help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huse, B.
Right arrow Articles by Rusconi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huse, B.
Right arrow Articles by Rusconi, S.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*PROGESTERONE
Molecular Endocrinology 12 (9): 1334-1342
Copyright © 1998 by The Endocrine Society

Definition of a Negative Modulation Domain in the Human Progesterone Receptor

Barbara Huse, Stefano Brenz Verca, Patricia Matthey and Sandro Rusconi

Biochemistry Institute Université de Fribourg, Pérolles CH-1700 Fribourg, Switzerland


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The progesterone receptor (PR) occurs in two major forms, the full-length PRB and the amino-truncated PRA, which lacks 164 amino-terminal residues. PRB functions as a strong transcriptional activator of progesterone-responsive genes, whereas PRA is inactive in several cell types where it may even act as a trans-dominant repressor of PRB and other steroid receptors, like the glucocorticoid receptor or, reportedly, the estrogen receptor. We initially observed that a PR deleted of its entire amino domain (PR538-C) is incapable of trans-repressing PRB or glucocorticoid receptor, suggesting that a negative modulation domain must be contained in the region between position 165 and 538. After testing progressive deletion mutants and chimeras, we demonstrate that this negative modulating domain is confined within 120 residues in the amino-terminal region and that it contains a subdomain of 40 residues that is crucial for intermolecular transrepression. Duplication, deletion, and transplantation of the negative modulation domain show that the negative modulation domain has only a limited functional autonomy. In our hands, transrepression of estrogen receptor could not be substantiated, and, under our conditions, at least an equimolar concentration of PRA expression plasmid is required for transrepression. Our deletion studies reveal domains that correlate with strong homology patches between the amino-terminal domains of mammalian and avian PR.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The progesterone receptor (PR) is a member of the nuclear receptor family, which is activated by diverse ligands such as steroids, thyroid hormones, and retinoids (Ref. 1 and references therein). These receptors act as transcriptional factors that regulate gene expression positively or negatively by interacting with cognate DNA sequences. Like all nuclear receptors, the PR can be subdivided in several functional regions such as the domains responsible for DNA binding [DNA-binding domain (DBD) and hormone-binding domain (HBD) (1, 2)]. Several distinct transactivating regions (AF) have been identified in the PR (Fig. 1AGo, top). The principal ones are the AF1 located at the N-terminal domain and the AF2 within the HBD (3, 4). More recent works pointed to a third domain (referred to as ‘AF3’ in Fig. 1AGo, top) that has been positioned within the first 164 N-terminal amino acids of the PRB form (6) and to a weaker activation domain overlapping the DBD [that we indicated as ’AF?’ (5)].



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. Effector and Reporter Constructs

A, Progressive deletion mutants. The full-length PR is 933 aa long. AF1, AF2, AF?, and AF3 are transcription activation domains (see text); DBD, hatched box; HBD, black box with white dots. The numbers in the different clone names indicate the position of the first intact PR residue, while C indicates that the cDNA extends to encode the natural carboxy terminus. PRB and PRA ( PRA165-C) are the naturally occurring PR forms. B, Internal duplication and deletion mutants. In PR2xP a segment of 157 aa encompassing the P element (positive modulation domain) is duplicated; in PR2xN the N element (negative modulation domain), within aa 307 and 427, is duplicated; in PR{Delta}N the N element is deleted. C, PR/GR chimeras. The chimeras have the N-terminal domain from the PR and the HBD from the GR (black rectangle). GRAF1, GRAF2, and GRAF3 indicate the position of the established transcriptional activator domains of the GR. D, Reporter plasmids. The MMTV-OVEC contains the MMTV-long terminal repeat segments at promoter position (28 ). In EREa-OVEC (line 21) we inserted two copies of a vitellogenin estrogen response element (17 ) in the promoter region; this reporter also possessed an SV40 enhancer located downstream (SV40). The EREb-OVEC contains four tandem copies of the ER-binding side described by Wen et al. (10 ) (see Materials and Methods). CMV-ref (line 23) has been used to standardize transfection and assays conditions and gives a shorter S1-protected signal (see Materials and Methods and Ref. 16). The construct G4-HTH-OVEC (nr 24) was used to test the in vivo DNA-binding capacity of relevant PR constructs. Symbols for G4-HTH-OVEC: G4, four tandem GAL4-binding elements (solid rectangles); HTH, TATA-box (rectangle marked ‘T’) flanked by adjacent HREs (double solid triangles) of the consensus sequence AGAACAnnnTGTTCT. Docking of an HRE-binding factor disturbs correct transcriptional initiation in these promoters. For further details, see text, Materials and Methods, and legend of Fig. 4Go.

 
PR naturally occurs in two distinct forms, the full-length PRB and the amino-truncated PRA (called PRA165-C, Fig. 1AGo, line 4), which is missing 164 amino-terminal amino acids (aas). Two distinct estrogen-regulated promoters are responsible for the synthesis of isoform A and isoform B, and it has been shown that the two isoforms differently activate transcription from target gene promoters (7, 8). When tested on transiently transfected PR-responsive reporters, the shorter isoform, PRA, is not an efficient transactivator in many cell lines, as for example in HeLa cells. In cell lines where it does not transactivate, PRA blocks induction by the larger isoform PRB (9, 10, 11, 12) as well as other steroid receptors such as glucocorticoid receptor (GR) or, reportedly, even the estrogen receptor (ER) (10, 13). Given our recent work on the mechanism of trans-dominant repression by natural or mutated steroid receptors (14, 15), we were particularly intrigued by the reported properties of PRA, and we decided to compare it with other repressors in our laboratory. To this end we dissected the amino terminus of the PR and analyzed the transacting properties of progressive deletions and duplications. Our results have allowed a clear identification of a positive (P) and a negative (N) modulation domain. Both the P and the N domains exhibit a marked cell type-dependent function, implicating the involvement of cellular factors in their action mechanism. We could narrow down the crucial regions for the P and the N domain to about 44 and 40 residues, respectively. These regions correspond to conserved homology patches between chick and mammalian PR.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Figure 1Go illustrates the DNA constructs used for this work. We assembled expression vectors encoding progressive deletion mutants to characterize the different modules that may be contained in the N-terminal domain of PR (Fig. 1AGo, constructs 2–9). As described below, these deletion mutants allowed the identification of a positive modulation domain (P) within the first 164 aas [coinciding with AF3 (6)] and a negative modulation domain (N) spanning aa 307–427. We investigated the effects of the relative stoichiometry of the N and P domains by constructing internal deletions (Fig. 1BGo, construct 13) as well as duplications (constructs 11 and 12). We also assembled PR/GR chimeric cDNAs to verify whether the N domain can be transplanted to another context (Fig. 1CGo). Other details of the expression plasmids encoding the effector genes and of the cognate reporter vectors (Fig. 1DGo) are given in Materials and Methods.

A transfection cocktail consisting of reference gene (CMV-ref, see Fig. 1DGo and Materials and Methods), reporter constructs (MMTV.OVEC or ERE-OVECse, Fig. 1DGo and Materials and Methods), and the different transactivators was transfected in HeLa or CV-1 cells by calcium phosphate coprecipitation. The reporter globin RNA was analyzed by a nuclease protection protocol that produces two radiographic signals (a test and a reference signal), which quantitatively represent bona fide transcriptional initiation of the reporter and reference globin transcripts (16). Figure 2Go gives qualitative examples of relevant results, and Fig. 3Go reports the quantitative evaluation of similar autoradiograms in which further combinations of transactivators/repressors were tested. Negative controls that give very low (basal) expression of the reporter are shown in Fig. 2AGo, lanes 1–2 (presence of hormone but absence of GR or PR), and in Fig. 3Go, A–C, bar 1 (coexpressed GR and PRB but absence of hormone).



View larger version (61K):
[in this window]
[in a new window]
 
Figure 2. Qualitative Examples of Transactivation and Transrepression by GR and PR

The cells were transfected by calcium phosphate precipitation, rinsed, and incubated for 48 h. The RNA was extracted and analyzed by nuclease protection essentially as described previously (16 ). The positions of the test signal (MMTV-OVEC, Fig. 1DGo, line 20) and reference signal (CMV-ref, Fig. 1DGo, line 23) are indicated by sig and ref, respectively. The amount of transfected transactivating PR DNA constructs was 1 µg and of the GR.wt plasmid 0.3 µg (in lanes indicated by +); the amounts of reference globin and carrier DNA are described in Materials and Methods. Hormones were added after rinsing of the CaPO4 cocktail, according to the scheme shown at top (+ and -). Hormones (see Materials and Methods for concentrations) were: D, dexamethasone; P, progesterone; R, R5020 (used in panel B). These concentrations were chosen to give appropriate activation according to the corresponding dose-response curves (not shown). A, Activation and repression functions in HeLa cells. The first two lanes are negative controls; lane 3 is a positive control with GR. Lanes 4–11 show transactivation by PRB, PR24-C, PRA165-C, PR217-C, PR307-C, PR427-C (clones a and b), and PR538-C. Lanes 12–20 show transrepression of GR upon coexpression of the same constructs of lanes 4–11. B, Comparison of PR activity in CV-1 and HeLa cells. The assays were conducted as in Fig. 1AGo. The transfectability of CV-1 cells (lanes 1–11) is about 5 times lower than that of HeLa cells (lanes 12–23). Note that PRA and PR307-C exhibit a significant transactivation in CV-1 cells (ratio signal/reference in lanes 3 and 4) while they are essentially silent in HeLa cells (lanes 15 and 16).

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. Quantitative Analysis of Transactivation and Transrepression Activity of Relevant PR Mutants

The histograms summarize the relative transcription levels measured by nuclease protection assays analogous to those exemplified in Fig. 2Go. Relative transcription is defined as signal divided by reference where the transcription levels obtained upon expression of 0.3 µg GR.wt are declared as 100%. All the results in Fig. 3Go are obtained from transient transfection in HeLa cells. The signals were quantified by densitometric scanning (Materials and Methods). SD is indicated by T-bars, whenever the data were collected from more than three independent transfections. Whenever required, the appropriate hormones were used at the concentrations cited in Materials and Methods. Bar 1 (basal) represents the reporter expression level of samples in which either a mix of GR and PR (0.3 µg GRwt + 1 µg PRB; panels A–C) or ER (0.3 µg, panel D) expressing vectors were cotransfected but no cognate hormone was added.A. Transactivation and transrepression of MMTV-OVEC by PRB and PRA. Left column, Transfected effectors and their quantity (micrograms of transfected expression plasmid are given in parentheses); shaded bars, activation of MMTV-OVEC; solid bars, transrepression of GR upon coexpression of the indicated PR constructs. B, Transactivation and transrepression by progressive PR deletion mutants. Symbols and conditions as in panel A. C, Transactivation and transrepression by internal deletion/duplication mutants and by PR/GR chimeras. Symbols and conditions as in panel A. D, Effect of PR forms on ER-mediated transactivation. The reporter gene was 4xEREb-OVEC (Fig. 1DGo, line 22). Symbols: shaded bars (1 2 3 4 ), effect of different amounts of ER encoding plasmid [HEO (20 )] on the reporter gene; solid bars, relative transcription of 4xEREb-OVEC in the presence of 0.1 µg HEO and 1 µg of expression plasmid encoding respectively GR, PRB, or PRA. The hormone concentrations are explained in Materials and Methods.

 
As anticipated, we observed that PRB is a strong activator of mouse mammary tumor virus (MMTV) promoter (Fig. 2AGo, lane 4, or Fig. 3AGo, bars 3–5) and could confirm that in HeLa cells PRA is essentially inactive, as seen in Fig. 2AGo (lane 6), Fig. 2BGo (lane 15), and in the histogram of Fig. 3AGo (shaded bar 6). The PRA construct is indeed able to repress PRB activity (data not shown) and GR activity [Fig. 2AGo (lane 15) and Fig. 2BGo (lane 20); Fig. 3AGo (bars 8–11)]. We call this inhibition ’transrepression’ independently of the underlying mechanism. In CV-1 cells, the transfection efficiency was generally lower than in HeLa cells (compare Fig. 2BGo, lanes 1–11 with lanes 12–23), and the different PR constructs exerted a relatively higher transactivation level. Thus, no convincing repression by PRA or analogous constructs could be monitored in this cell line. The transrepression capacity of the various constructs was therefore primarily tested in HeLa cells and in combination with a fixed amount of GR, since in this case the activity of the various components can be easily distinguished by appropriate hormone combinations. Under our conditions, we needed to cotransfect at least equimolar amounts of PRA plasmid (which roughly results in equal amounts of protein as will be shown in Fig. 4AGo), to obtain significant repression of GR activity (i.e. down to roughly 30% of mock-interfered control, Fig. 3AGo, bars 8–11). This is in contrast to data reported by others (9), where a 1:25 molar ratio of PRA-encoding plasmid was sufficient to obtain half-repression of PRB or GR activity. In our hands the strength of transrepression by PRA is roughly comparable to the inhibitor activity of a previously described GR mutant, the GR(Ala) (15) construct (Fig. 3AGo, bars 7 and 12). GR(Ala) contains a poly-alanine stretch in the N-terminal domain, has essentially lost its transactivation capacity, and behaves as a competitive inhibitor of the wild-type GR (15). Because of the similar behavior we initially inferred that PRA mainly inhibits by a competitive (passive) mode of repression. However, we were convinced that an intermolecular (active) effect must exist, given the behavior of further deletion mutants by which we could separate transrepression from the mere inability to transactivate (see below).



View larger version (48K):
[in this window]
[in a new window]
 
Figure 4. Immunoblot and DNA Binding of Transiently Expressed PR Mutants

A, The blotted hemagglutinin-tagged proteins were visualized by enhanced chemiluminescence as described in Materials and Methods. The following major bands corresponding to the expected molecular mass (in parentheses in the following list) can be detected: GR.wt (91 kDa), PRB (114 kDa), PR24-C (112 kDa); PR68-C (107 kDa); PRA (96 kDa); PR217-C (90 kDa); PR307-C (80 kDa); PR347-C (76 kDa); PR387-C (72 kDa); PR427-C (68 kDa) and PR538-C (55 kDa). Signals of lower molecular mass are seen throughout and are likely derived from proteolytic degradation. When we used anti-PR polyclonal antibodies (data not shown) to probe similar blots, we detected in lanes 2, 3, and 4 (extracts from cells expressing PRB, PR24-C, and PR68-C) substantial signals with size perfectly matching PRA, suggesting that PRA is cosynthesized from mRNA encoding larger polypeptides. Intensity of bands of the immunoblot was used to normalize the DNA-binding assay. B, In vivo DNA binding was measured by transient transfection of G4-HTH-OVEC as described in text and Materials and Methods. The positions of the test signal (G4-HTH-OVEC, Fig. 1DGo, line 24) and reference signal (CMV-ref, Fig. 1DGo, line 23) are indicated by sig and ref, respectively. The transfection cocktails contained the reference gene (0.1 µg); the reporter gene G4-HTH-OVEC (1 µg); carrier DNA (up to 20 µg), and the additional effector plasmids encoding the factors as shown at bottom: Gal4VP16 (1 µg vector in lanes marked with +); GRwt or PR mutants (10 µg vector). Shaded bars, No hormone added; solid bars, appropriate hormone (dexamethasone or R5020) added during incubation.

 
After analyzing the properties of naturally occurring PR forms, we studied the progressive deletion mutants described in Fig. 1AGo, whose cotransfection gave the results shown in Figs. 2Go and 3Go. The deletion of the first 23 aas (PR24-C) does not disturb the properties of the wild-type PRB (Fig. 3BGo, shaded bar 4). The deletion mutant PR68-C is less active and cannot fully repress GR activity, probably owing to its residual transactivation potential (Fig. 3BGo, shaded and solid bar 5). The three deletion mutants, PRA165-C (synonymous to PRA), PR217-C, and PR307-C are not transactivating and are all able to strongly inhibit the GR activity (Fig. 3BGo, bars 6–8). The two further deletions, PR347-C and PR387-C, are themselves not active (Fig. 3BGo, shaded bars 9 and 10) but have lost the ability to transinhibit the GR function (Fig. 3BGo, solid bars 9 and 10). In those mutants the inability of transactivating has been clearly separated from the transrepressing function. PR427-C is almost as active as PRB or PR24-C and is additive to cotransfected GR (compare bars 3 and 4 with bar 11 in Fig. 3BGo). The deletion PR538-C that lacks the AF-1 domain is essentially inactive but is incapable of repressing the activity of GR (Fig. 3BGo, shaded and solid bar 12).

We tested the autonomy of the identified N domain by constructing PR/GR chimeras in which different N-terminal PR domains were fused to the hormone- binding domain of GR (see Fig. 1CGo). Transfection of these constructs shows that all PR/GR chimeras remain active, although the PRB/GR chimera is more active than the PRA/GR chimera (Fig. 3CGo). The PRA/GR chimera is consequently unable to repress GR activity (Fig. 3CGo, solid bars in lines 8–11). This observation indicates that the N domain exerts its intermolecular inhibition only when embedded in the PR context. This is consistent with Giangrande et al. (13) who showed that the human PR (hPR) N domain maintains its repressive function when transplanted to the chick PR (cPR), but it does not maintain this property when moved to unrelated chimeric transcription factors.

We finally verified whether PRA is able to repress ER activity as proposed by others (10). We tested two estrogen response elements (ERE) reporters. We could not detect any sign of transrepression of ER either with the vitellogenin ERE (17) or with an ERE reconstructed from the work of Wen et al. (10) (see Fig. 3DGo and legend). Bars 2–4 of Fig. 3DGo show that increasing amounts of cotransfected ER plasmid give progressively "squelched" (18, 19) signals. Cotransfection of ER with GR or PRB intensifies the squelching effect (Fig. 3DGo, bars 8 and 9), whereas PRA (bar 7) does not squelch ER activity. Under all the tested conditions [with wild-type ER, mutated ER (HEO, Ref. 20) and under various ER and PR expression levels] we consistently observed that in HeLa cells GR and PRB efficiently compete (squelch) ER activity, whereas PRA does not affect or even increases ER activity.

Since the mutants PR347-C and PR387-C were incapable of both transactivation and transrepression, we questioned the stability and DNA- binding properties of all the relevant PR constructs. As shown in Fig. 4Go, we verified the protein levels by immunoblot and DNA-binding function with an in vivo interference assay. The immunoblot (Fig. 4AGo) demonstrates that, except for PRB, PR24-C, and PR538-C (lanes 2, 3, 8, and 13 showing about half-intensity signals), all deletion mutants give comparable levels of proteins. Those data were confirmed by in situ immunofluorescence of similarly transfected cells (data not shown). Additional polypeptides deriving most likely from proteolytic degradation are detected in the Western blot.

To verify the relative DNA-binding properties we designed an in vivo assay in which we test the capacity of PR mutants to interfere with transcription initiation when binding to sites flanking the TATA box of a reporter construct. As reporter we used G4-HTH-OVEC (Fig. 1DGo, construct 24), which gives high transcription level upon coexpression of GAL4-VP16. In this construct the TATA box is flanked by two hormone response elements (HREs) (for details see Materials and Methods), and docking of a high-affinity HRE-binding factor strongly interferes with correct transcriptional initiation (compare lane 2 with lane 3 in Fig. 4BGo). The relative transcription level of the G4-HTH-OVEC was quantitated and normalized (see histogram in Fig. 4BGo) to the relative protein levels detected in the immunoblot. For our purpose, the in vivo DNA binding assay is superior to the in vitro DNA binding assay because it verifies at the same time nuclear localization, hormone binding, protein stability, and DNA binding capacity. In this assay all PR mutants were able to repress the transcription from G4-HTH-OVEC (see Fig. 4BGo, lanes 4–14). The immunoblot and the in vivo DNA binding assays indicate that the failed transrepression by the mutants, PR68-C, PR347-C, and PR387-C, is not due to their intrinsic instability or incapacity to bind target DNA in vivo, whereas the lack of transrepression of PR538-C may be partly explained by a lower steady-state level.

The loss of transactivation upon deletion of the first 165 residues confirms that this portion contains a positive modulation domain (AF3; Ref. 6). The properties of our mutants, PR24-C and PR68-C, suggest that essential aas for AF3 can be narrowed down to a segment between aa 24 and 68. Operationally, we call the entire region 1–164 the P domain (positive modulation). Analogously, we define the region 307–427 as the N domain (negative modulation). As discussed below, this region can be subdivided into Na and Nb. The progressive deletion data suggested that the P and the N domains might antagonize each other, and we reasoned that changes in their stoichiometric ratio could reveal their relative importance. Therefore, we tested PR mutants in which these domains are duplicated or deleted (see Fig. 1BGo, constructs 11–13 for structures). We observed that PR2xP (where the P-domain is duplicated) is a spectacular activator. This mutant activates the MMTV-OVEC 300-fold stronger than the PRB and is obviously not able to repress the cotransfected GR activity (Fig. 3CGo, bar 4). In contrast, the mutant PR2xN (bearing an N domain duplication but maintaining the P domain) is no longer active and can partially transrepress (Fig. 3CGo, shaded and solid bar 6). Full repression could not be expected as this mutant still contains the intact P domain. Finally, PR{Delta}N (deletion of the N domain) gives a 2-fold higher activation compared with PRB (Fig. 3CGo, shaded bar 7) and is additive to cotransfected GR (Fig. 3CGo, solid bar 7).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this work we confirm that in HeLa cells, hPRA is a very poor activator and that it is able to repress PRB- and GR-mediated activation. To obtain transrepression with PRA, equimolar or even higher amounts of the expression plasmid are required in our system. This is in conflict with the report of Vegeto et al. (9) who described that cotransfection with only 1/25 the amount of PRA expression vector leads to repression. A second conflict is the different response in the two involved cell types: HeLa and CV-1. We found that PRA produces higher activation in CV-1 than in HeLa, whereas others (9, 10) have reported the reverse. While this work was in progress, yet another group confirmed our observed low activity of PRA in HeLa cells (13). A third discrepancy relates to the supposed interference of PRA with the action of ER. At least in HeLa cells, we detect no interference, while others (9, 10, 13) seem to have detected it in this same cell line. The reasons for these discrepancies are difficult to explain, although experimental conditions are slightly different. We used an internally controlled transfection assay, whereas in the other reports the transfection control was conducted in a separate test. Another difference is that we directly measured transcription initiation while others measured reporter enzymes that could arise from incorrectly initiated transcripts, thereby giving misleading results. In any case, our results indicate that the transrepression at submolar ratios, the cell type specificity, and the ER interference observed by others cannot be recapitulated under all circumstances and that these phenomena cannot be considered as general properties of PRA.

From our deletions and duplications we can distinguish three classes of mutant PR (Fig. 5AGo). The first class (Fig. 5AGo, left; we call it "B" from its prototype PRB) comprises all PR mutants that are able to transactivate. In Fig. 5AGo we illustrate class B as fully capable of intermolecular (shaded arrows marked by +) synergistic activation with the transactivation by the GR (double line arrow). The class B members (PRB, PR24-C, PR427-C, PR2xP, and PR{Delta}N) are obviously not able to repress, and their coexpression with GR leads to the addition or multiplication of both activities when tested on a GRE reporter promoter. The second class of phenotypes (which we call "A" from their prototype PRA, see Fig. 5AGo, middle) encompasses receptors containing the segment from aa 165 to 307, such as PRA165-C (synonymous to PRA), PR217-C, and PR307-C. These are inactive when tested alone (bottom drawing) and are able to transrepress (dashed inhibition lines marked with a minus sign) the action of GR or PRB. The receptors of class A seem therefore to contain domains that act both intra- and intermolecularly (solid and shaded inhibition lines, respectively, in Fig. 5AGo, middle). The third class contains the dispersed PR mutants, PR68-C, PR347-C, PR387-C, and PR538-C (class X, Fig. 5AGo), which seem to have lost intermolecular interference (no shaded inhibition lines) while maintaining the intramolecular one (solid inhibition lines). These latter are themselves inactive when tested alone (Fig. 5AGo, bottom drawing at right) but are poor GR transrepressors (Fig. 5AGo, top drawing at right) since they seem to lack the intermolecular inhibiting capacity (shaded arrow followed by ?). For PR68-C we attribute this lack of transrepression to possible residual aas belonging to the AF3 region (see below). The lack of transrepression by the mutant PR538-C could be likely explained by the lower steady-state levels of the corresponding polypeptide (Fig. 4AGo). For the mutants PR347-C and PR387-C, the loss of function could not be explained by lower expression, spurious mutations, or incapacity of in vivo DNA binding since Western blot and TATA-box interference assay (Fig. 4Go) demonstrated levels of expression and DNA binding to be comparable with class A mutants.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 5. Three Classes of hPR Phenotypes and Human vs. Chicken PR Homology

A, Intermolecular and intramolecular action. Top, The scheme shows three classes of situations for equimolar binding of GR (ovals) and PR (elongated octagons) homodimers at two adjacent palindromic response elements (dotted bars) in the ratio 1:1 (PR:GR, top). Bottom, Situation in which only PR is expressed. The Na domain is represented by solid belt in the PR symbols. The thickness of the broken arrow symbolizes the level of transcription in the various combinations. The dotted arrows represent the synergistic activation; the double dotted-arrow indicates the transactivation by GR; the dotted inhibition lines represent the intermolecular and the solid inhibition lines the intramolecular negative action. The signs - and + refer to intermolecular activation and repression functions, respectively; ? indicates the absence of either intermolecular activation or repression. The names of the constructs corresponding to a class are listed at the bottom. The mutants PR68-C and PR538-C are given in parentheses since they are operationally listed under class X although their lack of transrepression may be due to residual transactivating residues and lower expression levels, respectively (see text). B, Homology matrix of human vs. chicken PR amino-terminal sequences. The amino terminus of human PR (X-axis, 550 residues) and the chicken PR (Y axis, 410 residues) were compared in a homology matrix (stringency 6/13; program ‘DNA Strider’ from Christian Marck, Gif-sur-Yvette, CEDEX, France). The major colinear homology starts around position 500 of hPR (corresponding to AF1, followed by the Zn finger region). The patches of homology in the more upstream regions are coincident with some of the phenotypes displayed by the various deletion mutants (N-terminal border of relevant mutants is indicated by dotted lines, and names are indicated at the top). C, The region of highest homology between hPR and cPR amino termini roughly corresponds to the Na domain. The two relevant regions (249–350 for hPR, top sequence; and 163–270 for cPR, bottom sequence) are shown by maximum alignment. Vertical bars indicate identity, double dots indicate similarity. The region of most intense conservation lies between 300 and 331 of the hPR.

 
We also noted that some functional elements revealed by our deletion analysis coincide with homology patches between chick and human PR (Fig. 5Go, B and C). The significance of such homology is still unclear, especially because the chick PR does have distinct properties (Ref. 13 and references therein) but it is intriguing to note that the strongest homology stretches overlap with borders of functions defined in our deletion studies. A significant cluster of conserved aas is observed in the region between position 40 and 70, which overlaps the segment 24–68, whose removal causes a dramatic drop of transactivation in the PR. The properties of PR347-C and PR387-C suggest that the N domain can be subdivided in Na and Nb, where the Na subdomain seems to be necessary for intermolecular inhibition (see above). Our deletion analysis has narrowed this region to 40 residues (region 307–347), and the hPR/cPR homology (see Fig. 5CGo) covers the relevant portion along about 30 residues (segment 300–331). The Nb domain seems to be necessary only for intramolecular down-regulation as demonstrated by mutants PR347-C and PR387-C. Since we show that these two mutants are fully competent for DNA binding, we must conclude that a weak activator is not necessarily a good transrepressor. The Nb region (347–427) is characterized only by weak patches of homology between cPR and hPR (see homology matrix Fig. 5BGo). Further duplication and deletion mutants will be necessary to test whether or not the subdomains Na and Nb work in an interdependent manner.

Given the observed partial autonomy of the P and N domains, we raised the question of their relative stoichiometric importance (Fig. 3CGo). Analysis of the duplication and internal deletion mutants suggested that the stoichiometric ratio of the P and N modules strongly influences the transactivation and transrepression ability. Duplication of the P domain shows that this domain has a powerful (multiplicative) activation function. The internal deletion of the N domain leads to a receptor that is twice as active as the wild-type PRB. Thus, we conclude that one copy of the N domain provides an approximately 2-fold inhibition in the natural PRB. The addition of a second N domain (in PR2xN) nearly destroys the activation capacity of the PR. This suggests that the repressing activity of the N domain is also multiplicative with itself.

The transdominant repression of PRA is reminiscent of the one exerted by the GR(Ala) mutant previously obtained in our laboratory (14, 15). It is conceivable that PRA, like GR(Ala), is unable to activate the prototype MMTV promoter but fully capable of inducing other complex, natural promoters. We have recently initiated this type of functional genomics with our GR(Ala) expressed from recombinant adenoviral vectors, and we have indeed observed several chromosomal genes that are unexpectedly activated by GR(Ala) (S.B. Verca and S. Rusconi, in preparation). Similar experiments will be done with recombinant adenoviruses expressing PRB and PRA forms (H. Ghanbari and B. Huse, unpublished), and we are confident that they will reveal a set of resident promoters behaving differently than the prototype MMTV. Our work, together with the observations of other groups, makes us conclude that one cannot consider the PRA as generally incapable of transactivation since: 1) there are some cell types in which PRA is significantly transactivating, such as CV-1 cells (this work) or HepG2 cells (13); 2) only a few promoter combinations have been tested (see Ref. 9 and this work); 3) all the data have so far been collected from transient cotransfection experiments in which the order of addition of chromatin components does not necessarily reflect the situation for chromosomal genes. The cell type-preferential activation and repression by PRA suggests that additional cofactors may play a role in this mechanism. It seems logical that some cofactors will specifically interact with the N domain of the PR. One of our principal interests will be, indeed, the identification of such cofactors.

PRA and PRB seem to build a regulatory mechanism that possibly applies also to androgen receptor (21) and other factors (Ref. 22 and references therein), and we envisage new approaches to better understand their relative importance for the regulation of resident genes. To this aim we believe that our "functional genomics" analysis may reveal novel properties of the natural and artificial PR forms and may further clarify their physiological role in cell homeostasis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmids
Reporter Constructs
All reporter constructs are based on the OVEC vector (16). This vector contains a modified ß-globin gene from -1221 to +3325 cloned in pUC 18, which allows quantitative measurement of rabbit expressed ß-globin RNA levels with nuclease protection assays (16). The ß-globin promoter region from -435 to -37 has been replaced by a synthetic linker containing a SacI and SalI site. These sites allow insertion of synthetic promoter elements directly upstream of the ß-globin TATA-box. In MMTV-OVEC the MMTV-long terminal repeat segment from -600 to -20 was inserted. This element contains Octamer sites at -20, an NF-1 site at -70, and strong HREs at -120 and -180. In ERE-OVEC, the promoters are artificial estrogen response elements (ERE): a double Vitellogenin ERE sequence (17) in EREa-OVEC and four tandem copies of the ER-binding side 5'-AAT TCA AAG TCA GGT CA C AGT GAC CTG ATC AAA-3' described by Wen et al. (10) in the EREb-OVEC. The EREa-OVEC further contains an SV40 enhancer downstream of the ß-globin gene. The reporter construct for testing the DNA binding (G4-HTH-OVEC, Fig. 1DGo) is based on an OVEC vector that consists of four GAL4-binding sites (italics, in parentheses) and two GREs (uppercase letters in parentheses) flanking the TATA-box (underlined) in the following arrangement: (gaggtctcctgactccggaggactgtcctccgtgaccagtcttcgtc)4xgac-(AGAACAgctTGTTCT)gaactccttgggCATAAA(AGAACAgctTG-TTCT)gctgctgctt(->mRNA start). CMV-ref is similarly based on the OVEC vector, but it contains a 5'-truncated ß-globin gene (16) that gives a distinct signal that can be used to standardize transfection.

Eukaryotic Expression Vector
The cDNAs of all the transactivator mutants are based on the expression vector pSTC (23, 24, 25, 26). This vector contains the cytomegalovirus promoter/enhancer from -522 to +72 linked to the thymidine kinase leader sequence from +55 to +104 including the start codon and two additional amino acids followed in most constructs by the hemagglutinin tag. The vector includes a splicing and polyadenylation sites derived from the rabbit ß-globin gene and an SV40 origin of replication. The cDNAs of the various PR mutants were cloned in frame to the start codon of the thymidine kinase leader. Deletion and duplication mutants were cloned by amplifying the corresponding cDNA portions by PCR using primers bearing convenient restriction sites. The PR/GR chimeras were constructed by exploiting a common SphI site that is at a homologous position in the DNA-binding domain of both receptors. Constructions were done according to standard techniques (27), and relevant regions were verified by custom sequencing (Microsynth, Balgach, Switzerland).

Cell Cultures, Transfections, and Transcript Analysis
Cells were routinely grown in DMEM supplemented with 2.5% each of newborn calf serum and FCS (both sera from GIBCO, Grand Island, NY). After transfection the cells were cultured in DMEM supplemented with 3% FCS to avoid hormone agonists that are present in newborn calf serum. The transfection method was calcium phosphate coprecipitation (16). A typical transfection cocktail contained 10 µg reporter plasmid, 0.2 µg reference plasmid, and various amounts of expression vector for transactivation/transrepression and were adjusted to 25 µg with calf thymus DNA and cytomegalovirus (CMV) mock-expression vector to compensate for different plasmid combinations. Whenever required, corresponding hormones were added at the following final molar concentrations: dexamethasone, 5 x 10-7 M; R5020 (Dupont NEN, Boston, MA; progestin agonist), 5 x 10-8 M; progesterone, 5 x 10-7 M; 17ß-estradiol (Milan Biotech Inc., New York, NY), 5 x 10-7 M. Hormone was present during the entire incubation time (48 h). After this incubation, RNA was isolated and subjected to S1-nuclease protection analysis (16). The signals were quantified by densitometric scanning (Bio-Rad GS-760, Bio-Rad Laboratories, Richmond, CA) or by Phosphoimager analysis (Bio-Rad GS525). The relative transcription is defined as the ratio signal/reference.

Western Blot and in Vivo DNA Binding Assay
For Western blot and immunostaining, HeLa cells were transfected with 5 µg plasmid encoding the corresponding hemagglutinin-tagged PR and GR construct. Total cell extracts were electrophoresed by SDS-PAGE, and the blots were probed with an antihemagglutinin antibody. Visualization of signals was obtained with an antirabbit antibody allowing detection by enhanced chemiluminescence (Pierce Chemical Co., Rockford, IL).

For in vivo DNA binding assay we used conditions analogous to those for the Western blot, and the transfection cocktail was spiked with 1 µg G4-HTH-OVEC reporter plasmid, 0.1 µg reference plasmid (CMV-ovec), and 1 µg Gal4VP16. Appropriate hormones were given in the same concentrations as described above. Reporter RNA was measured by RNA protection assay, and quantitation of the signals was performed on a Phosphoimager (GS525, Bio-Rad).


    ACKNOWLEDGMENTS
 
We are grateful to Dr. D. Wen (Ligand Pharmaceuticals) for sending useful control plasmids encoding PRA and PRB and for sharing information on ERE reporter plasmids. We thank our colleagues at the Biochemistry Institute for critical review.


    FOOTNOTES
 
Address requests for reprints to: Sandro Rusconi, Biochemistry Institute, Universite de Fribourg, Perolles, CH-1700 Fribourg, Switzerland. E-mail: sandro.rusconi{at}unifr.ch

This work was supported by the Kanton Fribourg and by the Schweizerischer Nationalfonds, Grants 31–32486.91 and 31–49572.96 to S.R.

Received for publication July 22, 1997. Revision received May 12, 1998. Accepted for publication May 14, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  2. Beato M 1989 Gene regulation by steroid hormones. Cell 56:335–344[CrossRef][Medline]
  3. Gronemeyer H, Meyer M, Bocquel M, Kastner P, Turcotte B, Chambon P 1991 Progestin receptors: isoforms and antihormone action. J Steroid Biochem Mol Biol 40:271–278[CrossRef][Medline]
  4. Gronemeyer H, Meyer ME 1991 Nuclear receptors. Hormones, anti-hormones and regulation of the transcription. Ann Endocrinol (Paris) 52:335–338[Medline]
  5. Schwerk C, Klotzbucher M, Sachs M, Ulber V, Klein Hitpass L 1995 Identification of a transactivation function in the progesterone receptor that interacts with the TAFII110 subunit of the TFIID complex. J Biol Chem 270:21331–21338[Abstract/Free Full Text]
  6. Sartorius CA, Melville MY, Hovland AR, Tung L, Takimoto GS, Horwitz KB 1994 A third transactivation function (AF3) of human progesterone receptors located in the unique N-terminal segment of the B-isoform. Mol Endocrinol 8:1347–1360[Abstract/Free Full Text]
  7. Tora L, Gronemeyer H, Turcotte B, Gaub MP, Chambon P 1988 The N-terminal region of the chicken progesterone receptor specifies target gene activation. Nature 333:185–188[CrossRef][Medline]
  8. Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P 1990 Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 9:1603–1614[Medline]
  9. Vegeto E, Shahbaz MM, Wen DX, Goldman ME, O’Malley BW, McDonnell DP 1993 Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function (see comments). Mol Endocrinol 7:1244–1255[Abstract/Free Full Text]
  10. Wen DX, Xu YF, Mais DE, Goldman ME, McDonnell DP 1994 The A and B isoforms of the human progesterone receptor operate through distinct signaling pathways within target cells. Mol Cell Biol 14:8356–8364[Abstract/Free Full Text]
  11. Tung L, Mohamed MK, Hoeffler JP, Takimoto GS, Horwitz KB 1993 Oct Antagonist-occupied human progesterone B-receptors activate transcription without binding to progesterone response elements and are dominantly inhibited by A-receptors. Mol Endocrinol 7:1256–1265[Abstract/Free Full Text]
  12. Mohamed MK, Tung L, Takimoto GS, Horwitz KB 1994 The leucine zippers of c-fos and c-jun for progesterone receptor dimerization: a dominance in the A/B heterodimer. J Steroid Biochem Mol Biol 51:241–250[CrossRef][Medline]
  13. Giangrande PH, Pollio G, McDonnell DP 1997 Mapping and characterization of the functional domains responsible for the differential activity of the A and B isoforms of the human progesterone receptor. J Biol Chem 272:32889–32900[Abstract/Free Full Text]
  14. Lanz RB, Hug M, Gola M, Tallone T, Wieland S, Rusconi S 1994 Active, interactive, and inactive steroid receptor mutants. Steroids 59:148–152[CrossRef][Medline]
  15. Lanz RB, Wieland S, Hug M, Rusconi S 1995 A transcriptional repressor obtained by alternative translation of a trinucleotide repeat. Nucleic Acids Res 23:138–145[Abstract/Free Full Text]
  16. Westin G, Gerster T, Müller MM, Schaffner G, Schaffner W 1987 OVEC, a versatile system to study transcription in mammalian cells and cell-free extracts. Nucleic Acids Res 15:6787–6798[Abstract/Free Full Text]
  17. Klein-Hitpass L, Schrorpp M, Wagner U, Ryffel GU 1986 ERE vitellogenin. Cell 46:1053–1061[CrossRef][Medline]
  18. Ptashne M 1988 How eukaryotic transcriptional activators work. Nature 335:683–689[CrossRef][Medline]
  19. Ptashne M 1989 How gene activators work. Sci Am 260:40–47[Medline]
  20. Tora L, Mullick A, Metzger D, Ponglikitmongkol M, Park I, Chambon P 1989 The cloned human oestrogen receptor contains a mutation which alters its hormone binding properties. EMBO J 8:1981–1986[Medline]
  21. Wilson CM, McPhaul MJ 1996 A and B forms of androgen receptors are expressed in a variety of human tissues. Mol Cell Endocrinol 120:50–57
  22. Talbot D, Descombes P, Schibler U 1994 The 5' flanking region of the rat LAP gene can direct high level of expression in transgenic mice. Nucleic Acids Res 22:756–766[Abstract/Free Full Text]
  23. Rusconi S, Severne Y, Georgiev O, Galli I, Wieland S 1990 A novel expression assay to study transcriptional activators. Gene 89:211–221[CrossRef][Medline]
  24. Schatt M, Wieland S, Rusconi S 1989 Promoter and enhancer activation properties of the glucocorticoid receptor. In: Nunez J, Dumont JE (eds) Hormones and Cell Regulation. John Libbey, London, pp 39–44
  25. Schatt MD, Rusconi S, Schaffner W 1990 A single DNA-binding transcription factor is sufficient for activation from a distant enhancer and/or from a promoter position. EMBO J 9:481–487[Medline]
  26. Severne Y, Wieland S, Schaffner W, Rusconi S 1988 Metal binding ’finger’ structures in the glucocorticoid receptor defined by site-directed mutagenesis. EMBO J 7:2503–2508[Medline]
  27. Maniatis T, Fritsch EF, Sambrook J 1989 Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  28. Wieland S, Galli I, Schatt M, Severne Y, Rusconi S 1990 Genetic and Biochemical Analysis of a Steroid Receptor. In: Sekeris CE, Alexis M (eds) Activation of Hormone and Growth Factor Receptors. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 215–225



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
I. Quiles, L. Millan-Arino, A. Subtil-Rodriguez, B. Minana, N. Spinedi, C. Ballare, M. Beato, and A. Jordan
Mutational Analysis of Progesterone Receptor Functional Domains in Stable Cell Lines Delineates Sets of Genes Regulated by Different Mechanisms
Mol. Endocrinol., June 1, 2009; 23(6): 809 - 826.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. D. Graham, M. L. Yager, H. D. Hill, K. Byth, G. M. O'Neill, and C. L. Clarke
Altered Progesterone Receptor Isoform Expression Remodels Progestin Responsiveness of Breast Cancer Cells
Mol. Endocrinol., November 1, 2005; 19(11): 2713 - 2735.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Kim, C. A. Cantwell, P. F. Johnson, C. M. Pfarr, and S. C. Williams
Transcriptional Activity of CCAAT/Enhancer-binding Proteins Is Controlled by a Conserved Inhibitory Domain That Is a Target for Sumoylation
J. Biol. Chem., October 4, 2002; 277(41): 38037 - 38044.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Abdel-Hafiz, G. S. Takimoto, L. Tung, and K. B. Horwitz
The Inhibitory Function in Human Progesterone Receptor N Termini Binds SUMO-1 Protein to Regulate Autoinhibition and Transrepression
J. Biol. Chem., September 6, 2002; 277(37): 33950 - 33956.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Gao, J. Mazella, M. Tang, and L. Tseng
Ligand-Activated Progesterone Receptor Isoform hPR-A Is a Stronger Transactivator Than hPR-B for the Expression of IGFBP-1 (Insulin-Like Growth Factor Binding Protein-1) in Human Endometrial Stromal Cells
Mol. Endocrinol., December 1, 2000; 14(12): 1954 - 1961.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
J. A. Iñiguez-Lluhí and D. Pearce
A Common Motif within the Negative Regulatory Regions of Multiple Factors Inhibits Their Transcriptional Synergy
Mol. Cell. Biol., August 15, 2000; 20(16): 6040 - 6050.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
P. H. Giangrande, E. A. Kimbrel, D. P. Edwards, and D. P. McDonnell
The Opposing Transcriptional Activities of the Two Isoforms of the Human Progesterone Receptor Are Due to Differential Cofactor Binding
Mol. Cell. Biol., May 1, 2000; 20(9): 3102 - 3115.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
E. M. McGowan and C. L. Clarke
Effect of Overexpression of Progesterone Receptor A on Endogenous Progestin-Sensitive Endpoints in Breast Cancer Cells
Mol. Endocrinol., October 1, 1999; 13(10): 1657 - 1671.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Q. Wang, J. Lu, and E. L. Yong
Ligand- and Coactivator-mediated Transactivation Function (AF2) of the Androgen Receptor Ligand-binding Domain Is Inhibited by the Cognate Hinge Region
J. Biol. Chem., March 2, 2001; 276(10): 7493 - 7499.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huse, B.
Right arrow Articles by Rusconi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huse, B.
Right arrow Articles by Rusconi, S.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*PROGESTERONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals