotte B,
Chambon P 1991 Progestin receptors: isoforms and antihormone action. J
Steroid Biochem Mol Biol 40:271278[CrossRef][Medline]
-
Gronemeyer H, Meyer ME 1991 Nuclear receptors. Hormones,
anti-hormones and regulation of the transcription. Ann Endocrinol
(Paris) 52:335338[Medline]
-
Schwerk C, Klotzbucher M, Sachs M, Ulber V, Klein Hitpass L 1995 Identification of a transactivation function in the progesterone
receptor that interacts with the TAFII110 subunit of the TFIID complex.
J Biol Chem 270:2133121338[Abstract/Free Full Text]
-
Sartorius CA, Melville MY, Hovland AR, Tung L, Takimoto GS,
Horwitz KB 1994 A third transactivation function (AF3) of human
progesterone receptors located in the unique N-terminal segment of the
B-isoform. Mol Endocrinol 8:13471360[Abstract/Free Full Text]
-
Tora L, Gronemeyer H, Turcotte B, Gaub MP, Chambon P 1988 The
N-terminal region of the chicken progesterone receptor specifies target
gene activation. Nature 333:185188[CrossRef][Medline]
-
Kastner P, Krust A, Turcotte B, Stropp U, Tora L,
Gronemeyer H, Chambon P 1990 Two distinct estrogen-regulated
promoters generate transcripts encoding the two functionally different
human progesterone receptor forms A and B. EMBO J 9:16031614[Medline]
-
Vegeto E, Shahbaz MM, Wen DX, Goldman ME, OMalley
BW, McDonnell DP 1993 Human progesterone receptor A form is a
cell- and promoter-specific repressor of human progesterone receptor B
function (see comments). Mol Endocrinol 7:12441255[Abstract/Free Full Text]
-
Wen DX, Xu YF, Mais DE, Goldman ME, McDonnell DP 1994 The A
and B isoforms of the human progesterone receptor operate through
distinct signaling pathways within target cells. Mol Cell Biol 14:83568364[Abstract/Free Full Text]
-
Tung L, Mohamed MK, Hoeffler JP, Takimoto GS, Horwitz KB 1993 Oct Antagonist-occupied human progesterone B-receptors activate
transcription without binding to progesterone response elements and are
dominantly inhibited by A-receptors. Mol Endocrinol 7:12561265[Abstract/Free Full Text]
-
Mohamed MK, Tung L, Takimoto GS, Horwitz KB 1994 The leucine
zippers of c-fos and c-jun for progesterone receptor dimerization: a
dominance in the A/B heterodimer. J Steroid Biochem Mol Biol 51:241250[CrossRef][Medline]
-
Giangrande PH, Pollio G, McDonnell DP 1997 Mapping and
characterization of the functional domains responsible for the
differential activity of the A and B isoforms of the human progesterone
receptor. J Biol Chem 272:3288932900[Abstract/Free Full Text]
-
Lanz RB, Hug M, Gola M, Tallone T, Wieland S, Rusconi S 1994 Active, interactive, and inactive steroid receptor mutants. Steroids 59:148152[CrossRef][Medline]
-
Lanz RB, Wieland S, Hug M, Rusconi S 1995 A transcriptional
repressor obtained by alternative translation of a trinucleotide
repeat. Nucleic Acids Res 23:138145[Abstract/Free Full Text]
-
Westin G, Gerster T, Müller MM, Schaffner G, Schaffner W 1987 OVEC, a versatile system to study transcription in mammalian cells
and cell-free extracts. Nucleic Acids Res 15:67876798[Abstract/Free Full Text]
-
Klein-Hitpass L, Schrorpp M, Wagner U, Ryffel GU 1986 ERE
vitellogenin. Cell 46:10531061[CrossRef][Medline]
-
Ptashne M 1988 How eukaryotic transcriptional activators work.
Nature 335:683689[CrossRef][Medline]
-
Ptashne M 1989 How gene activators work. Sci Am 260:4047[Medline]
-
Tora L, Mullick A, Metzger D, Ponglikitmongkol M, Park I,
Chambon P 1989 The cloned human oestrogen receptor contains a mutation
which alters its hormone binding properties. EMBO J 8:19811986[Medline]
-
Wilson CM, McPhaul MJ 1996 A and B forms of androgen receptors
are expressed in a variety of human tissues. Mol Cell Endocrinol 120:5057
-
Talbot D, Descombes P, Schibler U 1994 The 5' flanking
region of the rat LAP gene can direct high level of expression in
transgenic mice. Nucleic Acids Res 22:756766[Abstract/Free Full Text]
-
Rusconi S, Severne Y, Georgiev O, Galli I, Wieland S 1990 A
novel expression assay to study transcriptional activators. Gene 89:211221[CrossRef][Medline]
-
Schatt M, Wieland S, Rusconi S 1989 Promoter and enhancer
activation properties of the glucocorticoid receptor. In: Nunez J,
Dumont JE (eds) Hormones and Cell Regulation. John Libbey, London, pp
3944
-
Schatt MD, Rusconi S, Schaffner W 1990 A single DNA-binding
transcription factor is sufficient for activation from a distant
enhancer and/or from a promoter position. EMBO J 9:481487[Medline]
-
Severne Y, Wieland S, Schaffner W, Rusconi S 1988 Metal
binding finger structures in the glucocorticoid receptor defined by
site-directed mutagenesis. EMBO J 7:25032508[Medline]
-
Maniatis T, Fritsch EF, Sambrook J 1989 Molecular Cloning, A
Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY
-
Wieland S, Galli I, Schatt M, Severne Y, Rusconi S 1990 Genetic and Biochemical Analysis of a Steroid Receptor. In: Sekeris CE,
Alexis M (eds) Activation of Hormone and Growth Factor Receptors.
Kluwer Academic Publishers, Dordrecht, The Netherlands, pp
215225
This article has been cited by other articles:

|
 |

|
 |
 
I. Quiles, L. Millan-Arino, A. Subtil-Rodriguez, B. Minana, N. Spinedi, C. Ballare, M. Beato, and A. Jordan
Mutational Analysis of Progesterone Receptor Functional Domains in Stable Cell Lines Delineates Sets of Genes Regulated by Different Mechanisms
Mol. Endocrinol.,
June 1, 2009;
23(6):
809 - 826.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Graham, M. L. Yager, H. D. Hill, K. Byth, G. M. O'Neill, and C. L. Clarke
Altered Progesterone Receptor Isoform Expression Remodels Progestin Responsiveness of Breast Cancer Cells
Mol. Endocrinol.,
November 1, 2005;
19(11):
2713 - 2735.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kim, C. A. Cantwell, P. F. Johnson, C. M. Pfarr, and S. C. Williams
Transcriptional Activity of CCAAT/Enhancer-binding Proteins Is Controlled by a Conserved Inhibitory Domain That Is a Target for Sumoylation
J. Biol. Chem.,
October 4, 2002;
277(41):
38037 - 38044.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Abdel-Hafiz, G. S. Takimoto, L. Tung, and K. B. Horwitz
The Inhibitory Function in Human Progesterone Receptor N Termini Binds SUMO-1 Protein to Regulate Autoinhibition and Transrepression
J. Biol. Chem.,
September 6, 2002;
277(37):
33950 - 33956.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Gao, J. Mazella, M. Tang, and L. Tseng
Ligand-Activated Progesterone Receptor Isoform hPR-A Is a Stronger Transactivator Than hPR-B for the Expression of IGFBP-1 (Insulin-Like Growth Factor Binding Protein-1) in Human Endometrial Stromal Cells
Mol. Endocrinol.,
December 1, 2000;
14(12):
1954 - 1961.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. A. Iñiguez-Lluhí and D. Pearce
A Common Motif within the Negative Regulatory Regions of Multiple Factors Inhibits Their Transcriptional Synergy
Mol. Cell. Biol.,
August 15, 2000;
20(16):
6040 - 6050.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. H. Giangrande, E. A. Kimbrel, D. P. Edwards, and D. P. McDonnell
The Opposing Transcriptional Activities of the Two Isoforms of the Human Progesterone Receptor Are Due to Differential Cofactor Binding
Mol. Cell. Biol.,
May 1, 2000;
20(9):
3102 - 3115.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. M. McGowan and C. L. Clarke
Effect of Overexpression of Progesterone Receptor A on Endogenous Progestin-Sensitive Endpoints in Breast Cancer Cells
Mol. Endocrinol.,
October 1, 1999;
13(10):
1657 - 1671.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Q. Wang, J. Lu, and E. L. Yong
Ligand- and Coactivator-mediated Transactivation Function (AF2) of the Androgen Receptor Ligand-binding Domain Is Inhibited by the Cognate Hinge Region
J. Biol. Chem.,
March 2, 2001;
276(10):
7493 - 7499.
[Abstract]
[Full Text]
[PDF]
|
 |
|