| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Endocrinology and Metabolism (J.S.S.) University of
Mississippi Medical Center and G. V. (Sonny) Montgomery
Veterans Administration Medical Center (J.S.S.) Jackson,
Mississippi 39216
Division of Endocrinology and Metabolism
(R.J.K.), University of Michigan Medical Center Ann Arbor,
Michigan 48109-0678
| ABSTRACT |
|---|
|
|
|---|
1 that is virtually incapable of
binding T3. V-erbA is a dominant repressor of
transcription induced by thyroid hormone receptors and retinoic acid
receptors; however, the genetic targets of v-erbA that lead to
oncogenesis are not known. Although v-erbA can bind as monomers and
dimers to DNA containing the consensus sequence AGGTCA arranged as
direct, inverted, or everted repeats, it is not known which sequence
represents the optimal v-erbA-binding site. Determination of the DNA
recognition properties of v-erbA would allow a better understanding
of the repressor activity of this oncoprotein. The current studies, by
using a random DNA selection strategy, have determined that the
imperfect everted repeat 5'-TGACC(T/C)NT(A/G)AGGTCAC is the optimal
v-erbA homodimer-binding site, where N represents any di- or
trinucleotide. Functional studies show that everted repeats containing
this sequence are substantially more potent v-erbA response
elements than direct or inverted repeats, even though many classic
T3 response elements are direct repeats. Thus,
v-erbA represses only a subset of T3 response
elements. In a similar fashion, v-erbA was found to repress a subset of
vitamin D response elements. Of general interest, the data indicate
that the two molecules of a transcription factor homodimer do not
necessarily have identical DNA-binding specificities. | INTRODUCTION |
|---|
|
|
|---|
V-erbA is a mutated form of TR
1. A comparison of the amino acid
sequences of the chicken TR
1 and v-erbA proteins indicates that
v-erbA has undergone 13 single amino acid mutations (6), two of which
are located in the P and D boxes. In addition, a 9-amino acid deletion
is found in the carboxy-terminal domain of v-erbA (6). As a consequence
of these mutations, v-erbA is unable to bind T3 in
mammalian cells (6).
In mammalian and avian cells, v-erbA acts as a constitutive dominant repressor of transcription regulated by TR and RAR (7, 8). However, it is not clear whether v-erbAs oncogenic function is based on suppression of TR or RAR function or whether it is mediated through uncharacterized v-erbA-responsive genes.
V-erbA and other members of this family can bind to response elements containing sequences related to AGGTCA arranged as direct, everted, or inverted repeats (IRs) (4). (Using past convention, an everted repeat (ER) is exemplified by TGACCT... AGGTCA, and an IR by AGGTCA... TGACCT.) In the case of direct repeats (DRs), the spacing preference between half-sites is dictated by a dimerization interface within the DNA-binding domain (9, 10). Thus, a DR of AGGTCA with a 1-bp spacer (DR1) is a response element for RXR, whereas DR3, DR4, and DR5 are response elements for VDR, TR, and RAR, respectively (11, 12).
V-erbA can bind as monomers, homodimers, and heterodimers with RXR to DNA containing the consensus sequence AGGTCA (8, 13). However, it is not clear that the hexamer AGGTCA represents the optimal binding site for v-erbA. Moreover, it remains unclear whether the biologically active v-erbA form is a monomer, homodimer, or heterodimer with RXR or another auxilliary protein. Therefore, the determination of the DNA recognition properties of v-erbA will be critical for achieving a better understanding of the repressor action of this oncoprotein and may provide insight into the molecular basis underlying the action of dominant negative forms of nuclear receptors in general.
The experiments described below characterize, by a nonbiased approach, the highest affinity DNA sequences for v-erbA homodimer binding and test the function of these sequences as potential response elements directing v-erbA suppression of TR, RAR, and VDR action.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
The selected consensus sequence is an imperfect ER in that the 5'-half-site has a less stringent nucleotide specificity than the 3'-half-site (reverse complement of (A/G)GGTCA vs. T(A/G)AGGTCAC; the 3'-half-site is an extended version of the 5'-half-site). As this result was unexpected, a competition EMSA was performed to confirm that the imperfect ER (ER569) binds v-erbA homodimers with an affinity equal to a perfect ER of the 3'-half-site nonamer (ER599). EMSAs were carried out using 32P-labeled oligonucleotide ER599 as a probe plus graded doses of either ER599 or ER569 as competitor DNAs. The dose of each competitor DNA required to diminish the 32P-labeled ER599-v-erbA homodimer band intensity by 50% was calculated. The data confirmed that oligonucleotides ER569 and ER599 display similar affinities for v-erbA homodimers (C50 values for ER569 and ER599 were 0.8 and 1 ng, respectively).
A faint intermediate complex migrating between the monomer and
homodimer complexes was also seen (Fig. 2
). This band was supershifted
by a specific v-erbA antibody (gift of M. Privalsky; data not
shown), indicating that it contains v-erbA. The band was not affected
by an anti-maltose-binding protein (MBP) antibody and did not comigrate
with an MBP-v-erbA fusion protein-DNA complex (data not shown),
indicating that the band does not contain MBP or MBP-v-erbA fusion
protein. For reasons discussed below, we believe this band may
represent a v-erbA homodimer bound only to the 3'-half-site.
Guanine Methylation Interference and Uracil Interference
Footprinting
To confirm the sequence assignments, guanine methylation
interference and uracil interference analyses were performed on a
high-affinity clone containing an ER sequence with a 5-bp spacer (clone
7). When the probes were incubated with v-erbA and subjected to EMSA,
two predominant protein-DNA complexes formed, corresponding to the
v-erbA monomer and homodimer. Also a third faint complex was detected
migrating between the monomer and the homodimer bands. All three
protein-DNA complexes were analyzed for methylation sensitivity. As
shown in Fig. 3
, interference was
observed on both half-sites for the v-erbA homodimer, whereas it was
seen only on the 3'-half-site for the v-erbA monomer. These findings,
in conjunction with the mutational analysis, indicate that indeed there
is v-erbA homodimer formation rather than independent occupancy of two
half-sites by two protein molecules. Specifically, DNA interference
footprinting showed that v-erbA as a monomer interacts with the
3'-half-site only. Furthermore, mutations within the 5'-half-site
(ER5-M2) disrupt v-erbA homodimerization without affecting v-erbA
monomer formation, whereas mutations within the 3'-half-site disrupt
both v-erbA monomer and homodimer formation (ER5-M5). Taken together,
these data indicate that the 5'-half-site is not used for v-erbA
monomer binding, and therefore the occupancy of both half-sites must be
mediated by v-erbA homodimerization.
|
Role of RXR in v-erbA Binding to the Consensus Sequences
Since it is known that RXR may enhance v-erbA binding to DNA, we
desired to address the binding of v-erbA-RXR heterodimers to these
different mutant oligonucleotides. For this purpose, we intentionally
used a dose of v-erbA that gave minimal homodimer binding. As shown in
Fig. 4A
, v-erbA-RXR heterodimers were
formed on ERs with a 5- or 6-bp spacer. On the ER with a 4-bp spacer,
neither v-erbA homodimers nor v-erbA-RXR heterodimers were seen. In
Fig. 4B
, v-erbA-RXR heterodimers were formed on DRs with different
spacers.
|
|
|
Subsequently, the DNA binding of v-erbA and TR
1 homodimers on the
panel of oligonucleotides was compared. Overall, TR
1 homodimers
displayed a very similar affinity pattern as v-erbA, with the exception
of the mutation of C to A at the end of the 3'-half-site (mutant
ER5-M6), which did not affect TR
1 homodimer binding (data not
shown). The same mutation decreased v-erbA homodimer binding by 60%
(Fig. 2
and Table 3
).
Transient Transfection Analysis of v-erbA Function
V-erbA is a transcriptional repressor in mammalian cells.
Therefore, to test the function of the sequences derived from the
random selection and their mutant versions as potential v-erbA response
elements, we determined their ability to direct v-erbA repression of
T3-dependent chloramphenicol acetyltransferase (CAT)
expression mediated by TR
1. JEG-3 human choriocarcinoma cells were
used since they have very low levels of endogenous TRs and are
transfected with high efficiency and reproducibility (15).
As shown in Fig. 7
and Table 4
, the imperfect ER5 supported maximal
v-erbA suppression of T3 induction; ER6 also supported a
strong v-erbA suppression of T3 induction, but was not as
potent as ER5. The difference in v-erbA repressor activity between
everted and direct or IRs was dramatic. Thus, v-erbA suppressed
T3-mediated CAT activity on ER5 and ER6 to 9.8 ±
1.6% and 20.8 ± 0.2%, respectively, of that observed in the
absence of v-erbA; whereas v-erbA suppressed T3-mediated
CAT activity on DR4-M1 only to 88.4 ± 4.9% and was without
effect on IR0 (97.9 ± 6.7% of that observed in the absence of
v-erbA). Importantly, these differing potencies of v-erbA repression
are observed despite comparable potencies of T3 induction
(e.g. compare ER5 and ER5-M3 vs. DR4-M1 and IR0;
Table 4
). In addition, in the absence of T3, v-erbA
suppressed baseline CAT activity 41% and 50% on ER5 and ER6,
respectively, but did not suppress baseline CAT activity on DR4-M1 and
IR0. Overall, therefore, v-erbA was a strong repressor of
T3 induction from ERs, a weak repressor from DRs, and
nonfunctional from an IR.
|
|
Additional studies were performed to compare the potency of the
imperfect ER569 vs. the perfect nonamer repeat ER599 as
potential v-erbA response elements. The T3 induction of CAT
from ER569 and ER599 was 4.6 ± 0.1 and 7.5 ± 0.2 fold,
respectively, in the presence of TR
1. Both constructs were equally
potent as v-erbA response elements. Specifically, by cotransfecting 150
ng or 1.5 µg of pRSV-v-erbA, v-erbA suppressed
T3-mediated CAT activity on ER569 to 41 ± 0.1% and
9.2 ± 0.3% of that observed in the absence of v-erbA,
respectively, and on ER599 to 44 ± 0.7% and 8.6 ± 0.3%
of that observed in the absence of v-erbA, respectively (n = 4).
Thus, these data in conjunction with the in vitro binding
results indicate that the conserved nonamer sequence (based on the
3'-half-site) is not required in the upstream half-site for optimal
binding or repressor activity of v-erbA.
Effect of Cotransfecting RXR on v-erbAs Repressor Activity on
Direct, Everted, and IRs
Experiments were conducted to examine whether cotransfection of
RXR would enhance the dominant negative activity of v-erbA. Since 1.5
µg of pRSV-v-erbA led to essentially complete suppression of
T3 induction on the ER5, the amount of v-erbA expression
vector was decreased to 150 ng for these studies. By cotransfecting 0,
100, and 300 ng of RXRß expression vector, v-erbA suppressed
T3-mediated CAT activity on ER5 to 50 ± 3.4%,
50 ± 3.2%, and 51 ± 4.5% of that observed in the absence
of v-erbA, respectively (n = 4). Thus, these data indicate that
cotransfected RXR has no effect on v-erbA repressor activity from this
ER response element. Similarly, cotransfection of RXR did not enhance
v-erbA repressor activity on the IR0 (data not shown). However, RXR did
enhance the weak repressor activity of v-erbA on the DR element DR4-M1.
As shown in Fig. 8
, by cotransfecting 0,
100, or 1000 ng of RXRß, v-erbA suppressed T3-mediated
CAT activity on DR4-M1 to 88 ± 2%, 52 ± 5%, and 20
± 3% of that observed in the absence of v-erbA, respectively.
|
|
V-erbA Suppression of Vitamin D-Mediated Gene Induction
There is evidence that vitamin D plays a protective role against
the development and progression of some neoplasias (16). Therefore, it
is possible that the oncogenic mechanism of v-erbA could be mediated,
at least in part, by inhibiting vitamin D action.
As shown in Fig. 10
, DR3 was a potent
vitamin D response element, as expected, since a DR of AGGTCA with
a 3-bp spacer is a classic vitamin D response element motif. V-erbA
suppressed vitamin D-mediated CAT activity on this response element
very modestly to 76 ± 4.5% of that observed in the absence of
v-erbA. On ERs with a 5-bp spacer (ER5-M3) and 6-bp spacer (ER6),
vitamin D-dependent induction of CAT activity was about half that seen
with DR3. However, powerful dominant negative activity was mediated by
v-erbA on these sites. Specifically, v-erbA suppressed vitamin
D-mediated CAT activity on ER5-M3 and ER6 to 10 ± 0.25% and
17 ± 0.8%, respectively, of that observed in the absence of
v-erbA. IR0 was not vitamin D responsive and therefore could not be
tested for v-erbA suppression.
|
| DISCUSSION |
|---|
|
|
|---|
Our current results indicate that the highest affinity sequence for v-erbA homodimer binding is the imperfect ER, TGACC(T/C)NxT(A/G)AGGTCAC, where Nx represents any three or four nucleotides, thus creating an ER5 or ER6 of the two classic AGGTCA-like hexamers. The consensus sequence for v-erbA homodimer binding on DRs also is an imperfect repeat, (A/G)(A/G)GGTCANxT(A/G)AGGTCAC, in this case with significant spacer flexibility. It was surprising that the two v-erbA-binding half-sites in the idealized selected sequences are not identical. This was true both for the optimal ER and the optimal DR. Thus, when a v-erbA homodimer binds DNA, each of the two v-erbA molecules has a different DNA sequence specificity. The 3'-binding site is essentially identical to the optimal v-erbA monomer-binding site (14), and by footprinting it is the site occupied when v-erbA monomers bind to these homodimer-selected elements. The 5'-binding site, however, has a different and less specific sequence requirement. This could be explained in a number of ways. Since v-erbA homodimers are not very stable in solution, a v-erbA monomer probably binds first to DNA. When a second v-erbA molecule binds, the overall complex is stabilized by protein-protein as well as protein-DNA interactions. The second v-erbA to bind, which occupies the 5'-half-site, could have a more relaxed DNA sequence requirement because its binding will be stabilized by interactions with the already-bound v-erbA monomer. Also, the v-erbA monomer-DNA interaction could result in DNA bending or other conformationl changes in the DNA, which could alter the sequence requirements for binding of the second v-erbA molecule. Finally, the protein-protein interactions in a v-erbA homodimer could result in asymmetric conformational changes in the two v-erbA molecules, resulting in differing DNA binding specificities. Taken together, the findings of a different DNA-binding preference for the 5' and 3' v-erbA molecules has important implications for protein-DNA interactions in general. This observation indicates that the DNA-binding specificity of a protein is determined not only by the amino acid sequence of the protein, but also by protein-protein interactions, half-site orientation, and the relative position of the protein on the response element (5' vs. 3').
Overall, the transfection data correlate well with the DNA-binding affinity for v-erbA homodimers in that ERs containing the consensus sequence with a 5- or 6-bp spacer are the most potent v-erbA response elements, followed by DRs, and with IR sequences being essentially nonfunctional. However, there are some discrepancies between EMSAs and transfection data. For example, ER5 is twice as potent as ER6 in directing v-erbA suppresion of T3 action, which is not explained by differences in binding affinities of v-erbA monomer, homodimer, or heterodimer with RXR between these two core motifs in EMSAs. One possible explanation could involve a recently described family of corepressors (N-CoR, SMRT) (18, 19). These proteins interact with the hinge region and the proximal portion of the carboxy-terminal (ligand-binding) domain of the unliganded members of the TR and RAR family, playing a major role in suppression of basal transcription. This interaction is destabilized by ligand. These corepressors can also interact with v-erbA, which has no known ligand, playing an important role in the dominant negative activity of this oncoprotein. It is possible that allosteric structural changes imposed on the receptor by DNA binding to differently oriented core motifs, differences in spacing, DNA sequence (optimal vs. traditional hexamer), as well as protein-protein interactions (homodimers vs. heterodimers with RXRs), influence the nature and the affinity of corepressor binding to the receptor.
Although RXRs can heterodimerize with v-erbA, the functional significance of this is not clear. If indeed, RXR plays a role in v-erbA action, we would predict that this effect will be conditioned to the arrangement of the core motifs: more important for DRs (weak v-erbA homodimer sites) and less important or irrelevant for core motifs arranged as ERs (strong v-erbA homodimer sites). Our results indicate that DRs, to become potent v-erbA response elements, require significant amounts of cotransfected RXR. In contrast, on ERs the cotransfection of RXR has no effect on v-erbA suppressor activity. However, it is possible that endogenous RXRs play a role in v-erbA action on ERs. This is difficult to assess as RXR null cell lines do not exist. Taken together our data indicate:
1. The most potent v-erbA response element is the ER containing the consensus sequence with a 5-bp spacer and, to a lesser extent, with a 6-bp spacer. V-erbAs suppressor activity on ERs is most likely mediated by v-erbA homodimers although we cannot rule out that heterodimer formation between v-erbA and endogenous auxiliary protein(s) accounts for some of this repressor activity.
2. DRs are weaker v-erbA response elements than ERs. This is in agreement with a previous report showing that an ER6 is a more potent v-erbA response element than a DR4 (13).
At least on DR4, significant v-erbA suppressor activity is dependent on large amounts of cotransfected RXR. However, cotransfected RXR does not increase T3 induction on this response element. These data suggest that there is a difference between the ability of endogenous RXRs to cooperate with TR vs. v-erbA.
Previous studies have shown a significant v-erbA-mediated suppressor activity on T3 action on the IR, TRE palindrome (7, 8, 20, 21). However, in two of these studies, two copies of TRE palindrome were used, thus becoming a complex TRE (20, 21). Furthermore, these two copies were inserted consecutively, and it is possible that the downstream half-site of the first insert and the upstream half-site of the second insert could create an ER that would be the core motif responsible for the suppression activity. Others used much higher amounts of pRSV-v-erbA (up to 10 µg) (7, 8). However, our selection data, in vitro binding affinities, and transfection studies indicate that IRs are substantially weaker v-erbA-binding sites and v-erbA-response elements than everted and DRs.
Vitamin D plays an important role in promoting cell differentiation and inhibiting cell proliferation in many tissues (16). Vitamin D analogs have been shown to be potent activators of the differentiation and inhibitors of the proliferation of myeloid leukemia cells, breast cancer, and other tumors (16). Therefore it is possible that the oncogenic mechanism behind v-erbA action could be mediated by the inhibition of vitamin D action, which has not been addressed previously. Our results indicate that v-erbA has a modest suppressive effect of vitamin D action on DR3. Although ERs with a 5- or 6-bp spacer are somewhat weaker vitamin D-response elements than DR3, v-erbA is a potent repressor of vitamin D action on ERs. By extension, it is possible that mutated forms of endogenous receptors with dominant negative activity similar to v-erbA would inhibit vitamin D action in particular tissues and play a role in neoplastic formation.
Mutant forms of nuclear receptors have been implicated in a variety of endocrine and neoplastic diseases, including mutations in TRß in the generalized thyroid hormone resistance syndrome, mutations in the VDR in vitamin D-resistant rickets type II, PML-RAR fusion protein in promyelocytic leukemia, and mutations in the estrogen receptor in hormone-resistant breast cancers (22, 23, 24, 25). In the majority, the mutant receptor appears to function as a dominant negative form inducing the disease by interfering with the action of the normal receptor counterpart. Therefore, a better understanding of v-erbA action may lead to important findings that can be applied to other clinical situations involving dominant negative transcription factors.
| MATERIALS AND METHODS |
|---|
|
|
|---|
1, and mouse RXR
were produced in
E. coli using the vector pMAL (New England
Biolabs, Beverley, MA) as described previously (14, 26, 27). This
vector produces a fusion protein of MBP followed by a cleavage site for
factor Xa and the receptor of interest. The fusion proteins were
purified by amylose chromatography and cleaved with factor Xa. The
final products were shown by SDS-PAGE to be of the appropriate size
(data not shown).
V-erbA and mouse TR
1 cDNAs were also transcribed from pBluescript
plasmids and then translated in rabbit reticulocyte lysate (Promega,
Madison, WI) in the presence of [3H] leucine as described
previously (28). Trichloroacetic acid-precipitable protein counts per
minute were determined, and the products were analyzed by SDS-PAGE.
Random DNA Pool Construction
Oligonucleotide primers A (5'-TCCGAATTCCTACAG) and B
(5'-AGACGGATCCATTGCA) were synthesized. A pool of oligonucleotides 49
nucleotides in length was synthesized containing the primer A sequence
at the 5'- end, an internal random sequence of 18 nucleotides, and the
reverse complement of primer B at the 3'-end. This internally random
sequence oligonucleotide pool was converted to double-stranded DNA by
annealing with primer B and filling in with a Klenow reaction. The
double-stranded pool was purified by PAGE.
Using this pool and the EMSA selection process described below, we were able to characterize the 3'-half-site for v-erbA homodimer binding and apparently the 5'-half-site. To confirm the selection at the 5'- half-site, a pool of oligonucleotides of 57 nucleotides in length was synthesized containing an internal 16-nucleotide random span followed by TGAGGTCACg (consensus sequence at the 3'-half-site for v-erbA homodimer binding in capital letters). Primer A and the reverse complement of primer B sequences were placed at the 5'- and 3'-ends, respectively. This oligonucleotide pool was made double stranded as described above.
EMSA
Protein-DNA-binding reactions were performed in 35 µl of 20
mM HEPES, pH 7.8, 20% glycerol, 1.4 µg
poly(deoxyinosinic-deoxycytidylic)acid, 1 mM
dithiothreitol, 50 mM KCl (in the later steps of the
selection process, up to 400 mM KCl was employed), 0.1%
Nonidet P40 (NP-40), 32P-labeled DNA, and the protein(s) of
interest. The amounts of protein and 32P-labeled DNA are
specified in subsequent sections. Reactions were incubated at room
temperature for 45 min before electrophoresis. Electrophoresis was
carried out on 0.25x TBE (22 mM Tris base, 22
mM boric acid, 0.5 mM EDTA) 6% polyacrylamide
gels (29:1 acrylamide-bisacrylamide) at room temperature. Wet gels were
exposed to film for 24 h at 4 C during the selection process. For
all other EMSAs, gels were fixed in 30% methanol-10% acetic acid,
dried, and exposed to film with an intensifying screen for 1236 h at
-70 C.
Selection Process
The random pool of double-stranded DNA was end-labeled with
[
-32P]ATP by T4 polynucleotide kinase. An EMSA was
performed with 40,000 cpm of 32P-labeled random DNA pool
plus 40 ng nonradiolabeled random DNA pool and 5 µg v-erbA. In the
initial round of selection we expected the v-erbA-DNA complex to be
undectectable. Therefore, we constructed a 52-bp fragment containing a
DR4 of the hexamer AGGTCA as a marker. The location of the marker
DNA-v-erbA complex was used as a reference to identify the portion of
the gel to excise in the random DNA pool-v-erbA lane. The DNA was
eluted into 0.1% SDS-0.5 M NH4OAc-1
mM EDTA, ethanol precipitated, and amplified by PCR using
primers A and B. Cycling conditions included 1 min each of denaturation
at 94 C, annealing at 56 C, and extension at 72 C for 30 cycles. The
products were purified by PAGE, and the selection process was repeated.
For subsequent selections, 40,000 cpm of 32P-labeled DNA
pool without nonradiolabeled DNA were used in the protein-DNA
incubations.
Eight rounds of selection were performed in total. In the third round of EMSA, a v-erbA-32P-labeled DNA complex with a mobility consistent with homodimer formation could be visualized. In the first two rounds, the protein-DNA incubations used 50 mM KCl, and in the first six rounds 5 µg v-erbA were employed. To select for higher affinity binding sites, rounds 35 and 68 were performed with 150 mM and 400 mM KCl, respectively, and the amount of v-erb-A was reduced to 500 ng for rounds 7 and 8. The selected v-erbA-binding DNA pool was ligated into the BamHI site of the plasmid vector pUTKAT3 (29). Individual bacterial clones were isolated and used to generate plasmid DNA. The sequences of all clones were determined by the dideoxynucleotide method using vector primers. With this approach we were able to identify the consensus sequence at the 3'-half-site. Consensus sequences at the 5'-half-site were also obtained; however, sequences from either primer were used as part of that half-site in many of the clones. Therefore, to confirm the selection of the upstream half-site for v-erbA homodimer binding, the double-stranded 57-bp oligonucleotide described above, containing an internal 16-bp random span followed by TGAGGTCACG, was subjected to six rounds of selection. In the initial two rounds, the protein-DNA incubations used 50 mM KCl and 2.5 µg v-erbA. Rounds 3 and 4 were performed with 150 mM KCl, and the amount of v-erbA was reduced to 250 ng, whereas rounds 5 and 6 were done with 400 mM KCl and the amount of v-erbA was decreased to 50 ng. Subcloning and DNA sequencing were performed as already described.
Guanine Methylation Interference and Uracil Interference
Analysis
This was performed on clone 7 using methylation interference
(30) to identify critical guanine residues and uracil interference (31)
to identify critical thymine residues. For these studies the DNA was
radiolabeled on either strand by performing a PCR in which one of the
two primers had been labeled at its 5'-end with
[
-32P]ATP. The PCR reactions were spiked with a small
amount of dUTP, and the products were purified by PAGE and then
methylated with dimethylsulfate. The probes were incubated with v-erbA,
subjected to EMSA, and the protein-DNA complexes were eluted. Cleavage
at methyl guanines and uracils was accomplished by standard protocols
(30, 31), and the products were analyzed on a 10%
polyacrylamide-sequencing gel.
Mutational Analysis
Several mutant-oligonucleotide versions of the consensus everted
and DR sequences were made by changing 13 bp at a time scanning
accross the consensus sequences. Also, an oligonucleotide containing an
IR sequence with no spacing between half-sites (IR0) was synthesized.
In addition, oligonucleotides arranged as ERs with a 5-bp spacer were
synthesized containing either the perfect nonamer sequence in both
half-sites (ER599) or the perfect nonamer sequence at the 3'-half-
site with the traditional hexamer at the 5'-half-site (ER569); the
latter represents the consensus sequence for v-erbA homodimer binding
found in the selection process. The sequences of these mutant
oligonucleotides are given in Table 3
, except for ER599 and ER569,
which are shown below (top strands excluding GATC overhangs).
ER599 CGGGCCGTGACCTCATTGAGGTCACG
ER569 CGGGCCATGACCTACTTGAGGTCACG
Oligonucleotides (double-stranded) were 32P-labeled by Klenow fill-in, and their binding to v-erbA was tested by EMSA and PhosphorImager (Molecular Dynamics, Sunnyvale, CA) analysis. Each oligonucleotide was assayed at least twice. The data were used in conjuction with the methylation sensitivity data to assess which bases are most important for protein-DNA binding.
Competition Assays
These studies were performed with the oligonucleotides ER599
and ER569. To accomplish this, 32P-labeled ER599
oligonucleotide (40,000 cpm) was incubated with 100 ng v-erbA plus
graded doses of nonradiolabeled ER599 or ER569. The amount of this
competitor DNA required to reduce the intensity of the standard
32P-labeled ER599 DNA-v-erbA homodimer complex by 50%
(C50 measured by densitometry of autoradiograms) was taken
as a measure of relative affinity. Competition assays were performed
twice.
Transient Transfections
JEG-3 cells were grown in 90% Eagles MEM plus 10% FBS and
were transfected using standard calcium phosphate precipitation (32).
The oligonucleotides described in the mutational analysis were used as
potential v-erbA response elements. These mutant oligonucleotides were
ligated as single inserts into pUTKAT3 at a BamHI site 5' to
the basal herpes simplex virus thymidine kinase promoter driving
expression of CAT (29). Reporter plasmids were transfected at a dose of
4 µg per 60-mm Petri dish. Mouse TR
1, rat RXRß, human RAR
,
and human VDR were expressed from the vector pCDM (32); v-erbA was
expressed from the vector pRSV (33). Transfections included 100 ng of
either pCDMTR
1, pCDMRAR
, or pCDMVDR, which represents a
nonsaturating dose of these expression plasmids, different amounts of
pCDMRXRß (0, 100 ng, 300 ng, 1 µg), and 1.5 µg of pRSV-v-erbA (or
vector). The amount of pRSV-v-erbA was reduced to 150 ng in experiments
containing the ER5 and cotransfected RXRß. Vector pCDM was added to
achieve a total of 3 µg pCDM-based plasmid per transfection.
Cotransfections included 1 µg of a human GH-expressing vector (pTKGH)
per 60-mm Petri dish to control for transfection efficiency. Cells were
transfected in the presence of 10% charcoal-stripped FBS and 100
nM dexamethasone. Cells were cultured ± the
appropiate ligand [10 nM T3, 1
µM all-trans-retinoic acid (RA) or 30
nM 1
,25-dihydroxyvitamin D3
(1
,25-(OH)2 vitamin D3)] for 2 days before
harvest. Transfections involving all-trans-RA or
1
,25-(OH)2 vitamin D3 were done under
conditions of subdued light. CAT and hGH assays were performed as
described previously (32). Ligand responsiveness is defined as CAT/hGH
for cells cultured with ligand divided by CAT/hGH for cells cultured
without ligand. V-erbA suppression of CAT reporter gene expression was
calculated as CAT/hGH for cells cultured with v-erbA divided by CAT/hGH
for cells cultured without v-erbA in the presence or absence of ligand.
Results are presented as the mean ± SE for four
independent transfections per assay condition.
| ACKNOWLEDGMENTS |
|---|
cDNA, J. W. Pike for the human VDR
cDNA, and R. Evans for the v-erbA cDNA, the human RAR
cDNA, and the
Rous sarcoma virus expression vector. | FOOTNOTES |
|---|
This work was supported by NIH Grant DK-44155 and Biomedical Research Support Grant of the University of Mississippi Medical Center.
Received for publication July 28, 1997. Revision received May 8, 1998. Accepted for publication May 14, 1998.
| REFERENCES |
|---|
|
|
|---|
1.
J Biol Chem 270:79577962
. Proc Natl Acad Sci USA 90:1066810672
with a novel putative
transcription factor. Cell 66:663674[CrossRef][Medline]
1 with high affinity.
J Biol Chem 268:1939219397
. J Biol Chem 269:3023230237This article has been cited by other articles:
![]() |
G. M. C. Bonamy, A. Guiochon-Mantel, and L. A. Allison Cancer Promoted by the Oncoprotein v-ErbA May Be Due to Subcellular Mislocalization of Nuclear Receptors Mol. Endocrinol., May 1, 2005; 19(5): 1213 - 1230. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kamashev, D. Vitoux, and H. de The PML-RARA-RXR Oligomers Mediate Retinoid and Rexinoid/cAMP Cross-Talk in Acute Promyelocytic Leukemia Cell Differentiation J. Exp. Med., April 19, 2004; 199(8): 1163 - 1174. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. DeLong, G. M. C. Bonamy, E. N. Fink, and L. A. Allison Nuclear Export of the Oncoprotein v-ErbA Is Mediated by Acquisition of a Viral Nuclear Export Sequence J. Biol. Chem., April 9, 2004; 279(15): 15356 - 15367. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Shen and J. S. Subauste Dimerization Interfaces of v-ErbA Homodimers and Heterodimers with Retinoid X Receptor alpha J. Biol. Chem., December 22, 2000; 275(52): 41018 - 41027. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Chen, B. Hu, E. A. Allegretto, and J. S. Adams The Vitamin D Response Element-binding Protein. A NOVEL DOMINANT-NEGATIVE REGULATOR OF VITAMIN D-DIRECTED TRANSACTIVATION J. Biol. Chem., November 3, 2000; 275(45): 35557 - 35564. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |