help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, J.-L.
Right arrow Articles by LeRoith, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, J.-L.
Right arrow Articles by LeRoith, D.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
Molecular Endocrinology 12 (9): 1452-1462
Copyright © 1998 by The Endocrine Society

Insulin-Like Growth Factor-I Affects Perinatal Lethality and Postnatal Development in a Gene Dosage-Dependent Manner: Manipulation Using the Cre/loxP System in Transgenic Mice

Jun-Li Liu, Alexander Grinberg, Heiner Westphal, Brian Sauer, Domenico Accili, Michael Karas and Derek LeRoith

Section on Cellular and Molecular Physiology (J.L.L., M.K., D.L.) Diabetes Branch and Laboratory of Biochemistry and Metabolism (B.S.) The National Institute of Diabetes and Digestive and Kidney Diseases
Laboratory of Mammalian Genes and Development (A.G., H.W.) and Developmental Endocrinology Branch (D.A.) The National Institute of Child Health and Human Development National Institutes of Health Bethesda, Maryland 20892


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Insulin-like growth factor-I (IGF-I) is essential for cell growth, differentiation and postnatal development. A null mutation in igf-1 causes intrauterine growth retardation and perinatal lethality. The present study was designed to test the lower limit of igf-1 gene dosage that ensures survival and postnatal growth by using the Cre/loxP system. Mice with variable reductions in IGF-I levels were generated by crossing EIIa-cre transgenic mice and mice with loxP-flanked igf-1 locus (igf-1/flox). EIIa-cre mice express bacteriophage P1 Cre (causes recombination) recombinase under the adenovirus promoter EIIa, during early embryonic development before implantation, and cause genomic recombination of the igf-1/flox locus. Mice with the most extensive recombination die immediately after birth, while the survivors have significant growth retardation in proportion to the reduction in their igf-1 gene. Interestingly, this gene dosage effect on body weight was not very significant before weaning. However, when the young animals were weaned at 3 weeks, the igf-1 gene dosage was the only independent predictor of the weight gain between 3 and 6 weeks among the parameters tested. Although growth retarded, mice with Cre-induced partial igf-1 deficiency were fertile and gave birth to null mice. Thus Cre-induced genomic recombination using the EIIa promoter occurs during development and creates distinct phenotypes compared with the conventional null mutation. This variability allows for postnatal survival and will enable one to begin to explore the role of the endocrine vs. paracrine effects of IGF-I.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Insulin-like growth factor I (IGF-I) is expressed by many cells and tissues during embryonic and postnatal development and in adult animals. IGF-I influences various biological processes through binding to its membrane-anchored receptor, the IGF-I receptor (IGF-IR), although at higher concentrations IGF-I can also activate the insulin receptor. In addition, in vivo, IGF-I action is modulated by a family of IGF-binding proteins present in the circulation. IGF-I, secreted from the liver in response to GH, promotes postnatal growth in bone, muscle, fat, and other tissues. Human and murine IGF-I deficiency caused severe intrauterine growth retardation, perinatal lethality, postnatal growth retardation, delayed development in brain, muscle, bone, and lung, and infertility (1, 2, 3, 4), demonstrating the essential role of IGF-I in normal growth and development. On the other hand, overexpression of IGF-I in transgenic mice is coupled with widespread tissue hypertrophy in the brain, heart, muscle, and intestine (5, 6, 7, 8).

The conventional gene knockout approach potently demonstrated the crucial role of IGF-I in intrauterine development and perinatal survival but is unsuitable for postnatal studies on animal growth because most of the mice die after birth (1, 2, 3). To study the lower limit of IGF-I expression necessary for postnatal survival and the effect of IGF-I deficiency on postnatal growth, the Cre/loxP system was used to avoid perinatal lethality. We generated mice with the igf-1 locus flanked by loxP (igf-1/flox) repeats by homologous recombination and crossed them with EIIa-cre transgenic mice, which express the bacteriophage P1 Cre recombinase under the adenovirus promoter EIIa during early embryonic development before implantation. In this manner, we created genetic mosaics whose IGF-I expression is partially abrogated, thus allowing the correlation of the level of mosaicism with various phenotypes and the level of IGF-I expression. As a result, Cre-induced igf-1 recombination caused postnatal lethality in the most severe cases of gene recombination and significant growth retardation in the survivors who had lesser degrees of recombination of the igf-1 locus. We demonstrate that igf-1 gene dosage determines the level of IGF-I expression and the rate of pre- and postnatal growth. Interestingly, we found a closer correlation of the growth rate with serum IGF-I concentration than with the level of liver IGF-I gene expression.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mutagenesis of the igf-1 Locus
We designed a replacement vector that would enable deletion of the entire exon 4 (encoding amino acid residues of 26–70) upon Cre expression and results in a truncated protein that has no functional capabilities (Fig. 1Go). A positive-negative selection protocol was used to facilitate identification of ES (embryonic stem cell) clones of homologous recombination (9). Linearized vector DNA was introduced into recipient ES cells by electroporation, and the cells were seeded and selected with the appropriate combination of antibiotics on feeder layers of mouse fibroblasts. A total of 125 clones were picked and expanded, and their genomic DNA was analyzed by Southern blotting.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Targeting of the Mouse igf-1 Locus

A, Restriction map of the wild-type igf-1 gene in the region containing exon 4. The restriction sites are: B, BamHI; E, EcoRI; H, HindIII; and K, KpnI. B, Schematic structure of the targeting vector. L: loxP sites. C, Expected mutagenesis to the igf-1 locus upon homologous recombination. At the bottom of each diagram, positions of the hybridization probes and PCR primers are indicated. The 1-kb ruler is approximate.

 
In the initial screening digested with BamHI and hybridized to the 3'-external probe, two clones (JL-43 and JL-115) exhibited a hybridization band of 11 kb, in contrast to 10 kb wild type allele, a sign of correct recombination (Fig. 2AGo). When digested with KpnI, a 9.5-kb segment of igf-1 locus was hybridized to both 5'- and 3'-external probes. Due to insertion of an extra KpnI site on the vector, these two correctly targeted clones exhibited additional shorter bands of expected sizes when hybridized to both probes (Fig. 2BGo). Both clones, JL-43 and JL-115, were injected into C57BL/6 blastocysts and transferred into pseudopregnant mothers. Male chimeric mice were bred against female C57BL/6 mice. The mice with germline transmission of loxP-flanked igf-1 locus (igf-1/flox) (F1) were intercrossed to generate homozygous igf-1/flox mice (F2), identified by PCR assay and Southern blot analysis of their tail DNA (Fig. 3Go).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 2. Characterization of ES Clones by Southern Blot Analysis

BamHI- and KpnI-digested genomic DNA from control ES cells (nos. 44, 45, 69, 70, 114, 116, and 125) and two correctly targeted clones (nos. 43 and 115) were hybridized to 5' (pB2-BH) and 3' (pH3-HE) external probes as indicated. The nature and size of the hybridization fragments (in kilobases) are shown.

 


View larger version (37K):
[in this window]
[in a new window]
 
Figure 3. Germline Transmission of loxP Recombination

F1, Crossing of chimeric founder mice with C57BJ/6 generated F1 offspring. To detect the presence of loxP integration, PCR was performed on tail DNA specimen with primers IA-8, IA-6, and ID-3 (as illustrated in Fig. 1Go). Both wild-type (350 bp, IA-8/ID-3) and igf-1/flox bands (200 bp, IA-6/ID-3) from the PCR reaction are depicted from mice of a representative litter. F2, Heterozygous igf-1/flox mice were allowed to interbreed to generate F2 offspring. For some representative individual mice, their genomic DNA, digested with HindIII, was probed with pSP-3 in a Southern blot. Wild-type band is 6.5 kb, while igf-1/flox locus is 4.9 kb, due to the presence of an internal HindIII site on the targeting vector.

 
Offspring from interbreeding of heterozygous igf-1/flox mice (F1) showed Mendelian inheritance of the mutant igf-1 alleles. Of eight litters (64 mice) analyzed, 19% of the mice were homozygous igf-1/flox, 56% were heterozygous, and the remaining 25% were wild type. This indicates that the introduction of loxP sequences and neo did not cause any major abnormalities. Mice with both homo- and heterozygous igf-1/flox loci are fertile and appear normal and healthy. A study of five litters revealed a slight growth retardation (<10%) in homozygous igf-1/flox mice (data not shown).

Cre Causes igf-1 Recombination in Heterozygous igf-1/flox Mice
EIIa-cre transgenic mice, which express Cre recombinase in early embryonic development, were used to develop mosaic mice of igf-1 recombination. All the offspring (Cre F1) from crossing male EIIa-cre and female heterozygous igf-1/flox mice carry one allele of cre, and ~half of them have their igf-1 exon 4 flanked by loxP sites. PCR analysis of tail DNA in mice bearing igf-1/flox revealed various degrees of exon 4 deletion. When primers ES-1/ID-3 were used (Fig. 1BGo), the wild-type PCR product is approximately 1 kb and the igf-1/flox locus is approximately 2 kb (which cannot be amplified under the assay condition), whereas Cre-induced exon 4 recombination is detected as a 0.2-kb band (Fig. 4Go). Southern blot analysis confirmed the conversion from the igf-1/flox fragment of 4.9 kb to the recombinant of 2.8 kb, when DNA was digested with HindIII and hybridized to pSP-3 internal probe (Fig. 4Go). This indicates that one copy of the cre transgene is sufficient to induce targeted gene recombination. Incomplete recombination may be attributed to delayed and/or mosaic expression of the cre.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 4. Genomic Analysis of Cre F1 Offspring, Derived from Crossing EIIa-Cre and Heterozygote igf-1/floxed Mice

A, PCR products of cleaved igf-1/flox (0.2 kb) and wild-type IGF-I gene (1 kb). B, Southern blot of the conversion of igf-1/flox (4.9 kb) into the cleavage product (2.8 kb). The conversion is not complete, indicating a mosaic expression of cre. C, All the offspring have cre gene in their genome as demonstrated by Southern blot analysis.

 
Neonatal Lethality and Growth Retardation Induced by igf-1 Recombination
To study the effect of cre expression in homozygous igf-1/flox mice, five pairs of mice heterozygous for both EIIa-cre and igf-1/flox were crossed to generate Cre F2. Each of three dams gave birth to 2 dead pups each (total of 6) in addition to 7–11 pups per litter, which survived for further study. Genomic DNA was prepared from 5 of the dead pups. By PCR and Southern blot analysis, all of them have almost complete (~95%) recombination of the igf-1 (Fig. 5Go) and were positive for the cre (data not shown). We were unable to prepare intact RNA from these pups to determine the level of igf-1 expression.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 5. Near-Complete Recombination of igf-1 Locus Caused Postnatal Death of Cre F2 Pups

Mice heterozygous for both EIIa-cre and igf-1/flox were crossed to generate Cre F2. Some dams gave birth to pups that died immediately after birth. Genomic DNA, digested with HindIII, was analyzed by Southern blot with 32P-labeled pSP-3. A, B, C, and D represent the dead pups while A48, A27, and A32 represent their parents.

 
To examine tissue igf-1 expression, fetuses at days 19–20 of gestation from two mothers were removed by cesarean section, their weights were determined, and their DNA and RNA were prepared. Out of 19 fetuses, 4 were homozygous igf-1/flox, and all of them were cre positive. Overall, there was 90–100% recombination on igf-1 exon 4 (Fig. 6Go), their body weights were only 69% of the wild type control (Table 1Go), and IGF-I mRNA was only 17% (Fig. 7Go and Table 2Go), indicating that Cre-induced igf-1 recombination caused intrauterine growth retardation. Therefore, in the most severe cases of igf-1 recombination, a phenotype similar to the previous reports of generalized igf-1 gene knockout is observed (2, 3).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 6. Genotyping of Cre F2 Fetus or the Surviving Mice at 3 Weeks

As in Fig. 3Go (F2), wild-type (WT) mice only have a 6.5-kb band, igf-1/flox (L/L) mice only have a 4.9-kb band, while heterozygous (W/L) have both bands. Upon Cre action, there are varying degrees of recombination of igf-1/flox allele (4.9 kb) to 2.8 kb.

 

View this table:
[in this window]
[in a new window]
 
Table 1. IGF-I Gene Dosage-Dependent Growth Retardation Induced by EIIa-cre Expression

 


View larger version (56K):
[in this window]
[in a new window]
 
Figure 7. IGF-I mRNA Expression Is Dramatically Reduced by Cre Expression in igf-1/flox Mice

A, A representative RNase protection assay is shown. The level of IGF-I mRNA is diminished in W/L mice and almost abolished in L/L mice. To demonstrate equal loading of total RNA, a protected band for 18S rRNA is illustrated at bottom. B, A representative Northern blot of IGF-I mRNA from 6-week-old mice liver, illustrating the 0.7-kb major form and 7-kb minor form. Their abundance is incomparable due to differential exposure. Compared with their wild-type littermates, IGF-I mRNA is decreased in W/L and dramatically reduced in L/L mice upon Cre activation, while actin-mRNA is not affected (see Table 2Go).

 

View this table:
[in this window]
[in a new window]
 
Table 2. IGF-I Gene Dosage-Dependent Reduction in Liver IGF-I mRNA and Serum IGF-I Concentration Induced by EIIa-cre Expression

 
Cre-Induced, Gene Dosage-Dependent Growth Retardation and Survival of igf-1/flox Mice
Most of the Cre F2 offspring survived, including some cre-positive homozygous igf-1/flox mice. Their body weights were measured at 3 and 6 weeks after birth, and their genotypes were analyzed by PCR and Southern blots. The level of igf-1 expression was determined by Northern blot analysis of total RNA prepared from the liver of 6-week-old mice. The animals were grouped by their igf-1 dosage determined by Southern blots. Compared with their wild-type littermates, mice with Cre-induced homozygous igf-1/flox recombination were significantly smaller at birth (69%) and grew at a slower rate [i.e. body weight 72% and 68% of wild-type controls at 3 and 6 weeks, respectively (Table 1Go)]. In the survivors, the igf-1/flox locus was incompletely cleaved, and they maintained 28% of igf-1 expression compared with their wild-type controls (Table 2Go). There was no significant change in the appearance and the relative weights of the organs examined, including brain, heart, liver, kidney, lung, and spleen (data not shown). Mice with a single-copy recombination of igf-1 demonstrated marginal slower growth (81–85% of control, P < 0.01) and had significantly impaired IGF-I expression (67% in fetus head and 62% in adult liver compared with their wild-type littermates) (Tables 1Go and 2Go).

In contrast to the dramatic decrease in the level of liver IGF-I mRNA, the change in serum IGF-I concentration is more moderate and correlates more closely with postnatal growth rate. Thus, mice with two alleles of Cre-induced igf-1 recombination (gene dosage 0.1–0.4) demonstrate liver IGF-I mRNA at 28% of the level of their wild-type littermates, whereas the level of circulating IGF-I is 71% and their growth rates were 68–72% of that of the control mice (Tables 1Go and 2Go).

Tissue Variations in Cre-Induced igf-1 Recombination and IGF-I Gene Expression
One explanation for the relative high level of serum IGF-I (71% of control) in the face of markedly reduced liver IGF-I mRNA levels (28% of control) is that circulating IGF-I may be derived from extrahepatic tissues. We therefore analyzed brain, kidney, muscle, liver, and lung from two litters of wild-type, heterozygous, and homozygous igf-1/flox mice (two to three each). Genomic DNA was prepared, and Cre-induced igf-1 recombination was studied by Southern blots. There was no significant difference in the pattern and degree of gene recombination induced by Cre expression, among all tissues examined (including the tails), indicating that the promoter EIIa was activated well ahead of tissue differentiation to have ensured homogenous recombination (data not shown).

To determine the level of IGF-I gene expression, total RNA from these tissues was used for ribonuclease (RNase) protection assay. While there was a >65% decrease in the liver IGF-I mRNA, the extrahepatic tissues had only ~a 40–50% decrease in IGF-I mRNA in igf-1/flox mice (data not shown). In a study involving 51 mice, Northern blots of liver RNA revealed a 72% reduction in the major form (~0.7 kb) of IGF-I mRNA and a more moderate (~48%) decrease in its minor form (~7 kb) (Fig. 7Go and Table 2Go). Interestingly, in extrahepatic tissues, the major IGF-I mRNA species are ~7 kb, which showed a similar modest reduction (~40–50%) upon Cre expression (Northern blots, data not shown).

Correlation of Growth Rate, Liver IGF-I mRNA Level, and Serum IGF-I Concentration with igf-1 Gene Dosage
The results of linear correlation analysis demonstrate that the Cre-induced decrease in igf-1 dosage directly affects the level of igf-1 expression, circulating IGF-I levels, and the rate of animal growth (Table 3Go). Very strong correlation (r = 0.80) was found between igf-1 gene dosage and liver IGF-I mRNA level. Significant (P < 0.001), but less strong correlation (r = 0.46–0.68) was observed between body weights at 3 and 6 weeks and the igf-1 gene dosage, liver IGF-I mRNA, and serum IGF-I levels. The correlation was stronger at 6 weeks of age when compared with 3 weeks of age (Table 3Go).


View this table:
[in this window]
[in a new window]
 
Table 3. Linear Correlation of Growth Rate, Liver IGF-I mRNA Level, and Serum IGF-I Concentration with igf-1 Gene Dosage

 
To further explore the statistical relationship between body weight and the level of mRNA, serum IGF-I, and igf-1 gene dosage, forward stepwise multiple linear regression analysis was performed. As a large sample size is needed for this extensive analysis and as there are obvious differences in body weights between males and females (at 6 weeks), we performed this analysis on the males (females were not distributed evenly between subgroups to allow informative analysis). As shown in Table 4Go, body weight at 3 weeks could be independently predicted by the serum IGF-I level. The impact of liver mRNA level was insignificant, and igf-1 gene dosage was excluded from the model. The situation is somewhat different when body weight at 6 weeks was predicted. Here again, the principal component of the model was the serum IGF-I level, but liver mRNA level accounts for a significant proportion of body weight prediction. When the gain of body weight (3–6 weeks) was analyzed as a dependent variable, the only independent parameter predicting this gain was igf-1 gene dosage.


View this table:
[in this window]
[in a new window]
 
Table 4. Forward Stepwise Multiple Regression Analysis of the Factors Affecting Animal Growth Rate

 
Mice with Cre-Induced Partial igf-1 Deficiency Are Fertile and Give Birth to igf-1 Null Mutants
As growth retardation is often associated with infertility, we tested 1) whether our igf-1/flox mice are fertile after Cre-induced recombination, 2) whether the knockout allele can be transmitted into germline, and 3) whether we can generate viable igf-1 null mice. Results of these breeding experiments demonstrated that homozygous igf-1/flox mice (with igf-1 gene dosage <=0.5), although growth retarded, are able to reproduce. Two pairs gave birth repeatedly to an average of seven pups per litter. Interestingly, about half of the igf-1 null mice (accounting for ~one quarter of the offspring) survived up to 4–6 weeks, although with severe growth retardation. At 3 weeks, null mice weighed only 4.5 ± 0.2 g (n = 3) in comparison to 12.0 ± 0.2 g (n = 4) for their heterozygous littermates (igf-1/flox/igf-1/null). IGF-I deficiency was confirmed by PCR and Southern blots on genomic DNA and by RNase protection assay for liver and brain total RNA (Fig. 8Go).



View larger version (69K):
[in this window]
[in a new window]
 
Figure 8. IGF-I Null Mutation Generated by Interbreeding Mice with Cre-Induced Partial IGF-I Deficiency

Homozygous igf-1/flox mice (with igf-1 gene dosage <=0.5) were allowed to reach maturity and to intercross. The offspring have two genotypes: L/- (heterozygous igf-1/flox/igf-1/null), which has one intact allele of igf-1 exon 4 (Southern blot, panel A), and normal expression of IGF-I gene in the liver and brain (RNase protection assay, RPA, panels B and C); and -/- (igf-1 null), which has the entire exon 4 excised (panel A) and complete absence of IGF-I mRNA in both the liver and brain (panels B and C). The blots were representatives of three experiments; 18S rRNA was also probed to demonstrate the equal loading of total RNA.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cre ("causes recombination") is a 38-kDa recombinase that recognizes loxP repeats, deletes the region in between, and rejoins genomic DNA in bacteriophage P1 (10). Gu et al. (11) demonstrated that the Cre/loxP system can mediate partial T cell-specific deletion of DNA polymerase ß in mice. More recently, Tsien et al. (12, 13) have generated Cre-induced NMDAR1 gene deletion restricted to CA1 region of the hippocampus. The mutant mice grow into adulthood without gross developmental abnormalities. More precise testing showed that they lack NMDA receptor-mediated synaptic currents and exhibited impaired spatial memory learning. Thus, in such cases, undesirable developmental and behavioral consequences caused by conventional gene knockout were circumvented.

Using homologous recombination, we have established a mouse strain in which the exon 4 of igf-1 is flanked by loxP sites. We have targeted the entire exon 4, which encodes for amino acid residues 26–70 of the peptide, including part of the domain B and entire domains C, A, and D. Previously Liu et al. (1, 2) replaced only part of the same exon encoding the residues 51–70, whereas Powell-Braxton et al. (3) targeted exon 3, which encodes only part of domain B of the molecule.

Our results from the mice with the most severe igf-1 recombination are similar to previously reported null mutations of the mouse igf-1 (1, 2, 3). Using the newly developed Cre/loxP system in transgenic mice, we created near- complete recombination of the target locus, which caused postnatal lethality, growth retardation, and dramatic decreases in igf-1 expression. Linear correlation analysis demonstrated that igf-1 gene dosage strongly defines the IGF-I mRNA level in liver as expected. Surprisingly, body weight at 3 weeks was predicted by only the serum IGF-I level but not by igf-1 gene dosage or the level of IGF-I mRNA in liver. At 6 weeks the mRNA level became a significant parameter for the forward stepwise model. This discrepancy could be explained by the consumption of mother’s milk by the pups up to 3 weeks of age. It is known that the content of IGF-I in the milk of most mammals is high (14). However, the role of milk-derived IGF-I in the growth of young animals is unclear. Although milk-borne IGF-I may not be essential for neonatal development, it has been reported that milk proteins protect IGF-I from degradation in neonatal rat intestine and oral consumption of IGF-I via milk is associated with the absorption of the growth factor into the bloodstream. Therefore therapeutic use of oral IGF-I has been proposed as an effective intervention for preterm neonates and those with compromised intestinal function (15, 16, 17). Our data are in agreement with this finding since once the animals were weaned, the body weight gain was predicted exclusively by gene dosage, which suggests that this effect could have been masked by oral IGF-I delivery. In addition, persistent presence or even compensatory increase of IGF-II in the perinatal period may also compensate for the growth deficiency in the first 3 weeks of life.

Another novel observation from our study was that the decrease in liver IGF-I mRNA levels was much more dramatic than the reduction in serum IGF-I concentration. This result contradicts the generally accepted hypothesis that liver is the main source of postnatal IGF-I production and is the major source of circulating, endocrine IGF-I that controls body growth. A number of possible explanations may explain the discrepancy between liver IGF-I mRNA levels and circulating IGF-I levels in our genetically engineered animals: 1) Enhanced translational activity may compensate for lower mRNA levels. 2) Circulating IGF-I may be metabolized more slowly, perhaps as a result of changes in IGF-binding proteins. 3) Extrahepatic tissues may, in fact, play a major role in contributing to the circulating IGF-I levels. Indeed, we favor the last possibility, despite the fact that it differs from conventional notions. Interestingly, recombination of the igf-1 by Cre, as detected on Southern blots, was similar in extrahepatic and hepatic tissues. Thus, we must conclude that igf-1 expression in these extrahepatic tissues was maintained despite the severe reduction in intact igf-1 gene. One possible explanation for this discrepancy is that in all the extrahepatic tissues we examined, IGF-I was apparently translated mainly from the higher (~7 kb) mRNA species, which may be less affected under the circumstances of low gene dosage. On the other hand, liver IGF-I production may be more sensitive to changes in igf-1 gene dosage with an effect on the lower mol wt mRNA species (~0.7 kb). These differences between liver and extrahepatic regulation of IGF-I expression have been previously described (18, 19, 20, 21).

In the present study, Cre-induced igf-1 knockout was achieved in mice of two generations (Cre F1 and F2). We demonstrated significant target gene recombination in Cre F1 mice that carry only one allele of igf-1/flox and cre transgene. Interbreeding of Cre F1 generated at least five genotypes of Cre F2 mice: homozygous igf-1/flox with or without cre transgene; heterozygous igf-1/flox with or without cre; and wild-type igf-1 locus in which case the presence of cre gene is irrelevant. The pattern of Cre activity judged by the recombination of the igf-1 locus is quite variable. There was near complete (~95%) recombination, which caused perinatal lethality, whereas incomplete deletion to the igf-1/flox locus was associated with postnatal survival and growth retardation. As listed in Tables 1Go and 2Go, we generated 11 mice with homozygous igf-1/flox locus, 70–90% gene deletion (gene dosage 0.1–0.4 group), which survived up to 6 weeks. Surprisingly, in this group five mice actually did not carry cre transgene. How then did igf-1 recombination occur? If the gene deletion occurred before the formation of the gametes, the recombination has to be all or none. If, on the other hand, gene recombination occurred after fertilization of the Cre F2, the cre transgene should not be lost during development. Therefore, we propose that these mice are derived from haploid gametes (oocytes) that inherited Cre protein from their diploid precursor cells via the cytoplasm during meiosis (without itself carrying a cre transgene). Limited Cre activity in those gametes and fertilized eggs will create incomplete (mosaic) recombination of the igf-1 locus. While this has to be tested, it remains a reasonable explanation since the EIIa promoter has been shown to be activated in undifferentiated stages of murine oogenesis and preimplantation development (22).

Growth retardation caused by genetic defects is often associated with infertility, such as mice lacking the IGF-I, vitamin D receptor, and ATM genes (1, 2, 3, 23, 24). In the case of igf-1 targeting, homozygous mice are sterile and growth retarded while heterozygous (gene dosage 0.5) are basically normal in both growth and fertility. We were interested in testing the effect of growth retardation caused by Cre-induced igf-1 recombination on fertility. In our studies, mice with igf-1 gene dosage <= 0.5 are still fertile. Therefore, infertility is not always the consequence of growth retardation. The same experiment also demonstrated that the Cre-recombined allele can be transmitted through the germline and produce null mice.

IGF-I is widely expressed throughout development and in adult life. Since the total knockout of the igf-1 gene has been known to cause profound defects in early development and postnatal viability, these animals cannot be used to address specific questions such as 1) what is the role of the circulating (endocrine) IGF-I in postnatal growth compared with local tissue IGF-I production? 2) how does IGF-I deficiency causes infertility? and 3) what is the role of tissue-specific expressed IGF-I? The Cre/loxP system provides a more powerful tool in answering these questions. Flanking the igf-1 locus by loxP sites opens a new chapter so that the gene can be manipulated just by expressing Cre in a chosen target tissues and at defined stages using tissue-specific promoters. Toward that direction, a tissue-specific promoter can activate the cre transgene at a defined stage in the development of the target tissue, such as T cell-specific lck promoter and neuron-specific {alpha}-calmodulin kinase II promoter (11, 12). A silent cre transgene (Mx1-Cre) can be induced upon application of interferon {alpha} (25). Furthermore, cre transgene has been successfully expressed in the liver after intravenous injection of virus-Cre constructs (26). The current study therefore demonstrates that the Cre/loxP system is suitable to generate genomic recombination of the mouse igf-1 gene in a controlled manner.

In summary, we developed a conditional igf-1 knockout system using the Cre/loxP model. The igf-1/flox mice appear healthy and demonstrated virtually normal growth rates. Expression of cre transgene created partial to near complete recombination of the igf-1 locus, which caused postnatal lethality, growth retardation, and dramatic decreases in igf-1 expression and decrease in serum IGF-I concentration. After cre expression, we demonstrated igf-1 gene dosage-dependent survival, growth, and decreases in mRNA and protein levels. Compared with those with null mutations, our mice with partial igf-1 deficiency are viable, have milder growth retardation, and are fertile, therefore allowing gene dosage-dependent studies. To dissect complex roles (endocrine, paracrine, autocrine) of a growth factor such as IGF-I, the Cre/loxP system can be extended to generate tissue- and developmental stage-specific knockout mice.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Targeting Vector and Generation of Mice with loxP-Flanked igf-1 Locus
Mouse genomic DNA fragments encompassing exon 4 and flanking sequences of igf-1 were prepared from {lambda}-phage clones 19 and 7, kindly provided by Drs. P Rotwein and R. D. Palmiter, respectively (20, 27). A 6.5-kb HindIII fragment (from {lambda}19) was used as the targeting region; immediately downstream, a 0.8-kb HindIII/EcoRI fragment (pH3-HE from {lambda}19) was used as 3'-external probe; and immediately upstream, a 1-kb BamHI/HindIII fragment (pB2-BH from {lambda}7) was used as 5'-external probe in screening homologous recombination (Fig. 1Go). The relative position of the fragments was confirmed by restriction mapping, Southern blot analysis, and partial sequencing and compared with the previous partial characterization of this region (20, 27).

The replacement-type targeting vector (Fig. 1BGo) was made by inserting the first loxP site (from pMC-lox-Neo) into intron 3 at the BamHI site of the 6.5-kb HindIII fragment, on a pBluescript KS+ backbone (Stratagene, La Jolla, CA). The bacterial neomycin-resistance gene (neo) along with the second loxP site [1.2 kb from pGH-1, K. Rajewsky (11)] was inserted into intron 4 at the EcoRI site. As a result, the two direct repeats of loxP sites flanked a 0.9-kb genomic region including the entire exon 4 (182 bp), which encodes residues 26–70 of mouse IGF-I (1, 20). The targeting vector contained 2.5 kb of homologous DNA upstream (left arm) of the first loxP site and 2.8 kb of homologous DNA downstream (right arm) of the second loxP site. A herpes simplex virus thymidine kinase gene [HSV-tk, 1.2 kb from pGH-1, K. Rajewsky (11)] was inserted upstream to the left arm. A unique SacII site at the 3'-end of the right arm was used to linearize the construct.

The targeting vector was electroporated into ES cells derived from 129 sv mice maintained on subconfluent embryonic fibroblasts. ES clones, resistant to both geneticin (G418) and gancyclovir, were picked and expanded. The ES cells harboring the homologous recombined construct were determined by Southern blotting using both 5'(pB2-BH) and 3'(pH3-HE) probes external to the homologous region (Fig. 1CGo). The correctly targeted ES cell clones were expanded and injected into C57BL/6 blastocysts and transferred into pseudopregnant mothers. Male chimeric mice were bred against female C57BL/6 mice. The F1 mice with germline transmission of the igf-1/flox locus were allowed to interbreed to generate homozygous igf-1/flox (F2) mice, identified by PCR assay and Southern blot analysis of their tail DNA.

Breeding Mice of EIIa-cre with igf-1/flox
EIIa-cre mice, on a FVB/N genetic background, carry the Cre recombinase gene driven by the adenovirus EIIa promoter (28). They express Cre in oocytes and in early mouse embryos before implantation (22, 28). Initially, female mice heterozygous for igf-1/flox locus were bred with male mice homozygous for the EIIa-cre transgene. Recombination of igf-1 exon 4 in offspring was assayed by PCR and Southern blotting of tail DNA. Mice heterozygous for both EIIa-cre and igf-1/flox locus (Cre F1) were interbred to obtain mice with homozygous igf-1/flox alleles (Cre F2). The expression of Cre in these mice induces deletion of igf-1 exon 4 and impaired expression of IGF-I, as shown in Results. Some Cre F2 mice were further allowed to breed to test their fertility and generate mice with igf-1 null mutation. Offsprings were ear tagged at P21 for identification and weaned, and tail biopsies were taken for DNA analysis.

Southern Blot Analysis
Genomic DNA from ES cells was prepared by an overnight digestion at 37 C in a lysis buffer (100 mM Tris HCl, pH 8.5, 5 mM EDTA, 0.2% SDS, 200 mM NaCl, 0.1 mg/ml proteinase K) and precipitation in isopropanol (29). The DNA was digested overnight with either BamHI or KpnI, fractionated by electrophoresis through 0.8% agarose gels, transferred to a maximum strength Nytran membrane (Schleicher & Schuell, Keene, NH), and hybridized with 32P-labeled 5'- or 3'-RNA probes synthesized with the Riboprobe Systems (Promega, Madison, WI). To calculate the extent of igf-1 recombination induced by Cre, Southern blots were analyzed by PhosphorImager 400E (Molecular Dynamics, Sunnyvale, CA).

Mouse tail DNA was prepared similarly in a lysis buffer (10 mM Tris, pH 8.0, 100 mM EDTA, 0.5% SDS, 0.2 mg/ml proteinase K) but at 55 C, and purified DNA was digested overnight with HindIII and processed for Southern blot using riboprobes synthesized with template DNA of pBS-1 or pSP-3 (Fig. 1Go). For detection of the cre transgene, tail DNA was digested with BamHI and probed with a XhoI/BamHI fragment of Cre coding region (from pMC-Cre) (11). Southern blots were performed from DNA prepared from other tissues including brain, kidney, liver, lung, and muscle.

PCR Analysis
PCR was performed on tail DNA preparations to identify which mice have loxP sites integrated into their genome. Using primers IA-8, IA-6, and ID-3 (see Fig. 1BGo for their positions), the PCR reactions were conducted after Perkin Elmer’s recommendation, with extra MgCl2 (1.5 mM) added. The reaction cycles are: 94 C, 1 min; 56 C, 1 min; 72 C, 1 min; 25 cycles.

To detect Cre-induced recombinants, primers ES-1 and ID-3 were used (Fig. 1BGo). The cycles are: 94 C, 1 min; 56 C, 1 min; 72 C, 1.5 min; 25 cycles.

To detect the presence of the Cre-coding sequence in mouse genome, PCR was performed with primers Cre-5 and Cre-3, which amplify a 0.6-kb fragment of the cre gene. The cycles are: 94 C, 1 min; 67 C, 1 min; 72 C, 1 min; 25 cycles. The primer sequences are (5' to 3'):

IA-8: AGTGATAGGTCACAAAGTTCC

IA-6: AAACCACACTGCTCGACATTG

ID-3: CACTAAGGAGTCTGTATTTGGACC

ES-1: AGCCTCTCAACTAAGACAATA

Cre-5: AATGCTTCTGTCCGTTTGCCGGT

Cre-3: CCAGGCTAAGTGCCTTCTCTACA

RNA Preparation, Northern Blot, and RNase Protection Assay
IGF-I gene expression in adult liver was studied by Northern blot analysis (30). Briefly, 10–15 µg total RNA, prepared using RNAzol B (Tel-Test Inc, Friendswood, TX), were electrophoresed on a 1% agarose gel containing 5% formaldehyde, transferred to a maximum-strength Nytran membrane (Schleicher & Schuell), and hybridized to a 32P-labeled-antisense riboprobe synthesized by T7 RNA polymerase using BamHI-linearized template DNA pMI-4 (exon 4) (Fig. 1AGo) (27). The blot was washed and exposed to X-Omat AR film at -70 C, and the specific bands of expected sizes were illustrated. To demonstrate equal loading of total RNA on the gel, the blots were stripped and reprobed with a 32P-labeled ß-actin riboprobe (Ambion, Austin, TX). The abundance of the hybridization signals was analyzed by PhosphorImager 400E and corrected by the amount of ß- actin mRNA.

In other tissues that express low levels of IGF-I, RNase protection assay was performed (31). Briefly, 50 µg total RNA were hybridized to the 32P-riboprobes for exon 4 and 18S rRNA (Ambion) overnight at 45 C, treated with RNase A, RNase T1, proteinase K, and phenol/chloroform, and precipitated. Protected probes were denatured, electrophoresed on an 8% polyacrylamide gel, and exposed to X-Omat AR film for 1–2 days. The protected bands corresponding to IGF-I mRNA and 18S rRNA were scanned in an Agfa Arcus II scanner, and densitometric analysis was performed using the MacBAS v2.31 program (Fuji Photo Film Co., Tokyo, Japan). The level of IGF-I mRNA was corrected by the amount of 18S rRNA and expressed as relative abundance to wild-type control samples.

Growth Rate, Serum IGF-I Concentration, and Statistical Analysis
The growth rate of mice with mutant igf-1 was determined by measuring the body weight at 3 weeks (when animals were weaned and ear tags were applied) and 6 weeks after birth. Animals are grouped according to their igf-1 dosage derived from their genotype (wild-type or igf-1/flox) and the extent of Cre-induced recombination, determined by PCR, Southern blots, and densitometry.

For serum IGF-I determination, 6-week-old mice were fasted overnight and killed by decapitation and blood was collected. The serum was extracted, to remove IGF-I binding proteins, and assayed by RIA using a kit purchased from Diagnostic Systems Laboratories, Inc. (Webster, TX) (32). The antibody used is specific for rat IGF-I and does not cross-react with human IGF-I or IGF-II. All manipulations were approved by the Animal Care and Use Committee of the National Institute of Diabetes and Digestive and Kidney Diseases, NIH, Bethesda, MD.

Statistical analysis was performed using Statistica Software Package (StatSoft, Inc., Tulsa, OK). Levels of IGF-I mRNA, serum IGF-I, and igf-1 gene dosage were entered into a forward stepwise multiple regression analysis to determine their independent relationship to the body weight.


    ACKNOWLEDGMENTS
 
The authors wish to thank Drs. H. Gu and K. Rajewsky for providing the plasmids pGH-1 and pMC-Cre, Dr. Peter Rotwein for providing mouse IGF-I genomic constructs {lambda}19 and pMI-4, Dr. R. D. Palmiter for the mouse IGF-I genomic library {lambda}7 and Drs. A. Koval, A. Butler, and C. Hernandez-Sanchez for DNA constructs, Cre probe, and RNase protection assay, respectively, and V. Blakesley and Marc Reitman for helpful discussions.


    FOOTNOTES
 
Address requests for reprints to: Derek LeRoith, M.D., Ph.D., Diabetes Branch, National Institute of Diabetes and Digestive and Kidney Diseases, NIH, Room 8S235A, Building 10, Bethesda Maryland 20892-1770. E-mail: derek{at}helix.nih.gov

J.-L. Liu is supported by a fellowship award from Medical Research Council of Canada.

Received for publication February 25, 1998. Revision received April 10, 1998. Accepted for publication May 12, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Liu JP, Baker J, Perkins AS, Robertson EJ, Efstratiadis A 1993 Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 75:59–72[Medline]
  2. Baker J, Liu JP, Robertson EJ, Efstratiadis A 1993 Role of insulin-like growth factors in embryonic and postnatal growth. Cell 75:73–82[CrossRef][Medline]
  3. Powell-Braxton L, Hollingshead P, Warburton C, Dowd M, Pitts-Meek S, Dalton D, Gillett N, Stewart TA 1993 IGF-I is required for normal embryonic growth in mice. Genes Dev 7:2609–2617[Abstract/Free Full Text]
  4. Woods KA, Camacho-Hubner C, Savage MO, Clark AJ 1996 Intrauterine growth retardation and postnatal growth failure associated with deletion of the insulin-like growth factor I gene. N Engl J Med 335:1363–1367[Free Full Text]
  5. D’Ercole AJ 1993 Expression of insulin-like growth factor-I in transgenic mice. Ann NY Acad Sci 692:149–160[Medline]
  6. Coleman ME, DeMayo F, Yin KC, Lee HM, Geske R, Montgomery C, Schwartz RJ 1995 Myogenic vector expression of insulin-like growth factor I stimulates muscle cell differentiation and myofiber hypertrophy in transgenic mice. J Biol Chem 270:12109–12116[Abstract/Free Full Text]
  7. Reiss K, Cheng W, Ferber A, Kajstura J, Li P, Li B, Olivetti G, Homcy CJ, Baserga R, Anversa P 1996 Overexpression of insulin-like growth factor-1 in the heart is coupled with myocyte proliferation in transgenic mice. Proc Natl Acad Sci USA 93:8630–8635[Abstract/Free Full Text]
  8. Ohneda K, Ulshen MH, Fuller CR, D’Ercole AJ, Lund PK 1997 Enhanced growth of small bowel in transgenic mice expressing human insulin-like growth factor I. Gastroenterology 112:444–454[CrossRef][Medline]
  9. Mansour SL, Thomas KR, Capecchi MR 1988 Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy for targeting mutations to non-selectable genes. Nature 336:348–352[CrossRef][Medline]
  10. Sauer B 1993 Manipulation of transgenes by site-specific recombination: use of Cre recombinase. Methods Enzymol 225:890–900[Medline]
  11. Gu H, Marth JD, Orban PC, Mossmann H, Rajewsky K 1994 Deletion of a DNA polymerase beta gene segment in T cells using cell type-specific gene targeting. Science 265:103–106[Abstract/Free Full Text]
  12. Tsien JZ, Chen DF, Gerber D, Tom C, Mercer EH, Anderson DJ, Mayford M, Kandel ER, Tonegawa S 1996 Subregion- and cell type-restricted gene knockout in mouse brain. Cell 87:1317–1326[CrossRef][Medline]
  13. Tsien JZ, Huerta PT, Tonegawa S 1996 The essential role of hippocampal CA1 NMDA receptor-dependent synaptic plasticity in spatial memory. Cell 87:1327–1338[CrossRef][Medline]
  14. Olanrewaju HA, Sanzenbacher ED, Seidel ER 1996 Insulin-like growth factor I in suckling rat gastric contents. Dig Dis Sci 41:1392–1397[CrossRef][Medline]
  15. Philipps AF, Anderson GG, Dvorak B, Williams CS, Lake M, Lebouton AV, Koldovsky O 1997 Growth of artificially fed infant rats: effect of supplementation with insulin-like growth factor I. Am J Physiol 272:R1532–R1539
  16. Burrin DG, Davis TA, Fiorotto ML, Reeds PJ 1997 Role of milk-borne vs. endogenous insulin-like growth factor I in neonatal growth. J Anim Sci 75:2739–2743[Abstract/Free Full Text]
  17. Burrin DG 1997 Is milk-borne insulin-like growth factor-I essential for neonatal development? J Nutr 127:975S–979S[Abstract/Free Full Text]
  18. Hoyt EC, Van Wyk JJ, Lund PK 1988 Tissue and development specific regulation of a complex family of rat insulin-like growth factor I messenger ribonucleic acids. Mol Endocrinol 2:1077–1086[Abstract/Free Full Text]
  19. Lowe Jr WL, Roberts Jr CT, Lasky SR, LeRoith D 1987 Differential expression of alternative 5' untranslated regions in mRNAs encoding rat insulin-like growth factor I. Proc Natl Acad Sci USA 84:8946–8950[Abstract/Free Full Text]
  20. Mathews L, Norstedt G, Palmiter R 1986 Regulation of insulin-like growth factor I gene expression by growth hormone. Proc Natl Acad Sci USA 83:9343–9347[Abstract/Free Full Text]
  21. Yang H, Adamo ML, Koval AP, McGuinness MC, Ben-Hur H, Yang Y, LeRoith D, Roberts Jr CT 1995 Alternative leader sequences in insulin-like growth factor I mRNAs modulate translational efficiency and encode multiple signal peptides. Mol Endocrinol 9:1380–1395[Abstract/Free Full Text]
  22. Dooley TP, Miranda M, Jones NC, DePamphilis ML 1989 Transactivation of the adenovirus EIIa promoter in the absence of adenovirus E1A protein is restricted to mouse oocytes and preimplantation embryos. Development 107:945–956[Abstract/Free Full Text]
  23. Yoshizawa T, Handa Y, Uematsu Y, Takeda S, Sekine K, Yoshihara Y, Kawakami T, Arioka K, Sato H, Uchiyama Y, Masushige S, Fukamizu A, Matsumoto T, Kato S 1997 Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning. Nat Genet 16:391–396[CrossRef][Medline]
  24. Xu Y, Ashley T, Brainerd EE, Bronson RT, Meyn MS, Baltimore D 1996 Targeted disruption of ATM leads to growth retardation, chromosomal fragmentation during meiosis, immune defects, and thymic lymphoma. Genes Dev 10:2411–2422[Abstract/Free Full Text]
  25. Kuhn R, Schwenk F, Aguet M, Rajewsky K 1995 Inducible gene targeting in mice. Science 269:1427–1429[Abstract/Free Full Text]
  26. Wang Y, Krushel LA, Edelman GM 1996 Targeted DNA recombination in vivo using an adenovirus carrying the cre recombinase gene. Proc Natl Acad Sci USA 93:3932–3936[Abstract/Free Full Text]
  27. Tollefsen SE, Lajara R, McCusker RH, Clemmons DR, Rotwein P 1989 Insulin-like growth factors (IGF) in muscle development. Expression of IGF-I, the IGF-I receptor, and an IGF binding protein during myoblast differentiation. J Biol Chem 264:13810–13817[Abstract/Free Full Text]
  28. Lakso M, Pichel JG, Gorman JR, Sauer B, Okamoto Y, Lee E, Alt FW, Westphal H 1996 Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc Natl Acad Sci USA 93:5860–5865[Abstract/Free Full Text]
  29. Laird PW, Zijderveld A, Linders K, Rudnicki MA, Jaenisch R, Berns A 1991 Simplified mammalian DNA isolation procedure. Nucleic Acids Res 19:4293[Free Full Text]
  30. Liu JL, Patel YC 1995 Glucocorticoids inhibit somatostatin gene expression through accelerated degradation of somatostatin messenger ribonucleic acid in human thyroid medullary carcinoma (TT) cells. Endocrinology 136:2389–2396[Abstract]
  31. Werner H, Woloschak M, Adamo M, Shen-Orr Z, Roberts Jr CT, LeRoith D 1989 Developmental regulation of the rat insulin-like growth factor I receptor gene. Proc Natl Acad Sci USA 86:7451–7455[Abstract/Free Full Text]
  32. Lee PD, Baker BK, Liu F, Kwan EY, Hintz RL 1996 A homologous radioimmunoassay for rat insulin-like growth factor-I (IGF-I): implications for studies of human IGF-I physiology. J Clin Endocrinol Metab 81:2002–2005[Abstract]



This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
W. Matheny, E. Merritt, S. V. Zannikos, R. P. Farrar, and M. L. Adamo
Serum IGF-I-Deficiency Does Not Prevent Compensatory Skeletal Muscle Hypertrophy in Resistance Exercise
Experimental Biology and Medicine, February 1, 2009; 234(2): 164 - 170.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. Svensson, J. Kindblom, R. Shao, S. Moverare-Skrtic, M. K Lagerquist, N. Andersson, K. Sjogren, K. Venken, D. Vanderschueren, J.-O. Jansson, et al.
Liver-derived IGF1 enhances the androgenic response in prostate
J. Endocrinol., December 1, 2008; 199(3): 489 - 497.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Moore, S. Carbajal, L. Beltran, S. N. Perkins, S. Yakar, D. LeRoith, S. D. Hursting, and J. DiGiovanni
Reduced Susceptibility to Two-Stage Skin Carcinogenesis in Mice with Low Circulating Insulin-Like Growth Factor I Levels
Cancer Res., May 15, 2008; 68(10): 3680 - 3688.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Anzo, L. J. Cobb, D. L. Hwang, H. Mehta, J. W. Said, S. Yakar, D. LeRoith, and P. Cohen
Targeted Deletion of Hepatic Igf1 in TRAMP Mice Leads to Dramatic Alterations in the Circulating Insulin-Like Growth Factor Axis but Does Not Reduce Tumor Progression
Cancer Res., May 1, 2008; 68(9): 3342 - 3349.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Wang, M. R. Bowl, S. Bender, J. Peng, L. Farber, J. Chen, A. Ali, Z. Zhang, A. S. Alberts, R. V. Thakker, et al.
Parafibromin, a Component of the Human PAF Complex, Regulates Growth Factors and Is Required for Embryonic Development and Survival in Adult Mice
Mol. Cell. Biol., May 1, 2008; 28(9): 2930 - 2940.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. R. Goldman-Johnson, D. M. de Kretser, and J. R. Morrison
Evidence that Androgens Regulate Early Developmental Events, Prior to Sexual Differentiation
Endocrinology, January 1, 2008; 149(1): 5 - 14.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
I. Kim, S.-H. Ahn, T. Inagaki, M. Choi, S. Ito, G. L. Guo, S. A. Kliewer, and F. J. Gonzalez
Differential regulation of bile acid homeostasis by the farnesoid X receptor in liver and intestine
J. Lipid Res., December 1, 2007; 48(12): 2664 - 2672.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. E. Govoni, J. E. Wergedal, L. Florin, P. Angel, D. J. Baylink, and S. Mohan
Conditional Deletion of Insulin-Like Growth Factor-I in Collagen Type 1{alpha}2-Expressing Cells Results in Postnatal Lethality and a Dramatic Reduction in Bone Accretion
Endocrinology, December 1, 2007; 148(12): 5706 - 5715.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
K. E. Govoni, S. K. Lee, Y.-S. Chung, R. R. Behringer, J. E. Wergedal, D. J. Baylink, and S. Mohan
Disruption of insulin-like growth factor-I expression in type II{alpha}I collagen-expressing cells reduces bone length and width in mice
Physiol Genomics, August 20, 2007; 30(3): 354 - 362.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. Svensson, A. Tivesten, K. Sjogren, O. Isaksson, G. Bergstrom, S. Mohan, J. Molne, J. Isgaard, and C. Ohlsson
Liver-derived IGF-I regulates kidney size, sodium reabsorption, and renal IGF-II expression
J. Endocrinol., June 1, 2007; 193(3): 359 - 366.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. V. Loladze, M. A. Stull, A. M. Rowzee, J. DeMarco, J. H. Lantry III, C. J. Rosen, D. LeRoith, K.-U. Wagner, L. Hennighausen, and T. L. Wood
Epithelial-Specific and Stage-Specific Functions of Insulin-Like Growth Factor-I during Postnatal Mammary Development
Endocrinology, November 1, 2006; 147(11): 5412 - 5423.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J Svensson, M Diez, J Engel, C Wass, A Tivesten, J-O Jansson, O Isaksson, T Archer, T Hokfelt, and C Ohlsson
Endocrine, liver-derived IGF-I is of importance for spatial learning and memory in old mice.
J. Endocrinol., June 1, 2006; 189(3): 617 - 627.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. T. Oliver, J. Rosenberger, R. Lopez, A. Gomez, K. K. Cummings, and M. L. Fiorotto
The Local Expression and Abundance of Insulin-Like Growth Factor (IGF) Binding Proteins in Skeletal Muscle Are Regulated by Age and Gender But Not Local IGF-I in Vivo
Endocrinology, December 1, 2005; 146(12): 5455 - 5462.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Svensson, B. Soderpalm, K. Sjogren, J. Engel, and C. Ohlsson
Liver-derived IGF-I regulates exploratory activity in old mice
Am J Physiol Endocrinol Metab, September 1, 2005; 289(3): E466 - E473.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Z. Tang, R. Yu, Y. Lu, A. F. Parlow, and J.-L. Liu
Age-dependent onset of liver-specific IGF-I gene deficiency and its persistence in old age: implications for postnatal growth and insulin resistance in LID mice
Am J Physiol Endocrinol Metab, August 1, 2005; 289(2): E288 - E295.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Guo, Y. Lu, D. Houle, K. Robertson, Z. Tang, J. J. Kopchick, Y. L. Liu, and J.-L. Liu
Pancreatic Islet-Specific Expression of an Insulin-Like Growth Factor-I Transgene Compensates Islet Cell Growth in Growth Hormone Receptor Gene-Deficient Mice
Endocrinology, June 1, 2005; 146(6): 2602 - 2609.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Kim, E. Barton, N. Muja, S. Yakar, P. Pennisi, and D. LeRoith
Intact Insulin and Insulin-Like Growth Factor-I Receptor Signaling Is Required for Growth Hormone Effects on Skeletal Muscle Growth and Function in Vivo
Endocrinology, April 1, 2005; 146(4): 1772 - 1779.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
C. Phornphutkul, K.-Y. Wu, X. Yang, Q. Chen, and P. A Gruppuso
Insulin-like growth factor-I signaling is modified during chondrocyte differentiation
J. Endocrinol., December 1, 2004; 183(3): 477 - 486.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
Y. Lu, P. L. Herrera, Y. Guo, D. Sun, Z. Tang, D. LeRoith, and J.-L. Liu
Pancreatic-Specific Inactivation of IGF-I Gene Causes Enlarged Pancreatic Islets and Significant Resistance to Diabetes
Diabetes, December 1, 2004; 53(12): 3131 - 3141.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Mazerbourg, D. M. Bouley, S. Sudo, C. A. Klein, J. V. Zhang, K. Kawamura, L. V. Goodrich, H. Rayburn, M. Tessier-Lavigne, and A. J. W. Hsueh
Leucine-Rich Repeat-Containing, G Protein-Coupled Receptor 4 Null Mice Exhibit Intrauterine Growth Retardation Associated with Embryonic and Perinatal Lethality
Mol. Endocrinol., September 1, 2004; 18(9): 2241 - 2254.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J.-L. Liu, K. T. Coschigano, K. Robertson, M. Lipsett, Y. Guo, J. J. Kopchick, U. Kumar, and Y. L. Liu
Disruption of growth hormone receptor gene causes diminished pancreatic islet size and increased insulin sensitivity in mice
Am J Physiol Endocrinol Metab, September 1, 2004; 287(3): E405 - E413.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Wessells, S. Yakar, and P. F. Johnson
Critical Prosurvival Roles for C/EBP{beta} and Insulin-Like Growth Factor I in Macrophage Tumor Cells
Mol. Cell. Biol., April 15, 2004; 24(8): 3238 - 3250.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. H. Ngo, R. J. Barnard, P. Cohen, S. Freedland, C. Tran, F. deGregorio, Y. I. Elshimali, D. Heber, and W. J. Aronson
Effect of Isocaloric Low-fat Diet on Human LAPC-4 Prostate Cancer Xenografts in Severe Combined Immunodeficient Mice and the Insulin-like Growth Factor Axis
Clin. Cancer Res., July 1, 2003; 9(7): 2734 - 2743.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. Leneuve, S. Colnot, G. Hamard, F. Francis, M. Niwa-Kawakita, M. Giovannini, and M. Holzenberger
Cre-mediated germline mosaicism: a new transgenic mouse for the selective removal of residual markers from tri-lox conditional alleles
Nucleic Acids Res., March 1, 2003; 31(5): e21 - e21.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Ajo, L. Cacicedo, C. Navarro, and F. Sanchez-Franco
Growth Hormone Action on Proliferation and Differentiation of Cerebral Cortical Cells from Fetal Rat
Endocrinology, March 1, 2003; 144(3): 1086 - 1097.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Tivesten, E. Bollano, I. Andersson, S. Fitzgerald, K. Caidahl, K. Sjogren, O. Skott, J.-L. Liu, R. Mobini, O. G. P. Isaksson, et al.
Liver-Derived Insulin-Like Growth Factor-I Is Involved in the Regulation of Blood Pressure in Mice
Endocrinology, November 1, 2002; 143(11): 4235 - 4242.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
Liver-Specific IGF-1-Deficient Mice
Sci. Aging Knowl. Environ., October 23, 2002; 2002(42): tg11 - 11.
[Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Hellstrom, B. Carlsson, A. Niklasson, K. Segnestam, M. Boguszewski, L. de Lacerda, M. Savage, E. Svensson, L. Smith, D. Weinberger, et al.
IGF-I Is Critical for Normal Vascularization of the Human Retina
J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3413 - 3416.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. M. Naranjo, S. Yakar, M. Sanchez-Gomez, A. U. Perez, J. Setser, and D. LERoith
Protein Calorie Restriction Affects Nonhepatic IGF-I Production and the Lymphoid System: Studies Using the Liver-Specific IGF-I Gene-Deleted Mouse Model
Endocrinology, June 1, 2002; 143(6): 2233 - 2241.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
C. S. Carter, M. M. Ramsey, R. L. Ingram, A. B. Cashion, W. T. Cefalu, Z.Q. Wang, and W. E. Sonntag
Models of Growth Hormone and IGF-1 Deficiency: Applications to Studies of Aging Processes and Life-Span Determination
J. Gerontol. A Biol. Sci. Med. Sci., May 1, 2002; 57(5): B177 - 188.
[Abstract] [Full Text]


Home page
PhysiologyHome page
A. A. Butler, S. Yakar, and D. LeRoith
Insulin-Like Growth Factor-I: Compartmentalization Within the Somatotropic Axis?
Physiology, April 1, 2002; 17(2): 82 - 85.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Wu, S. Yakar, L. Zhao, L. Hennighausen, and D. LeRoith
Circulating Insulin-like Growth Factor-I Levels Regulate Colon Cancer Growth and Metastasis
Cancer Res., February 1, 2002; 62(4): 1030 - 1035.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Holzenberger, G. Hamard, R. Zaoui, P. Leneuve, B. Ducos, C. Beccavin, L. Perin, and Y. Le Bouc
Experimental IGF-I Receptor Deficiency Generates a Sexually Dimorphic Pattern of Organ-Specific Growth Deficits in Mice, Affecting Fat Tissue in Particular
Endocrinology, October 1, 2001; 142(10): 4469 - 4478.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
G. Camarero, C. Avendano, C. Fernandez-Moreno, A. Villar, J. Contreras, F. de Pablo, J. G. Pichel, and I. Varela-Nieto
Delayed Inner Ear Maturation and Neuronal Loss in Postnatal Igf-1-Deficient Mice
J. Neurosci., October 1, 2001; 21(19): 7630 - 7641.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
K. Sjogren, K. Wallenius, J.-L. Liu, M. Bohlooly-Y, G. Pacini, L. Svensson, J. Tornell, O. G.P. Isaksson, B. Ahren, J.-O. Jansson, et al.
Liver-Derived IGF-I is of Importance for Normal Carbohydrate and Lipid Metabolism
Diabetes, July 1, 2001; 50(7): 1539 - 1545.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. A. Butler and D. LeRoith
Minireview: Tissue-Specific Versus Generalized Gene Targeting of the igf1 and igf1r Genes and Their Roles in Insulin-Like Growth Factor Physiology
Endocrinology, May 1, 2001; 142(5): 1685 - 1688.
[Abstract] [Full Text]


Home page
DiabetesHome page
S. Yakar, J.-L. Liu, A. M. Fernandez, Y. Wu, A. V. Schally, J. Frystyk, S. D. Chernausek, W. Mejia, and D. Le Roith
Liver-Specific igf-1 Gene Deletion Leads to Muscle Insulin Insensitivity
Diabetes, May 1, 2001; 50(5): 1110 - 1118.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Hellstrom, C. Perruzzi, M. Ju, E. Engström, A.-L. Hård, J.-L. Liu, K. Albertsson-Wikland, B. Carlsson, A. Niklasson, L. Sjödell, et al.
Low IGF-I suppresses VEGF-survival signaling in retinal endothelial cells: Direct correlation with clinical retinopathy of prematurity
PNAS, May 1, 2001; (2001) 101113998.
[Abstract] [Full Text]


Home page
Endocr. Rev.Home page
D. Le Roith, C. Bondy, S. Yakar, J.-L. Liu, and A. Butler
The Somatomedin Hypothesis: 2001
Endocr. Rev., February 1, 2001; 22(1): 53 - 74.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
J.-L. Liu, S. Yakar, and D. LeRoith
Mice Deficient in Liver Production of Insulin-Like Growth Factor I Display Sexual Dimorphism in Growth Hormone-Stimulated Postnatal Growth
Endocrinology, December 1, 2000; 141(12): 4436 - 4441.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Holzenberger, C. Lenzner, P. Leneuve, R. Zaoui, G. Hamard, S. Vaulont, and Y. L. Bouc
Cre-mediated germline mosaicism: a method allowing rapid generation of several alleles of a target gene
Nucleic Acids Res., November 1, 2000; 28(21): e92 - e92.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
J.-L. Liu, S. Yakar, and D. LeRoith
Conditional Knockout of Mouse Insulin-Like Growth Factor-1 Gene Using the Cre/loxP System
Experimental Biology and Medicine, April 1, 2000; 223(4): 344 - 351.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. R. Boisclair, J. Wang, J. Shi, K. R. Hurst, and G. T. Ooi
Role of the Suppressor of Cytokine Signaling-3 in Mediating the Inhibitory Effects of Interleukin-1beta on the Growth Hormone-dependent Transcription of the Acid-labile Subunit Gene in Liver Cells
J. Biol. Chem., February 11, 2000; 275(6): 3841 - 3847.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J.-L. Liu and D. LeRoith
Insulin-Like Growth Factor I Is Essential for Postnatal Growth in Response to Growth Hormone
Endocrinology, November 1, 1999; 140(11): 5178 - 5184.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Yakar, J.-L. Liu, B. Stannard, A. Butler, D. Accili, B. Sauer, and D. LeRoith
Normal growth and development in the absence of hepatic insulin-like growth factor I
PNAS, June 22, 1999; 96(13): 7324 - 7329.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Sjogren, J.-L. Liu, K. Blad, S. Skrtic, O. Vidal, V. Wallenius, D. LeRoith, J. Tornell, O. G. P. Isaksson, J.-O. Jansson, et al.
Liver-derived insulin-like growth factor I (IGF-I) is the principal source of IGF-I in blood but is not required for postnatal body growth in mice
PNAS, June 8, 1999; 96(12): 7088 - 7092.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Zhang, H. Hoff, and C. Sell
Insulin-like Growth Factor I-mediated Degradation of Insulin Receptor Substrate-1 Is Inhibited by Epidermal Growth Factor in Prostate Epithelial Cells
J. Biol. Chem., July 14, 2000; 275(29): 22558 - 22562.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Hellstrom, C. Perruzzi, M. Ju, E. Engstrom, A.-L. Hard, J.-L. Liu, K. Albertsson-Wikland, B. Carlsson, A. Niklasson, L. Sjodell, et al.
Low IGF-I suppresses VEGF-survival signaling in retinal endothelial cells: Direct correlation with clinical retinopathy of prematurity
PNAS, May 8, 2001; 98(10): 5804 - 5808.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. S. Sohal, M. Nghiem, M. A. Crackower, S. A. Witt, T. R. Kimball, K. M. Tymitz, J. M. Penninger, and J. D. Molkentin
Temporally Regulated and Tissue-Specific Gene Manipulations in the Adult and Embryonic Heart Using a Tamoxifen-Inducible Cre Protein
Circ. Res., July 6, 2001; 89(1): 20 - 25.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, J.-L.
Right arrow Articles by LeRoith, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, J.-L.
Right arrow Articles by LeRoith, D.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals