| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Section on Cellular and Molecular Physiology (J.L.L., M.K.,
D.L.) Diabetes Branch and Laboratory of Biochemistry and
Metabolism (B.S.) The National Institute of Diabetes and
Digestive and Kidney Diseases
Laboratory of Mammalian
Genes and Development (A.G., H.W.) and Developmental Endocrinology
Branch (D.A.) The National Institute of Child Health and Human
Development National Institutes of Health Bethesda, Maryland
20892
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The conventional gene knockout approach potently demonstrated the crucial role of IGF-I in intrauterine development and perinatal survival but is unsuitable for postnatal studies on animal growth because most of the mice die after birth (1, 2, 3). To study the lower limit of IGF-I expression necessary for postnatal survival and the effect of IGF-I deficiency on postnatal growth, the Cre/loxP system was used to avoid perinatal lethality. We generated mice with the igf-1 locus flanked by loxP (igf-1/flox) repeats by homologous recombination and crossed them with EIIa-cre transgenic mice, which express the bacteriophage P1 Cre recombinase under the adenovirus promoter EIIa during early embryonic development before implantation. In this manner, we created genetic mosaics whose IGF-I expression is partially abrogated, thus allowing the correlation of the level of mosaicism with various phenotypes and the level of IGF-I expression. As a result, Cre-induced igf-1 recombination caused postnatal lethality in the most severe cases of gene recombination and significant growth retardation in the survivors who had lesser degrees of recombination of the igf-1 locus. We demonstrate that igf-1 gene dosage determines the level of IGF-I expression and the rate of pre- and postnatal growth. Interestingly, we found a closer correlation of the growth rate with serum IGF-I concentration than with the level of liver IGF-I gene expression.
| RESULTS |
|---|
|
|
|---|
|
|
|
Cre Causes igf-1 Recombination in Heterozygous
igf-1/flox Mice
EIIa-cre transgenic mice, which express Cre recombinase
in early embryonic development, were used to develop mosaic mice of
igf-1 recombination. All the offspring (Cre F1) from
crossing male EIIa-cre and female heterozygous
igf-1/flox mice carry one allele of cre, and
half of them have their igf-1 exon 4 flanked by loxP
sites. PCR analysis of tail DNA in mice bearing igf-1/flox
revealed various degrees of exon 4 deletion. When primers ES-1/ID-3
were used (Fig. 1B
), the wild-type PCR product is approximately 1 kb
and the igf-1/flox locus is approximately 2 kb (which cannot
be amplified under the assay condition), whereas Cre-induced exon 4
recombination is detected as a 0.2-kb band (Fig. 4
). Southern blot analysis confirmed
the conversion from the igf-1/flox fragment of 4.9 kb to the
recombinant of 2.8 kb, when DNA was digested with HindIII
and hybridized to pSP-3 internal probe (Fig. 4
). This indicates that
one copy of the cre transgene is sufficient to induce
targeted gene recombination. Incomplete recombination may be attributed
to delayed and/or mosaic expression of the cre.
|
95%)
recombination of the igf-1 (Fig. 5
|
|
|
|
|
In contrast to the dramatic decrease in the level of liver IGF-I mRNA,
the change in serum IGF-I concentration is more moderate and correlates
more closely with postnatal growth rate. Thus, mice with two alleles of
Cre-induced igf-1 recombination (gene dosage 0.10.4)
demonstrate liver IGF-I mRNA at 28% of the level of their wild-type
littermates, whereas the level of circulating IGF-I is 71% and their
growth rates were 6872% of that of the control mice (Tables 1
and 2
).
Tissue Variations in Cre-Induced igf-1 Recombination
and IGF-I Gene Expression
One explanation for the relative high level of serum IGF-I (71%
of control) in the face of markedly reduced liver IGF-I mRNA levels
(28% of control) is that circulating IGF-I may be derived from
extrahepatic tissues. We therefore analyzed brain, kidney, muscle,
liver, and lung from two litters of wild-type, heterozygous, and
homozygous igf-1/flox mice (two to three each). Genomic DNA
was prepared, and Cre-induced igf-1 recombination was
studied by Southern blots. There was no significant difference in the
pattern and degree of gene recombination induced by Cre expression,
among all tissues examined (including the tails), indicating that the
promoter EIIa was activated well ahead of tissue differentiation to
have ensured homogenous recombination (data not shown).
To determine the level of IGF-I gene expression, total RNA from these
tissues was used for ribonuclease (RNase) protection assay. While there
was a >65% decrease in the liver IGF-I mRNA, the extrahepatic tissues
had only
a 4050% decrease in IGF-I mRNA in igf-1/flox
mice (data not shown). In a study involving 51 mice, Northern blots of
liver RNA revealed a 72% reduction in the major form (
0.7 kb) of
IGF-I mRNA and a more moderate (
48%) decrease in its minor form
(
7 kb) (Fig. 7
and Table 2
). Interestingly, in extrahepatic tissues,
the major IGF-I mRNA species are
7 kb, which showed a similar modest
reduction (
4050%) upon Cre expression (Northern blots, data not
shown).
Correlation of Growth Rate, Liver IGF-I mRNA Level, and Serum IGF-I
Concentration with igf-1 Gene Dosage
The results of linear correlation analysis demonstrate that the
Cre-induced decrease in igf-1 dosage directly affects the
level of igf-1 expression, circulating IGF-I levels, and the
rate of animal growth (Table 3
). Very
strong correlation (r = 0.80) was found between
igf-1 gene dosage and liver IGF-I mRNA level. Significant
(P < 0.001), but less strong correlation
(r = 0.460.68) was observed between body weights at 3
and 6 weeks and the igf-1 gene dosage, liver IGF-I mRNA, and
serum IGF-I levels. The correlation was stronger at 6 weeks of age when
compared with 3 weeks of age (Table 3
).
|
|
0.5), although growth retarded, are able
to reproduce. Two pairs gave birth repeatedly to an average of seven
pups per litter. Interestingly, about half of the igf-1 null
mice (accounting for
one quarter of the offspring) survived up to
46 weeks, although with severe growth retardation. At 3 weeks, null
mice weighed only 4.5 ± 0.2 g (n = 3) in comparison to
12.0 ± 0.2 g (n = 4) for their heterozygous littermates
(igf-1/flox/igf-1/null). IGF-I deficiency was confirmed by
PCR and Southern blots on genomic DNA and by RNase protection assay for
liver and brain total RNA (Fig. 8
|
| DISCUSSION |
|---|
|
|
|---|
Using homologous recombination, we have established a mouse strain in which the exon 4 of igf-1 is flanked by loxP sites. We have targeted the entire exon 4, which encodes for amino acid residues 2670 of the peptide, including part of the domain B and entire domains C, A, and D. Previously Liu et al. (1, 2) replaced only part of the same exon encoding the residues 5170, whereas Powell-Braxton et al. (3) targeted exon 3, which encodes only part of domain B of the molecule.
Our results from the mice with the most severe igf-1 recombination are similar to previously reported null mutations of the mouse igf-1 (1, 2, 3). Using the newly developed Cre/loxP system in transgenic mice, we created near- complete recombination of the target locus, which caused postnatal lethality, growth retardation, and dramatic decreases in igf-1 expression. Linear correlation analysis demonstrated that igf-1 gene dosage strongly defines the IGF-I mRNA level in liver as expected. Surprisingly, body weight at 3 weeks was predicted by only the serum IGF-I level but not by igf-1 gene dosage or the level of IGF-I mRNA in liver. At 6 weeks the mRNA level became a significant parameter for the forward stepwise model. This discrepancy could be explained by the consumption of mothers milk by the pups up to 3 weeks of age. It is known that the content of IGF-I in the milk of most mammals is high (14). However, the role of milk-derived IGF-I in the growth of young animals is unclear. Although milk-borne IGF-I may not be essential for neonatal development, it has been reported that milk proteins protect IGF-I from degradation in neonatal rat intestine and oral consumption of IGF-I via milk is associated with the absorption of the growth factor into the bloodstream. Therefore therapeutic use of oral IGF-I has been proposed as an effective intervention for preterm neonates and those with compromised intestinal function (15, 16, 17). Our data are in agreement with this finding since once the animals were weaned, the body weight gain was predicted exclusively by gene dosage, which suggests that this effect could have been masked by oral IGF-I delivery. In addition, persistent presence or even compensatory increase of IGF-II in the perinatal period may also compensate for the growth deficiency in the first 3 weeks of life.
Another novel observation from our study was that the decrease in liver
IGF-I mRNA levels was much more dramatic than the reduction in serum
IGF-I concentration. This result contradicts the generally accepted
hypothesis that liver is the main source of postnatal IGF-I production
and is the major source of circulating, endocrine IGF-I that controls
body growth. A number of possible explanations may explain the
discrepancy between liver IGF-I mRNA levels and circulating IGF-I
levels in our genetically engineered animals: 1) Enhanced translational
activity may compensate for lower mRNA levels. 2) Circulating IGF-I may
be metabolized more slowly, perhaps as a result of changes in
IGF-binding proteins. 3) Extrahepatic tissues may, in fact, play a
major role in contributing to the circulating IGF-I levels. Indeed, we
favor the last possibility, despite the fact that it differs from
conventional notions. Interestingly, recombination of the
igf-1 by Cre, as detected on Southern blots, was
similar in extrahepatic and hepatic tissues. Thus, we must conclude
that igf-1 expression in these extrahepatic tissues was
maintained despite the severe reduction in intact igf-1
gene. One possible explanation for this discrepancy is that in all the
extrahepatic tissues we examined, IGF-I was apparently translated
mainly from the higher (
7 kb) mRNA species, which may be less
affected under the circumstances of low gene dosage. On the other hand,
liver IGF-I production may be more sensitive to changes in
igf-1 gene dosage with an effect on the lower mol wt mRNA
species (
0.7 kb). These differences between liver and extrahepatic
regulation of IGF-I expression have been previously described
(18, 19, 20, 21).
In the present study, Cre-induced igf-1 knockout was
achieved in mice of two generations (Cre F1 and
F2). We demonstrated significant target gene recombination
in Cre F1 mice that carry only one allele of
igf-1/flox and cre transgene. Interbreeding of
Cre F1 generated at least five genotypes of Cre
F2 mice: homozygous igf-1/flox with or without
cre transgene; heterozygous igf-1/flox with or
without cre; and wild-type igf-1 locus in which
case the presence of cre gene is irrelevant. The pattern of
Cre activity judged by the recombination of the igf-1 locus
is quite variable. There was near complete (
95%) recombination,
which caused perinatal lethality, whereas incomplete deletion to the
igf-1/flox locus was associated with postnatal survival and
growth retardation. As listed in Tables 1
and 2
, we generated 11 mice
with homozygous igf-1/flox locus, 7090% gene deletion
(gene dosage 0.10.4 group), which survived up to 6 weeks.
Surprisingly, in this group five mice actually did not carry
cre transgene. How then did igf-1 recombination
occur? If the gene deletion occurred before the formation of the
gametes, the recombination has to be all or none. If, on the other
hand, gene recombination occurred after fertilization of the Cre
F2, the cre transgene should not be lost during
development. Therefore, we propose that these mice are derived from
haploid gametes (oocytes) that inherited Cre protein from their diploid
precursor cells via the cytoplasm during meiosis (without itself
carrying a cre transgene). Limited Cre activity in those
gametes and fertilized eggs will create incomplete (mosaic)
recombination of the igf-1 locus. While this has to be
tested, it remains a reasonable explanation since the EIIa promoter has
been shown to be activated in undifferentiated stages of murine
oogenesis and preimplantation development (22).
Growth retardation caused by genetic defects is often associated with
infertility, such as mice lacking the IGF-I, vitamin D receptor, and
ATM genes (1, 2, 3, 23, 24). In the case of igf-1 targeting,
homozygous mice are sterile and growth retarded while heterozygous
(gene dosage 0.5) are basically normal in both growth and fertility. We
were interested in testing the effect of growth retardation caused by
Cre-induced igf-1 recombination on fertility. In our
studies, mice with igf-1 gene dosage
0.5 are still
fertile. Therefore, infertility is not always the consequence of growth
retardation. The same experiment also demonstrated that the
Cre-recombined allele can be transmitted through the germline and
produce null mice.
IGF-I is widely expressed throughout development and in adult life.
Since the total knockout of the igf-1 gene has been known to
cause profound defects in early development and postnatal viability,
these animals cannot be used to address specific questions such as 1)
what is the role of the circulating (endocrine) IGF-I in postnatal
growth compared with local tissue IGF-I production? 2) how does IGF-I
deficiency causes infertility? and 3) what is the role of
tissue-specific expressed IGF-I? The Cre/loxP system provides a more
powerful tool in answering these questions. Flanking the
igf-1 locus by loxP sites opens a new chapter so that the
gene can be manipulated just by expressing Cre in a chosen target
tissues and at defined stages using tissue-specific promoters. Toward
that direction, a tissue-specific promoter can activate the
cre transgene at a defined stage in the development of the
target tissue, such as T cell-specific lck promoter and neuron-specific
-calmodulin kinase II promoter (11, 12). A silent cre
transgene (Mx1-Cre) can be induced upon application of interferon
(25). Furthermore, cre transgene has been successfully
expressed in the liver after intravenous injection of virus-Cre
constructs (26). The current study therefore demonstrates that the
Cre/loxP system is suitable to generate genomic recombination of the
mouse igf-1 gene in a controlled manner.
In summary, we developed a conditional igf-1 knockout system using the Cre/loxP model. The igf-1/flox mice appear healthy and demonstrated virtually normal growth rates. Expression of cre transgene created partial to near complete recombination of the igf-1 locus, which caused postnatal lethality, growth retardation, and dramatic decreases in igf-1 expression and decrease in serum IGF-I concentration. After cre expression, we demonstrated igf-1 gene dosage-dependent survival, growth, and decreases in mRNA and protein levels. Compared with those with null mutations, our mice with partial igf-1 deficiency are viable, have milder growth retardation, and are fertile, therefore allowing gene dosage-dependent studies. To dissect complex roles (endocrine, paracrine, autocrine) of a growth factor such as IGF-I, the Cre/loxP system can be extended to generate tissue- and developmental stage-specific knockout mice.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-phage clones 19
and 7, kindly provided by Drs. P Rotwein and R. D. Palmiter,
respectively (20, 27). A 6.5-kb HindIII fragment (from
19) was used as the targeting region; immediately downstream, a
0.8-kb HindIII/EcoRI fragment (pH3-HE from
19)
was used as 3'-external probe; and immediately upstream, a 1-kb
BamHI/HindIII fragment (pB2-BH from
7) was
used as 5'-external probe in screening homologous recombination (Fig. 1
The replacement-type targeting vector (Fig. 1B
) was made by inserting
the first loxP site (from pMC-lox-Neo) into intron 3 at the
BamHI site of the 6.5-kb HindIII fragment, on a
pBluescript KS+ backbone (Stratagene, La Jolla, CA). The bacterial
neomycin-resistance gene (neo) along with the second loxP
site [1.2 kb from pGH-1, K. Rajewsky (11)] was inserted into intron 4
at the EcoRI site. As a result, the two direct repeats of
loxP sites flanked a 0.9-kb genomic region including the entire exon 4
(182 bp), which encodes residues 2670 of mouse IGF-I (1, 20). The
targeting vector contained 2.5 kb of homologous DNA upstream (left arm)
of the first loxP site and 2.8 kb of homologous DNA downstream (right
arm) of the second loxP site. A herpes simplex virus thymidine kinase
gene [HSV-tk, 1.2 kb from pGH-1, K. Rajewsky (11)] was
inserted upstream to the left arm. A unique SacII site at
the 3'-end of the right arm was used to linearize the construct.
The targeting vector was electroporated into ES cells derived from 129
sv mice maintained on subconfluent embryonic fibroblasts. ES clones,
resistant to both geneticin (G418) and gancyclovir, were picked and
expanded. The ES cells harboring the homologous recombined construct
were determined by Southern blotting using both 5'(pB2-BH) and
3'(pH3-HE) probes external to the homologous region (Fig. 1C
). The
correctly targeted ES cell clones were expanded and injected into
C57BL/6 blastocysts and transferred into pseudopregnant mothers. Male
chimeric mice were bred against female C57BL/6 mice. The F1
mice with germline transmission of the igf-1/flox locus were
allowed to interbreed to generate homozygous igf-1/flox
(F2) mice, identified by PCR assay and Southern blot
analysis of their tail DNA.
Breeding Mice of EIIa-cre with
igf-1/flox
EIIa-cre mice, on a FVB/N genetic background, carry
the Cre recombinase gene driven by the adenovirus EIIa promoter (28).
They express Cre in oocytes and in early mouse embryos before
implantation (22, 28). Initially, female mice heterozygous for
igf-1/flox locus were bred with male mice homozygous for the
EIIa-cre transgene. Recombination of igf-1 exon 4
in offspring was assayed by PCR and Southern blotting of tail DNA. Mice
heterozygous for both EIIa-cre and igf-1/flox
locus (Cre F1) were interbred to obtain mice with
homozygous igf-1/flox alleles (Cre F2). The
expression of Cre in these mice induces deletion of
igf-1 exon 4 and impaired expression of IGF-I, as shown in
Results. Some Cre F2 mice were further allowed
to breed to test their fertility and generate mice with
igf-1 null mutation. Offsprings were ear tagged at P21 for
identification and weaned, and tail biopsies were taken for DNA
analysis.
Southern Blot Analysis
Genomic DNA from ES cells was prepared by an overnight digestion
at 37 C in a lysis buffer (100 mM Tris HCl, pH 8.5, 5
mM EDTA, 0.2% SDS, 200 mM NaCl, 0.1 mg/ml
proteinase K) and precipitation in isopropanol (29). The DNA was
digested overnight with either BamHI or KpnI,
fractionated by electrophoresis through 0.8% agarose gels, transferred
to a maximum strength Nytran membrane (Schleicher & Schuell, Keene,
NH), and hybridized with 32P-labeled 5'- or 3'-RNA probes
synthesized with the Riboprobe Systems (Promega, Madison, WI). To
calculate the extent of igf-1 recombination induced by Cre,
Southern blots were analyzed by PhosphorImager 400E (Molecular
Dynamics, Sunnyvale, CA).
Mouse tail DNA was prepared similarly in a lysis buffer (10
mM Tris, pH 8.0, 100 mM EDTA, 0.5% SDS, 0.2
mg/ml proteinase K) but at 55 C, and purified DNA was digested
overnight with HindIII and processed for Southern blot using
riboprobes synthesized with template DNA of pBS-1 or pSP-3 (Fig. 1
).
For detection of the cre transgene, tail DNA was digested
with BamHI and probed with a
XhoI/BamHI fragment of Cre coding region (from
pMC-Cre) (11). Southern blots were performed from DNA prepared from
other tissues including brain, kidney, liver, lung, and muscle.
PCR Analysis
PCR was performed on tail DNA preparations to identify which
mice have loxP sites integrated into their genome. Using primers IA-8,
IA-6, and ID-3 (see Fig. 1B
for their positions), the PCR reactions
were conducted after Perkin Elmers recommendation, with extra
MgCl2 (1.5 mM) added. The reaction cycles are:
94 C, 1 min; 56 C, 1 min; 72 C, 1 min; 25 cycles.
To detect Cre-induced recombinants, primers ES-1 and ID-3 were used
(Fig. 1B
). The cycles are: 94 C, 1 min; 56 C, 1 min; 72 C, 1.5 min; 25
cycles.
To detect the presence of the Cre-coding sequence in mouse genome, PCR was performed with primers Cre-5 and Cre-3, which amplify a 0.6-kb fragment of the cre gene. The cycles are: 94 C, 1 min; 67 C, 1 min; 72 C, 1 min; 25 cycles. The primer sequences are (5' to 3'):
IA-8: AGTGATAGGTCACAAAGTTCC
IA-6: AAACCACACTGCTCGACATTG
ID-3: CACTAAGGAGTCTGTATTTGGACC
ES-1: AGCCTCTCAACTAAGACAATA
Cre-5: AATGCTTCTGTCCGTTTGCCGGT
Cre-3: CCAGGCTAAGTGCCTTCTCTACA
RNA Preparation, Northern Blot, and RNase Protection Assay
IGF-I gene expression in adult liver was studied by Northern
blot analysis (30). Briefly, 1015 µg total RNA, prepared using
RNAzol B (Tel-Test Inc, Friendswood, TX), were electrophoresed on a 1%
agarose gel containing 5% formaldehyde, transferred to a
maximum-strength Nytran membrane (Schleicher & Schuell), and hybridized
to a 32P-labeled-antisense riboprobe synthesized by T7 RNA
polymerase using BamHI-linearized template DNA pMI-4 (exon
4) (Fig. 1A
) (27). The blot was washed and exposed to X-Omat AR film at
-70 C, and the specific bands of expected sizes were illustrated. To
demonstrate equal loading of total RNA on the gel, the blots were
stripped and reprobed with a 32P-labeled ß-actin
riboprobe (Ambion, Austin, TX). The abundance of the hybridization
signals was analyzed by PhosphorImager 400E and corrected by the amount
of ß- actin mRNA.
In other tissues that express low levels of IGF-I, RNase protection assay was performed (31). Briefly, 50 µg total RNA were hybridized to the 32P-riboprobes for exon 4 and 18S rRNA (Ambion) overnight at 45 C, treated with RNase A, RNase T1, proteinase K, and phenol/chloroform, and precipitated. Protected probes were denatured, electrophoresed on an 8% polyacrylamide gel, and exposed to X-Omat AR film for 12 days. The protected bands corresponding to IGF-I mRNA and 18S rRNA were scanned in an Agfa Arcus II scanner, and densitometric analysis was performed using the MacBAS v2.31 program (Fuji Photo Film Co., Tokyo, Japan). The level of IGF-I mRNA was corrected by the amount of 18S rRNA and expressed as relative abundance to wild-type control samples.
Growth Rate, Serum IGF-I Concentration, and Statistical
Analysis
The growth rate of mice with mutant igf-1 was
determined by measuring the body weight at 3 weeks (when animals were
weaned and ear tags were applied) and 6 weeks after birth. Animals are
grouped according to their igf-1 dosage derived from their
genotype (wild-type or igf-1/flox) and the extent of
Cre-induced recombination, determined by PCR, Southern blots, and
densitometry.
For serum IGF-I determination, 6-week-old mice were fasted overnight and killed by decapitation and blood was collected. The serum was extracted, to remove IGF-I binding proteins, and assayed by RIA using a kit purchased from Diagnostic Systems Laboratories, Inc. (Webster, TX) (32). The antibody used is specific for rat IGF-I and does not cross-react with human IGF-I or IGF-II. All manipulations were approved by the Animal Care and Use Committee of the National Institute of Diabetes and Digestive and Kidney Diseases, NIH, Bethesda, MD.
Statistical analysis was performed using Statistica Software Package (StatSoft, Inc., Tulsa, OK). Levels of IGF-I mRNA, serum IGF-I, and igf-1 gene dosage were entered into a forward stepwise multiple regression analysis to determine their independent relationship to the body weight.
| ACKNOWLEDGMENTS |
|---|
19 and pMI-4, Dr. R.
D. Palmiter for the mouse IGF-I genomic library
7 and Drs. A. Koval,
A. Butler, and C. Hernandez-Sanchez for DNA constructs, Cre probe, and
RNase protection assay, respectively, and V. Blakesley and Marc Reitman
for helpful discussions. | FOOTNOTES |
|---|
J.-L. Liu is supported by a fellowship award from Medical Research Council of Canada.
Received for publication February 25, 1998. Revision received April 10, 1998. Accepted for publication May 12, 1998.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
W. Matheny, E. Merritt, S. V. Zannikos, R. P. Farrar, and M. L. Adamo Serum IGF-I-Deficiency Does Not Prevent Compensatory Skeletal Muscle Hypertrophy in Resistance Exercise Experimental Biology and Medicine, February 1, 2009; 234(2): 164 - 170. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Svensson, J. Kindblom, R. Shao, S. Moverare-Skrtic, M. K Lagerquist, N. Andersson, K. Sjogren, K. Venken, D. Vanderschueren, J.-O. Jansson, et al. Liver-derived IGF1 enhances the androgenic response in prostate J. Endocrinol., December 1, 2008; 199(3): 489 - 497. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Moore, S. Carbajal, L. Beltran, S. N. Perkins, S. Yakar, D. LeRoith, S. D. Hursting, and J. DiGiovanni Reduced Susceptibility to Two-Stage Skin Carcinogenesis in Mice with Low Circulating Insulin-Like Growth Factor I Levels Cancer Res., May 15, 2008; 68(10): 3680 - 3688. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Anzo, L. J. Cobb, D. L. Hwang, H. Mehta, J. W. Said, S. Yakar, D. LeRoith, and P. Cohen Targeted Deletion of Hepatic Igf1 in TRAMP Mice Leads to Dramatic Alterations in the Circulating Insulin-Like Growth Factor Axis but Does Not Reduce Tumor Progression Cancer Res., May 1, 2008; 68(9): 3342 - 3349. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Wang, M. R. Bowl, S. Bender, J. Peng, L. Farber, J. Chen, A. Ali, Z. Zhang, A. S. Alberts, R. V. Thakker, et al. Parafibromin, a Component of the Human PAF Complex, Regulates Growth Factors and Is Required for Embryonic Development and Survival in Adult Mice Mol. Cell. Biol., May 1, 2008; 28(9): 2930 - 2940. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Goldman-Johnson, D. M. de Kretser, and J. R. Morrison Evidence that Androgens Regulate Early Developmental Events, Prior to Sexual Differentiation Endocrinology, January 1, 2008; 149(1): 5 - 14. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kim, S.-H. Ahn, T. Inagaki, M. Choi, S. Ito, G. L. Guo, S. A. Kliewer, and F. J. Gonzalez Differential regulation of bile acid homeostasis by the farnesoid X receptor in liver and intestine J. Lipid Res., December 1, 2007; 48(12): 2664 - 2672. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Govoni, J. E. Wergedal, L. Florin, P. Angel, D. J. Baylink, and S. Mohan Conditional Deletion of Insulin-Like Growth Factor-I in Collagen Type 1{alpha}2-Expressing Cells Results in Postnatal Lethality and a Dramatic Reduction in Bone Accretion Endocrinology, December 1, 2007; 148(12): 5706 - 5715. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Govoni, S. K. Lee, Y.-S. Chung, R. R. Behringer, J. E. Wergedal, D. J. Baylink, and S. Mohan Disruption of insulin-like growth factor-I expression in type II{alpha}I collagen-expressing cells reduces bone length and width in mice Physiol Genomics, August 20, 2007; 30(3): 354 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Svensson, A. Tivesten, K. Sjogren, O. Isaksson, G. Bergstrom, S. Mohan, J. Molne, J. Isgaard, and C. Ohlsson Liver-derived IGF-I regulates kidney size, sodium reabsorption, and renal IGF-II expression J. Endocrinol., June 1, 2007; 193(3): 359 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Loladze, M. A. Stull, A. M. Rowzee, J. DeMarco, J. H. Lantry III, C. J. Rosen, D. LeRoith, K.-U. Wagner, L. Hennighausen, and T. L. Wood Epithelial-Specific and Stage-Specific Functions of Insulin-Like Growth Factor-I during Postnatal Mammary Development Endocrinology, November 1, 2006; 147(11): 5412 - 5423. [Abstract] [Full Text] [PDF] |
||||
![]() |
J Svensson, M Diez, J Engel, C Wass, A Tivesten, J-O Jansson, O Isaksson, T Archer, T Hokfelt, and C Ohlsson Endocrine, liver-derived IGF-I is of importance for spatial learning and memory in old mice. J. Endocrinol., June 1, 2006; 189(3): 617 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. T. Oliver, J. Rosenberger, R. Lopez, A. Gomez, K. K. Cummings, and M. L. Fiorotto The Local Expression and Abundance of Insulin-Like Growth Factor (IGF) Binding Proteins in Skeletal Muscle Are Regulated by Age and Gender But Not Local IGF-I in Vivo Endocrinology, December 1, 2005; 146(12): 5455 - 5462. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Svensson, B. Soderpalm, K. Sjogren, J. Engel, and C. Ohlsson Liver-derived IGF-I regulates exploratory activity in old mice Am J Physiol Endocrinol Metab, September 1, 2005; 289(3): E466 - E473. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Tang, R. Yu, Y. Lu, A. F. Parlow, and J.-L. Liu Age-dependent onset of liver-specific IGF-I gene deficiency and its persistence in old age: implications for postnatal growth and insulin resistance in LID mice Am J Physiol Endocrinol Metab, August 1, 2005; 289(2): E288 - E295. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Guo, Y. Lu, D. Houle, K. Robertson, Z. Tang, J. J. Kopchick, Y. L. Liu, and J.-L. Liu Pancreatic Islet-Specific Expression of an Insulin-Like Growth Factor-I Transgene Compensates Islet Cell Growth in Growth Hormone Receptor Gene-Deficient Mice Endocrinology, June 1, 2005; 146(6): 2602 - 2609. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kim, E. Barton, N. Muja, S. Yakar, P. Pennisi, and D. LeRoith Intact Insulin and Insulin-Like Growth Factor-I Receptor Signaling Is Required for Growth Hormone Effects on Skeletal Muscle Growth and Function in Vivo Endocrinology, April 1, 2005; 146(4): 1772 - 1779. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Phornphutkul, K.-Y. Wu, X. Yang, Q. Chen, and P. A Gruppuso Insulin-like growth factor-I signaling is modified during chondrocyte differentiation J. Endocrinol., December 1, 2004; 183(3): 477 - 486. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Lu, P. L. Herrera, Y. Guo, D. Sun, Z. Tang, D. LeRoith, and J.-L. Liu Pancreatic-Specific Inactivation of IGF-I Gene Causes Enlarged Pancreatic Islets and Significant Resistance to Diabetes Diabetes, December 1, 2004; 53(12): 3131 - 3141. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mazerbourg, D. M. Bouley, S. Sudo, C. A. Klein, J. V. Zhang, K. Kawamura, L. V. Goodrich, H. Rayburn, M. Tessier-Lavigne, and A. J. W. Hsueh Leucine-Rich Repeat-Containing, G Protein-Coupled Receptor 4 Null Mice Exhibit Intrauterine Growth Retardation Associated with Embryonic and Perinatal Lethality Mol. Endocrinol., September 1, 2004; 18(9): 2241 - 2254. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Liu, K. T. Coschigano, K. Robertson, M. Lipsett, Y. Guo, J. J. Kopchick, U. Kumar, and Y. L. Liu Disruption of growth hormone receptor gene causes diminished pancreatic islet size and increased insulin sensitivity in mice Am J Physiol Endocrinol Metab, September 1, 2004; 287(3): E405 - E413. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wessells, S. Yakar, and P. F. Johnson Critical Prosurvival Roles for C/EBP{beta} and Insulin-Like Growth Factor I in Macrophage Tumor Cells Mol. Cell. Biol., April 15, 2004; 24(8): 3238 - 3250. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Ngo, R. J. Barnard, P. Cohen, S. Freedland, C. Tran, F. deGregorio, Y. I. Elshimali, D. Heber, and W. J. Aronson Effect of Isocaloric Low-fat Diet on Human LAPC-4 Prostate Cancer Xenografts in Severe Combined Immunodeficient Mice and the Insulin-like Growth Factor Axis Clin. Cancer Res., July 1, 2003; 9(7): 2734 - 2743. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Leneuve, S. Colnot, G. Hamard, F. Francis, M. Niwa-Kawakita, M. Giovannini, and M. Holzenberger Cre-mediated germline mosaicism: a new transgenic mouse for the selective removal of residual markers from tri-lox conditional alleles Nucleic Acids Res., March 1, 2003; 31(5): e21 - e21. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ajo, L. Cacicedo, C. Navarro, and F. Sanchez-Franco Growth Hormone Action on Proliferation and Differentiation of Cerebral Cortical Cells from Fetal Rat Endocrinology, March 1, 2003; 144(3): 1086 - 1097. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tivesten, E. Bollano, I. Andersson, S. Fitzgerald, K. Caidahl, K. Sjogren, O. Skott, J.-L. Liu, R. Mobini, O. G. P. Isaksson, et al. Liver-Derived Insulin-Like Growth Factor-I Is Involved in the Regulation of Blood Pressure in Mice Endocrinology, November 1, 2002; 143(11): 4235 - 4242. [Abstract] [Full Text] [PDF] |
||||
![]() |
Liver-Specific IGF-1-Deficient Mice Sci. Aging Knowl. Environ., October 23, 2002; 2002(42): tg11 - 11. [Full Text] |
||||
![]() |
A. Hellstrom, B. Carlsson, A. Niklasson, K. Segnestam, M. Boguszewski, L. de Lacerda, M. Savage, E. Svensson, L. Smith, D. Weinberger, et al. IGF-I Is Critical for Normal Vascularization of the Human Retina J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3413 - 3416. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. M. Naranjo, S. Yakar, M. Sanchez-Gomez, A. U. Perez, J. Setser, and D. LERoith Protein Calorie Restriction Affects Nonhepatic IGF-I Production and the Lymphoid System: Studies Using the Liver-Specific IGF-I Gene-Deleted Mouse Model Endocrinology, June 1, 2002; 143(6): 2233 - 2241. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Carter, M. M. Ramsey, R. L. Ingram, A. B. Cashion, W. T. Cefalu, Z.Q. Wang, and W. E. Sonntag Models of Growth Hormone and IGF-1 Deficiency: Applications to Studies of Aging Processes and Life-Span Determination J. Gerontol. A Biol. Sci. Med. Sci., May 1, 2002; 57(5): B177 - 188. [Abstract] [Full Text] |
||||
![]() |
A. A. Butler, S. Yakar, and D. LeRoith Insulin-Like Growth Factor-I: Compartmentalization Within the Somatotropic Axis? Physiology, April 1, 2002; 17(2): 82 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wu, S. Yakar, L. Zhao, L. Hennighausen, and D. LeRoith Circulating Insulin-like Growth Factor-I Levels Regulate Colon Cancer Growth and Metastasis Cancer Res., February 1, 2002; 62(4): 1030 - 1035. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Holzenberger, G. Hamard, R. Zaoui, P. Leneuve, B. Ducos, C. Beccavin, L. Perin, and Y. Le Bouc Experimental IGF-I Receptor Deficiency Generates a Sexually Dimorphic Pattern of Organ-Specific Growth Deficits in Mice, Affecting Fat Tissue in Particular Endocrinology, October 1, 2001; 142(10): 4469 - 4478. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Camarero, C. Avendano, C. Fernandez-Moreno, A. Villar, J. Contreras, F. de Pablo, J. G. Pichel, and I. Varela-Nieto Delayed Inner Ear Maturation and Neuronal Loss in Postnatal Igf-1-Deficient Mice J. Neurosci., October 1, 2001; 21(19): 7630 - 7641. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sjogren, K. Wallenius, J.-L. Liu, M. Bohlooly-Y, G. Pacini, L. Svensson, J. Tornell, O. G.P. Isaksson, B. Ahren, J.-O. Jansson, et al. Liver-Derived IGF-I is of Importance for Normal Carbohydrate and Lipid Metabolism Diabetes, July 1, 2001; 50(7): 1539 - 1545. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Butler and D. LeRoith Minireview: Tissue-Specific Versus Generalized Gene Targeting of the igf1 and igf1r Genes and Their Roles in Insulin-Like Growth Factor Physiology Endocrinology, May 1, 2001; 142(5): 1685 - 1688. [Abstract] [Full Text] |
||||
![]() |
S. Yakar, J.-L. Liu, A. M. Fernandez, Y. Wu, A. V. Schally, J. Frystyk, S. D. Chernausek, W. Mejia, and D. Le Roith Liver-Specific igf-1 Gene Deletion Leads to Muscle Insulin Insensitivity Diabetes, May 1, 2001; 50(5): 1110 - 1118. [Abstract] [Full Text] |
||||
![]() |
A. Hellstrom, C. Perruzzi, M. Ju, E. Engström, A.-L. Hård, J.-L. Liu, K. Albertsson-Wikland, B. Carlsson, A. Niklasson, L. Sjödell, et al. Low IGF-I suppresses VEGF-survival signaling in retinal endothelial cells: Direct correlation with clinical retinopathy of prematurity PNAS, May 1, 2001; (2001) 101113998. [Abstract] [Full Text] |
||||
![]() |
D. Le Roith, C. Bondy, S. Yakar, J.-L. Liu, and A. Butler The Somatomedin Hypothesis: 2001 Endocr. Rev., February 1, 2001; 22(1): 53 - 74. [Abstract] [Full Text] |
||||
![]() |
J.-L. Liu, S. Yakar, and D. LeRoith Mice Deficient in Liver Production of Insulin-Like Growth Factor I Display Sexual Dimorphism in Growth Hormone-Stimulated Postnatal Growth Endocrinology, December 1, 2000; 141(12): 4436 - 4441. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Holzenberger, C. Lenzner, P. Leneuve, R. Zaoui, G. Hamard, S. Vaulont, and Y. L. Bouc Cre-mediated germline mosaicism: a method allowing rapid generation of several alleles of a target gene Nucleic Acids Res., November 1, 2000; 28(21): e92 - e92. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Liu, S. Yakar, and D. LeRoith Conditional Knockout of Mouse Insulin-Like Growth Factor-1 Gene Using the Cre/loxP System Experimental Biology and Medicine, April 1, 2000; 223(4): 344 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. R. Boisclair, J. Wang, J. Shi, K. R. Hurst, and G. T. Ooi Role of the Suppressor of Cytokine Signaling-3 in Mediating the Inhibitory Effects of Interleukin-1beta on the Growth Hormone-dependent Transcription of the Acid-labile Subunit Gene in Liver Cells J. Biol. Chem., February 11, 2000; 275(6): 3841 - 3847. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Liu and D. LeRoith Insulin-Like Growth Factor I Is Essential for Postnatal Growth in Response to Growth Hormone Endocrinology, November 1, 1999; 140(11): 5178 - 5184. [Abstract] [Full Text] |
||||
![]() |
S. Yakar, J.-L. Liu, B. Stannard, A. Butler, D. Accili, B. Sauer, and D. LeRoith Normal growth and development in the absence of hepatic insulin-like growth factor I PNAS, June 22, 1999; 96(13): 7324 - 7329. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sjogren, J.-L. Liu, K. Blad, S. Skrtic, O. Vidal, V. Wallenius, D. LeRoith, J. Tornell, O. G. P. Isaksson, J.-O. Jansson, et al. Liver-derived insulin-like growth factor I (IGF-I) is the principal source of IGF-I in blood but is not required for postnatal body growth in mice PNAS, June 8, 1999; 96(12): 7088 - 7092. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, H. Hoff, and C. Sell Insulin-like Growth Factor I-mediated Degradation of Insulin Receptor Substrate-1 Is Inhibited by Epidermal Growth Factor in Prostate Epithelial Cells J. Biol. Chem., July 14, 2000; 275(29): 22558 - 22562. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hellstrom, C. Perruzzi, M. Ju, E. Engstrom, A.-L. Hard, J.-L. Liu, K. Albertsson-Wikland, B. Carlsson, A. Niklasson, L. Sjodell, et al. Low IGF-I suppresses VEGF-survival signaling in retinal endothelial cells: Direct correlation with clinical retinopathy of prematurity PNAS, May 8, 2001; 98(10): 5804 - 5808. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Sohal, M. Nghiem, M. A. Crackower, S. A. Witt, T. R. Kimball, K. M. Tymitz, J. M. Penninger, and J. D. Molkentin Temporally Regulated and Tissue-Specific Gene Manipulations in the Adult and Embryonic Heart Using a Tamoxifen-Inducible Cre Protein Circ. Res., July 6, 2001; 89(1): 20 - 25. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |