help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Subauste, J. S.
Right arrow Articles by Koenig, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Subauste, J. S.
Right arrow Articles by Koenig, R. J.
Molecular Endocrinology 12 (9): 1380-1392
Copyright © 1998 by The Endocrine Society

Characterization of the DNA-Binding and Dominant Negative Activity of v-erbA Homodimers

Jose S. Subauste and Ronald J. Koenig

Division of Endocrinology and Metabolism (J.S.S.) University of Mississippi Medical Center and G. V. (Sonny) Montgomery Veterans Administration Medical Center (J.S.S.) Jackson, Mississippi 39216
Division of Endocrinology and Metabolism (R.J.K.), University of Michigan Medical Center Ann Arbor, Michigan 48109-0678


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The oncoprotein v-erbA is a mutated form of thyroid hormone receptor {alpha}1 that is virtually incapable of binding T3. V-erbA is a dominant repressor of transcription induced by thyroid hormone receptors and retinoic acid receptors; however, the genetic targets of v-erbA that lead to oncogenesis are not known. Although v-erbA can bind as monomers and dimers to DNA containing the consensus sequence AGGTCA arranged as direct, inverted, or everted repeats, it is not known which sequence represents the optimal v-erbA-binding site. Determination of the DNA recognition properties of v-erbA would allow a better understanding of the repressor activity of this oncoprotein. The current studies, by using a random DNA selection strategy, have determined that the imperfect everted repeat 5'-TGACC(T/C)NT(A/G)AGGTCAC is the optimal v-erbA homodimer-binding site, where N represents any di- or trinucleotide. Functional studies show that everted repeats containing this sequence are substantially more potent v-erbA response elements than direct or inverted repeats, even though many classic T3 response elements are direct repeats. Thus, v-erbA represses only a subset of T3 response elements. In a similar fashion, v-erbA was found to repress a subset of vitamin D response elements. Of general interest, the data indicate that the two molecules of a transcription factor homodimer do not necessarily have identical DNA-binding specificities.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The avian erythroblastosis virus induces erythroleukemia and fibrosarcomas in chickens (1). This retrovirus possesses two oncogenes, v-erbA and v-erbB (1). Both oncogenes are required to fully transform erythroblasts and fibroblasts (2, 3). V-erbA is a member of the zinc finger transcription factor superfamily. Other members of this family include the glucocorticoid receptor, thyroid hormone receptors (TRs)1, retinoic acid receptors (RARs), retinoid X receptors (RXRs), and the vitamin D receptor (VDR) (4). These receptors regulate gene expression by binding to specific DNA sequences (response elements) usually located in the 5'-flanking regions of target genes (4). The most highly conserved region of erbA proteins is a more or less centrally located 66- to 68-amino acid DNA-binding domain that contains two zinc fingers. Two regions, termed P and D boxes, located at the bases of the first and second zinc fingers, respectively, are important for specific DNA recognition (5).

V-erbA is a mutated form of TR{alpha}1. A comparison of the amino acid sequences of the chicken TR{alpha}1 and v-erbA proteins indicates that v-erbA has undergone 13 single amino acid mutations (6), two of which are located in the P and D boxes. In addition, a 9-amino acid deletion is found in the carboxy-terminal domain of v-erbA (6). As a consequence of these mutations, v-erbA is unable to bind T3 in mammalian cells (6).

In mammalian and avian cells, v-erbA acts as a constitutive dominant repressor of transcription regulated by TR and RAR (7, 8). However, it is not clear whether v-erbA’s oncogenic function is based on suppression of TR or RAR function or whether it is mediated through uncharacterized v-erbA-responsive genes.

V-erbA and other members of this family can bind to response elements containing sequences related to AGGTCA arranged as direct, everted, or inverted repeats (IRs) (4). (Using past convention, an everted repeat (ER) is exemplified by TGACCT... AGGTCA, and an IR by AGGTCA... TGACCT.) In the case of direct repeats (DRs), the spacing preference between half-sites is dictated by a dimerization interface within the DNA-binding domain (9, 10). Thus, a DR of AGGTCA with a 1-bp spacer (DR1) is a response element for RXR, whereas DR3, DR4, and DR5 are response elements for VDR, TR, and RAR, respectively (11, 12).

V-erbA can bind as monomers, homodimers, and heterodimers with RXR to DNA containing the consensus sequence AGGTCA (8, 13). However, it is not clear that the hexamer AGGTCA represents the optimal binding site for v-erbA. Moreover, it remains unclear whether the biologically active v-erbA form is a monomer, homodimer, or heterodimer with RXR or another auxilliary protein. Therefore, the determination of the DNA recognition properties of v-erbA will be critical for achieving a better understanding of the repressor action of this oncoprotein and may provide insight into the molecular basis underlying the action of dominant negative forms of nuclear receptors in general.

The experiments described below characterize, by a nonbiased approach, the highest affinity DNA sequences for v-erbA homodimer binding and test the function of these sequences as potential response elements directing v-erbA suppression of TR, RAR, and VDR action.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Selection of a High-Affinity v-erbA Homodimer-Binding DNA Pool
The selection process used a population of double stranded 49-bp oligonucleotides in which the central 18 bp were generated randomly. PCR primers were made to complement the known flanking sequences. The random DNA pool was screened by electrophoretic mobility shift assay (EMSA) using Escherichia coli-expressed v-erbA. Isolation and elution of the v-erbA-DNA complex and amplification by PCR followed by EMSA was repeated for a total of eight rounds. This approach led to the isolation of a DNA pool that bound v-erbA as homodimers. Interestingly, during the selection process, v-erbA homodimer-DNA complexes were more prominent than v-erbA monomer-DNA complexes under high-salt incubations. This would suggest that under high-stringency conditions, v-erbA homodimers display higher affinity and/or stability for DNA binding than v-erbA monomers. The v-erbA-homodimer-binding DNA pool was subcloned and 24 different clones were sequenced. Twenty of them were ERs with spacing between half-sites of 4, 5, or 6 bp (Table 1Go; in keeping with convention, we define the spacer as the nucleotides separating the traditional core AGGTCA-like hexamers. However, in the selected clones the two most 3'-spacer positions have nonrandom nucleotide distributions.) The remaining four clones were DRs with a 4-bp spacer. Clones with IR sequences were not obtained. For ERs, the consensus sequence at the 3'-half-site is the 9-bp T(A/G)AGGTCAC (Table 1Go, bases 11–19). The same 3'-half-site sequence appears to be selected for the DRs, although it should be recognized that only four DR clones were obtained. This sequence is very similar to the optimal v-erbA monomer-binding site (14) except that a guanine was preferred at position 10 in the monomer selection, but no preference was observed at the corresponding position for homodimers.


View this table:
[in this window]
[in a new window]
 
Table 1. Sequence Conservation among 24 Clones Selected for v-erbA Homodimer Binding*

 
As shown in Table 1Go, the consensus sequence at the 5'-half-site for everted and DRs appeared to be TGACC(T/C) and GGGGTCA, respectively. However, sequences from either primer were used as part of that half-site in many of the clones. Although the primer sequences were excluded from this analysis, a consequence is that only a small number of clones containing the full 5'-selected sequence was obtained. Therefore, to confirm the selection of the upstream half-site for v-erbA homodimer binding, a double-stranded 57-bp oligonucleotide was synthesized containing an internal 16-bp random span followed by the 3'-consensus motif TGAGGTCAC. The random DNA selection strategy was performed as already described with six rounds in total. As shown in Fig. 1Go, v-erbA homodimer binding greatly exceeds monomer binding under high stringency conditions. After subcloning, 35 different clones were sequenced. Twenty three of them were ERs and 12 were DRs. Eighteen of the 23 clones with ERs had a 5-bp spacer, and the remaining clones had a 4- or 6-bp spacer. Clones with DR sequences had a 3- to 6-bp spacer. As is seen in Table 2Go, the consensus sequence of the 5'-half-site for the ER was the hexamer TGACC(T/C), whereas for the DR it was the heptamer (A/G)(A/G)GGTCA. These results confirm the original random selection data presented in Table 1Go.



View larger version (68K):
[in this window]
[in a new window]
 
Figure 1. EMSA Selection of a DNA Pool That Binds v-erbA as a Homodimer

DNA pools were end-labeled with 32P, incubated with E. coli-expressed v-erbA or buffer, and subjected to PAGE. The random pool consists of a 57-bp DNA fragment with a 16-bp internal random span followed by TGAGGTCAC to select for the 5'-half-site of v-erbA homodimer. The v-erbA homodimer complex is invisible after incubation with the random pool DNA (lane 1) but is present after six rounds of selection (lanes 4 and 5). M and D indicate the presence of v-erbA monomer and homodimer-DNA complexes, respectively.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Sequence Conservation at the 5'-Half-Site for v-erbA Homodimer binding

 
Mutational Analysis
Mutational analysis was performed to further confirm the optimal binding sequence for v-erbA homodimers. Several mutant versions of the consensus sequences for everted and DRs were synthesized and 32P-labeled to similar specific activities, and their abilities to bind v-erbA were tested by EMSA. As shown in Fig. 2Go and quantified in Table 3Go, the binding of v-erbA homodimers to ERs substantially exceeded that to DRs (e.g. ER5 vs. DR4). ERs containing the consensus sequence with a 5- and 6-bp spacer displayed the highest degree of v-erbA homodimer binding (ER5, ER5-M1, ER6). Mutations within the consensus sequence of either half-site in the ERs (mutants ER5-M2 through ER5-M6) significantly decreased v-erbA homodimer binding. Within the downstream half-site, mutation of the 5'-TG (ER5-M4) was much more deleterious for v-erbA homodimer and monomer binding than the mutation of the 3'-C (ER5-M6). Interestingly, mutation of the 3'-half-site (mutant ER5-M5) impaired monomer and homodimer binding whereas a similar mutation of the 5'-half-site (ER5-M2) impaired homodimer binding but did not affect monomer binding. This confirms that sequences surrounding the hexamer AGGTCA are crucial for v-erbA monomer binding, since the appropriate sequences are only present in the 3'-half-site. Also, mutations outside the consensus sequence did not affect v-erbA binding (mutant ER5-M1).



View larger version (56K):
[in this window]
[in a new window]
 
Figure 2. Effect of DNA Sequence Mutations on the Binding of v-erbA Homodimers to Everted and DR Consensus Sequences

Oligonucleotides arranged as ERs (ER4, ER5, ER5-M1 through ER5-M6, ER6) or DRs (DR4, DR4-M1) were end-labeled with 32P, incubated with E. coli-expressed v-erbA or buffer, and subjected to PAGE. M and D indicate the presence of v-erbA monomer and homodimer-DNA complexes, respectively. The faint intermediate complex (indicated by the asterisk) seen in EMSA studies is believed to be a homodimer interacting with the 3'-half-site (see Fig. 3Go). The lanes of this gel were loaded in an order that would be nonintuitive to most readers. To facilitate analysis, the autoradiogram was scanned, and the order of the lanes was changed using Adobe Photoshop software. The image was not altered in any other way. A free DNA lane is shown for only one probe (ER5, lane 1). However, free DNA was run for all probes, and, as expected, all looked like lane 1 (data not shown).

 

View this table:
[in this window]
[in a new window]
 
Table 3. Relative Binding of v-erbA Homodimers to Consensus and Mutant Oligonucleotides

 
Perhaps even more so than with ERs, spacing flexibility was tolerated for v-erbA homodimer binding to DRs. Thus, DR3, 4, 5, and 6 bound v-erbA homodimers with similar affinities (Table 3Go). The experiments shown in Fig. 2Go were performed at 50 mM KCl, but additional studies were undertaken at higher stringency (150 and 400 mM KCl). Under high-salt conditions the binding pattern for v-erbA homodimers remained unchanged; v-erbA monomer binding, however, was disrupted as previously discussed (data not shown).

The selected consensus sequence is an imperfect ER in that the 5'-half-site has a less stringent nucleotide specificity than the 3'-half-site (reverse complement of (A/G)GGTCA vs. T(A/G)AGGTCAC; the 3'-half-site is an extended version of the 5'-half-site). As this result was unexpected, a competition EMSA was performed to confirm that the imperfect ER (ER5–69) binds v-erbA homodimers with an affinity equal to a perfect ER of the 3'-half-site nonamer (ER5–99). EMSAs were carried out using 32P-labeled oligonucleotide ER5–99 as a probe plus graded doses of either ER5–99 or ER5–69 as competitor DNAs. The dose of each competitor DNA required to diminish the 32P-labeled ER5–99-v-erbA homodimer band intensity by 50% was calculated. The data confirmed that oligonucleotides ER5–69 and ER5–99 display similar affinities for v-erbA homodimers (C50 values for ER5–69 and ER5–99 were 0.8 and 1 ng, respectively).

A faint intermediate complex migrating between the monomer and homodimer complexes was also seen (Fig. 2Go). This band was supershifted by a specific v-erbA antibody (gift of M. Privalsky; data not shown), indicating that it contains v-erbA. The band was not affected by an anti-maltose-binding protein (MBP) antibody and did not comigrate with an MBP-v-erbA fusion protein-DNA complex (data not shown), indicating that the band does not contain MBP or MBP-v-erbA fusion protein. For reasons discussed below, we believe this band may represent a v-erbA homodimer bound only to the 3'-half-site.

Guanine Methylation Interference and Uracil Interference Footprinting
To confirm the sequence assignments, guanine methylation interference and uracil interference analyses were performed on a high-affinity clone containing an ER sequence with a 5-bp spacer (clone 7). When the probes were incubated with v-erbA and subjected to EMSA, two predominant protein-DNA complexes formed, corresponding to the v-erbA monomer and homodimer. Also a third faint complex was detected migrating between the monomer and the homodimer bands. All three protein-DNA complexes were analyzed for methylation sensitivity. As shown in Fig. 3Go, interference was observed on both half-sites for the v-erbA homodimer, whereas it was seen only on the 3'-half-site for the v-erbA monomer. These findings, in conjunction with the mutational analysis, indicate that indeed there is v-erbA homodimer formation rather than independent occupancy of two half-sites by two protein molecules. Specifically, DNA interference footprinting showed that v-erbA as a monomer interacts with the 3'-half-site only. Furthermore, mutations within the 5'-half-site (ER5-M2) disrupt v-erbA homodimerization without affecting v-erbA monomer formation, whereas mutations within the 3'-half-site disrupt both v-erbA monomer and homodimer formation (ER5-M5). Taken together, these data indicate that the 5'-half-site is not used for v-erbA monomer binding, and therefore the occupancy of both half-sites must be mediated by v-erbA homodimerization.



View larger version (72K):
[in this window]
[in a new window]
 
Figure 3. Combined Guanine Methylation Interference and Uracil Interference of v-erbA Binding to Clone 7

A, The top strand contained the sequence TGACCTAATTGAGGTCAC. Fg and Fgt represent the free DNAs cleaved either at guanine alone or guanine plus uracil, respectively. Dgt, Mgt, and Igt represent homodimer, monomer, and intermediate v-erbA bound DNA, respectively, cleaved at guanines plus uracils. Footprinted bases analyzed by PhosphorImager are indicated by solid circles. Critical guanines and thymines have been identified for v-erbA homodimer, monomer, and intermediate complexes. B, The DNA sequence of clone 7 is indicated with footprinted bases designated by solid circles.

 
The faint v-erbA-DNA complex of intermediate mobility in EMSAs showed identical methylation sensitivity to the monomer complex, suggesting that the faint complex is formed by a v-erbA homodimer interacting only with the downstream half-site.

Role of RXR in v-erbA Binding to the Consensus Sequences
Since it is known that RXR may enhance v-erbA binding to DNA, we desired to address the binding of v-erbA-RXR heterodimers to these different mutant oligonucleotides. For this purpose, we intentionally used a dose of v-erbA that gave minimal homodimer binding. As shown in Fig. 4AGo, v-erbA-RXR heterodimers were formed on ERs with a 5- or 6-bp spacer. On the ER with a 4-bp spacer, neither v-erbA homodimers nor v-erbA-RXR heterodimers were seen. In Fig. 4BGo, v-erbA-RXR heterodimers were formed on DRs with different spacers.



View larger version (87K):
[in this window]
[in a new window]
 
Figure 4. EMSA Analysis of v-erbA/RXR{alpha} Binding to Everted and DR Core Motifs

A, 32P-labeled variably spaced ER probes were incubated with E. coli-expressed v-erbA and/or RXR{alpha} and analyzed by EMSA. R, VA, VAVA, and RVA represent RXR{alpha} monomer, v-erbA monomer, v-erbA homodimer, and RXR{alpha}-v-erbA heterodimer-DNA complexes, respectively. B, Similar to panel A but on variably spaced DRs.

 
Affinity of v-erbA Binding to IR Sequences
During the random DNA pool selection, no IR sequences were obtained, suggesting that v-erbA has a low affinity for homodimer binding to this core motif. To confirm this impression, v-erbA binding to IR0 (TAAGGTCATGACCTTA), a well characterized T3 response element (TRE), was compared with that for an ER with a 6-bp spacer and a DR with a 4-bp spacer. V-erbA is capable of binding as a monomer to IR0, but the affinity for homodimer binding is very poor, much lower than that for the ER and DR (Fig. 5Go). However, RXR enhances the v-erbA binding to IR0 (Fig. 6Go).



View larger version (51K):
[in this window]
[in a new window]
 
Figure 5. EMSA of v-erbA Binding to Differently Oriented Core Motifs

32P-labeled everted (ER6), direct (DR4-M1), and inverted (IR0) repeat probes were incubated with E. coli-expressed v-erbA and analyzed by EMSA. M and D indicate the presence of v-erbA monomer and homodimer DNA complexes, respectively. The asterisk denotes the faint intermediate complex seen previously in Fig. 2Go.

 


View larger version (77K):
[in this window]
[in a new window]
 
Figure 6. EMSA of v-erbA/RXR{alpha} Binding to an Inverted-Repeat Motif

32P-labeled IR sequence (IR0) probe was incubated with E. coli- expressed v-erbA and/or RXR{alpha} and analyzed by EMSA. VA and RVA represent v-erbA monomer and RXR{alpha}-v-erbA-heterodimer-DNA complexes, respectively.

 
The in vitro binding assays also were performed with reticulocyte lysate in vitro translated v-erbA; mock reticulocyte lysate was used as a control. The data obtained with the in vitro translated v-erbA corroborate the binding affinity pattern for homodimers found with E. coli-expressed protein (data not shown).

Subsequently, the DNA binding of v-erbA and TR{alpha}1 homodimers on the panel of oligonucleotides was compared. Overall, TR{alpha}1 homodimers displayed a very similar affinity pattern as v-erbA, with the exception of the mutation of C to A at the end of the 3'-half-site (mutant ER5-M6), which did not affect TR{alpha}1 homodimer binding (data not shown). The same mutation decreased v-erbA homodimer binding by 60% (Fig. 2Go and Table 3Go).

Transient Transfection Analysis of v-erbA Function
V-erbA is a transcriptional repressor in mammalian cells. Therefore, to test the function of the sequences derived from the random selection and their mutant versions as potential v-erbA response elements, we determined their ability to direct v-erbA repression of T3-dependent chloramphenicol acetyltransferase (CAT) expression mediated by TR{alpha}1. JEG-3 human choriocarcinoma cells were used since they have very low levels of endogenous TRs and are transfected with high efficiency and reproducibility (15).

As shown in Fig. 7Go and Table 4Go, the imperfect ER5 supported maximal v-erbA suppression of T3 induction; ER6 also supported a strong v-erbA suppression of T3 induction, but was not as potent as ER5. The difference in v-erbA repressor activity between everted and direct or IRs was dramatic. Thus, v-erbA suppressed T3-mediated CAT activity on ER5 and ER6 to 9.8 ± 1.6% and 20.8 ± 0.2%, respectively, of that observed in the absence of v-erbA; whereas v-erbA suppressed T3-mediated CAT activity on DR4-M1 only to 88.4 ± 4.9% and was without effect on IR0 (97.9 ± 6.7% of that observed in the absence of v-erbA). Importantly, these differing potencies of v-erbA repression are observed despite comparable potencies of T3 induction (e.g. compare ER5 and ER5-M3 vs. DR4-M1 and IR0; Table 4Go). In addition, in the absence of T3, v-erbA suppressed baseline CAT activity 41% and 50% on ER5 and ER6, respectively, but did not suppress baseline CAT activity on DR4-M1 and IR0. Overall, therefore, v-erbA was a strong repressor of T3 induction from ERs, a weak repressor from DRs, and nonfunctional from an IR.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 7. Dominant Negative Effect of v-erbA on TR{alpha}1 Action on Differently Oriented Core Motifs in a Transient Transfection System

A, JEG-3 cells were transfected with the reporter plasmid pUTKAT3 containing a single copy of either an ER containing the consensus sequence for v-erbA homodimer binding with a 5- or 6-bp spacer (ER5 and ER6), a DR with a 4-bp spacer (DR4-M1), or an IR (IR0), along with the internal control plasmid pTKGH. All cells also received expression vectors for TR{alpha}1 ± v-erbA (or empty vector). Cells were cultured for 2 days in the presence of 10 nM T3, after which cell lysates were analyzed for CAT activity and media were analyzed for hGH. B, Similar to A but in the absence of T3.

 

View this table:
[in this window]
[in a new window]
 
Table 4. Function of Oligonucleotides as v-erbA and TR{alpha}1 Response Elements

 
The v-erbA suppression of T3-mediated CAT activity was about 4-fold greater for ER5 than for ER4, the ER with a 4-bp spacer. Mutations within the consensus sequence of ERs, with the exception of ER5-M3, significantly interfered with T3 induction and/or v-erbA repressor activity, as shown in Table 4Go. The repressor activity of v-erbA on the mutants ER5-M2, ER5-M4, and ER5-M6 is difficult to evaluate accurately since these response elements elicited weak T3 induction.

Additional studies were performed to compare the potency of the imperfect ER5–69 vs. the perfect nonamer repeat ER5–99 as potential v-erbA response elements. The T3 induction of CAT from ER5–69 and ER5–99 was 4.6 ± 0.1 and 7.5 ± 0.2 fold, respectively, in the presence of TR{alpha}1. Both constructs were equally potent as v-erbA response elements. Specifically, by cotransfecting 150 ng or 1.5 µg of pRSV-v-erbA, v-erbA suppressed T3-mediated CAT activity on ER5–69 to 41 ± 0.1% and 9.2 ± 0.3% of that observed in the absence of v-erbA, respectively, and on ER5–99 to 44 ± 0.7% and 8.6 ± 0.3% of that observed in the absence of v-erbA, respectively (n = 4). Thus, these data in conjunction with the in vitro binding results indicate that the conserved nonamer sequence (based on the 3'-half-site) is not required in the upstream half-site for optimal binding or repressor activity of v-erbA.

Effect of Cotransfecting RXR on v-erbA’s Repressor Activity on Direct, Everted, and IRs
Experiments were conducted to examine whether cotransfection of RXR would enhance the dominant negative activity of v-erbA. Since 1.5 µg of pRSV-v-erbA led to essentially complete suppression of T3 induction on the ER5, the amount of v-erbA expression vector was decreased to 150 ng for these studies. By cotransfecting 0, 100, and 300 ng of RXRß expression vector, v-erbA suppressed T3-mediated CAT activity on ER5 to 50 ± 3.4%, 50 ± 3.2%, and 51 ± 4.5% of that observed in the absence of v-erbA, respectively (n = 4). Thus, these data indicate that cotransfected RXR has no effect on v-erbA repressor activity from this ER response element. Similarly, cotransfection of RXR did not enhance v-erbA repressor activity on the IR0 (data not shown). However, RXR did enhance the weak repressor activity of v-erbA on the DR element DR4-M1. As shown in Fig. 8Go, by cotransfecting 0, 100, or 1000 ng of RXRß, v-erbA suppressed T3-mediated CAT activity on DR4-M1 to 88 ± 2%, 52 ± 5%, and 20 ± 3% of that observed in the absence of v-erbA, respectively.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 8. Effect of RXRß on the Dominant Negative Activity of v-erbA on T3 Induction from a DR Core Motif

JEG-3 cells were transfected with the reporter plasmid pUTKAT3 containing a single copy of a DR with a 4-bp spacer (DR4-M1), along with the internal control plasmid pTKGH. All cells also received expression vectors for TR{alpha}1 ± v-erbA (or empty vector), and 0, 100 ng, or 1 µg of the expression vector for RXRß. Cells were cultured for 2 days in the presence of 10 nM T3, and then cell lysates were analyzed for CAT activity and media were analyzed for hGH.

 
V-erbA Suppression of RA-Mediated Activity
It is known that v-erbA also behaves as a dominant repressor of transcription regulated by RAR. Therefore, we determined the role of these potential v-erbA response elements in directing v-erbA repression of RA- dependent CAT expression mediated by RAR. Specifically we were interested in DR5, a well characterized retinoic acid response element, DR6, IR0, and ERs. As depicted in Fig. 9Go, DR5, DR6, and IR0 all functioned as retinoic acid response elements, with DR5 being the most potent element.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 9. Dominant Negative Effect of v-erbA on RAR{alpha} Action in a Transient Transfection System

A, JEG-3 cells were transfected with the reporter plasmid pUTKAT3 containing a single copy of either a DR with a 5-bp spacer (DR5), a DR with a 6-bp spacer (DR6), or an IR (IR0) along with the internal control plasmid pTKGH. All cells also received expression vectors for RAR ± v-erbA (or empty vector). Cells were cultured for 2 days in the presence of 1 µM all-trans-RA, after which cell lysates were analyzed for CAT activity and media were analyzed for hGH. B, Similar to panel A but in the absence of all-trans-RA.

 
V-erbA suppressed RA-mediated CAT activity on DR5 and DR6 to 55 ± 3% and 41 ± 1.5% of that observed in the absence of v-erbA, respectively. On IR0, v-erbA suppressed RA-mediated CAT activity to 84 ± 7% of that observed in the absence of v-erbA, confirming that IR0 is not only a low-affinity DNA site for v-erbA homodimer binding but also is a poor response element in directing v-erbA suppression of both T3 and RA action. ERs with a 5- or 6-bp spacer were not RA responsive and therefore could not be tested for v-erbA suppression.

V-erbA Suppression of Vitamin D-Mediated Gene Induction
There is evidence that vitamin D plays a protective role against the development and progression of some neoplasias (16). Therefore, it is possible that the oncogenic mechanism of v-erbA could be mediated, at least in part, by inhibiting vitamin D action.

As shown in Fig. 10Go, DR3 was a potent vitamin D response element, as expected, since a DR of AGGTCA with a 3-bp spacer is a classic vitamin D response element motif. V-erbA suppressed vitamin D-mediated CAT activity on this response element very modestly to 76 ± 4.5% of that observed in the absence of v-erbA. On ERs with a 5-bp spacer (ER5-M3) and 6-bp spacer (ER6), vitamin D-dependent induction of CAT activity was about half that seen with DR3. However, powerful dominant negative activity was mediated by v-erbA on these sites. Specifically, v-erbA suppressed vitamin D-mediated CAT activity on ER5-M3 and ER6 to 10 ± 0.25% and 17 ± 0.8%, respectively, of that observed in the absence of v-erbA. IR0 was not vitamin D responsive and therefore could not be tested for v-erbA suppression.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 10. Dominant Negative Effect of v-erbA on VDR Action in a Transient Transfection System

A, JEG-3 cells were transfected with the reporter plasmid pUTKAT3 containing a single copy of either an ER containing the consensus sequence for v-erbA homodimer with a 5- or 6-bp spacer (ER5-M3 and ER6), or a DR with a 3-bp spacer (DR3), along with the internal control plasmid pTKGH. All cells also received expression vectors for VDR ± v-erbA (or empty vector). Cells were cultured for 2 days in the presence of 30 nM 1{alpha},25-(OH)2D3 after which cell lysates were analyzed for CAT activity and media were analyzed for hGH. B, Similar to A but in the absence of 1{alpha}, 25-(OH)2D3.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
V-erbA is a dominant repressor of transcription, characterized by inhibition of TR and RAR action in mammalian and avian cells. It is still unknown how v-erbA mediates gene suppression. Furthermore it is unclear whether the biologically active v-erbA form is a monomer, homodimer, or heterodimer with RXR or another auxiliary factor. Since infected cells with the avian erythroblastosis virus express high levels of v-erbA (17), it is possible that v-erbA by itself, as either monomers or homodimers, could play an important role in v-erbA’s action.

Our current results indicate that the highest affinity sequence for v-erbA homodimer binding is the imperfect ER, TGACC(T/C)NxT(A/G)AGGTCAC, where Nx represents any three or four nucleotides, thus creating an ER5 or ER6 of the two classic AGGTCA-like hexamers. The consensus sequence for v-erbA homodimer binding on DRs also is an imperfect repeat, (A/G)(A/G)GGTCANxT(A/G)AGGTCAC, in this case with significant spacer flexibility. It was surprising that the two v-erbA-binding half-sites in the idealized selected sequences are not identical. This was true both for the optimal ER and the optimal DR. Thus, when a v-erbA homodimer binds DNA, each of the two v-erbA molecules has a different DNA sequence specificity. The 3'-binding site is essentially identical to the optimal v-erbA monomer-binding site (14), and by footprinting it is the site occupied when v-erbA monomers bind to these homodimer-selected elements. The 5'-binding site, however, has a different and less specific sequence requirement. This could be explained in a number of ways. Since v-erbA homodimers are not very stable in solution, a v-erbA monomer probably binds first to DNA. When a second v-erbA molecule binds, the overall complex is stabilized by protein-protein as well as protein-DNA interactions. The second v-erbA to bind, which occupies the 5'-half-site, could have a more relaxed DNA sequence requirement because its binding will be stabilized by interactions with the already-bound v-erbA monomer. Also, the v-erbA monomer-DNA interaction could result in DNA bending or other conformationl changes in the DNA, which could alter the sequence requirements for binding of the second v-erbA molecule. Finally, the protein-protein interactions in a v-erbA homodimer could result in asymmetric conformational changes in the two v-erbA molecules, resulting in differing DNA binding specificities. Taken together, the findings of a different DNA-binding preference for the 5' and 3' v-erbA molecules has important implications for protein-DNA interactions in general. This observation indicates that the DNA-binding specificity of a protein is determined not only by the amino acid sequence of the protein, but also by protein-protein interactions, half-site orientation, and the relative position of the protein on the response element (5' vs. 3').

Overall, the transfection data correlate well with the DNA-binding affinity for v-erbA homodimers in that ERs containing the consensus sequence with a 5- or 6-bp spacer are the most potent v-erbA response elements, followed by DRs, and with IR sequences being essentially nonfunctional. However, there are some discrepancies between EMSAs and transfection data. For example, ER5 is twice as potent as ER6 in directing v-erbA suppresion of T3 action, which is not explained by differences in binding affinities of v-erbA monomer, homodimer, or heterodimer with RXR between these two core motifs in EMSAs. One possible explanation could involve a recently described family of corepressors (N-CoR, SMRT) (18, 19). These proteins interact with the hinge region and the proximal portion of the carboxy-terminal (ligand-binding) domain of the unliganded members of the TR and RAR family, playing a major role in suppression of basal transcription. This interaction is destabilized by ligand. These corepressors can also interact with v-erbA, which has no known ligand, playing an important role in the dominant negative activity of this oncoprotein. It is possible that allosteric structural changes imposed on the receptor by DNA binding to differently oriented core motifs, differences in spacing, DNA sequence (optimal vs. traditional hexamer), as well as protein-protein interactions (homodimers vs. heterodimers with RXRs), influence the nature and the affinity of corepressor binding to the receptor.

Although RXRs can heterodimerize with v-erbA, the functional significance of this is not clear. If indeed, RXR plays a role in v-erbA action, we would predict that this effect will be conditioned to the arrangement of the core motifs: more important for DRs (weak v-erbA homodimer sites) and less important or irrelevant for core motifs arranged as ERs (strong v-erbA homodimer sites). Our results indicate that DRs, to become potent v-erbA response elements, require significant amounts of cotransfected RXR. In contrast, on ERs the cotransfection of RXR has no effect on v-erbA suppressor activity. However, it is possible that endogenous RXRs play a role in v-erbA action on ERs. This is difficult to assess as RXR null cell lines do not exist. Taken together our data indicate:

1. The most potent v-erbA response element is the ER containing the consensus sequence with a 5-bp spacer and, to a lesser extent, with a 6-bp spacer. V-erbA’s suppressor activity on ERs is most likely mediated by v-erbA homodimers although we cannot rule out that heterodimer formation between v-erbA and endogenous auxiliary protein(s) accounts for some of this repressor activity.

2. DRs are weaker v-erbA response elements than ERs. This is in agreement with a previous report showing that an ER6 is a more potent v-erbA response element than a DR4 (13).

At least on DR4, significant v-erbA suppressor activity is dependent on large amounts of cotransfected RXR. However, cotransfected RXR does not increase T3 induction on this response element. These data suggest that there is a difference between the ability of endogenous RXRs to cooperate with TR vs. v-erbA.

Previous studies have shown a significant v-erbA-mediated suppressor activity on T3 action on the IR, TRE palindrome (7, 8, 20, 21). However, in two of these studies, two copies of TRE palindrome were used, thus becoming a complex TRE (20, 21). Furthermore, these two copies were inserted consecutively, and it is possible that the downstream half-site of the first insert and the upstream half-site of the second insert could create an ER that would be the core motif responsible for the suppression activity. Others used much higher amounts of pRSV-v-erbA (up to 10 µg) (7, 8). However, our selection data, in vitro binding affinities, and transfection studies indicate that IRs are substantially weaker v-erbA-binding sites and v-erbA-response elements than everted and DRs.

Vitamin D plays an important role in promoting cell differentiation and inhibiting cell proliferation in many tissues (16). Vitamin D analogs have been shown to be potent activators of the differentiation and inhibitors of the proliferation of myeloid leukemia cells, breast cancer, and other tumors (16). Therefore it is possible that the oncogenic mechanism behind v-erbA action could be mediated by the inhibition of vitamin D action, which has not been addressed previously. Our results indicate that v-erbA has a modest suppressive effect of vitamin D action on DR3. Although ERs with a 5- or 6-bp spacer are somewhat weaker vitamin D-response elements than DR3, v-erbA is a potent repressor of vitamin D action on ERs. By extension, it is possible that mutated forms of endogenous receptors with dominant negative activity similar to v-erbA would inhibit vitamin D action in particular tissues and play a role in neoplastic formation.

Mutant forms of nuclear receptors have been implicated in a variety of endocrine and neoplastic diseases, including mutations in TRß in the generalized thyroid hormone resistance syndrome, mutations in the VDR in vitamin D-resistant rickets type II, PML-RAR fusion protein in promyelocytic leukemia, and mutations in the estrogen receptor in hormone-resistant breast cancers (22, 23, 24, 25). In the majority, the mutant receptor appears to function as a dominant negative form inducing the disease by interfering with the action of the normal receptor counterpart. Therefore, a better understanding of v-erbA action may lead to important findings that can be applied to other clinical situations involving dominant negative transcription factors.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Production and Purification of Proteins
V-erbA, mouse TR{alpha}1, and mouse RXR{alpha} were produced in E. coli using the vector pMAL (New England Biolabs, Beverley, MA) as described previously (14, 26, 27). This vector produces a fusion protein of MBP followed by a cleavage site for factor Xa and the receptor of interest. The fusion proteins were purified by amylose chromatography and cleaved with factor Xa. The final products were shown by SDS-PAGE to be of the appropriate size (data not shown).

V-erbA and mouse TR{alpha}1 cDNAs were also transcribed from pBluescript plasmids and then translated in rabbit reticulocyte lysate (Promega, Madison, WI) in the presence of [3H] leucine as described previously (28). Trichloroacetic acid-precipitable protein counts per minute were determined, and the products were analyzed by SDS-PAGE.

Random DNA Pool Construction
Oligonucleotide primers A (5'-TCCGAATTCCTACAG) and B (5'-AGACGGATCCATTGCA) were synthesized. A pool of oligonucleotides 49 nucleotides in length was synthesized containing the primer A sequence at the 5'- end, an internal random sequence of 18 nucleotides, and the reverse complement of primer B at the 3'-end. This internally random sequence oligonucleotide pool was converted to double-stranded DNA by annealing with primer B and filling in with a Klenow reaction. The double-stranded pool was purified by PAGE.

Using this pool and the EMSA selection process described below, we were able to characterize the 3'-half-site for v-erbA homodimer binding and apparently the 5'-half-site. To confirm the selection at the 5'- half-site, a pool of oligonucleotides of 57 nucleotides in length was synthesized containing an internal 16-nucleotide random span followed by TGAGGTCACg (consensus sequence at the 3'-half-site for v-erbA homodimer binding in capital letters). Primer A and the reverse complement of primer B sequences were placed at the 5'- and 3'-ends, respectively. This oligonucleotide pool was made double stranded as described above.

EMSA
Protein-DNA-binding reactions were performed in 35 µl of 20 mM HEPES, pH 7.8, 20% glycerol, 1.4 µg poly(deoxyinosinic-deoxycytidylic)acid, 1 mM dithiothreitol, 50 mM KCl (in the later steps of the selection process, up to 400 mM KCl was employed), 0.1% Nonidet P40 (NP-40), 32P-labeled DNA, and the protein(s) of interest. The amounts of protein and 32P-labeled DNA are specified in subsequent sections. Reactions were incubated at room temperature for 45 min before electrophoresis. Electrophoresis was carried out on 0.25x TBE (22 mM Tris base, 22 mM boric acid, 0.5 mM EDTA) 6% polyacrylamide gels (29:1 acrylamide-bisacrylamide) at room temperature. Wet gels were exposed to film for 24 h at 4 C during the selection process. For all other EMSAs, gels were fixed in 30% methanol-10% acetic acid, dried, and exposed to film with an intensifying screen for 12–36 h at -70 C.

Selection Process
The random pool of double-stranded DNA was end-labeled with [{gamma}-32P]ATP by T4 polynucleotide kinase. An EMSA was performed with 40,000 cpm of 32P-labeled random DNA pool plus 40 ng nonradiolabeled random DNA pool and 5 µg v-erbA. In the initial round of selection we expected the v-erbA-DNA complex to be undectectable. Therefore, we constructed a 52-bp fragment containing a DR4 of the hexamer AGGTCA as a marker. The location of the marker DNA-v-erbA complex was used as a reference to identify the portion of the gel to excise in the random DNA pool-v-erbA lane. The DNA was eluted into 0.1% SDS-0.5 M NH4OAc-1 mM EDTA, ethanol precipitated, and amplified by PCR using primers A and B. Cycling conditions included 1 min each of denaturation at 94 C, annealing at 56 C, and extension at 72 C for 30 cycles. The products were purified by PAGE, and the selection process was repeated. For subsequent selections, 40,000 cpm of 32P-labeled DNA pool without nonradiolabeled DNA were used in the protein-DNA incubations.

Eight rounds of selection were performed in total. In the third round of EMSA, a v-erbA-32P-labeled DNA complex with a mobility consistent with homodimer formation could be visualized. In the first two rounds, the protein-DNA incubations used 50 mM KCl, and in the first six rounds 5 µg v-erbA were employed. To select for higher affinity binding sites, rounds 3–5 and 6–8 were performed with 150 mM and 400 mM KCl, respectively, and the amount of v-erb-A was reduced to 500 ng for rounds 7 and 8. The selected v-erbA-binding DNA pool was ligated into the BamHI site of the plasmid vector pUTKAT3 (29). Individual bacterial clones were isolated and used to generate plasmid DNA. The sequences of all clones were determined by the dideoxynucleotide method using vector primers. With this approach we were able to identify the consensus sequence at the 3'-half-site. Consensus sequences at the 5'-half-site were also obtained; however, sequences from either primer were used as part of that half-site in many of the clones. Therefore, to confirm the selection of the upstream half-site for v-erbA homodimer binding, the double-stranded 57-bp oligonucleotide described above, containing an internal 16-bp random span followed by TGAGGTCACG, was subjected to six rounds of selection. In the initial two rounds, the protein-DNA incubations used 50 mM KCl and 2.5 µg v-erbA. Rounds 3 and 4 were performed with 150 mM KCl, and the amount of v-erbA was reduced to 250 ng, whereas rounds 5 and 6 were done with 400 mM KCl and the amount of v-erbA was decreased to 50 ng. Subcloning and DNA sequencing were performed as already described.

Guanine Methylation Interference and Uracil Interference Analysis
This was performed on clone 7 using methylation interference (30) to identify critical guanine residues and uracil interference (31) to identify critical thymine residues. For these studies the DNA was radiolabeled on either strand by performing a PCR in which one of the two primers had been labeled at its 5'-end with [{gamma}-32P]ATP. The PCR reactions were spiked with a small amount of dUTP, and the products were purified by PAGE and then methylated with dimethylsulfate. The probes were incubated with v-erbA, subjected to EMSA, and the protein-DNA complexes were eluted. Cleavage at methyl guanines and uracils was accomplished by standard protocols (30, 31), and the products were analyzed on a 10% polyacrylamide-sequencing gel.

Mutational Analysis
Several mutant-oligonucleotide versions of the consensus everted and DR sequences were made by changing 1–3 bp at a time scanning accross the consensus sequences. Also, an oligonucleotide containing an IR sequence with no spacing between half-sites (IR0) was synthesized. In addition, oligonucleotides arranged as ERs with a 5-bp spacer were synthesized containing either the perfect nonamer sequence in both half-sites (ER5–99) or the perfect nonamer sequence at the 3'-half- site with the traditional hexamer at the 5'-half-site (ER5–69); the latter represents the consensus sequence for v-erbA homodimer binding found in the selection process. The sequences of these mutant oligonucleotides are given in Table 3Go, except for ER5–99 and ER5–69, which are shown below (top strands excluding GATC overhangs).

ER5–99 CGGGCCGTGACCTCATTGAGGTCACG

ER5–69 CGGGCCATGACCTACTTGAGGTCACG

Oligonucleotides (double-stranded) were 32P-labeled by Klenow fill-in, and their binding to v-erbA was tested by EMSA and PhosphorImager (Molecular Dynamics, Sunnyvale, CA) analysis. Each oligonucleotide was assayed at least twice. The data were used in conjuction with the methylation sensitivity data to assess which bases are most important for protein-DNA binding.

Competition Assays
These studies were performed with the oligonucleotides ER5–99 and ER5–69. To accomplish this, 32P-labeled ER5–99 oligonucleotide (40,000 cpm) was incubated with 100 ng v-erbA plus graded doses of nonradiolabeled ER5–99 or ER5–69. The amount of this competitor DNA required to reduce the intensity of the standard 32P-labeled ER5–99 DNA-v-erbA homodimer complex by 50% (C50 measured by densitometry of autoradiograms) was taken as a measure of relative affinity. Competition assays were performed twice.

Transient Transfections
JEG-3 cells were grown in 90% Eagle’s MEM plus 10% FBS and were transfected using standard calcium phosphate precipitation (32). The oligonucleotides described in the mutational analysis were used as potential v-erbA response elements. These mutant oligonucleotides were ligated as single inserts into pUTKAT3 at a BamHI site 5' to the basal herpes simplex virus thymidine kinase promoter driving expression of CAT (29). Reporter plasmids were transfected at a dose of 4 µg per 60-mm Petri dish. Mouse TR{alpha}1, rat RXRß, human RAR{alpha}, and human VDR were expressed from the vector pCDM (32); v-erbA was expressed from the vector pRSV (33). Transfections included 100 ng of either pCDMTR{alpha}1, pCDMRAR{alpha}, or pCDMVDR, which represents a nonsaturating dose of these expression plasmids, different amounts of pCDMRXRß (0, 100 ng, 300 ng, 1 µg), and 1.5 µg of pRSV-v-erbA (or vector). The amount of pRSV-v-erbA was reduced to 150 ng in experiments containing the ER5 and cotransfected RXRß. Vector pCDM was added to achieve a total of 3 µg pCDM-based plasmid per transfection.

Cotransfections included 1 µg of a human GH-expressing vector (pTKGH) per 60-mm Petri dish to control for transfection efficiency. Cells were transfected in the presence of 10% charcoal-stripped FBS and 100 nM dexamethasone. Cells were cultured ± the appropiate ligand [10 nM T3, 1 µM all-trans-retinoic acid (RA) or 30 nM 1{alpha},25-dihydroxyvitamin D3 (1{alpha},25-(OH)2 vitamin D3)] for 2 days before harvest. Transfections involving all-trans-RA or 1{alpha},25-(OH)2 vitamin D3 were done under conditions of subdued light. CAT and hGH assays were performed as described previously (32). Ligand responsiveness is defined as CAT/hGH for cells cultured with ligand divided by CAT/hGH for cells cultured without ligand. V-erbA suppression of CAT reporter gene expression was calculated as CAT/hGH for cells cultured with v-erbA divided by CAT/hGH for cells cultured without v-erbA in the presence or absence of ligand. Results are presented as the mean ± SE for four independent transfections per assay condition.


    ACKNOWLEDGMENTS
 
The authors would like to thank Rajam Radhakrishnan for her assistance in these experiments and Leon Hebert and Robert Cooksey for the preparation of the figures. We thank M. Privalsky for the v-erbA antiserum, C. Glass and M. G. Rosenfeld for the rat RXRß cDNA, P. Chambon for the mouse RXR{alpha} cDNA, J. W. Pike for the human VDR cDNA, and R. Evans for the v-erbA cDNA, the human RAR{alpha} cDNA, and the Rous sarcoma virus expression vector.


    FOOTNOTES
 
Address requests for reprints to: Jose S. Subauste, M.D., G.V. (Sonny) Montgomery Veterans Administration Medical Center, R & E Building, Room 422, 1500 East Woodrow Wilson Drive, Jackson, Mississippi 39216.

This work was supported by NIH Grant DK-44155 and Biomedical Research Support Grant of the University of Mississippi Medical Center.

Received for publication July 28, 1997. Revision received May 8, 1998. Accepted for publication May 14, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Graf T, Beug H 1983 Role of the v-erbA and v-erbB oncogenes of avian erythroblastosis virus in erythroid cell transformation. Cell 34:7–9[CrossRef][Medline]
  2. Gandrillon O, Jurdic P, Benchaibi M, Xiao JH, Ghysdael J, Samarut J 1987 Expression of the v-erbA oncogene in chicken embryo fibroblasts stimulates their proliferation in vitro and enhances tumor growth in vivo. Cell 49:687–697[CrossRef][Medline]
  3. Frykberg L, Palmieri S, Beug H, Graf T, Hayman M, Vennstrom B 1983 Transforming capacities of avian erythroblastosis virus mutants deleted in the erbA or erbB oncogenes. Cell 32:227–238[CrossRef][Medline]
  4. Glass CK 1994 Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr Rev 15:391–407[CrossRef][Medline]
  5. Umesono K, Evans RM 1989 Determinants of target gene specificity for steroid/thyroid hormone receptors. Cell 57:1139–1146[CrossRef][Medline]
  6. Sap J, Munoz A, Damm K, Goldberg Y, Ghysdael J, Leutz A, Beug H, Vennstrom B 1986 The c-erbA protein is a high affinity receptor for thyroid hormone. Nature 324:635–640[CrossRef][Medline]
  7. Sharif M, Privalsky ML 1991 V-erbA oncogene function in neoplasia correlates with its ability to repress retinoic acid. Cell 66:885–893[CrossRef][Medline]
  8. Damm K, Thompson CC, Evans RM 1989 Protein encoded by v-erbA functions as a thyroid-hormone receptor antagonist. Nature 339:593–597[CrossRef][Medline]
  9. Zechel C, Shen X, Chen J, Chen Z, Chambon P, Gronemeyer H 1994 The dimerization interfaces formed between the DNA binding domains of RXR, RAR and TR determine the binding specificity and polarity of the full-length receptors to direct repeats. EMBO J 13:1425–1433[Medline]
  10. Perlmann T, Rangarajan P, Umesono K, Evans RM 1993 Determinants for selective RAR and TR recognition of direct repeat HREs. Genes Dev 7:1411–1422[Abstract/Free Full Text]
  11. Umesono K, Murakami KK, Thompson CC, Evans RM 1991 Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65:1255–1266[CrossRef][Medline]
  12. Mangelsdorf DJ, Umesono K, Kliewer SA, Borgmeyer U, Ong ES, Evans RM 1991 A direct repeat in the cellular retinol-binding protein type II confers differential regulation by RXR and RAR. Cell 66:555–561[CrossRef][Medline]
  13. Yen PM, Ikeda M, Brubaker JH, Forgione M, Sugawara A, Chin WW 1994 Roles of v-erbA homodimers and heterodimers in mediating dominant negative activity by v-erbA. J Biol Chem 269:903–909[Abstract/Free Full Text]
  14. Subauste JS, Koenig RJ 1995 Comparison of the DNA binding specificity and function of v-erbA and thyroid hormone receptor {alpha}1. J Biol Chem 270:7957–7962[Abstract/Free Full Text]
  15. Koenig RJ, Lazar MA, Hodin RA, Brent GA, Larsen PR, Chin WW, Moore DD 1989 Inhibition of thyroid hormone action by a non-hormone binding c-erbA protein generated by alternative mRNA splicing. Nature 337:659–661[CrossRef][Medline]
  16. Bikle DD 1992 Vitamin D: new actions, new analogs, new therapeutic potential. Endocr Rev 13:765–784[CrossRef][Medline]
  17. Chen H, Smit-McBride Z, Lewis S, Sharif M, Privalsky ML 1993 Nuclear hormone receptors involved in neoplasia: erbA exhibits a novel DNA sequence specificity determined by amino acids outside of the zinc-finger domain. Mol Cell Biol 13:2366–2376[Abstract/Free Full Text]
  18. Chen DJ, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]
  19. Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Soderstrom M, Glass C, Rosenfeld M 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–404[CrossRef][Medline]
  20. Hermann T, Hoffmann B, Piedrafita FJ, Zhang X, Pfahl M 1993 V-erbA requires auxiliary proteins for dominant negative activity. Oncogene 8:55–65[Medline]
  21. Damm K, Evans RM 1993 Identification of a domain required for oncogenic activity and transcriptional suppression by v-erbA and thyroid-hormone receptor {alpha}. Proc Natl Acad Sci USA 90:10668–10672[Abstract/Free Full Text]
  22. Nagaya T, Madison LD, Jameson JL 1992 Thyroid hormone receptor mutants that cause resistance to thyroid hormone. Evidence for receptor competition for DNA sequences in target genes. J Biol Chem 267:13014–13019[Abstract/Free Full Text]
  23. Kakizuka A, Miller WH, Umesono K, Warell RP, Frankel SR, Murty VV, Dimitrovsky E, Evans RM 1991 Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR {alpha} with a novel putative transcription factor. Cell 66:663–674[CrossRef][Medline]
  24. Hughes MR, Malloy PJ, Kieback DG, Kesterson RA, Pike JW, Feldman D, O’Malley BW 1988 Point mutations in the human vitamin D receptor gene associated with hypocalcemic rickets. Science 242:1702–1705[Abstract/Free Full Text]
  25. Horowitz KB 1992 Cellular heterogeneity and mutant oestrogen receptors in hormone resistant breast cancers. Cancer Surv 14:41–54[Medline]
  26. Katz RW, Koenig RJ 1993 Nonbiased identification of DNA sequences that bind thyroid hormone receptor {alpha}1 with high affinity. J Biol Chem 268:19392–19397[Abstract/Free Full Text]
  27. Subauste JS, Katz RW, Koenig RJ 1994 DNA binding specificity and function of retinoid X receptor {alpha}. J Biol Chem 269:30232–30237[Abstract/Free Full Text]
  28. Prost E, Koenig RJ, Moore DD, Larsen PR, Whalen RG 1988 Multiple sequences encoding potential thyroid hormone receptors isolated from mouse skeletal muscle cDNA libraries. Nucleic Acids Res 16:6248[Free Full Text]
  29. Prost E, Moore DD 1986 CAT vectors for analysis of eukaryotic promoters and enhancers. Gene 45:107–111[CrossRef][Medline]
  30. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (eds) 1994 Current Protocols in Molecular Biology. John Wiley & Sons, New York, pp 12.3.1–12.3.7
  31. Pu WT, Struhl K 1992 Uracil interference, a rapid and general method for defining protein-DNA interactions involving the 5-methyl group of thymines: the GCN4-DNA complex. Nucleic Acids Res 20:771–775[Abstract/Free Full Text]
  32. Koenig RJ, Warne RL, Brent GA, Harney JW, Larsen PR, Moore DD 1988 Isolation of a cDNA clone encoding a biologically active thyroid hormone receptor. Proc Natl Acad Sci USA 85:5031–5035[Abstract/Free Full Text]
  33. Thompson CC, Evans RM 1989 Trans-activation by thyroid hormone receptors: functional parallels with steroid hormone receptors. Proc Natl Acad Sci USA 86:3494–3498[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
G. M. C. Bonamy, A. Guiochon-Mantel, and L. A. Allison
Cancer Promoted by the Oncoprotein v-ErbA May Be Due to Subcellular Mislocalization of Nuclear Receptors
Mol. Endocrinol., May 1, 2005; 19(5): 1213 - 1230.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
D. Kamashev, D. Vitoux, and H. de The
PML-RARA-RXR Oligomers Mediate Retinoid and Rexinoid/cAMP Cross-Talk in Acute Promyelocytic Leukemia Cell Differentiation
J. Exp. Med., April 19, 2004; 199(8): 1163 - 1174.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. J. DeLong, G. M. C. Bonamy, E. N. Fink, and L. A. Allison
Nuclear Export of the Oncoprotein v-ErbA Is Mediated by Acquisition of a Viral Nuclear Export Sequence
J. Biol. Chem., April 9, 2004; 279(15): 15356 - 15367.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Shen and J. S. Subauste
Dimerization Interfaces of v-ErbA Homodimers and Heterodimers with Retinoid X Receptor alpha
J. Biol. Chem., December 22, 2000; 275(52): 41018 - 41027.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Chen, B. Hu, E. A. Allegretto, and J. S. Adams
The Vitamin D Response Element-binding Protein. A NOVEL DOMINANT-NEGATIVE REGULATOR OF VITAMIN D-DIRECTED TRANSACTIVATION
J. Biol. Chem., November 3, 2000; 275(45): 35557 - 35564.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal